Monoclonal antibodies binding to SSEA4 and their uses

Abstract

An isolated monoclonal antibody or antigen-binding fragment specifically binds to stage-specific embryonic antigen 4. The monoclonal antibody or antigen-binding fragment comprises: a heavy chain CDR1 having a sequence of sequence identification number: 33 or sequence identification number: 40, a heavy chain CDR2 having a sequence of sequence identification number: 34 or sequence identification number: 39, a heavy chain CDR3 having a sequence of sequence identification number: 35 or sequence identification number: 41, a light chain CDR1 having a sequence of sequence identification number: 36 or sequence identification number: 42, a light chain CDR2 having a sequence of sequence identification number: 37 or sequence identification number: 43, and a light chain CDR3 having a sequence of sequence identification number: 38 or sequence identification number: 44. The present invention discloses an anti-tumor method, which is performed by administering the above monoclonal antibody or antigen-binding fragment to a tumor subject expressing stage-specific embryonic antigen 4.

Description

Technical Field

[0001] The present invention relates to monoclonal antibodies binding to SSEA4 and uses thereof. Background Art

[0002] The goal of immunotherapy for cancer is to increase the strength of the patient's own immune response against the tumor. Immunotherapy can stimulate the activity of specific components of the immune system against cancer cells, or it can counteract signals produced by cancer cells that suppress the immune response.

[0003] For example, antibodies that specifically bind to tumor-associated antigens (TAAs) (e.g., protein antigens and carbohydrate antigens) on the surface of cancer cells have been developed as cancer vaccines, resulting in antibody-dependent cellular cytotoxicity, antibody-dependent phagocytosis, complement-dependent cytolysis, and direct cell growth inhibition and / or cytotoxic effects.

[0004] Monoclonal antibody-based anticancer vaccines have been developed against many carbohydrate TAAs (e.g., Globo H, stage-specific embryonic antigen 3, and stage-specific embryonic antigen 4). However, in order to promote more effective killing of cancer cells and provide durable resistance to cancer recurrence, improved monoclonal antibodies with high affinity for carbohydrate TAAs are needed as anticancer vaccines. Summary of the invention

[0005] In order to meet the above needs, the present invention provides an isolated monoclonal antibody or an antigen-binding fragment thereof, which specifically binds to stage-specific embryonic antigen 4 (SSEA4). The monoclonal antibody or antigen-binding fragment comprises: a heavy chain CDR1 (H-CDR1) having a sequence of SEQ ID NO: 33 or SEQ ID NO: 40, a heavy chain CDR2 (H-CDR2) having a sequence of SEQ ID NO: 34 or SEQ ID NO: 39, a heavy chain CDR3 (H-CDR3) having a sequence of SEQ ID NO: 35 or SEQ ID NO: 41, a light chain CDR1 (L-CDR1) having a sequence of SEQ ID NO: 36 or SEQ ID NO: 42, a light chain CDR2 (L-CDR2) having a sequence of SEQ ID NO: 37 or SEQ ID NO: 43, and a light chain CDR3 (L-CDR3) having a sequence of SEQ ID NO: 38 or SEQ ID NO: 44.

[0006] The isolated monoclonal antibodies within the scope of the present invention include heavy chain sequences selected from the following groups: sequence identification number: 2, sequence identification number: 6, sequence identification number: 10, sequence identification number: 12, sequence identification number: 14, sequence identification number: 22, sequence identification number: 24 and sequence identification number: 26; and light chain sequences selected from the following groups: sequence identification number: 4, sequence identification number: 8, sequence identification number: 16, sequence identification number: 18, sequence identification number: 20, sequence identification number: 28, sequence identification number: 30 and sequence identification number: 32.

[0007] The present invention also provides a method for treating a tumor, wherein cells in the tumor express SSEA4, by administering an effective amount of the monoclonal antibody or antigen-binding fragment.

[0008] Also disclosed is a nucleic acid construct encoding the monoclonal antibody or antigen-binding fragment thereof, and a recombinant cell containing the nucleic acid construct. The recombinant cell expresses the monoclonal antibody or antigen-binding fragment thereof that specifically binds to SSEA4.

[0009] The details of many embodiments of the present invention are described in the following description and drawings. Other features, objects and advantages of the present invention will be apparent from the description and also from the appended claims. Finally, the references cited herein are incorporated by reference in their entirety. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] The following description is directed to the accompanying drawings for explaining the present invention, wherein:

[0011] Figure 1A is an amino acid sequence alignment of the gonadal human IGHV4-59x01 heavy chain variable region (huIGHV4-59x01, sequence identification number: 60) and the corresponding amino acid sequences of anti-SSEA4 murine monoclonal antibody 1 (muMAb1 H, sequence identification number: residues 20-138 of 2) and human monoclonal antibody 1 sequences (huMAb1 H, sequence identification number: residues 20-138 of 10; huMAb1 H1, sequence identification number: residues 20-138 of 12; huMAb1 H2, sequence identification number: residues 20-138 of 14), in this figure and all other figures, the CDR regions are boxed;

[0012] Figure 1Bis an amino acid sequence alignment of the gonadal human IGKV3-11x01 light chain variable region (huIGKV3-11x01, sequence identification number: 61) and the amino acid sequences corresponding to the anti-SSEA4 murine monoclonal antibody 1 (muMAb1 L, sequence identification number: residues 23-128 of 4) and the human monoclonal antibody 1 sequence (huMAb1 L, sequence identification number: residues 23-128 of 16; huMAb1 L1, sequence identification number: residues 23-128 of 18; huMAb1 L2, sequence identification number: residues 23-128 of 20);

[0013] Figure 2A is an amino acid sequence alignment of the gonadal human IGHV4-59x01 heavy chain variable region (huIGHV4-59x01, SEQ ID NO: 60) and the amino acid sequences corresponding to the anti-SSEA4 murine monoclonal antibody 2 (muMAb2 H, SEQ ID NO: 6 residues 20-139) and the human monoclonal antibody 2 sequence (huMAb2 H, SEQ ID NO: 22 residues 20-139; huMAb2 H1, SEQ ID NO: 24 residues 20-139; huMAb2 H2, SEQ ID NO: 26 residues 20-139); and

[0014] Figure 2B It is an amino acid sequence alignment of the gonadal human IGKV3-11x01 light chain variable region with the amino acid sequences corresponding to the anti-SSEA4 murine monoclonal antibody 2 (muMAb2 L, sequence identification number: residues 23-128 of 8) and the human monoclonal antibody 2 sequences (huMAb2 L, sequence identification number: residues 23-128 of 28; huMAb2 L1, sequence identification number: residues 23-128 of 30; huMAb2 L2, sequence identification number: residues 23-128 of 32). DETAILED DESCRIPTION

[0015] Detailed description of preferred embodiments

[0016] As described above, the present invention provides a monoclonal antibody or antigen-binding fragment (e.g., single-chain Fv) having a specified CDR region, which specifically binds to stage-specific embryonic antigen 4 (SSEA4). In an exemplary monoclonal antibody or antigen-binding fragment, the heavy chain CDR1 (H-CDR1) has a sequence with sequence identification number: 33; the heavy chain CDR2 (H-CDR2) has a sequence with sequence identification number: 34; the heavy chain CDR3 (H-CDR3) has a sequence with sequence identification number: 35; the light chain CDR1 (L-CDR1) has a sequence with sequence identification number: 42; the light chain CDR2 (L-CDR2) has a sequence with sequence identification number: 43; and the light chain CDR3 (L-CDR3) has a sequence with sequence identification number: 44.

[0017] Examples of monoclonal antibodies having the same CDR regions as in the previous paragraph have the following combinations of heavy chain sequences and light chain sequences: (i) a heavy chain sequence of sequence identification number: 14 and a light chain sequence of sequence identification number: 28, (ii) a heavy chain sequence of sequence identification number: 14 and a light chain sequence of sequence identification number: 30, (iii) a heavy chain sequence of sequence identification number: 14 and a light chain sequence of sequence identification number: 32, (iv) a heavy chain sequence of sequence identification number: 2 and a light chain sequence of sequence identification number: 4, and (v) a heavy chain sequence of sequence identification number: 6 and a light chain sequence of sequence identification number: 8.

[0018] A nucleic acid construct encoding the monoclonal antibody or binding fragment comprises sequences encoding the H-CDR1, H-CDR2, H-CDR3, L-CDR1, L-CDR2 and L-CDR3 regions listed above. In one embodiment, the nucleic acid construct encodes the amino acids of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44.

[0019] In another aspect, the nucleic acid construct encodes a monoclonal antibody having the heavy chain and light chain sequences described above. Specific examples of such nucleic acid constructs include any one of the following sequence combinations: (i) sequence identification number: 13 and sequence identification number: 27, (ii) sequence identification number: 13 and sequence identification number: 29, (iii) sequence identification number: 13 and sequence identification number: 31, (iv) sequence identification number: 1 and sequence identification number: 3, and (v) sequence identification number: 5 and sequence identification number: 7.

[0020] In addition, a recombinant cell is provided, which contains any of the above nucleic acid constructs and expresses a monoclonal antibody or binding fragment that specifically binds to SSEA4. A specific recombinant cell expresses a monoclonal antibody or binding fragment having the following CDR sequences: sequence identification number: 33, sequence identification number: 34, sequence identification number: 35, sequence identification number: 42, sequence identification number: 43, and sequence identification number: 44. An example of such a recombinant cell expresses a monoclonal antibody having a heavy chain sequence of sequence identification number: 14 and a light chain sequence of sequence identification number: 28.

[0021] The above method for treating a tumor can be performed by administering any monoclonal antibody disclosed in the present application. In one example, the monoclonal antibody comprises sequences of sequence identification number: 33, sequence identification number: 34, sequence identification number: 35, sequence identification number: 42, sequence identification number: 43, and sequence identification number: 44. The monoclonal antibody may have a heavy chain sequence of sequence identification number: 14 and a light chain sequence of sequence identification number: 28.

[0022] This tumor treatment method can effectively treat breast cancer, colon cancer, gastrointestinal cancer, kidney cancer, lung cancer, liver cancer, ovarian cancer, pancreatic cancer, rectal cancer, stomach cancer, testicular cancer, thymus cancer, cervical cancer, prostate cancer, bladder cancer, skin cancer, nasopharyngeal cancer, esophageal cancer, oral cancer, head and neck cancer, bone cancer, cartilage cancer, muscle cancer, lymph node cancer, bone marrow cancer, and brain cancer.

[0023] It is believed that, without further elaboration, one skilled in the art can apply the disclosure to the fullest extent possible based on the disclosure herein. Therefore, the following specific examples are not to be construed as merely illustrative of the remaining disclosure and not limiting. All publications and patent documents cited herein are incorporated herein by reference in their entirety.

[0024] Example

[0025] Example 1: Fusion tumor production

[0026] Mouse monoclonal antibodies against SSEA4 were produced using standard procedures. Briefly, mice were injected with SSEA4 fused to bovine serum albumin (BSA-SSEA4) and adjuvant every two weeks until 10 weeks. Anti-SSEA4 antibody titers in blood samples were analyzed by enzyme-linked immunosorbent assay (ELISA) using ELISA plates with conjugated BSA-SSEA4 under standard conditions.

[0027] The mouse blood sample with the highest titer by BSA-SSEA4 ELISA was also tested by ELISA using human pancreatic cancer (HPAC) cells expressing SSEA4.

[0028] Splenocytes with the highest antibody titers were isolated from both mice and fused with myeloma cells using standard techniques to form hybridomas. Hybridomas producing high titers of anti-SSEA4 antibodies were identified using standard subcloning procedures and ELISA analysis using BSA-SSEA4 and HPAC cells. Hybridomas producing antibodies that bound to both HPAC and the human myeloma cell line A375, which does not express SSEA4, were not followed further.

[0029] Antibodies that bind to cell surface SSEA4 were confirmed by incubating fusion tumor supernatants of HPAC cells and A375 cells, followed by incubation with fluorescently labeled secondary antibodies, and using fluorescence-activated cell sorting analysis. Two monoclonal antibodies [referred to as murine monoclonal antibody 1 (muMAb1) and murine monoclonal antibody 2 (muMAb2)] were selected for further analysis. These monoclonal antibodies both bound to BSA-SSEA4 and HPAC cells and did not bind to A375 cells.

[0030] Isotype analysis showed that muMAb1 is an IgG1κ antibody, while muMAb2 is an IgG3κ antibody.

[0031] The concentration of monoclonal antibodies in the hybridoma supernatant and the binding affinity to SSEA4 were determined as described in the following two sections. d The value is 0.22 nM, while the K d The value is 0.08nM.

[0032] Example 2: Determination of Antibody Concentration by ELISA

[0033] The muMAb antibody concentration in the culture medium samples was determined by ELISA using the primary antibodies coated on the ELISA plates below. For MAbs, the ELISA plates were coated with AffiniPure Goat Anti-Mouse IgG (H+L) (Jackson ImmunoResearch #115-005-062) at 1 μg / ml, 100 μl / well overnight. After incubation of serially diluted fusion tumor supernatants or culture medium samples from transient transfections (see below), the wells were thoroughly washed and bound to the detected antibodies by adding Peroxidase AffiniPure Goat Anti-Mouse IgG (H+L) (Jackson ImmunoResearch #115-035-062) diluted 1:8,000. After thorough washing, ABTS Peroxidase Substrate (1 Component) (KPL #50-66-06) was added and the absorbance of each well was measured at 405 nm.

[0034] For humanized mAbs (see below), ELISA plates were coated with 1 μg / ml, 100 μl / well of Fcγ fragment-specific AffiniPure F(ab')2Fragment Goat Anti-Human IgG (Jackson ImmunoResearch #109-006-098) overnight. Detection of bound humanized antibodies was performed as described above for mouse antibodies using 1:10,000 dilution of Fcγ fragment-specific Peroxidase AffiniPure Goat Anti-Human IgG (Jackson ImmunoResearch #109-035-008).

[0035] Example 3: Determination of antibody affinity by ELISA

[0036] The antigen binding affinity was determined by a standard ELISA protocol using the following reagent set: ELISA plates were coated with 1:1,000 dilution of BSA-SSEA4. Serially diluted samples of fusion tumor supernatant or transient transfection samples were added to each well, followed by thorough washing. The following secondary antibodies were used to detect muMAbs and huMAbs bound to antigens on the culture plates: AffiniPure Goat Anti-Mouse IgG specific for FcγSubclass 1 (Jackson ImmunoResearch #115-005-205) at a dilution of 1:2,500 for muMAb1, AffiniPure Goat Anti-Mouse IgG specific for FcγSubclass 3 (Jackson ImmunoResearch #115-005-209) at a dilution of 1:2,500 for muMAb2, and AffiniPure Goat Anti-Human IgG (H+L) (Jackson ImmunoResearch #109-005-088) at a dilution of 1:2,500 for all humanized antibodies.

[0037] Plate-bound secondary antibody was Peroxidase AffiniPure Bovine Anti-Goat IgG (H+L) (Jackson ImmunoResearch #805-035-180) diluted 1:6,000 and detection and development were performed as described above.

[0038] Example 4: Cloning of antibody genes

[0039] VH and VL antibody sequences were cloned from fusion tumors as follows. Total RNA was isolated from approximately 5-7×10 6 First strand cDNA synthesis was performed using the Maxima Universal First Strand cDNA Synthesis Kit (Thermo Fisher cat. #K1661) with 6 μg of total RNA and the following gene-specific primers: mouse IgG1 VH: TATGCAAGGCTTACAACCACA (SEQ ID NO: 45), mouse IgG3 VH: GGGGGTACTGGGCTTGGGTAT (SEQ ID NO: 46), and mouse γ VL: CTCATTCCTGTTGAAGCTCTTGAC (SEQ ID NO: 47).

[0040] As the first strand cDNA was synthesized, a poly A sequence was attached to the 5' end of each first strand cDNA by terminal transferase. The resulting 5' tailed cDNA products were subjected to two rounds of PCR amplification reactions. The first round of PCR was performed using Herculase II DNA polymerase (Agilent Technologies cat#600679) and the following primers: 5'GTGACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT (SEQ ID No.: 48), 3' primer for mouse IgG1 VH: CTTCCGGAATTCCTCAATTTTCTTGTCCACCTTGGTGC (SEQ ID No.: 49), 3' primer for mouse IgG3 VH: CTTCCGGAATTCCTCGATTCTCTTGATCAACTCAGTCT (SEQ ID No.: 50), and 3' primer for mouse γ VL: CTTCCGGAATTCCTCATTCCTGTTGAAGCTCTTGACAATGGG (SEQ ID No.: 51).

[0041] A portion (1 / 20) of the first round PCR product was further amplified in the second round of PCR using Phusion High Fidelity DNA Polymerase (Fisher Scientific cat# F530L) and the following primers: 5'GTGACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT (SEQ ID No.: 48), 3' primer for mouse IgG1VH: ATTAAGTCGACATAGACAGATGGGGGTGTCGTTTTGGC (SEQ ID No.: 52), 3' primer for mouse IgG3VH: ATTAAGTCGACAGGGACCAAGGGATAGACAGATGG (SEQ ID No.: 53), and 3' primer for mouse γVL: CTACCTCGAGGGATACAGTTGGTGCAGCATC (SEQ ID No.: 54).

[0042] The resulting PCR products were digested with a pair of restriction enzymes: ClaI / SalI for the VH PCR fragment and ClaI / XhoI for the VL PCR fragment and inserted into the cloning vector using standard recombinant DNA procedures. To identify full-length VH / VL clones, clones containing the insert were sequenced in the appropriate size range.

[0043] Example 5: Construction of full-length mouse antibody expression vector

[0044] Full-length mouse IgG heavy and light chain expression plasmids were constructed as follows.

[0045] First strand cDNA synthesis was performed by reverse transcriptase (RT) using the Maxima Universal First Strand cDNA Synthesis Kit (Thermo Fisher cat# K1661) with 6 μg of total RNA from the fusion tumor containing the full-length VH and VL sequences identified above. Oligo dT primer and random hexamer primers were used in separate RT reactions. The oligo dT and random hexamer primers were combined as primers for RT products and used as the source of full-length cDNA for muMAb1 and muMAb2 by one round of PCR amplification using Phusion High Fidelity DNA Polymerase (Fisher Scientific cat# F530L) and the following primer pairs, which were designed using the sequence information obtained above.

[0046] For muMAb1 and muMAb2 gamma light chains, the 5' primer was CAGTCCGCGGCCACCATGGATTTTCAAGTGCAGATTTTC (SEQ ID NO: 55), and the 3' primer was AGGAAGATCTAACACTCATTCCTGTTGAAGC (SEQ ID NO: 56). For muMAb1 mouse IgG1 heavy chain, the 5' primer was CAGTCCGCGGCCACCATGGCTGTCCTGGTGCTGTT (SEQ ID NO: 57), and the 3' primer was CTGGACAGGGATCCAGAGTTCCA (SEQ ID NO: 58). For muMAb2 mouse IgG3 heavy chain, the 5' primer was CAGTCCGCGGCCACCATGGCTGTCCTGGTGCTGTT (SEQ ID NO: 57), and the 3' primer was CATGAGATCTCATTTACCAGGGGAGCGAGA (SEQ ID NO: 59).

[0047] The amplified muMAb1 and muMAb2 murine gamma light chain sequences and muMAb2 murine IgG3 heavy chain sequences were cloned directly into mammalian expression plasmids as SacII / BglII restriction fragments. The muMAb1 murine IgG1 heavy chain amplification product is present at the 5' end of the gene coding sequence, just past the internal BamHI position corresponding to approximately the center of the CH1 region. It was cloned as a SacII / BamHI restriction fragment into the previously constructed full-length murine IgG1 heavy chain expression plasmid. All clones were verified by sequencing.

[0048] The sequence identification numbers corresponding to the amino acid sequences of muMAb1 and muMAb2 are shown in Table 1 below.

[0049] Table 1. Full-length heavy and light chain monoclonal antibody sequences

[0050] mAbs Heavy chain mAbs Light chain muMAb1 H Sequence ID: 2 muMAb1 L Sequence ID number: 4 muMAb2 H Sequence ID number: 6 muMAb2 L Sequence ID number: 8 huMAb1 H Sequence ID number: 10 huMAb1 L Sequence ID number: 16 huMAb1 H1 Sequence ID number: 12 huMAb1 L1 Sequence ID number: 18 huMAb1 H2 Sequence ID number: 14 huMAb1 L2 Sequence ID number: 20 huMAb2 H Sequence ID number: 22 huMAb2 L Sequence ID number: 28 huMAb2 H1 Sequence ID number: 24 huMAb2 L1 Sequence ID number: 30 huMAb2 H2 Sequence ID number: 26 huMAb2 L2 Sequence ID number: 32

[0051] Example 6: Humanization

[0052] To humanize muMAb1 and muMAb2, human immunoglobulin gonad sequences with the highest homology to the mouse antibody sequences were identified by aligning the mouse sequences with the human immunoglobulin gene database. The results showed that the human gonadal sequence that was most similar to both the heavy chains of muMAb1 and muMAb2 was huIGHV4-59x01, while the light chain that was most similar to both muMAb1 and muMAb2 was huIGKV3-11x01.

[0053] To humanize muMAb1 and muMAb2, the CDR regions were grafted into human sequences to generate huMAb1 and huMAb2, respectively. The sequence identification numbers corresponding to the amino acid sequences of the heavy and light chains of huMAb1 and huMAb2 are shown in Table 1 above.

[0054] The mutations in the huMAb1 and huMAb2 sequences were designed in silico to maximize humanization and provide structural support for the CDR loops. The amino acid changes and their positions in the heavy and light chain sequences are shown below in Tables 2-5 and Figure 1A , 1B , 2A and 2B.

[0055] Table 2. Mutations in the huMAb1 heavy chain sequence

[0056]

[0057]

[0058] Table 3. Mutations in the huMAb1 light chain sequence

[0059] Residue L1 L2 Ile 2 Asn Asn Leu 47 Trp Ser 65 Arg Thr 69 Asn Phe 71 Tyr Tyr

[0060] Table 4. Mutations in the huMAb2 heavy chain sequence

[0061] Residue H1 H2 Ile 37 Val Ala 62 Ser Val 67 Leu Val 71 Lys Lys Thr 73 Asn Asn 76 Ser Phe 78 Val Val Arg 97 Lys Lys

[0062] Table 5. Mutations in the huMAb2 light chain sequence

[0063] Residual L1 L2 Ile 2 Asn Asn Leu 47 Trp Thr 69 Asn Asn Phe 71 Tyr Tyr

[0064] The sequence identification numbers corresponding to the amino acid sequences encoded by the mutated full-length heavy and light chain genes are shown in Table 1 above.

[0065] The sequence identification numbers of all CDR sequences of the above antibodies are shown in Table 6 below.

[0066] Table 6. Sequence identification numbers corresponding to CDR regions

[0067] CDR muMAb1 / hMAb1 muMAb2 / hMAb2 HCDR1 Sequence ID number: 33 Sequence ID number: 40 HCDR2 Sequence ID number: 34 Sequence ID number: 34 HCDR3 Sequence ID number: 35 Sequence ID number: 41 <![CDATA[HCDR2 H1 a ]]> Sequence ID number: 39 Sequence ID number: 39 LCDR1 Sequence ID number: 36 Sequence ID number: 42 LCDR2 Sequence ID number: 37 Sequence ID number: 43 LCDR3 Sequence ID number: 38 Sequence ID number: 44

[0068] Example 7: Construction of humanized antibody expression vector

[0069] Construction of full-length humanized heavy and light chain expression plasmids was performed using standard recombinant DNA techniques. Fragments were appropriately cloned into constructs containing: (i) a full-length human IgG1 heavy chain with an introduced silent mutation to create an NheI restriction site at the beginning of the CH1 region, and (ii) a full-length human kappa light chain with an introduced silent mutation to create a BsiWI restriction site at the beginning of the CL constant region.

[0070] DNA fragments having sequences based on the mutation variants discussed above are synthesized using standard techniques and cloned into appropriate expression vectors.

[0071] Example 8: Production of recombinant antibodies by transient transfection in 293T cells

[0072] Human 293T embryonic kidney epithelial cell line was maintained in DMEM (HyClone cat#SH30243.02) supplemented with 10% heat-inactivated fetal bovine serum, 2mM L-glutamine, and penicillin / streptomycin (GIBCO cat#15140). Expression constructs were introduced into cells by poly(ethyleneimine) (PEI)-mediated transfection. Briefly, DNA mixtures were prepared by combining heavy and light chain expression plasmids in a 1:1 ratio. PEI / DNA complexes were then formed at a 1.5:1 PEI to DNA ratio and added to the cultured cells after 20 minutes of incubation. Two days after transfection, the culture medium was removed and replaced with fresh medium. Supernatants were collected on the fifth day after transfection for analysis.

[0073] Large-scale production of recombinant antibodies was performed by transfecting heavy and light chain expression plasmids into human 293T cells as described above. After three days, transfected cells were harvested and inoculated into shake flasks in serum-free medium supplemented with 6 mM L-glutamine (HyClone CDM4HEK293 cat# SH3085802). Cell growth and antibody production were monitored and culture supernatant was harvested for antibody purification when cell viability dropped below 50%.

[0074] The expression of different combinations of heavy and light chains was performed by co-transfection of heavy and light chain expression plasmids as described above. The affinities of these recombinant antibodies are shown in Table 7 below.

[0075] Table 7. Binding affinity of recombinant antibodies

[0076] Anti-SSEA4 Ab Heavy chain Light chain <![CDATA[K d (nM)]]> <![CDATA[Exponent a > muMAb1 muMAb1 H muMAb1 L 0.17 0.9 muMAb2 muMAb2 H muMAb2 L 0.19 1.1 huMAb1 huMAb1 H huMAb1 L <![CDATA[N.D. b ]]> <![CDATA[- c ]]> huMAb1a huMAb1 H2 huMAb1 L1 4.3 23.9 huMAb1b huMAb1 H2 huMAb1 L2 4.7 26.1 huMAb2 huMAb2 H huMAb2 L <![CDATA[N.D. b ]]> <![CDATA[- c ]]> huMAb2a huMAb2 H2 huMAb2 L2 5.7 31.7 huMAb3 huMAb1 H2 huMAb2 L 0.09 0.5 huMAb4 huMAb1 H2 huMAb2 L1 0.10 0.6 huMAb5 huMAb1 H2 huMAb2 L2 0.14 0.8

[0077] a The index is calculated by using the average K of muMAb1 and muMAb2 d (0.18) to convert K d Obtained by standardization.

[0078] b No binding detected

[0079] c Undetermined

[0080] The binding affinities of two recombinant humanized antibodies (i.e., huMAb3 and huMAb4) were also determined by surface plasmon resonance analysis using standard operating procedures. d The values ​​were between 50 nM and 90 nM. The K d The value is approximately 0.4 μM.

[0081] Whether by ELISA or by surface plasmon resonance, the results showed that huMAb3 has a high affinity for SSEA4.

[0082] Other specific examples

[0083] All features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced with an alternative feature that provides the same, equivalent or similar purpose. Unless otherwise expressly stated, each feature disclosed is only an example of an equivalent or similar feature of the same series.

[0084] Through the above description, those skilled in the art can easily determine the essential features of the present invention, and can make various changes and modifications of the present invention without departing from its spirit and scope to make it suitable for various uses and situations. Therefore, other specific examples also fall within the scope of the scope of the present application. Sequence Listing <110> GlycoBiomedical Corporation <120> Monoclonal antibodies binding to SSEA4 and their uses <130> 218498-0001PCT <160> 61 <170> PatentIn version 3.5 <210> 1 <211> 1389 <212> DNA <213> Mus musculus <220> <221> CDS <222> (1)..(1389) <223> heavy chain <400> 1 atg gct gtc ctg gtg ctg ttc ctc tgc ctg gtt gca ttt cca agc tgt 48 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 gtc ctg tcc cag gtg cag ctg aag gag tca gga cct ggc ctg gtg gcg 96 Val Leu Ser Gln Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val Ala 20 25 30 ccc tca cag agc ctg tcc atc act tgc act gtc tct ggg ttt tca tta 144 Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 acc agc tat ggt gta gac tgg gtt cgc cag cct cca gga aag ggt ctg 192 Thr Ser Tyr Gly Val Asp Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 gag tgg ctg gga gta ata tgg ggt ggt gga agc aca aat tat aat tca 240 Glu Trp Leu Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 gct ctc atg tcc aga ctg agc atc agc aaa gac aac tcc aag agc caa 288 Ala Leu Met Ser Arg Leu Ser Ile Ser Lys Asp Asn Ser Lys Ser Gln 85 90 95 gtt ttc tta aaa atg aac agt ctg caa act gat gac aca gcc atg tac 336 Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Met Tyr 100 105 110 tac tgt gcc aaa cat gag gta cta cgg ggg tat gct ctg gac tac tgg 384 Tyr Cys Ala Lys His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr Trp 115 120 125 ggt caa gga acc tca gtc acc gtc tcc tca gcc aaa acg aca ccc cca 432 Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro 130 135 140 tct gtc tat cca ctg gcc cct gga tct gct gcc caa act aac tcc atg 480 Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met 145 150 155 160 gtg acc ctg gga tgc ctg gtc aag ggc tat ttc cct gag cca gtg aca 528 Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr 165 170 175 gtg acc tgg aac tct gga tcc ctg tcc agc ggt gtg cac acc ttc cca 576 Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro 180 185 190 gct gtc ctg cag tct gac ctc tac act ctg agc agc tca gtg act gtc 624 Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val 195 200 205 ccc tcc agc acc tgg ccc agc gag acc gtc acc tgc aac gtt gcc cac 672 Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys Asn Val Ala His 210 215 220 ccg gcc agc agc acc aag gtg gac aag aaa att gtg ccc aggg gat tgt 720 Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys 225 230 235 240 ggt tgt aag cct tgc ata tgt aca gtc cca gaa gta tca tct gtc ttc Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe 245 250 255 atc ttc ccc cca aag ccc aag gat gtg ctc acc att act ctg act cct 816 Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro 260 265 270 aag gtc acg tgt gtt gtg gta gac atc agc aag gat gat ccc gag gtc 864 Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val 275 280 285 cag ttc agc tgg ttt gta gat gat gtg gag gtg cac aca gct cag acg 912 Gln Phe Served Trp Phe Val Asp Val Glu Val His Thr Ala Gln Thr 290,295,300 caa ccc cgg gag gag cag ttc aac agc act ttc cgc tca gtc agt gaa 960 Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu 305 310 315 320 ctt ccc atc atg cac cag gac tgg ctc aat ggc aag gag ttc aaa tgc 1008 Leu Pro Meets His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys 325 330 335 agg gtc aac agt gca gct ttc cct gcc ccc atc gag aaa acc atc tcc 1056 Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser 340 345 350 aaa acc aaa ggc aga ccg aag gct cca cag gtg tac acc att cca cct 1104 Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro 355 360 365 ccc aag gag cag atg gcc aag gat aaa gtc agt ctg acc tgc atg ata 1152 Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile 370 375 380 aca gac ttc ttc cct gaa gac att act gtg gag tgg cag tgg aat ggg 1200 Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly 385 390 395 400 cag cca gcg gag aac tac aag aac act cag ccc atc atg gac aca gat 1248 Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp 405 410 415 ggc tct tac ttc gtc tac agc aag ctc aat gtg cag aag agc aac tgg 1296 Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp 420 425 430 gag gca gga aat act ttc acc tgc tct gtg tta cat gag ggc ctg cac 1344 Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His 435 440 445 aac cac cat act gag aag agc ctc tcc cac tct cct ggt aaa tga 1389 Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Lys 450 455 460 <210> 2 <211> 462 <212> PRT <213> Mus musculus <400> 2 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 Val Leu Ser Gln Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val Ala 20 25 30 Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Thr Ser Tyr Gly Val Asp Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Leu Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 Ala Leu Met Ser Arg Leu Ser Ile Ser Lys Asp Asn Ser Lys Ser Gln 85 90 95 Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Met Tyr 100 105 110 Tyr Cys Ala Lys His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr Trp 115 120 125 Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro 130 135 140 Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met 145 150 155 160 Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val 195 200 205 Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys Asn Val Ala His 210 215 220 Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys 225 230 235 240 Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe 245 250 255 Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro 260 265 270 Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val 275 280 285 Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr 290 295 300 Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu 305 310 315 320 Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys 325 330 335 Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser 340 345 350 Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro 355 360 365 Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile 370 375 380 Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly 385 390 395 400 Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp 405 410 415 Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp 420 425 430 Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His 435 440 445 Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Lys 450 455 460 <210> 3 <211> 708 <212> DNA <213> Mus musculus <220> <221> CDS <222> (1)..(708) <223> light chain <400> 3 atg gat ttt caa gtg cag att ttc agc ttc ctg cta atc ​​agt gcc tca 48 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Phe Ser Ala Ser 1 5 10 15 gtc ata atg tcc aga gga gaa aat gtt ctc acc cag tct cca gca atc ​​96 Arg Gly Glu Asn Val Leu Thr Gln Ser On Ile 20 25 30 atg tct gca tct cca ggg gaa aag gtc acc atg acc tgc agt gcc agc 144 Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser 35 40 45 tca agt gta agt tac atg cac tgg tac cag cag aag tca aac acc tcc 192 Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Asn Thr Ser 50 55 60 ccc aaa ctc tgg att tat gac aca tcc aaa ctg gct tct gga gtc cca 240 Pro Lys Leu Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro 65 70 75 80 ggt cgc ttc agt ggc agg ggg tct gga aac tct tat tct ctc acg atc 288 Gly Arg Phe Ser Gly Arg Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile 85 90 95 agc agc atg gag gct gaa gat gtt gcc act tat tac tgt ttt cag ggg 336 Ser Ser Met Glu Ala Glu Asp Val Ala Thr Tyr Tyr Cys Phe Gln Gly 100 105 110 agt ggg tac cca ctc acg ttc ggc tcg ggg aca aag ttg gaa ata aaa 384 Ser Gly Tyr Pro Leu Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 115 120 125 cgg gct gat gct gca cca act gta tcc atc ttc cca cca tcc agt gag 432 Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 130 135 140 cag tta aca tct gga ggt gcc tca gtc gtg tgc ttc tg aac aac ttc 480 Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe 145 150 155 160 tac ccc aaa gac atc aat gtc aag tgg aag at gat ggc agt ga cga 528 Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg 165 170 175 caa aat ggc gtc ctg aac agt tgg act gat cag gac agc aaa gac agc 576 Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser 180 185 190 acc tac agc atg agc agc acc ctc acg ttg acc aag gac gag tat gaa 624 Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu 195 200 205 cga cat aac agc tat acc tgt gag gcc act cac aag aca tca act tca 672 Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser 210 215 220 ccc att gtc aag agc ttc aac agg aat gag tgt tag 708 Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 235 <210> 4 <211> 235 <212> PRT <213> Mus musculus <400> 4 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Ile 20 25 30 Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser 35 40 45 Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Asn Thr Ser 50 55 60 Pro Lys Leu Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro 65 70 75 80 Gly Arg Phe Ser Gly Arg Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile 85 90 95 Ser Ser Met Glu Ala Glu Asp Val Ala Thr Tyr Tyr Cys Phe Gln Gly 100 105 110 Ser Gly Tyr Pro Leu Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 115 120 125 Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 130 135 140 Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe 145 150 155 160 Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg 165 170 175 Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu 195 200 205 Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser 210 215 220 Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 235 <210> 5 <211> 1410 <212> DNA <213> Mus musculus <220> <221> CDS <222> (1)..(1410) <223> heavy chain <400> 5 atg gct gtc ctg gtg ctg ttc ctc tgc ctg gtt gca ttt cca agc tgt 48 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 gtc ctg acc cag gtg cag ctg aag gag tca gga cct ggc ctg gtg gcg 96 Val Leu Thr Gln Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val Ala 20 25 30 ccc tca cag agc ctg tcc atc act tgc act gtc tct ggg ttt tca tta 144 Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 gcc agc tat ggt gta gac tgg gtt cgc cag cct cca gga aag ggt ctg 192 Ala Ser Tyr Gly Val Asp Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 gag tgg ctg gga gta ata tgg ggt ggt gga agt aca aat tat aat tca 240 Glu Trp Leu Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 gct ctc atg tcc aga ctt acc atc aac aaa gac aac tcc aag agc caa 288 Ala Leu Met Ser Arg Leu Thr Ile Asn Lys Asp Asn Ser Lys Ser Gln 85 90 95 ctt ttc tta aaa atg aac agt ctg caa act gat gac aca gcc atg tat 336 Leu Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Met Tyr 100 105 110 tac tgt gcc aaa cat gga gat agt aat tcc ggt tat gct atg gac tac 384 Tyr Cys Ala Lys His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 115 120 125 tgg ggt caa gga atc tca gtc acc gtc tcc tca gct aca aca aca gcc 432 Trp Gly Gln Gly Ile Ser Val Thr Val Ser Ser Ala Thr Thr Thr Ala 130 135 140 cca tct gtc tat ccc ttg gtc cct ggc tgc ggt gac aca tct gga tcc 480 Pro Ser Val Tyr Pro Leu Val Pro Gly Cys Gly Asp Thr Ser Gly Ser 145 150 155 160 tcg gtg aca ctg gga tgc ctt gtc aaa ggc tac ttc cct gag ccg gta 528 Ser Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val 165 170 175 act gta aaa tgg aac tat gga gcc ctg tcc agc ggt gtg cgc aca gtc 576 Thr Val Lys Trp Asn Tyr Gly Ala Leu Ser Ser Gly Val Arg Thr Val 180 185 190 tca tct gta ctg cag tct ggg ttc tat tcc ctc agc agc ttg gtg act 624 Ser Ser Val Leu Gln Ser Gly Phe Tyr Ser Leu Ser Ser Leu Val Thr 195 200 205 gta ccc tcc agc acc tgg ccc agc cag act gtc atc tgc aac gta gcc 672 Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val Ile Cys Asn Val Ala 210 215 220 cac cca gcc agc aag act gag ttg atc aag aga atc gag cct aga ata 720 His Pro Ala Ser Lys Thr Glu Leu Ile Lys Arg Ile Glu Pro Arg Ile 225 230 235 240 ccc aag ccc agt acc ccc cca ggt tct tca tgc cca cct ggt aac atc 768 Pro Lys Pro Ser Thr Pro Pro Gly Ser Ser Cys Pro Pro Gly Asn Ile 245 250 255 ttg ggt gga cca tcc gtc ttc atc ttc ccc cca aag ccc aag gat gca 816 Leu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Ala 260 265 270 ctc atg atc tcc cta acc ccc aag gtt acg tgt gtg gtg gtg gat gtg 864 Leu Met Ile Ser Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Val 275 280 285 agc gag gat gac cca gat gtc cat gtc agc tgg ttt gtg gac aac aaa 912 Ser Glu Asp Asp Pro Asp Val His Val Ser Trp Phe Val Asp Asn Lys 290 295 300 gaa gta cac aca gcc tgg acg cag ccc cgt gaa gct cag tac aac agt 960 Glu Val His Thr Ala Trp Thr Gln Pro Arg Glu Ala Gln Tyr Asn Ser 305 310 315 320 acc ttc cga gtg gtc agt gcc ctc ccc atc cag cac cag gac tgg atg 1008 Thr Phe Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Met 325 330 335 agg ggc aag gag ttc aaa tgc aag gtc aac aac aaa gcc ctc cca gcc 1056 Arg Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Ala Leu Pro Ala 340 345 350 ccc atc gag aga acc atc tca aaa ccc aaa gga aga gcc cag aca cct 1104 Pro Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly Arg Ala Gln Thr Pro 355 360 365 caa gta tac acc ata ccc cca cct cgt gaa caa atg tcc aag aag aag 1152 Gln Val Tyr Thr Ile Pro Pro Pro Arg Glu Gln Met Ser Lys Lys Lys 370 375 380 gtt agt ctg acc tgc ctg gtc acc aac ttc ttc tct gaa gcc atc agt 1200 Val Ser Leu Thr Cys Leu Val Thr Asn Phe Phe Ser Glu Ala Ile Ser 385 390 395 400 gtg gag tgg gaa agg aac gga gaa ctg gag cag gat tac aag aac act 1248 Val Glu Trp Glu Arg Asn Gly Glu Leu Glu Gln Asp Tyr Lys Asn Thr 405 410 415 cca ccc atc ctg gac tcg gat ggg acc tac ttc ctc tac agc aag ctc 1296 Pro Pro Ile Leu Asp Ser Asp Gly Thr Tyr Phe Leu Tyr Ser Lys Leu 420 425 430 act gtg gat aca gac agt tgg ttg caa gga gaa att ttt acc tgc tcc 1344 Thr Val Asp Thr Asp Ser Trp Leu Gln Gly Glu Ile Phe Thr Cys Ser 435 440 445 gtg gtg cat gag gct ctc cat aac cac cac aca cag aag aac ctg tct 1392 Val Val His Glu Ala Leu His Asn His His Thr Gln Lys Asn Leu Ser 450 455 460 cgc tcc cct ggt aaa tga 1410 Arg Ser Pro Gly Lys 465 <210> 6 <211> 469 <212> PRT <213> Mus musculus <400> 6 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 Val Leu Thr Gln Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val Ala 20 25 30 Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Ala Ser Tyr Gly Val Asp Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Leu Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 Ala Leu Met Ser Arg Leu Thr Ile Asn Lys Asp Asn Ser Lys Ser Gln 85 90 95 Leu Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Met Tyr 100 105 110 Tyr Cys Ala Lys His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 115 120 125 Trp Gly Gln Gly Ile Ser Val Thr Val Ser Ser Ala Thr Thr Thr Ala 130 135 140 Pro Ser Val Tyr Pro Leu Val Pro Gly Cys Gly Asp Thr Ser Gly Ser 145 150 155 160 Ser Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val 165 170 175 Thr Val Lys Trp Asn Tyr Gly Ala Leu Ser Ser Gly Val Arg Thr Val 180 185 190 Ser Ser Val Leu Gln Ser Gly Phe Tyr Ser Leu Ser Ser Leu Val Thr 195 200 205 Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val Ile Cys Asn Val Ala 210 215 220 His Pro Ala Ser Lys Thr Glu Leu Ile Lys Arg Ile Glu Pro Arg Ile 225 230 235 240 Pro Lys Pro Ser Thr Pro Pro Gly Ser Ser Cys Pro Pro Gly Asn Ile 245 250 255 Leu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Ala 260 265 270 Leu Met Ile Ser Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Val 275 280 285 Ser Glu Asp Asp Pro Asp Val His Val Ser Trp Phe Val Asp Asn Lys 290 295 300 Glu Val His Thr Ala Trp Thr Gln Pro Arg Glu Ala Gln Tyr Asn Ser 305 310 315 320 Thr Phe Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Met 325 330 335 Arg Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Ala Leu Pro Ala 340 345 350 Pro Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly Arg Ala Gln Thr Pro 355 360 365 Gln Val Tyr Thr Ile Pro Pro Pro Arg Glu Gln Met Ser Lys Lys Lys 370 375 380 Val Ser Leu Thr Cys Leu Val Thr Asn Phe Phe Ser Glu Ala Ile Ser 385 390 395 400 Val Glu Trp Glu Arg Asn Gly Glu Leu Glu Gln Asp Tyr Lys Asn Thr 405 410 415 Pro Pro Ile Leu Asp Ser Asp Gly Thr Tyr Phe Leu Tyr Ser Lys Leu 420 425 430 Thr Val Asp Thr Asp Ser Trp Leu Gln Gly Glu Ile Phe Thr Cys Ser 435 440 445 Val Val His Glu Ala Leu His Asn His His Thr Gln Lys Asn Leu Ser 450 455 460 Arg Ser Pro Gly Lys 465 <210> 7 <211> 708 <212> DNA <213> Muscles <220> <221> CDS <222> (1)..(708) <223> chain light. <400> 7 atg gat ttt caa gtg cag att ttc agc ttc ctg cta atc ​​agt gcc tca 48 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Phe Ser Ala Ser 1 5 10 15 gtc ata atg tcc aga gga gaa aat gtt ctc acc cag tct cca gca atc ​​96 Arg Gly Glu Asn Val Leu Thr Gln Ser On Ile 20 25 30 atg tct gca tct cca ggg gaa aag gtc acc atg acc tgc agt gcc agc 144 Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser 35 40 45 cca agt gta agt tac atg cac tgg tac cag cag aag tca agc acc tcc 192 Pro Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Ser Thr Ser 50 55 60 ccc aaa ctc tgg att tat gac aca tac aaa ctg gct tct gga gtc cca 240 Pro Lys Leu Trp Ile Tyr Asp Thr Tyr Lys Leu Ala Ser Gly Val Pro 65 70 75 80 ggt cgc ttc agt ggc agt ggg tct gga aac tct tac tct ctc acg atc 288 Gly Arg Phe Ser Gly Ser Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile 85 90 95 aga acc atg gag gct gaa gat gtt gcc act tat tac tgt ttt cag ggg 336 Arg Thr Met Glu Ala Glu Asp Val Ala Thr Tyr Tyr Cys Phe Gln Gly 100 105 110 agt ggg ttc cca ctc acg ttc ggc tcg ggg aca aag ttg gaa ata aaa 384 Ser Gly Phe Pro Leu Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 115 120 125 cgg gct gat gct gca cca act gta tcc atc ttc cca cca tcc agt gag 432 Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 130 135 140 cag tta aca tct gga ggt gcc tca gtc gtg tgc ttc ttg aac aac ttc 480 Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe 145 150 155 160 tac ccc aaa gac atc aat gtc aag tgg aag att gat ggc agt gaa cga 528 Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg 165 170 175 caa aat ggc gtc ctg aac agt tgg act gat cag gac agc aaa gac agc 576 Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser 180 185 190 acc tac agc atg agc agc acc ctc acg ttg acc aag gac gag tat gaa 624 Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu 195 200 205 cga cat aac agc tat acc tgt gag gcc act cac aag aca tca act tca 672 Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser 210 215 220 ccc att gtc aag agc ttc aac agg aat gag tgt tag 708 Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 235 <210> 8 <211> 235 <212> PRT <213> Mus musculus <400> 8 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Ile 20 25 30 Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser 35 40 45 Pro Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Ser Thr Ser 50 55 60 Pro Lys Leu Trp Ile Tyr Asp Thr Tyr Lys Leu Ala Ser Gly Val Pro 65 70 75 80 Gly Arg Phe Ser Gly Ser Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile 85 90 95 Arg Thr Met Glu Ala Glu Asp Val Ala Thr Tyr Tyr Cys Phe Gln Gly 100 105 110 Ser Gly Phe Pro Leu Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 115 120 125 Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 130 135 140 Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe 145 150 155 160 Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg 165 170 175 Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu 195 200 205 Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser 210 215 220 Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 235 <210> 9 <211> 1407 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(1407) <223> humanized heavy chain <400> 9 atg gct gtc ctg gtg ctg ttc ctc tgc ctg gtt gca ttt cca agc tgt 48 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 gtc ctg tcc cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag 96 Val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 cct tcg gag acc ctg tcc ctc acc tgc act gtc tct ggg ttt tca tta 144 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 acc agc tat ggt gta gac tgg atc cgg cag ccc cca ggg aag gga ctg 192 Thr Ser Tyr Gly Val Asp Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 gag tgg att ggg gta ata tgg ggt ggt gga agc aca aat tat aat tca 240 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 gct ctc atg tcc cga gtc acc ata tca gta gac acg tcc aag aac cag 288 Ala Leu Met Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln 85 90 95 ttc tcc ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat 336 Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 tac tgt gcg aga cat gag gta cta cgg ggg tat gct ctg gac tac tgg 384 Tyr Cys Ala Arg His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr Trp 115 120 125 ggc caa ggt acc ctg gtc acc gtc tcg agt gct agc acc aag ggc cca 432 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 tcg gtc ttc ccc ctg gca ccc tcc tcc aag agc acc tct ggg ggc aca 480 Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr 145 150 155 160 gcg gcc ctg ggc tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg acg 528 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 gtg tcg tgg aac tca ggc gcc ctg acc agc ggc gtg cac acc ttc ccg 576 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 gct gtc cta cag tcc tca gga ctc tac tcc ctc agc agc gtg gtg acc 624 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 gtg ccc tcc agc agc ttg ggc acc cag acc tac atc tgc aac gtg aat 672 Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 210 215 220 cac aag ccc agc aac acc aag gtg gac aag aga gtt gag ccc aaa tct 720 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser 225 230 235 240 tgt gac aaa act cac aca tgc cca ccg tgc cca gca cct gaa ctc ctg 768 Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 245 250 255 ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa ccc aag gac acc ctc 816 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 260 265 270 atg atc tcc cgg acc cct gag gtc aca tgc gtg gtg gtg gac gtg agc 864 Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 275 280 285 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 912 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 290 295 300 gtg cat aat gcc aag aca aag ccg cgg gag gag cag tac aac agc acg 960 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 305 310 315 320 tac cgt gtg gtc agc gtc ctc acc gtc ctg cac cag gac tgg ctg aat 1008 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn 325 330 335 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc ctc cca gcc ccc 1056 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 340 345 350 atc gag aaa acc atc tcc aaa gcc aaa ggg cag ccc cga gaa cca cag 1104 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 355 360 365 gtg tac acc ctg ccc cca tcc cgg gat gag ctg acc aag aac cag gtc 1152 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val 370 375 380 agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc gcc gtg 1200 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 385 390 395 400 gag tgg gag agc aat ggg cag ccg gag aac aac tac aag acc acg cct 1248 Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro 405 410 415 ccc gtg ctg gac tcc gac ggc tcc ttc ttc ctc tac agc aag ctc acc 1296 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 420 425 430 gtg gac aag agc agg tgg cag cag ggg aac gtc ttc tca tgc tcc gtg 1344 Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 435 440 445 atg cat gag gct ctg cac aac cac tac acg cag aag agc ctc tcc ctg 1392 Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 450 455 460 tct ccg ggt aaa tga 1407 Ser Pro Gly Lys 465 <210> 10 <211> 468 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 10 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 Val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Thr Ser Tyr Gly Val Asp Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 Ala Leu Met Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln 85 90 95 Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 Tyr Cys Ala Arg His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr Trp 115 120 125 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr 145 150 155 160 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 210 215 220 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser 225 230 235 240 Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 245 250 255 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 260 265 270 Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 275 280 285 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 290 295 300 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 305 310 315 320 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn 325 330 335 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 340 345 350 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 355 360 365 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val 370 375 380 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 385 390 395 400 Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro 405 410 415 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 420 425 430 Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 435 440 445 Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 450 455 460 Ser Pro Gly Lys 465 <210> 11 <211> 1407 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(1407) <223> humanized heavy chain <400> 11 atg gct gtc ctg gtg ctg ttc ctc tgc ctg gtt gca ttt cca agc tgt 48 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 gtc ctg tcc cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag 96 Val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 cct tcg gag acc ctg tcc ctc acc tgc act gtc tct ggg ttt tca tta 144 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 acc agc tat ggt gta gac tgg atc cgg cag ccc cca ggg aag gga ctg 192 Thr Ser Tyr Gly Val Asp Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 gag tgg att ggg gta ata tgg ggt ggt gga agc aca aat tat aat tca 240 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 tcc ctc atg tcc cga gtc acc ata tca aaa gac acg tcc aag aac cag 288 Ser Leu Met Ser Arg Val Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln 85 90 95 gtt tcc ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat 336 Val Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 tac tgt gcg aaa cat gag gta cta cgg ggg tat gct ctg gac tac tgg 384 Tyr Cys Ala Lys His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr Trp 115 120 125 ggc caa ggt acc ctg gtc acc gtc tcg agt gct agc acc aag ggc cca 432 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 tcg gtc ttc ccc ctg gca ccc tcc tcc aag agc acc tct ggg ggc aca 480 Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr 145 150 155 160 gcg gcc ctg ggc tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg acg 528 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 gtg tcg tgg aac tca ggc gcc ctg acc agc ggc gtg cac acc ttc ccg 576 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 gct gtc cta cag tcc tca gga ctc tac tcc ctc agc agc gtg gtg acc 624 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 gtg ccc tcc agc agc ttg ggc acc cag acc tac atc tgc aac gtg aat 672 Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 210 215 220 cac aag ccc agc aac acc aag gtg gac aag aga gtt gag ccc aaa tct 720 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser 225 230 235 240 tgt gac aaa act cac aca tgc cca ccg tgc cca gca cct gaa ctc ctg 768 Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 245 250 255 ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa ccc aag gac acc ctc 816 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 260 265 270 atg atc tcc cgg acc cct gag gtc aca tgc gtg gtg gtg gac gtg agc 864 Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 275 280 285 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 912 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 290 295 300 gtg cat aat gcc aag aca aag ccg cgg gag gag cag tac aac agc acg 960 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 305 310 315 320 tac cgt gtg gtc agc gtc ctc acc gtc ctg cac cag gac tgg ctg aat 1008 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn 325 330 335 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc ctc cca gcc ccc 1056 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 340 345 350 atc gag aaa acc atc tcc aaa gcc aaa ggg cag ccc cga gaa cca cag 1104 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 355 360 365 gtg tac acc ctg ccc cca tcc cgg gat gag ctg acc aag aac cag gtc 1152 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val 370 375 380 agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc gcc gtg 1200 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 385 390 395 400 gag tgg gag agc aat ggg cag ccg gag aac aac tac aag acc acg cct 1248 Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro 405 410 415 ccc gtg ctg gac tcc gac ggc tcc ttc ttc ctc tac agc aag ctc acc 1296 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 420 425 430 gtg gac aag agc agg tgg cag cag ggg aac gtc ttc tca tgc tcc gtg 1344 Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 435 440 445 atg cat gag gct ctg cac aac cac tac acg cag aag agc ctc tcc ctg 1392 Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 450 455 460 tct ccg ggt aaa tga 1407 Ser Pro Gly Lys 465 <210> 12 <211> 468 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 12 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 Val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Thr Ser Tyr Gly Val Asp Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 Ser Leu Met Ser Arg Val Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln 85 90 95 Val Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 Tyr Cys Ala Lys His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr Trp 115 120 125 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr 145 150 155 160 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 210 215 220 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser 225 230 235 240 Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 245 250 255 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 260 265 270 Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 275 280 285 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 290 295 300 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 305 310 315 320 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn 325 330 335 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 340 345 350 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 355 360 365 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val 370 375 380 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 385 390 395 400 Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro 405 410 415 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 420 425 430 Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 435 440 445 Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 450 455 460 Ser Pro Gly Lys 465 <210> 13 <211> 1407 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(1407) <223> humanized heavy chain <400> 13 atg gct gtc ctg gtg ctg ttc ctc tgc ctg gtt gca ttt cca agc tgt 48 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 gtc ctg tcc cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag 96 Val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 cct tcg gag acc ctg tcc ctc acc tgc act gtc tct ggg ttt tca tta 144 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 acc agc tat ggt gta gac tgg gtt cgg cag ccc cca ggg aag gga ctg 192 Thr Ser Tyr Gly Val Asp Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 gag tgg att ggg gta ata tgg ggt ggt gga agc aca aat tat aat tca 240 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 gct ctc atg tcc cga ctg acc ata tca aaa gac aac tcc aag agc cag 288 Ala Leu Met Ser Arg Leu Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln 85 90 95 gtt tcc ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat 336 Val Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 tac tgt gcg aaa cat gag gta cta cgg ggg tat gct ctg gac tac tgg 384 Tyr Cys Ala Lys His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr Trp 115 120 125 ggc caa ggt acc ctg gtc acc gtc tcg agt gct agc acc aag ggc cca 432 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 tcg gtc ttc ccc ctg gca ccc tcc tcc aag agc acc tct ggg ggc aca 480 Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr 145 150 155 160 gcg gcc ctg ggc tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg acg 528 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 gtg tcg tgg aac tca ggc gcc ctg acc agc ggc gtg cac acc ttc ccg 576 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 gct gtc cta cag tcc tca gga ctc tac tcc ctc agc agc gtg gtg acc 624 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 gtg ccc tcc agc agc ttg ggc acc cag acc tac atc tgc aac gtg aat 672 Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 210 215 220 cac aag ccc agc aac acc aag gtg gac aag aga gtt gag ccc aaa tct 720 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser 225 230 235 240 tgt gac aaa act cac aca tgc cca ccg tgc cca gca cct gaa ctc ctg 768 Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 245 250 255 ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa ccc aag gac acc ctc 816 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 260 265 270 atg atc tcc cgg acc cct gag gtc aca tgc gtg gtg gtg gac gtg agc 864 Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 275 280 285 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 912 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 290 295 300 gtg cat aat gcc aag aca aag ccg cgg gag gag cag tac aac agc acg 960 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 305 310 315 320 tac cgt gtg gtc agc gtc ctc acc gtc ctg cac cag gac tgg ctg aat 1008 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn 325 330 335 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc ctc cca gcc ccc 1056 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 340 345 350 atc gag aaa acc atc tcc aaa gcc aaa ggg cag ccc cga gaa cca cag 1104 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 355 360 365 gtg tac acc ctg ccc cca tcc cgg gat gag ctg acc aag aac cag gtc 1152 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val 370 375 380 agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc gcc gtg 1200 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 385 390 395 400 gag tgg gag agc aat ggg cag ccg gag aac aac tac aag acc acg cct 1248 Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro 405 410 415 ccc gtg ctg gac tcc gac ggc tcc ttc ttc ctc tac agc aag ctc acc 1296 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 420 425 430 gtg gac aag agc agg tgg cag cag ggg aac gtc ttc tca tgc tcc gtg 1344 Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 435 440 445 atg cat gag gct ctg cac aac cac tac acg cag aag agc ctc tcc ctg 1392 Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 450 455 460 tct ccg ggt aaa tga 1407 Ser Pro Gly Lys 465 <210> 14 <211> 468 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 14 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 Val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Thr Ser Tyr Gly Val Asp Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 Ala Leu Met Ser Arg Leu Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln 85 90 95 Val Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 Tyr Cys Ala Lys His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr Trp 115 120 125 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr 145 150 155 160 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 210 215 220 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser 225 230 235 240 Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 245 250 255 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 260 265 270 Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 275 280 285 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 290 295 300 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 305 310 315 320 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn 325 330 335 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 340 345 350 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 355 360 365 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val 370 375 380 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 385 390 395 400 Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro 405 410 415 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 420 425 430 Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 435 440 445 Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 450 455 460 Ser Pro Gly Lys 465 <210> 15 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(708) <223> humanized light chain <400> 15 atg gat ttt caa gtg cag att ttc agc ttc ctg cta atc agt gcc tca 48 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 gtc ata atg tcc aga gga gaa att gtg ttg aca cag tct cca gcc acc 96 Val Ile Met Ser Arg Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 ctg tct ttg tct cca ggg gaa aga gcc acc ctc tcc tgc agt gcc agc 144 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 tca agt gta agt tac atg cac tgg tac caa cag aaa cct ggc cag gct 192 Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 ccc agg ctc ctc atc tat gac aca tcc aaa ctg gct tct ggc atc cca 240 Pro Arg Leu Leu Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 gcc agg ttc agt ggc agt ggg tct ggg aca gac ttc act ctc acc atc 288 Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 85 90 95 agc agc cta gag cct gaa gat ttt gca gtt tat tac tgt ttt cag ggg 336 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 agt ggg tac cca ctc acg ttt ggc cag ggg acc aag gtg gaa atc aaa 384 Ser Gly Tyr Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 cgt acg gtg gct gca cca tct gtc ttc atc ttc ccg cca tct gat gag 432 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 cag ttg aaa tct gga act gcc tct gtt gtg tgc ctg ctg aat aac ttc 480 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 tat ccc aga gag gcc aaa gta cag tgg aag gtg gat aac gcc ctc caa 528 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 tcg ggt aac tcc cag gag agt gtc aca gag cag gac agc aag gac agc 576 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 acc tac agc ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag 624 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 aaa cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg 672 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 ccc gtc aca aag agc ttc aac agg gga gag tgt tag 708 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 16 <211> 235 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 16 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Leu Leu Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 85 90 95 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 Ser Gly Tyr Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 17 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(708) <223> humanized light chain <400> 17 atg gat ttt caa gtg cag att ttc agc ttc ctg cta atc agt gcc tca 48 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 gtc ata atg tcc aga gga gaa aat gtg ttg aca cag tct cca gcc acc 96 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 ctg tct ttg tct cca ggg gaa aga gcc acc ctc tcc tgc agt gcc agc 144 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 tca agt gta agt tac atg cac tgg tac caa cag aaa cct ggc cag gct 192 Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 ccc agg ctc ctc atc tat gac aca tcc aaa ctg gct tct ggc atc cca 240 Pro Arg Leu Leu Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 gcc agg ttc agt ggc agt ggg tct ggg aac gac tat act ctc acc atc 288 Ala Arg Phe Ser Gly Ser Gly Ser Gly Asn Asp Tyr Thr Leu Thr Ile 85 90 95 agc agc cta gag cct gaa gat ttt gca gtt tat tac tgt ttt cag ggg 336 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 agt ggg tac cca ctc acg ttt ggc cag ggg acc aag gtg gaa atc aaa 384 Ser Gly Tyr Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 cgt acg gtg gct gca cca tct gtc ttc atc ttc ccg cca tct gat gag 432 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 cag ttg aaa tct gga act gcc tct gtt gtg tgc ctg ctg aat aac ttc 480 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 tat ccc aga gag gcc aaa gta cag tgg aag gtg gat aac gcc ctc caa 528 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 tcg ggt aac tcc cag gag agt gtc aca gag cag gac agc aag gac agc 576 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 acc tac agc ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag 624 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 aaa cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg 672 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 ccc gtc aca aag agc ttc aac agg gga gag tgt tag 708 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 18 <211> 235 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 18 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Leu Leu Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Gly Ser Gly Asn Asp Tyr Thr Leu Thr Ile 85 90 95 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 Ser Gly Tyr Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 19 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(708) <223> humanized light chain <400> 19 atg gat ttt caa gtg cag att ttc agc ttc ctg cta atc agt gcc tca 48 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 gtc ata atg tcc aga gga gaa aat gtg ttg aca cag tct cca gcc acc 96 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 ctg tct ttg tct cca ggg gaa aga gcc acc ctc tcc tgc agt gcc agc 144 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 tca agt gta agt tac atg cac tgg tac caa cag aaa cct ggc cag gct 192 Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 ccc agg ctc tgg atc tat gac aca tcc aaa ctg gct tct ggc atc cca 240 Pro Arg Leu Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 gcc agg ttc agt ggc agg ggg tct ggg aac gac tat act ctc acc atc 288 Ala Arg Phe Ser Gly Arg Gly Ser Gly Asn Asp Tyr Thr Leu Thr Ile 85 90 95 agc agc cta gag cct gaa gat ttt gca gtt tat tac tgt ttt cag ggg 336 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 agt ggg tac cca ctc acg ttt ggc cag ggg acc aag gtg gaa atc aaa 384 Ser Gly Tyr Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 cgt acg gtg gct gca cca tct gtc ttc atc ttc ccg cca tct gat gag 432 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 cag ttg aaa tct gga act gcc tct gtt gtg tgc ctg ctg aat aac ttc 480 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 tat ccc aga gag gcc aaa gta cag tgg aag gtg gat aac gcc ctc caa 528 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 tcg ggt aac tcc cag gag agt gtc aca gag cag gac agc aag gac agc 576 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 acc tac agc ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag 624 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 aaa cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg 672 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 ccc gtc aca aag agc ttc aac agg gga gag tgt tag 708 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 20 <211> 235 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 20 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Leu Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 Ala Arg Phe Ser Gly Arg Gly Ser Gly Asn Asp Tyr Thr Leu Thr Ile 85 90 95 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 Ser Gly Tyr Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 21 <211> 1410 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(1410) <223> humanized heavy chain <400> 21 atg gct gtc ctg gtg ctg ttc ctc tgc ctg gtt gca ttt cca agc tgt 48 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 gtc ctg acc cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag 96 Val Leu Thr Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 cct tcg gag acc ctg tcc ctc acc tgc act gtc tct ggg ttt tca tta 144 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 gcc agc tat ggt gta gac tgg atc cgg cag ccc cca ggg aag gga ctg 192 Ala Ser Tyr Gly Val Asp Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 gag tgg att ggg gta ata tgg ggt ggt gga agt aca aat tat aat tca 240 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 gct ctc atg tcc cga gtc acc ata tca gta gac acg tcc aag aac cag 288 Ala Leu Met Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln 85 90 95 ttc tcc ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat 336 Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 tac tgt gcg aga cat gga gat agt aat tcc ggt tat gct atg gac tac 384 Tyr Cys Ala Arg His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 115 120 125 tgg ggc caa ggt acc ctg gtc acc gtc tcg agt gct agc acc aag ggc 432 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 cca tcg gtc ttc ccc ctg gca ccc tcc tcc aag agc acc tct ggg ggc 480 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 aca gcg gcc ctg ggc tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg 528 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 acg gtg tcg tgg aac tca ggc gcc ctg acc agc ggc gtg cac acc ttc 576 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 ccg gct gtc cta cag tcc tca gga ctc tac tcc ctc agc agc gtg gtg 624 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 acc gtg ccc tcc agc agc ttg ggc acc cag acc tac atc tgc aac gtg 672 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 aat cac aag ccc agc aac acc aag gtg gac aag aga gtt gag ccc aaa 720 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 225 230 235 240 tct tgt gac aaa act cac aca tgc cca ccg tgc cca gca cct gaa ctc 768 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 ctg ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa ccc aag gac acc 816 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 ctc atg atc tcc cgg acc cct gag gtc aca tgc gtg gtg gtg gac gtg 864 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 agc cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg 912 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 gag gtg cat aat gcc aag aca aag ccg cgg gag gag cag tac aac agc 960 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 acg tac cgt gtg gtc agc gtc ctc acc gtc ctg cac cag gac tgg ctg 1008 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 aat ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc ctc cca gcc 1056 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 ccc atc gag aaa acc atc tcc aaa gcc aaa ggg cag ccc cga gaa cca 1104 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 cag gtg tac acc ctg ccc cca tcc cgg gat gag ctg acc aag aac cag 1152 Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln 370 375 380 gtc agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc gcc 1200 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 gtg gag tgg gag agc aat ggg cag ccg gag aac aac tac aag acc acg 1248 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 cct ccc gtg ctg gac tcc gac ggc tcc ttc ttc ctc tac agc aag ctc 1296 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 acc gtg gac aag agc agg tgg cag cag ggg aac gtc ttc tca tgc tcc 1344 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 gtg atg cat gag gct ctg cac aac cac tac acg cag aag agc ctc tcc 1392 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 ctg tct ccg ggt aaa tga 1410 Leu Ser Pro Gly Lys 465 <210> 22 <211> 469 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 22 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 Val Leu Thr Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Ala Ser Tyr Gly Val Asp Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 Ala Leu Met Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln 85 90 95 Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 Tyr Cys Ala Arg His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 115 120 125 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 225 230 235 240 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln 370 375 380 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 Leu Ser Pro Gly Lys 465 <210> 23 <211> 1410 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(1410) <223> humanized heavy chain <400> 23 atg gct gtc ctg gtg ctg ttc ctc tgc ctg gtt gca ttt cca agc tgt 48 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 gtc ctg acc cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag 96 Val Leu Thr Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 cct tcg gag acc ctg tcc ctc acc tgc act gtc tct ggg ttt tca tta 144 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 gcc agc tat ggt gta gac tgg atc cgg cag ccc cca ggg aag gga ctg 192 Ala Ser Tyr Gly Val Asp Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 gag tgg att ggg gta ata tgg ggt ggt gga agt aca aat tat aat tca 240 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 tcc ctc atg tcc cga gtc acc ata tca aaa gac acg tcc aag aac cag 288 Ser Leu Met Ser Arg Val Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln 85 90 95 ctt tcc ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat 336 Leu Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 tac tgt gcg aaa cat gga gat agt aat tcc ggt tat gct atg gac tac 384 Tyr Cys Ala Lys His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 115 120 125 tgg ggc caa ggt acc ctg gtc acc gtc tcg agt gct agc acc aag ggc 432 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 cca tcg gtc ttc ccc ctg gca ccc tcc tcc aag agc acc tct ggg ggc 480 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 aca gcg gcc ctg ggc tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg 528 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 acg gtg tcg tgg aac tca ggc gcc ctg acc agc ggc gtg cac acc ttc 576 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 ccg gct gtc cta cag tcc tca gga ctc tac tcc ctc agc agc gtg gtg 624 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 acc gtg ccc tcc agc agc ttg ggc acc cag acc tac atc tgc aac gtg 672 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 aat cac aag ccc agc aac acc aag gtg gac aag aga gtt gag ccc aaa 720 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 225 230 235 240 tct tgt gac aaa act cac aca tgc cca ccg tgc cca gca cct gaa ctc 768 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 ctg ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa ccc aag gac acc 816 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 ctc atg atc tcc cgg acc cct gag gtc aca tgc gtg gtg gtg gac gtg 864 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 agc cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg 912 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 gag gtg cat aat gcc aag aca aag ccg cgg gag gag cag tac aac agc 960 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 acg tac cgt gtg gtc agc gtc ctc acc gtc ctg cac cag gac tgg ctg 1008 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 aat ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc ctc cca gcc 1056 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 ccc atc gag aaa acc atc tcc aaa gcc aaa ggg cag ccc cga gaa cca 1104 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 cag gtg tac acc ctg ccc cca tcc cgg gat gag ctg acc aag aac cag 1152 Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln 370 375 380 gtc agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc gcc 1200 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 gtg gag tgg gag agc aat ggg cag ccg gag aac aac tac aag acc acg 1248 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 cct ccc gtg ctg gac tcc gac ggc tcc ttc ttc ctc tac agc aag ctc 1296 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 acc gtg gac aag agc agg tgg cag cag ggg aac gtc ttc tca tgc tcc 1344 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 gtg atg cat gag gct ctg cac aac cac tac acg cag aag agc ctc tcc 1392 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 ctg tct ccg ggt aaa tga 1410 Leu Ser Pro Gly Lys 465 <210> 24 <211> 469 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 24 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 Val Leu Thr Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Ala Ser Tyr Gly Val Asp Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 Ser Leu Met Ser Arg Val Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln 85 90 95 Leu Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 Tyr Cys Ala Lys His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 115 120 125 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 225 230 235 240 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln 370 375 380 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 Leu Ser Pro Gly Lys 465 <210> 25 <211> 1410 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(1410) <223> humanized heavy chain <400> 25 atg gct gtc ctg gtg ctg ttc ctc tgc ctg gtt gca ttt cca agc tgt 48 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 gtc ctg acc cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag 96 Val Leu Thr Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 cct tcg gag acc ctg tcc ctc acc tgc act gtc tct ggg ttt tca tta 144 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 gcc agc tat ggt gta gac tgg gtt cgg cag ccc cca ggg aag gga ctg 192 Ala Ser Tyr Gly Val Asp Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 gag tgg att ggg gta ata tgg ggt ggt gga agt aca aat tat aat tca 240 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 gct ctc atg tcc cga ctt acc ata tca aaa gac aac tcc aag agc cag 288 Ala Leu Met Ser Arg Leu Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln 85 90 95 ctt tcc ctg aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat 336 Leu Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 tac tgt gcg aaa cat gga gat agt aat tcc ggt tat gct atg gac tac 384 Tyr Cys Ala Lys His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 115 120 125 tgg ggc caa ggt acc ctg gtc acc gtc tcg agt gct agc acc aag ggc 432 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 cca tcg gtc ttc ccc ctg gca ccc tcc tcc aag agc acc tct ggg ggc 480 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 aca gcg gcc ctg ggc tgc ctg gtc aag gac tac ttc ccc gaa ccg gtg 528 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 acg gtg tcg tgg aac tca ggc gcc ctg acc agc ggc gtg cac acc ttc 576 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 ccg gct gtc cta cag tcc tca gga ctc tac tcc ctc agc agc gtg gtg 624 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 acc gtg ccc tcc agc agc ttg ggc acc cag acc tac atc tgc aac gtg 672 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 aat cac aag ccc agc aac acc aag gtg gac aag aga gtt gag ccc aaa 720 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 225 230 235 240 tct tgt gac aaa act cac aca tgc cca ccg tgc cca gca cct gaa ctc 768 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 ctg ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa ccc aag gac acc 816 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 ctc atg atc tcc cgg acc cct gag gtc aca tgc gtg gtg gtg gac gtg 864 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 agc cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg 912 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 gag gtg cat aat gcc aag aca aag ccg cgg gag gag cag tac aac agc 960 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 acg tac cgt gtg gtc agc gtc ctc acc gtc ctg cac cag gac tgg ctg 1008 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 aat ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc ctc cca gcc 1056 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 ccc atc gag aaa acc atc tcc aaa gcc aaa ggg cag ccc cga gaa cca 1104 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 cag gtg tac acc ctg ccc cca tcc cgg gat gag ctg acc aag aac cag 1152 Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln 370 375 380 gtc agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc gcc 1200 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 gtg gag tgg gag agc aat ggg cag ccg gag aac aac tac aag acc acg 1248 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 cct ccc gtg ctg gac tcc gac ggc tcc ttc ttc ctc tac agc aag ctc 1296 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 acc gtg gac aag agc agg tgg cag cag ggg aac gtc ttc tca tgc tcc 1344 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 gtg atg cat gag gct ctg cac aac cac tac acg cag aag agc ctc tcc 1392 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 ctg tct ccg ggt aaa tga 1410 Leu Ser Pro Gly Lys 465 <210> 26 <211> 469 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 26 Met Ala Val Leu Val Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys 1 5 10 15 Val Leu Thr Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Ala Ser Tyr Gly Val Asp Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Ile Gly Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser 65 70 75 80 Ala Leu Met Ser Arg Leu Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln 85 90 95 Leu Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 Tyr Cys Ala Lys His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 115 120 125 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 225 230 235 240 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln 370 375 380 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 Leu Ser Pro Gly Lys 465 <210> 27 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(708) <223> humanized light chain <400> 27 atg gat ttt caa gtg cag att ttc agc ttc ctg cta atc agt gcc tca 48 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 gtc ata atg tcc aga gga gaa att gtg ttg aca cag tct cca gcc acc 96 Val Ile Met Ser Arg Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 ctg tct ttg tct cca ggg gaa aga gcc acc ctc tcc tgc agt gcc agc 144 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 cca agt gta agt tac atg cac tgg tac caa cag aaa cct ggc cag gct 192 Pro Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 ccc agg ctc ctc atc tat gac aca tac aaa ctg gct tct ggc atc cca 240 Pro Arg Leu Leu Ile Tyr Asp Thr Tyr Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 gcc agg ttc agt ggc agt ggg tct ggg aca gac ttc act ctc acc atc 288 Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 85 90 95 agc agc cta gag cct gaa gat ttt gca gtt tat tac tgt ttt cag ggg 336 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 agt ggg ttc cca ctc acg ttt ggc cag ggg acc aag gtg gaa atc aaa 384 Ser Gly Phe Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 cgt acg gtg gct gca cca tct gtc ttc atc ttc ccg cca tct gat gag 432 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 cag ttg aaa tct gga act gcc tct gtt gtg tgc ctg ctg aat aac ttc 480 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 tat ccc aga gag gcc aaa gta cag tgg aag gtg gat aac gcc ctc caa 528 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 tcg ggt aac tcc cag gag agt gtc aca gag cag gac agc aag gac agc 576 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 acc tac agc ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag 624 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 aaa cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg 672 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 ccc gtc aca aag agc ttc aac agg gga gag tgt tag 708 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 28 <211> 235 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 28 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 Pro Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Leu Leu Ile Tyr Asp Thr Tyr Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 85 90 95 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 Ser Gly Phe Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 29 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(708) <223> humanized light chain <400> 29 atg gat ttt caa gtg cag att ttc agc ttc ctg cta atc agt gcc tca 48 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 gtc ata atg tcc aga gga gaa aat gtg ttg aca cag tct cca gcc acc 96 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 ctg tct ttg tct cca ggg gaa aga gcc acc ctc tcc tgc agt gcc agc 144 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 cca agt gta agt tac atg cac tgg tac caa cag aaa cct ggc cag gct 192 Pro Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 ccc agg ctc ctc atc tat gac aca tac aaa ctg gct tct ggc atc cca 240 Pro Arg Leu Leu Ile Tyr Asp Thr Tyr Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 gcc agg ttc agt ggc agt ggg tct ggg aac gac tac act ctc acc atc 288 Ala Arg Phe Ser Gly Ser Gly Ser Gly Asn Asp Tyr Thr Leu Thr Ile 85 90 95 agc agc cta gag cct gaa gat ttt gca gtt tat tac tgt ttt cag ggg 336 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 agt ggg ttc cca ctc acg ttt ggc cag ggg acc aag gtg gaa atc aaa 384 Ser Gly Phe Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 cgt acg gtg gct gca cca tct gtc ttc atc ttc ccg cca tct gat gag 432 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 cag ttg aaa tct gga act gcc tct gtt gtg tgc ctg ctg aat aac ttc 480 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 tat ccc aga gag gcc aaa gta cag tgg aag gtg gat aac gcc ctc caa 528 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 tcg ggt aac tcc cag gag agt gtc aca gag cag gac agc aag gac agc 576 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 acc tac agc ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag 624 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 aaa cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg 672 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 ccc gtc aca aag agc ttc aac agg gga gag tgt tag 708 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 30 <211> 235 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 30 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 Pro Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Leu Leu Ile Tyr Asp Thr Tyr Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Gly Ser Gly Asn Asp Tyr Thr Leu Thr Ile 85 90 95 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 Ser Gly Phe Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 31 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> CDS <222> (1)..(708) <223> humanized light chain <400> 31 atg gat ttt caa gtg cag att ttc agc ttc ctg cta atc agt gcc tca 48 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 gtc ata atg tcc aga gga gaa aat gtg ttg aca cag tct cca gcc acc 96 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 ctg tct ttg tct cca ggg gaa aga gcc acc ctc tcc tgc agt gcc agc 144 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 cca agt gta agt tac atg cac tgg tac caa cag aaa cct ggc cag gct 192 Pro Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 ccc agg ctc tgg atc tat gac aca tac aaa ctg gct tct ggc atc cca 240 Pro Arg Leu Trp Ile Tyr Asp Thr Tyr Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 gcc agg ttc agt ggc agt ggg tct ggg aac gac tac act ctc acc atc 288 Ala Arg Phe Ser Gly Ser Gly Ser Gly Asn Asp Tyr Thr Leu Thr Ile 85 90 95 agc agc cta gag cct gaa gat ttt gca gtt tat tac tgt ttt cag ggg 336 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 agt ggg ttc cca ctc acg ttt ggc cag ggg acc aag gtg gaa atc aaa 384 Ser Gly Phe Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 cgt acg gtg gct gca cca tct gtc ttc atc ttc ccg cca tct gat gag 432 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 cag ttg aaa tct gga act gcc tct gtt gtg tgc ctg ctg aat aac ttc 480 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 tat ccc aga gag gcc aaa gta cag tgg aag gtg gat aac gcc ctc caa 528 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 tcg ggt aac tcc cag gag agt gtc aca gag cag gac agc aag gac agc 576 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 acc tac agc ctc agc agc acc ctg acg ctg agc aaa gca gac tac gag 624 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 aaa cac aaa gtc tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg 672 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 ccc gtc aca aag agc ttc aac agg gga gag tgt tag 708 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 32 <211> 235 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 32 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Glu Asn Val Leu Thr Gln Ser Pro Ala Thr 20 25 30 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser 35 40 45 Pro Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Leu Trp Ile Tyr Asp Thr Tyr Lys Leu Ala Ser Gly Ile Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Gly Ser Gly Asn Asp Tyr Thr Leu Thr Ile 85 90 95 Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Phe Gln Gly 100 105 110 Ser Gly Phe Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 115 120 125 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 33 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> H-CDR1 <400> 33 Gly Phe Ser Leu Thr Ser Tyr Gly Val Asp 1 5 10 <210> 34 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> H-CDR2 <400> 34 Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser Ala Leu Met Ser 1 5 10 15 <210> 35 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> H-CDR3 <400> 35 His Glu Val Leu Arg Gly Tyr Ala Leu Asp Tyr 1 5 10 <210> 36 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> L-CDR1 <400> 36 Ser Ala Ser Ser Ser Val Ser Tyr Met His 1 5 10 <210> 37 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> L-CDR2 <400> 37 Asp Thr Ser Lys Leu Ala Ser 1 5 <210> 38 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> L-CDR3 <400> 38 Phe Gln Gly Ser Gly Tyr Pro Leu Thr 1 5 <210> 39 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> H-CDR2 <400> 39 Val Ile Trp Gly Gly Gly Ser Thr Asn Tyr Asn Ser Ser Leu Met Ser 1 5 10 15 <210> 40 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> H-CDR1 <400> 40 Gly Phe Ser Leu Ala Ser Tyr Gly Val Asp 1 5 10 <210> 41 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> H-CDR3 <400> 41 His Gly Asp Ser Asn Ser Gly Tyr Ala Met Asp Tyr 1 5 10 <210> 42 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> L-CDR1 <400> 42 Ser Ala Ser Pro Ser Val Ser Tyr Met His 1 5 10 <210> 43 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> L-CDR2 <400> 43 Asp Thr Tyr Lys Leu Ala Ser 1 5 <210> 44 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> L-CDR3 <400> 44 Phe Gln Gly Ser Gly Phe Pro Leu Thr 1 5 <210> 45 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 45 tatgcaaggc ttacaaccac a 21 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 46 gggggtactg ggcttgggta t 21 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 47 ctcattcctg ttgaagctct tgac 24 <210> 48 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 48 gtgactcgag tcgacatcga tttttttttt ttttttt 37 <210> 49 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 49 cttccggaat tcctcaattt tcttgtccac cttggtgc 38 <210> 50 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 50 cttccggaat tcctcgattc tcttgatcaa ctcagtct 38 <210> 51 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 51 cttccggaat tcctcattcc tgttgaagct cttgacaatg gg 42 <210> 52 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 52 attaagtcga catagacaga tgggggtgtc gttttggc 38 <210> 53 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 53 attaagtcga cagggaccaa gggatagaca gatgg 35 <210> 54 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 54 ctacctcgag ggatacagtt ggtgcagcat c 31 <210> 55 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 55 cagtccgcgg ccaccatgga ttttcaagtg cagattttc 39 <210> 56 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 56 aggaagatct aacactcatt cctgttgaag c 31 <210> 57 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 57 cagtccgcgg ccaccatggc tgtcctggtg ctgtt 35 <210> 58 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 58 ctggacaggg atccagagtt cca 23 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 59 catgagatct catttaccag gggagcgaga 30 <210> 60 <211> 108 <212> PRT <213> Homo sapiens <220> <221> misc_feature <223> huIGHV4-59x01 <400> 60 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr 20 25 30 Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60 Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu 65 70 75 80 Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Arg Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 100 105 <210> 61 <211> 105 <212> PRT <213> Homo sapiens <220> <221> misc_feature <223> huIGKV3-11x01 <400> 61 Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45 Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro 65 70 75 80 Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Phe 85 90 95 Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105

Claims

1. An isolated monoclonal antibody or antigen-binding fragment thereof, characterized in that: Comprising: a heavy chain H-CDR1 composed of the sequence shown in sequence number 33, a heavy chain H-CDR2 composed of the sequence shown in sequence number 34, a heavy chain H-CDR3 composed of the sequence shown in sequence number 35, a light chain L-CDR1 composed of the sequence shown in sequence number 42, a light chain L-CDR2 composed of the sequence shown in sequence number 43, and a light chain L-CDR3 composed of the sequence shown in sequence number 44; The monoclonal antibody or antigen-binding fragment specifically binds to the stage-specific embryonic antigen 4.

2. The isolated monoclonal antibody according to claim 1, characterized in that The heavy chain sequence is the sequence shown in sequence number 14; the light chain sequence is the sequence shown in sequence number 28.

3. The isolated monoclonal antibody according to claim 1, characterized in that The heavy chain sequence is the sequence shown in sequence number 14; the light chain sequence is the sequence shown in sequence number 30.

4. The isolated monoclonal antibody according to claim 1, characterized in that: The heavy chain sequence is the sequence shown in sequence number 14; the light chain sequence is the sequence shown in sequence number 32.

5. A nucleic acid construct, characterized in that: Used to encode the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 4.

6. A recombinant cell, characterized in that A cell comprising the nucleic acid construct of claim 5, wherein the cell expresses a monoclonal antibody that specifically binds to stage-specific embryonic antigen 4.

Images