Use of a mutant of miR396 or a coding gene thereof in regulating plant agronomic traits
By regulating the expression of miR396 and GRF genes, the problem of limited plant agronomic trait improvement capabilities in existing technologies has been solved, and significant improvements in agronomic traits of crops such as rice, such as yield and panicle development, have been achieved under low nitrogen conditions.
Patent Information
- Application Number
- CN201910606371.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2019-07-05
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2039-07-05
AI Technical Summary
Existing miRNA targets have limited ability to improve plant agronomic traits, especially under low nitrogen conditions, making it difficult to significantly increase the yield and agronomic traits of crops such as rice.
By using specific nucleic acid constructs or mutants of their encoding genes, plant agronomic traits can be regulated, including reducing the expression or activity of miR396 and increasing the expression or activity of GRF genes or their encoded proteins. Specific methods include introducing miR396 inhibitors and introducing or expressing GRF genes, as well as optimizing nucleic acid sequences and GRF protein promoters.
It significantly improves plant agronomic traits under low nitrogen conditions, such as increasing yield, biomass, panicle and grain development, fruit size and number, grain length, panicle length, thousand-grain weight, and leaf length, achieving efficient agronomic trait regulation under low nitrogen conditions.
Smart Images

Figure CN112251434B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of crop genetics, specifically to the application of a mutant of miR396 or its encoding gene in regulating plant agronomic traits. Background Technology
[0002] Rice is one of the world's most important food crops and my country's largest food crop. The successful application of dwarfing breeding in the late 1950s and early 1960s and the three-line hybrid indica rice in the 1970s led to two major leaps in my country's rice yield, making a significant contribution to achieving food self-sufficiency. In the past decade or so, with the continuous increase in my country's population, the demand for total rice production has been steadily rising. In modern agricultural production, the use of chemical fertilizers, especially nitrogen fertilizers, has played a crucial role in promoting agricultural development. However, the excessive use of nitrogen fertilizers has also brought about many problems and impacts, not only causing enormous waste of economic resources but also seriously threatening the ecological environment. Excessive use of nitrogen fertilizers leads to soil acidification, secondary salinization, and contributes to the greenhouse effect, ozone layer depletion, and eutrophication of water bodies. Therefore, developing new rice varieties that can maintain or improve existing rice yields under low-nitrogen conditions is an important task for genetic breeders.
[0003] microRNAs (miRNAs) are a class of non-coding, single-stranded small RNA molecules, 20–24 nucleotides in length. They bind to the mRNA of target genes through base pairing, thereby causing mRNA degradation or translational repression. In plants, miRNAs regulate plant growth, development, and stress tolerance by controlling the accumulation of protein-coding genes in in situ.
[0004] However, current miRNA targets have limited ability to improve plant agronomic traits.
[0005] Therefore, there is an urgent need in this field to develop a method that can significantly improve plant agronomic traits. Summary of the Invention
[0006] The purpose of this invention is to provide a method that can significantly improve the agronomic traits of plants.
[0007] In a first aspect of the invention, there is provided the use of a nucleic acid construct or a mutant of its encoding gene for regulating plant agronomic traits under low nitrogen conditions or for preparing a composition or formulation for regulating plant agronomic traits under low nitrogen conditions, wherein the agronomic traits of the plant are selected from one or more of the following:
[0008] (a) Yield and / or biomass;
[0009] (b) Ear and / or grain development;
[0010] (c) Size, weight and / or quantity of fruit and / or seeds;
[0011] (d) Particle length;
[0012] (e) Particle width;
[0013] (f) Ear length;
[0014] (g) 1000-grain weight;
[0015] (h) Leaf length;
[0016] (i) Leaf width;
[0017] (j) Number of effective tillers;
[0018] (k) Number of pods;
[0019] The nucleic acid construct has a 5'-3' Formula I structure:
[0020] X1-X2-X3 (I)
[0021] In the formula, X1 is selected from positions 1-12 of SEQ ID NO:1 or positions 1-9 of SEQ ID NO:2;
[0022] X2 is selected from the mature / conserved sequence of miR396;
[0023] X3 is selected from bits 44-184 of SEQ ID NO:1 or bits 41-176 of SEQ ID NO:2;
[0024] Furthermore, each "-" represents a bond or nucleotide linkage sequence.
[0025] In another preferred embodiment, the regulation of plant agronomic traits includes:
[0026] (a) Increase yield and / or biomass;
[0027] (b) Promote spikelet and / or grain shape development;
[0028] (c) Increase the size, weight and / or quantity of fruits and / or seeds;
[0029] (d) Increase grain length;
[0030] (e) Increase particle width;
[0031] (f) Increase ear length;
[0032] (g) Increase the thousand-grain weight;
[0033] (h) Increase leaf length.
[0034] In another preferred embodiment, the mature / conserved sequence of miR396 includes the mature / conserved sequences of miR396a, miR396b, miR396c, miR396d, miR396e, miR396f, miR396g, and / or miR396h.
[0035] In another preferred embodiment, the mature / conserved sequence of miR396 includes the mature / conserved sequence of miR396e and / or miR396f.
[0036] In another preferred embodiment, X2 is selected from positions 13-43 of SEQ ID NO:1 or positions 10-40 of SEQ ID NO:2.
[0037] In another preferred embodiment, the low nitrogen condition refers to the nitrogen content (N) of the culture medium or field growth conditions. L The ratio of nitrogen content (N0) in a complete nutrient medium or under field growth conditions (N) L / N0) is 0-1, preferably 0.01-0.9, preferably 0.1-0.9, preferably 0.3-0.8, even better 0.5-0.8, even better 0.6-0.8.
[0038] In another preferred embodiment, the nucleic acid construct is selected from the group consisting of:
[0039] (a) Having the nucleotide sequence shown in SEQ ID NO:1 or 2;
[0040] (b) Polynucleotides with nucleotide sequence homology ≥75% (preferably ≥85%, more preferably ≥90% or ≥95%) to the sequence shown in SEQ ID NO:1 or 2;
[0041] (c) A polynucleotide with 1-60 (preferably 1-30, more preferably 1-10) nucleotides truncated or added to the 5' and / or 3' ends of the polynucleotide shown in SEQ ID NO:1 or 2.
[0042] In another preferred embodiment, the sequence of the nucleic acid construct is as shown in SEQ ID NO:1 or 2.
[0043] In another preferred embodiment, the coding gene encodes a nucleic acid construct as defined in the first aspect of the invention.
[0044] In another preferred embodiment, the coding genes include MIR396a, MIR396b, MIR396c, MIR396d, MIR396e, MIR396f, MIR396g and / or MIR396h.
[0045] In another preferred embodiment, the encoding gene includes MIR396e and / or MIR396f.
[0046] In another preferred embodiment, the nucleic acid construct or its encoding gene is derived from one or more plants selected from the group consisting of: Arabidopsis thaliana, rice, Chinese cabbage, soybean, tomato, corn, tobacco, wheat, sorghum, rapeseed, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, and romaine lettuce.
[0047] In another preferred embodiment, the nucleic acid construct or its encoding gene is derived from rice.
[0048] In another preferred embodiment, the nucleic acid construct or a mutant of its encoding gene is derived from one or more plants selected from the group consisting of: Arabidopsis thaliana, rice, Chinese cabbage, soybean, tomato, corn, tobacco, wheat, sorghum, rapeseed, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, and romaine lettuce.
[0049] In another preferred embodiment, the nucleic acid construct or a mutant of its encoding gene is derived from rice.
[0050] In another preferred embodiment, the nucleic acid construct or its encoding gene mutants include mutants of miR396a, miR396b, miR396c, miR396d, miR396e, miR396f, miR396g and / or miR396h.
[0051] In another preferred embodiment, the nucleic acid construct or a mutant of its encoding gene includes mutants of miR396e and / or miR396f.
[0052] In another preferred embodiment, the composition is an agricultural composition.
[0053] In another preferred embodiment, the composition comprises (a) a miR396 inhibitor; and (b) an agronomically acceptable carrier.
[0054] In another preferred embodiment, the dosage form of the composition or preparation is selected from the group consisting of solutions, emulsions, suspensions, powders, foams, pastes, granules, aerosols, or combinations thereof.
[0055] In another preferred embodiment, the plants include angiosperms and gymnosperms.
[0056] In another preferred embodiment, the gymnosperm is selected from the group consisting of: Cycadaceae, Podocarpaceae, Araucariaceae, Pinaceae, Taxaceae, Cupressaceae, Cephalotaxaceae, Taxaceae, Ephedrine, Gnetaceae, Monotypic families, Welwitschiaceae, or combinations thereof.
[0057] In another preferred embodiment, the plants include monocotyledonous plants and dicotyledonous plants.
[0058] In another preferred embodiment, the plants include herbaceous plants and woody plants.
[0059] In another preferred embodiment, the herbaceous plant is selected from the group consisting of: Solanaceae, Poaceae, Leguminosae, or combinations thereof.
[0060] In another preferred embodiment, the woody plant is selected from the group consisting of Actinidiaceae, Rosaceae, Moraceae, or combinations thereof.
[0061] In another preferred embodiment, the plant is selected from the group consisting of: cruciferous plants, grasses, legumes, solanaceae, actinidiaceae, malvaceae, peony family, rose family, lily family, or combinations thereof.
[0062] In another preferred embodiment, the plant is selected from the group consisting of: Arabidopsis thaliana, rice, Chinese cabbage, soybean, tomato, corn, tobacco, wheat, sorghum, rapeseed, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, romaine lettuce, or combinations thereof.
[0063] In another preferred embodiment, the rice is selected from the group consisting of indica rice, japonica rice, or a combination thereof.
[0064] In another preferred embodiment, the nucleic acid construct or mutant of the encoding gene defined in the first aspect of the invention is natural or synthetic.
[0065] In another preferred embodiment, the nucleic acid construct or its encoding gene mutant includes substitutions, insertions, and / or deletions of bases in the nucleic acid construct or its encoding gene as defined in the first aspect of the invention, preferably large fragment deletions.
[0066] In another preferred embodiment, the expression or activity of the nucleic acid construct or its encoding gene mutant is reduced by ≥50%, more preferably ≥70%, more preferably ≥90% or 100% compared to the expression or activity of the wild-type nucleic acid construct or its encoding gene.
[0067] In another preferred embodiment, the ratio of the activity E1 of the nucleic acid construct or a mutant of its encoding gene to the background activity E0 of the wild-type nucleic acid construct or a mutant of its encoding gene is ≤1 / 2, preferably ≤1 / 5, more preferably ≤1 / 10, and even more preferably 0.
[0068] In another preferred embodiment, the nucleic acid construct or a mutant of its encoding gene reduces, silences, or loses its regulatory effect on the target gene.
[0069] In another preferred embodiment, the target gene includes the GRF gene.
[0070] In another preferred embodiment, the GRF gene is selected from the group consisting of GRF4, GRF6, GRF8, or combinations thereof.
[0071] In another preferred embodiment, the GRF gene includes GRF8.
[0072] In another preferred embodiment, the mutation site of the nucleic acid construct or its encoding gene includes at least a portion of a mature sequence region or a conserved sequence region.
[0073] In another preferred embodiment, the mutation site of the nucleic acid construct or its encoding gene is in a mature sequence region or a conserved sequence region.
[0074] A second aspect of the present invention provides the use of a GRF gene or its encoded protein promoter for regulating plant agronomic traits under low nitrogen conditions or for preparing compositions or formulations for regulating plant agronomic traits under low nitrogen conditions, wherein the agronomic traits of the plant are selected from one or more of the following:
[0075] (a) Yield and / or biomass;
[0076] (b) Ear and / or grain development;
[0077] (c) Size, weight and / or quantity of fruit and / or seeds;
[0078] (d) Particle length;
[0079] (e) Particle width;
[0080] (f) Ear length;
[0081] (g) 1000-grain weight;
[0082] (h) Leaf length;
[0083] (i) Leaf width;
[0084] (j) Number of effective tillers;
[0085] (k) Number of pods.
[0086] In another preferred embodiment, the GRF genes include GRF4, GRF6, and / or GRF8.
[0087] In another preferred embodiment, the GRF Genes include GRF protein-coding genes and GRF Conserved gene regions sequence.
[0088] In another preferred embodiment, the GRF Genes include wild type GRF Genes and mutants GRF Gene.
[0089] In another preferred embodiment, the mutant includes a mutant form in which the function of the encoded protein is not altered after mutation (i.e., the function is the same as or substantially the same as the wild-type encoded protein).
[0090] In another preferred embodiment, the mutant... GRF Gene-encoded polypeptides and wild-type GRF The polypeptides encoded by the genes are the same or essentially the same.
[0091] In another preferred embodiment, the mutant... GRF Genes include those of wild type GRF Polynucleotides with ≥80% homology (preferably ≥90%, even better ≥95%) compared to genes.
[0092] In another preferred embodiment, the mutant... GRF Genes included in wild type GRF A polynucleotide with 1-60 (preferably 1-30, more preferably 1-10) nucleotides truncated or added to the 5' and / or 3' ends of the gene.
[0093] In another preferred embodiment, the described GRF Genes are selected from the following groups: cDNA sequences, genomic sequences, or combinations thereof.
[0094] In another preferred embodiment, the nucleotide sequence of the GRF4 gene is selected from the group consisting of:
[0095] (a) A polynucleotide encoding a polypeptide as shown in SEQ ID NO:3 or 4;
[0096] (b) Polynucleotides with sequences as shown in SEQ ID NO:5;
[0097] (c) Polynucleotides with nucleotide sequence homology ≥75% (preferably ≥85%, more preferably ≥90% or ≥95%) to the sequence shown in SEQ ID NO:5;
[0098] (d) A polynucleotide with 1-60 (preferably 1-30, more preferably 1-10) nucleotides truncated or added to the 5' and / or 3' ends of the polynucleotide shown in SEQ ID NO:5;
[0099] (e) A polynucleotide complementary to any of the polynucleotides described in (a)-(d).
[0100] In another preferred embodiment, the nucleotide sequence of the GRF4 gene is shown in SEQ ID NO:5.
[0101] In another preferred embodiment, the nucleotide sequence of the GRF6 gene is selected from the group consisting of:
[0102] (a) A polynucleotide encoding a polypeptide as shown in SEQ ID NO:6;
[0103] (b) Polynucleotides with sequences as shown in SEQ ID NO:7;
[0104] (c) Polynucleotides with nucleotide sequence homology ≥75% (preferably ≥85%, more preferably ≥90% or ≥95%) to the sequence shown in SEQ ID NO:7;
[0105] (d) A polynucleotide with 1-60 (preferably 1-30, more preferably 1-10) nucleotides truncated or added to the 5' and / or 3' ends of the polynucleotide shown in SEQ ID NO:7;
[0106] (e) A polynucleotide complementary to any of the polynucleotides described in (a)-(d).
[0107] In another preferred embodiment, the nucleotide sequence of the GRF6 gene is shown in SEQ ID NO:7.
[0108] In another preferred embodiment, the nucleotide sequence of the GRF8 gene is selected from the group consisting of:
[0109] (a) A polynucleotide encoding a polypeptide as shown in SEQ ID NO:8;
[0110] (b) Polynucleotides with sequences as shown in SEQ ID NO:9;
[0111] (c) Polynucleotides with nucleotide sequence homology ≥75% (preferably ≥85%, more preferably ≥90% or ≥95%) to the sequence shown in SEQ ID NO:9;
[0112] (d) A polynucleotide with 1-60 (preferably 1-30, more preferably 1-10) nucleotides truncated or added to the 5' and / or 3' ends of the polynucleotide shown in SEQ ID NO:9;
[0113] (e) A polynucleotide complementary to any of the polynucleotides described in (a)-(d).
[0114] In another preferred embodiment, the nucleotide sequence of the GRF8 gene is shown in SEQ ID NO:9.
[0115] In another preferred embodiment, the amino acid sequence of the GRF4 protein is selected from the group consisting of:
[0116] (i) A polypeptide having the amino acid sequence shown in SEQ ID NO:3 or 4;
[0117] (ii) A polypeptide derived from (i) formed by substituting, deleting, or adding one or more (e.g., 1-10) amino acid residues of an amino acid sequence as shown in SEQ ID NO:3 or 4; or
[0118] (iii) A polypeptide having the GRF4 activity, wherein the amino acid sequence is ≥80% homology (preferably ≥90%, more preferably ≥95% or ≥98%) with the amino acid sequence shown in SEQ ID NO:3 or 4.
[0119] In another preferred embodiment, the amino acid sequence of the GRF4 protein is as shown in SEQ ID NO:3 or 4.
[0120] In another preferred embodiment, the amino acid sequence of the GRF6 protein is selected from the group consisting of:
[0121] (i) A polypeptide having the amino acid sequence shown in SEQ ID NO:6;
[0122] (ii) A polypeptide derived from (i) formed by substituting, deleting, or adding one or more (e.g., 1-10) amino acid residues of the amino acid sequence shown in SEQ ID NO:6; or
[0123] (iii) A polypeptide having the GRF6 activity, wherein the amino acid sequence is ≥80% homology (preferably ≥90%, more preferably ≥95% or ≥98%) to the amino acid sequence shown in SEQ ID NO:6.
[0124] In another preferred embodiment, the amino acid sequence of the GRF6 protein is shown in SEQ ID NO:6.
[0125] In another preferred embodiment, the amino acid sequence of the GRF8 protein is selected from the group consisting of:
[0126] (i) A polypeptide having the amino acid sequence shown in SEQ ID NO:8;
[0127] (ii) A polypeptide derived from (i) formed by substituting, deleting, or adding one or more (e.g., 1-10) amino acid residues of the amino acid sequence shown in SEQ ID NO:8; or
[0128] (iii) A polypeptide having the GRF8 activity, wherein the amino acid sequence is ≥80% homology (preferably ≥90%, more preferably ≥95% or ≥98%) to the amino acid sequence shown in SEQ ID NO:8.
[0129] In another preferred embodiment, the amino acid sequence of the GRF8 protein is shown in SEQ ID NO:8.
[0130] In another preferred embodiment, the GRF gene or its encoded protein promoter includes a substance that promotes the expression or activity of the GRF gene or its encoded protein.
[0131] In another preferred embodiment, the expression or activity of the GRF gene or its encoded protein refers to increasing the expression or activity of the GRF gene or its encoded protein by ≥10%, more preferably ≥20%, more preferably ≥50%, and even more preferably ≥70%.
[0132] In another preferred embodiment, the GRF gene or its encoded protein promoter is selected from the group consisting of small molecule compounds, nucleic acid molecules, enzymes, or combinations thereof.
[0133] In another preferred embodiment, the GRF gene or its encoded protein is derived from one or more plants selected from the group consisting of: Arabidopsis thaliana, rice, Chinese cabbage, soybean, tomato, corn, tobacco, wheat, sorghum, rapeseed, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, and romaine lettuce.
[0134] In another preferred embodiment, the GRF gene or its encoded protein is derived from rice.
[0135] In another preferred embodiment, the composition is an agricultural composition.
[0136] In another preferred embodiment, the composition comprises (a) a promoter of the GRF gene or its encoded protein; and (b) an agronomically acceptable vector.
[0137] In another preferred embodiment, the dosage form of the composition or preparation is selected from the group consisting of solutions, emulsions, suspensions, powders, foams, pastes, granules, aerosols, or combinations thereof.
[0138] In another preferred embodiment, the plants include angiosperms and gymnosperms.
[0139] In another preferred embodiment, the gymnosperm is selected from the group consisting of: Cycadaceae, Podocarpaceae, Araucariaceae, Pinaceae, Taxaceae, Cupressaceae, Cephalotaxaceae, Taxaceae, Ephedrine, Gnetaceae, Monotypic families, Welwitschiaceae, or combinations thereof.
[0140] In another preferred embodiment, the plants include monocotyledonous plants and dicotyledonous plants.
[0141] In another preferred embodiment, the plants include herbaceous plants and woody plants.
[0142] In another preferred embodiment, the herbaceous plant is selected from the group consisting of: Solanaceae, Poaceae, Leguminosae, or combinations thereof.
[0143] In another preferred embodiment, the woody plant is selected from the group consisting of Actinidiaceae, Rosaceae, Moraceae, or combinations thereof.
[0144] In another preferred embodiment, the plant is selected from the group consisting of: cruciferous plants, grasses, legumes, solanaceae, actinidiaceae, malvaceae, peony family, rose family, lily family, or combinations thereof.
[0145] In another preferred embodiment, the plant is selected from the group consisting of: Arabidopsis thaliana, rice, Chinese cabbage, soybean, tomato, corn, tobacco, wheat, sorghum, rapeseed, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, romaine lettuce, or combinations thereof.
[0146] In another preferred embodiment, the rice is selected from the group consisting of indica rice, japonica rice, or a combination thereof.
[0147] A third aspect of the present invention provides a method for improving plant agronomic traits, comprising:
[0148] Under low nitrogen conditions, the expression or activity of miR396 in plants is reduced or the expression or activity of GRF genes or their encoded proteins in plants is increased.
[0149] In another preferred embodiment, the GRF gene is selected from the group consisting of GRF4, GRF6, GRF8, or combinations thereof.
[0150] In another preferred embodiment, the GRF gene includes GRF8.
[0151] In another preferred embodiment, the reduction of miR396 expression or activity in plants is achieved by the following means:
[0152] (1) Obtain the nucleic acid construct mutant of the first aspect of the present invention by causing a miR396 mutation in a plant, and / or
[0153] (2) Introduce an inhibitor of miR396 into the plant.
[0154] In another preferred embodiment, the method includes the steps of:
[0155] (i) Provide a plant or plant cell; and
[0156] (ii) Introducing an inhibitor of miR396 into the plant or plant cells to obtain plants or plant cells with downregulated miR396 expression.
[0157] In another preferred embodiment, the miR396 inhibitors include inhibitors of miR396a, miR396b, miR396c, miR396d, miR396e, miR396f, miR396g and / or miR396h.
[0158] In another preferred embodiment, the inhibitor of miR396 includes inhibitors of miR396e and / or miR396f.
[0159] In another preferred embodiment, the miR396 inhibitor is selected from the group consisting of small molecule compounds, antisense nucleic acids, microRNA, siRNA, RNAi, CRISPR reagent, or combinations thereof.
[0160] In another preferred embodiment, "reduction" means that the expression or activity of miR396 is reduced while meeting the following conditions:
[0161] The ratio of A1 / A0 is ≤80%, preferably ≤60%, more preferably ≤40%, and most preferably 0-30%; wherein, A1 is the expression or activity of miR396 in the plant; and A0 is the expression or activity of the same miR396 in wild-type plants of the same species.
[0162] In another preferred embodiment, the reduction refers to the expression level E1 of MIR396 in the plant being 0-80% of that of the wild type, more preferably 0-60%, more preferably 0-40%, and even more preferably 0-30%, compared to the expression level E0 of the wild type MIR396.
[0163] In another preferred embodiment, the reduction of miR396 expression or activity in the plant is achieved by means selected from the group consisting of: gene mutation, gene knockout, gene interruption, RNA interference technology, CRISPR technology, or a combination thereof.
[0164] In another preferred embodiment, the reduction of miR396 expression or activity in plants is achieved by gene editing of miR396 using one or more sgRNA-mediated Cas9 nucleases.
[0165] In another preferred embodiment, the method includes giving the plant GRF Promoters of genes or their encoded polypeptides.
[0166] In another preferred embodiment, the method includes introducing exogenous [product / method] into the plant. GRF Genes or their encoded proteins.
[0167] In another preferred embodiment, the method includes the steps of:
[0168] (i) Provide a plant or plant cell; and
[0169] (ii) will GRF The gene sequence is introduced into the plant or plant cell to obtain a plant or plant cell with upregulated GRF gene expression.
[0170] In another preferred embodiment, the method includes the steps of:
[0171] (a) Provide carrying GRF Agrobacterium, a gene sequence expression vector;
[0172] (b) Contacting plant cells, tissues, or organs with Agrobacterium tumefaciens from step (a), thereby causing... GRF The gene sequence is transferred into plant cells and integrated into the chromosomes of the plant cells;
[0173] (c) Select Transferred In GRF Plant cells, tissues, or organs containing gene sequences; and
[0174] (d) Regenerate the plant cells, tissues or organs from step (c) into a plant.
[0175] In another preferred embodiment, the improved plant agronomic traits include:
[0176] (a) Increase yield and / or biomass;
[0177] (b) Promote spikelet and / or grain shape development;
[0178] (c) Increase the size, weight and / or quantity of fruits and / or seeds;
[0179] (d) Increase grain length;
[0180] (e) Increase particle width;
[0181] (f) Increase ear length;
[0182] (g) Increase the thousand-grain weight;
[0183] (h) Increase leaf length;
[0184] (i) Increase the number of effective tillers.
[0185] A fourth aspect of the present invention provides a composition for improving plant agronomic traits under low nitrogen conditions, comprising:
[0186] (i) miR396 inhibitors, and / or promoters of the GRF gene or its encoded protein; and
[0187] (ii) An agriculturally acceptable carrier.
[0188] In another preferred embodiment, the composition comprises an agricultural composition.
[0189] In another preferred embodiment, the dosage form of the composition is selected from the group consisting of solutions, emulsions, suspensions, powders, foams, pastes, granules, aerosols, or combinations thereof.
[0190] In another preferred embodiment, the composition contains 0.0001-99 wt%, preferably 0.1-90 wt%, of component (a) based on the total weight of the composition.
[0191] In another preferred embodiment, the improved plant agronomic traits include:
[0192] (a) Increase yield and / or biomass;
[0193] (b) Promote spikelet and / or grain shape development;
[0194] (c) Increase the size, weight and / or quantity of fruits and / or seeds;
[0195] (d) Increase grain length;
[0196] (e) Increase particle width;
[0197] (f) Increase ear length;
[0198] (g) Increase the thousand-grain weight;
[0199] (h) Increase leaf length.
[0200] The fifth aspect of the present invention provides the use of the composition described in the fourth aspect of the present invention for improving the agronomic traits of plants under low nitrogen conditions.
[0201] The sixth aspect of this invention provides a method for preparing gene-edited plant tissues or plant cells, comprising the steps of:
[0202] Under low nitrogen conditions, gene-edited plant tissues or cells are obtained by reducing the expression or activity of miR396 in plant tissues or cells and / or increasing the expression or activity of GRF genes or their encoded proteins in plant tissues or cells.
[0203] The seventh aspect of this invention provides a method for preparing gene-edited plants, comprising the steps of:
[0204] Gene-edited plant tissues or plant cells prepared by the method described in the sixth aspect of the present invention are regenerated into plant bodies, thereby obtaining gene-edited plants.
[0205] The eighth aspect of the present invention provides a gene-edited plant, said plant being prepared using the method described in the seventh aspect of the present invention.
[0206] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0207] The following figures are used to illustrate specific embodiments of the present invention and are not intended to limit the scope of the invention as defined by the claims.
[0208] Figure 1 The effects of different mir396e mutation types on seed grain shape are shown.
[0209] Figure 2 The differences in seed size between wild type and mir396e mutant were shown.
[0210] Figure 3 The growth status of the plants under different nitrogen conditions is shown.
[0211] Figure 4 The effects of the miR396ef mutation on seed size and thousand-seed weight under low nitrogen conditions were shown.
[0212] Among them, (a) the effect of the miR396ef mutation on grain length and grain width;
[0213] (b) The effect of the miR396ef mutation on grain thickness;
[0214] (c) Effect of miR396ef mutation on thousand-grain weight.
[0215] Figure 5 The image shows a slice of the seed.
[0216] Among them, (a) the effect of the miR396ef mutation on the length of glumes cells;
[0217] (b) Effect of miR396ef mutation on the number of palea and lemma cells.
[0218] Figure 6 The effects of the mir396ef mutation on spike length, main branch, and number of grains per spike were shown.
[0219] Among them, (a) the effect of the miR396ef mutation on spike length;
[0220] (b) The effect of the miR396ef mutation on the number of principal branches;
[0221] (c) Effect of miR396ef mutation on grain number per ear.
[0222] Figure 7 The effect of the mir396ef mutation on rice yield was shown.
[0223] Among them, (a) the yield of miR396ef mutant under non-low nitrogen conditions;
[0224] (b) Yield of miR396ef mutant under low nitrogen conditions.
[0225] Figure 8 The effect of the miR396ef mutation on rice leaf length was shown.
[0226] Figure 9 The effect of the mir396ef mutation on rice plant height was shown.
[0227] Figure 10 The effect of the mir396ef mutation on rice biomass was shown.
[0228] Figure 11 It was shown that mir396ef regulates grain and ear development through the miR396-GRF4 / 6 / 8-GIF1 / 2 / 3 pathway.
[0229] Among them, (a) the mir396 target resistance gene sequence;
[0230] (b) Effects of np:rGRF4, np:rGRF6 and np:rGRF8 on grain shape;
[0231] (c) Effects of np:rGRF6 and np:rGRF8 on spike length;
[0232] (d) The interaction between GRE and GIF;
[0233] (e) Plant type and seed breeding type of gif1 mutant. Detailed Implementation
[0234] Through extensive and in-depth research, the inventors have for the first time discovered or synthesized a new class of nucleic acid constructs of formula I representing miR396 and its family members, or mutants of their encoding genes. The nucleic acid constructs of this invention, or mutants of their encoding genes, can significantly improve plant agronomic traits under low-nitrogen conditions, including: (a) increased yield and / or biomass; (b) promoted spike and / or grain type development; (c) fruit and / or seed size, weight, and / or number; (d) grain length; (e) grain width; (f) spike length; (g) thousand-grain weight; (h) leaf length; (i) leaf width; (j) number of effective tillers; and (k) number of pods, etc. Furthermore, the inventors unexpectedly discovered that increasing the expression or activity of GRF genes (such as GFR4, 6, and / or 8) or their encoded proteins can significantly improve plant agronomic traits under low nitrogen conditions, including: (a) increased yield and / or biomass; (b) promoted spike and / or grain type development; (c) fruit and / or seed size, weight, and / or number; (d) grain length; (e) grain width; (f) spike length; (g) thousand-grain weight; (h) leaf length; (i) leaf width; (j) effective tiller number; (k) Furthermore, this invention is the first to discover that the nucleic acid construct of this invention or mutants of its encoding gene, under low nitrogen conditions, influence plant yield, biomass; spike type and / or grain type development; fruit and / or seed size, weight and / or number; grain length; grain width; spike length; thousand-grain weight; leaf length; leaf width; number of effective tillers; and number of pods, among other traits. Based on this, the inventors completed this invention.
[0235] GRF gene
[0236] As used in this article, the term " GRF "Gene" and "gene of this invention" can be used interchangeably, both referring to the gene of this invention that regulates plant agronomic traits.
[0237] In a preferred embodiment, the gene of the present invention includes GRF4, GRF6, GRF8 Preferably, the genes of the present invention include GRF8 More preferably, the present invention GRF The genes are derived from rice.
[0238] GRF, short for growth-regulating factors, is a class of transcription factors unique to plants. It interacts with the SNH domain of GIF (GRF-interaction factor) proteins through its N-terminal QLQ domain, forming a functional complex that jointly participates in the regulation of downstream gene expression. The number of members varies slightly among different species; Arabidopsis contains 9, rice contains 12, and maize contains 14.
[0239] The present invention GRF Genes can be in DNA or RNA form. DNA forms include cDNA, genomic DNA, or artificially synthesized DNA. Genomic DNA can be identical to the sequences shown in SEQ ID NO:5, 7, and 9 or a degenerate variant. The DNA of this invention can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be identical to the coding region sequence shown in SEQ ID NO:5, 7, and 9 or a degenerate variant.
[0240] As used herein, "degenerate variant" refers to a nucleic acid sequence that encodes a protein having SEQ ID NO:3, 4, 6 or 8, but differs from the coding region sequence shown in SEQ ID NO:5, 7 or 9.
[0241] Polynucleotides encoding mature polypeptides of SEQ ID NO: 3, 4, 6 or 8 include: coding sequences that encode only the mature polypeptide; coding sequences of the mature polypeptide and various additional coding sequences; coding sequences of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.
[0242] The term "polynucleotide encoding a polypeptide" can refer to a polynucleotide that includes the polypeptide, or it can also include additional coding and / or non-coding sequences.
[0243] This invention also relates to variants of the aforementioned polynucleotides that encode polypeptides or fragments, analogs, and derivatives of polypeptides having the same amino acid sequence as those of this invention. These polynucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.
[0244] The present invention also relates to polynucleotides that hybridize with the above-described sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. In the present invention, “stringent conditions” means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, more preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO:2.
[0245] This invention also relates to nucleic acid fragments that hybridize with the sequences described above. As used herein, a "nucleic acid fragment" is at least 15 nucleotides long, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides or more. The nucleic acid fragments can be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding polypeptides related to heat resistance.
[0246] GRF Gene-encoded polypeptides
[0247] As used herein, the terms "polypeptide of the invention", ..." and "polypeptide of the invention" are used interchangeably. GRF Gene-encoded polypeptides GRF "Gene-encoded proteins" GRF The term "polypeptide" can be used interchangeably, both referring to the polypeptides of this invention that regulate plant agronomic traits under low nitrogen conditions.
[0248] In a preferred embodiment, the polypeptide of the present invention comprises GRF4, GRF6 and / or GRF8. More preferably, the polypeptide of the present invention is derived from rice.
[0249] The polypeptides of the present invention can be recombinant polypeptides, natural polypeptides, or synthetic polypeptides, with recombinant polypeptides being preferred. The polypeptides of the present invention can be naturally purified products, chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptides of the present invention can be glycosylated or non-glycosylated. The polypeptides of the present invention may or may not include an initial methionine residue.
[0250] The present invention also includes GRF Fragments, derivatives, and analogs of polypeptides. As used herein, the terms "fragment," "derivative," and "analyte" refer to substances that substantially retain the natural composition of the present invention. GRFA polypeptide having the same biological function or activity as a polypeptide. The polypeptide fragments, derivatives, or analogs of the present invention may be (i) polypeptides in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) polypeptides having substituent groups in one or more amino acid residues; or (iii) polypeptides formed by fusing a mature polypeptide with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (iv) polypeptides formed by fusing an additional amino acid sequence to this polypeptide sequence (e.g., a leader sequence or secretion sequence, or a sequence used to purify this polypeptide, or a proteogenic sequence, or a fusion protein). Based on the teachings herein, these fragments, derivatives, and analogs are within the scope well known to those skilled in the art.
[0251] In a preferred embodiment, the polypeptide of the present invention refers to a polypeptide having the sequence of SEQ ID NO: 3, 4, 6, or 8 that regulates plant agronomic traits under low nitrogen conditions. It also includes variants of the sequence of SEQ ID NO: 3, 4, 6, or 8 having the same function as the GRF polypeptide. These variants include (but are not limited to): deletions, insertions, and / or substitutions of one or more amino acids (typically 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10), and the addition of one or more amino acids (typically less than 20, preferably less than 10, more preferably less than 5) at the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids of similar or comparable properties generally does not alter the function of the protein. Similarly, the addition of one or more amino acids at the C-terminus and / or N-terminus generally does not alter the function of the protein. The term also includes... GRF Active fragments and active derivatives of peptides.
[0252] The variants of this polypeptide include: homologous sequences, conserved variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes to the DNA of the SPL polypeptide under high or low severity conditions, and polypeptides or proteins obtained using antiserum containing an anti-GRF polypeptide. The invention also provides other polypeptides, such as fusion proteins comprising a GRF polypeptide or a fragment thereof. In addition to nearly full-length polypeptides, the invention also includes soluble fragments of the GRF polypeptide. Typically, this fragment has at least about 10 consecutive amino acids of the GRF polypeptide sequence, typically at least about 30 consecutive amino acids, preferably at least about 50 consecutive amino acids, more preferably at least about 80 consecutive amino acids, and most preferably at least about 100 consecutive amino acids.
[0253] This invention also provides GRF peptides or analogues thereof. These analogues may differ from natural GRF peptides in that they differ in amino acid sequence, in the form of modifications that do not affect the sequence, or both. These peptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis through radiation or exposure to a mutagen, site-directed mutagenesis, or other known molecular biology techniques. Analogs also include those having residues different from natural L-amino acids (e.g., D-amino acids), and those having non-naturally occurring or synthetic amino acids (e.g., β, γ-amino acids). It should be understood that the peptides of this invention are not limited to the representative peptides exemplified above.
[0254] Modifications (typically without altering the primary structure) include: chemically derived forms of peptides, either in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation. Modifications also include sequences containing phosphorylated amino acid residues (such as phosphotyrosine, phosphotyserine, phosphotythreonine). Modifications also include peptides that are modified to improve their resistance to proteolysis or optimize their solubility.
[0255] In this invention, a "GRF-conserved variant polypeptide" refers to a polypeptide formed by replacing up to 10, more preferably up to 8, more preferably up to 5, and most preferably up to 3 amino acids of the amino acid sequence SEQ ID NO: 3, 4, 6, or 8 with amino acids of similar or analogous properties. In the protein, substitution with amino acids of similar or analogous properties generally does not alter the protein's function, and adding one or more amino acids to the C-terminus and / or L-terminus generally does not alter the protein's function either. These conserved variant polypeptides are preferably generated by amino acid substitutions according to the table below.
[0256]
[0257] GRF Promoters of genes or their encoded proteins
[0258] In this invention, GRF Promoters of genes or their encoded proteins include those capable of enhancing... GRF The expression and / or activity of a gene or its encoded protein.
[0259] In this invention, the GRF There are no particular limitations on the promotion of genes or their encoded proteins; anything that can promote GRF expression or enhance GRF protein activity is within the scope of protection of this invention.
[0260] In a preferred embodiment, the promoter of the GRF gene or its encoded protein includes small molecule compounds, nucleic acids, enzymes, etc.
[0261] miR396
[0262] miR396 is a non-coding single-stranded small RNA molecule containing 20–24 nucleotides in length, mainly located at the 5' end of the coding sequence. Its 5' and 3' copulas pair with each other, forming a neck-loop structure. It comprises eight members: miR396a, miR396b, miR396c, miR396d, miR396e, miR396f, miR396g, and miR396h. Through base pairing, it binds to the mRNA of target genes, thereby causing mRNA degradation or translational repression, playing an important regulatory role in plant growth and development.
[0263] In a preferred embodiment, the sequence of miR396e is shown in SEQ ID NO: 1, and the sequence of miR396f is shown in SEQ ID NO: 2.
[0264] Mature / Conserved sequence of miR396
[0265] In this invention, mature / conserved sequence refers to the actual functional sequence formed after the RNA precursor sequence has been processed by cutting.
[0266] Specifically, in this invention, miR396 represents an RNA precursor sequence; the mature sequence is the RNA sequence formed after the RNA precursor sequence has been cut and processed; a conserved sequence refers to an RNA fragment with consistent sequences across different species; a mature sequence can be equivalent to a conserved sequence, and there can be overlap between mature and conserved sequences; a conserved sequence can be longer than a mature sequence. MIR396 represents the DNA sequence encoding miR396.
[0267] Within the miR396 family, the mature / conserved sequences among the miR396 subtypes a, b, c, d, e, f, g, and h are highly similar.
[0268] The nucleic acid constructs of the present invention or mutants of their encoding genes
[0269] This invention provides a nucleic acid construct or a mutant of its encoding gene for regulating agronomic traits of plants under low nitrogen conditions.
[0270] In this invention, the nucleic acid construct has a 5'-3' Formula I structure:
[0271] X1-X2-X3 (I)
[0272] In the formula, X1 is selected from positions 1-12 of SEQ ID NO:1 or positions 1-9 of SEQ ID NO:2;
[0273] X2 is selected from the mature / conserved sequence of miR396;
[0274] X3 is selected from bits 44-184 of SEQ ID NO:1 or bits 41-176 of SEQ ID NO:2;
[0275] Furthermore, each "-" represents a bond or nucleotide linkage sequence.
[0276] In this invention, the nucleic acid constructs of this invention or mutants of their encoding genes include miR396a, miR396b, miR396c, miR396d, miR396e, miR396f, miR396g and / or miR396h mutants.
[0277] In this invention, the nucleic acid construct or its encoding gene mutant can be a single mutation, a double mutation, or a multiple mutation, preferably a single mutation or a double mutation, and more preferably a mutation of miR396e and / or miR396f.
[0278] The various elements used in the constructs of this invention are either known in the art or can be prepared by methods known to those skilled in the art.
[0279] The vector of the present invention is formed by inserting a mutant of the encoding gene of the construct of the present invention or the GRF gene into an exogenous vector (especially a vector suitable for transgenic plant manipulation).
[0280] Transgenic plant cells are obtained by transforming the vector of the present invention into plant cells, thereby mediating the integration of the vector of the present invention into the chromosomes of the plant cells.
[0281] The transgenic plant cells of the present invention are regenerated into a plant body, thereby obtaining a transgenic plant.
[0282] The mutant encoding gene of the nucleic acid construct constructed in this invention can be introduced into plant cells using conventional genetic transformation techniques (such as Agrobacterium-mediated transformation) to obtain plant cells carrying the mutant encoding gene of the nucleic acid construct (or a vector carrying the mutant encoding gene of the nucleic acid construct), or to obtain plant cells with the mutant encoding gene of the nucleic acid construct integrated into their genome.
[0283] miR396 inhibitors
[0284] This invention also provides an inhibitor targeting miR396, which can inhibit the expression or activity of miR396. In this invention, the miR396 inhibitor is selected from the group consisting of small molecule compounds, antisense nucleic acids, microRNA, siRNA, RNAi, CRISPR reagent, or combinations thereof.
[0285] use
[0286] This invention also provides the use of the nucleic acid construct of Formula I or a mutant of its encoding gene, a miR396 inhibitor, and / or a promoter of the GRF gene or its encoded protein, which are used to regulate agronomic traits of plants under low nitrogen conditions. In this invention, the nucleic acid construct of Formula I or a mutant of its encoding gene is derived from rice.
[0287] In this invention, the expression or activity of miR396 can be inhibited by techniques such as gene mutation, gene knockout, gene interruption, RNA interference, and CRISPR technology.
[0288] In a preferred embodiment, miR396 can be gene-edited using one or more sgRNA-mediated Cas9 nucleases.
[0289] Plant (e.g., rice) improvement
[0290] The present invention also provides a method for improving plants (such as rice), the improvement comprising: (a) increasing yield and / or biomass; (b) promoting panicle and / or grain type development; (c) increasing grain length; (d) increasing grain width; (e) increasing panicle length; (f) increasing thousand-grain weight; (g) increasing leaf length; and (h) increasing leaf width, comprising the steps of: reducing the expression or activity of miR396 in plants under low nitrogen conditions, applying an inhibitor of miR396, a nucleic acid construct as defined in the first aspect of the present invention or a mutant of its encoding gene, and / or increasing the expression or activity of the GRF gene or its encoding protein in plants.
[0291] As is known to those skilled in the art, the same trait in different types of crops can be characterized by different terms, or the same trait can be characterized by other traits with different terms. For example, in crops such as wheat and rice, yield can be reflected by the shape of the spike, such as spike length, number of grains per spike, and grain shape; in soybeans, yield can be reflected by the number of pods and grain shape; and in tomatoes, yield can be reflected by the size and number of fruits. Therefore, the improvement of crop traits in this invention is not limited to the traits listed in this invention, but also includes other traits in other crops that have the same concept as the traits described in this invention but are not listed in this invention.
[0292] In this invention, plants or plant seeds can be further treated with other substances that can regulate plant traits using conventional methods, thereby improving the traits of the corresponding plants.
[0293] The main advantages of this invention include:
[0294] (1) This invention is the first to discover a new class of nucleic acid constructs of miR396 and its family members represented by Formula I or mutants of their encoding genes, especially the miR396e and / or miR396f subtype mutants, which can significantly improve plant traits under low nitrogen conditions, including (a) increasing yield and / or biomass; (b) promoting spike and / or grain type development; (c) increasing grain length; (d) increasing grain width; (e) increasing spike length; (f) increasing thousand-grain weight; (g) increasing leaf length; and (h) increasing leaf width.
[0295] (2) This invention is the first to discover that the nucleic acid construct shown in Formula I of this invention or a mutant of its encoding gene can upregulate the expression of the GRF8 gene.
[0296] (3) This invention is the first to discover that the nucleic acid construct shown in Formula I of this invention or the mutant of its encoding gene regulates grain and spike development through the miR396-GRF4 / 6 / 8-GIF1 / 2 / 3 pathway.
[0297] (4) This invention is the first to discover that the nucleic acid construct of Formula I of this invention or the mutant of its encoding gene can reduce the amount of nitrogen fertilizer used, increase the utilization rate of nitrogen fertilizer, increase the accumulation of rice biomass energy, increase the yield and biomass of rice, and at the same time reduce the environmental pollution caused by nitrogen fertilizer.
[0298] (5) This invention is the first to discover that increasing the expression or activity of GRF genes (including GRF4, 6, and / or 8, especially GRF8) or their encoded proteins in plants can significantly improve plant traits under low nitrogen conditions, including (a) increasing yield and / or biomass; (b) promoting spike and / or grain type development; (c) increasing grain length; (d) increasing grain width; (e) increasing spike length; (f) increasing thousand-grain weight; (g) increasing leaf length; and (h) increasing leaf width.
[0299] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.
[0300] Unless otherwise specified, all reagents or materials used in the embodiments of this invention are commercially available products.
[0301] In this invention, the culture medium used is commercially available Kimura B medium. The nutrient-rich condition is that the commercially available Kimura B medium of this invention contains all the components required for plant growth, wherein the nitrogen content is (0.034 g / L); the nitrogen-free condition is that the commercially available Kimura B medium used in this invention does not contain nitrogen but contains all other components.
[0302] The low-nitrogen conditions described in this invention refer to nitrogen fertilizer application rates lower than the conventional fertilizer application rates during crop growth, or the absence of additional nitrogen fertilizer application to the soil. The conventional fertilizer application rates are those known to those skilled in the art or to farmers as the amounts applied to ensure stable and high-quality crop yields. In the field operations described in the embodiments of this invention, the low-nitrogen conditions refer to the situation where no additional nitrogen fertilizer is applied to the plant growth environment.
[0303] In this invention, the nitrogen content under low-nitrogen conditions is 3 / 5 to 4 / 5 of the nitrogen content under full-nitrogen conditions.
[0304] The conventional application rate of nitrogen fertilizer, such as for rice, wheat, and corn, is 150-350 kg per hectare. The application rate varies for different crops and in different regions. The conventional rate can be determined by those skilled in the art or by farmers' planting experience.
[0305] Example 1: Under low nitrogen conditions, the miR396e single mutant can increase rice yield.
[0306] 1. Design of gene editing sites
[0307] To design a gene editing vector targeting miR396e and avoid simultaneously targeting other members of the miR396 family, a target site was selected on the stem-loop sequence of the miR396 precursor, and an sgRNA sequence was designed targeting this site: GCUCAUGUUGGGAUUGUGGU (SEQ ID NO:10).
[0308] 2. Construction of CRISPR-Cas9 gene editing tools
[0309] A) Dissolve the primers in ddH2O to 10 μM, add 1 μl of each of the forward and reverse primers to 8 μl of annealing solution (anneal buffer: TE buffer with 50 mM NaCl), and mix well;
[0310] B) Run the annealing program on the mixed primers, heat the PCR instrument to 95°C and hold for 5 min, then decrease the temperature by 0.1°C every 1 second until it reaches 16°C;
[0311] C) Digest the CRISPR-Cas9 vector with BsaI, recover the vector fragment, and set aside for later use;
[0312] D) Connect the gRNA and the CRISPR-Cas9 vector.
[0313] Annealing product 1
[0314] BsaI digested CRISPR vector 1
[0315] 10x T4 buffer 1
[0316] T4 ligase 0.5
[0317] Add water to 10 μl, incubate at 16°C for 2 hours.
[0318] E) Transform E. coli, select a single clone M13F, and sequence to verify that the fragment was successfully ligated into the vector.
[0319] 3. Vector genetic transformation
[0320] A) The above-constructed plasmid was directly transformed into Agrobacterium EHA105:
[0321] 1. Add plasmid DNA to Agrobacterium competent cells, then incubate on ice for 30 min, in liquid nitrogen for 1 min, and then immediately in a 37°C water bath for 2 min.
[0322] 2. Remove the centrifuge tube, add LB medium, and incubate with shaking for 3-5 hours.
[0323] 3. Spread the bacterial culture onto LB agar plates containing the appropriate antibiotics, and incubate upside down in an incubator. Colonies will be visible in about 2 days.
[0324] B) Genetically modified rice:
[0325] 1. Callus induction: After dehulling, seeds were disinfected by soaking in NaClO, rinsed with sterile water, and then inoculated into NB induction medium and cultured in an incubator for 10–15 days.
[0326] 2. Callus subculture: The induced callus is cut off with a single-edged scalpel and placed in subculture medium for culture under the same conditions.
[0327] 3. Agrobacterium infection and screening of resistant callus: Agrobacterium strain EH105 transformed into the target vector was propagated, and then callus in good condition was soaked.
[0328] 4. Aspirate or discard the bacterial solution, and place the callus tissue in a dark incubator for 48–72 h.
[0329] 5. After co-culture, the callus tissue was rinsed with carbenicillin-resistant sterile water to remove Agrobacterium.
[0330] 6. Dry the callus tissue and inoculate it onto a selection medium containing antibiotics, then culture it under light for two weeks.
[0331] 7. Callus differentiation culture: Select vigorous callus tissue (resistant callus tissue) and transfer it to a differentiation medium containing antibiotics. Within a week, most callus tissue grows rapidly, and green spots appear on the surface of the callus tissue. The green callus tissue will quickly differentiate into seedlings.
[0332] 4. Plant culture and mutant screening
[0333] A) Transfer the healthy seedlings that have differentiated to a rooting medium containing antibiotics for one week of rooting culture. After hardening off at room temperature for 2-3 days, transplant them into the field after 15-20 days of substrate cultivation in a greenhouse.
[0334] B) Take leaves from each plant, extract genomic DNA, and design primers on both sides of the target site. Perform Sanger sequencing on the amplified fragments to determine the genotype of each plant.
[0335] C) Detect the mutation types of the miR396e gene. In the T0 generation, a series of mutation types in the mature region of miR396e were screened, and the mutation type population was continuously increased through 4-5 generations of continuous propagation.
[0336] D) Using miR396e as a detection probe, Northern blot hybridization was used to detect the accumulation level of mature miR396e in the mir396e / f mutant.
[0337] 5. Experimental Results
[0338] Multiple mutation types targeting miR396e were detected. Observational analysis revealed that the miR396e mutant phenotype can affect rice grain shape (grain length, grain width, and / or grain weight). However, not all mutants showed differences in grain shape. Analysis showed that when the mutation type was insertion or deletion of a small fragment, no significant changes in grain size were observed in the transgenic lines. However, in large fragment deletion mutants, mutations where the deletion location included the maturity region site of miR396e showed significant changes in grain shape. Figure 1 ).
[0339] Further analysis showed that, compared to wild-type plants, the mir396e mutant plants had a 4.77% increase in seed length and a 5.58% increase in seed width. Figure 2 ).
[0340] 6. Experimental Conclusions
[0341] Silent expression of miR396e can alter rice seed grain shape, specifically increasing grain length, width, and / or thickness, ultimately increasing rice yield through changes in grain shape.
[0342] Example 2: Under low nitrogen conditions, the miR396ef double mutant can increase rice yield.
[0343] Different types of mutants, such as miR396ef and mir396abcef, were obtained using the method described in Experimental Example 1.
[0344] (1) Effect of nitrogen-free conditions on the growth status of miR396ef mutant
[0345] Observations were conducted on mutant and wild-type seedlings grown under different nitrogen conditions. It was found that under total nitrogen (0.034 g / L nitrogen) culture conditions, the mir396 mutant and wild-type showed almost no difference; however, in nitrogen-free (0 g / L nitrogen) culture medium, the three mir396e / f mutants exhibited significantly stronger growth potential than the wild-type. Figure 3 The preliminary results of this experiment indicate that miR396e / f can participate in the response to external nitrogen deficiency stress and has an important impact on the growth potential of rice.
[0346] (1) Effect of miR396ef on particle shape under low nitrogen conditions
[0347] In field conditions, under low nitrogen conditions (no nitrogen fertilizer applied), different mutant types of miR396ef in the mature region can increase rice grain length by 8.46%, grain width by 7.95%, grain thickness by 8.16%, and thousand-grain weight by 26.51%. Figure 4 (a-c). The granular morphology of the mir396abcef mutant is consistent with that of the mir396ef mutant, with no significant statistical difference.
[0348] Sectional observation of wild-type and mutant seeds revealed that the main changes in seed morphology were an increase in the number and size of glume cells. Figure 5 (ab)
[0349] (2) Under low nitrogen conditions, the miR396ef mutation can increase the number of grains per panicle in rice.
[0350] Under field conditions and low nitrogen conditions (no nitrogen fertilizer applied), compared with the wild type, mir396ef had a longer panicle (20.55±1.83 cm vs. 17.93±1.64 cm) and more main branches (8.8±1.34 vs. 7.33±1.56). Longer panicle length and more panicle branches are generally associated with more grains; the mir396ef mutant had a higher number of grains per panicle than the wild type (77.82±8.89 vs. 72.35±10.96). Figure 6 ,ac)
[0351] (3) Under low nitrogen conditions, the miR396ef mutation can increase rice yield.
[0352] Our field yield trials showed that, under normal cultivation conditions, the grain yield of the mir396ef mutant increased by about 4% relative to the wild type in fields (2m×2m) where 270 kg ha-1 nitrogen fertilizer was applied.
[0353] Under low-nitrogen conditions (without nitrogen fertilizer), the grain yield of the mir396ef mutant rice was significantly increased by approximately 15% compared to the wild type. Figure 7 (ab)
[0354] In summary, the mir396ef double mutant has a more significant impact on rice phenotypes such as grain shape, number of grains per panicle, and plant height under low nitrogen conditions compared to normal cultivation conditions. By influencing the phenotypes, rice yield can ultimately be increased.
[0355] Example 3: Under low nitrogen conditions, the miR396ef mutant can increase the biomass of rice.
[0356] (1) The miR396ef mutation can increase rice leaf length
[0357] Under field conditions, during the mid-grain-filling stage, three dominant tillers were selected from each individual plant, for a total of 20 plants. The leaf sheaths of the three tillers from each selected plant were cut at the flag leaf sheath. The distance from the leaf tip to the leaf sheath was measured using a ruler. Compared to the wild-type flag leaf, the flag leaf of the mir396ef double mutant was 32.8% longer. Figure 8 ).
[0358] (2) The miR396ef mutation can increase the height of rice plants.
[0359] Under field conditions, during the late grain-filling stage, 20 individual plants were selected; the distance from the ground surface to the ear of each plant was measured using a ruler. The results showed that the mir396ef mutant (74.13±3.54 cm) was longer than the wild type (69.33±3.20 cm), but the number of tillers was similar to the wild type. Figure 9 )
[0360] (3) The miR396ef mutation can increase the aboveground biomass accumulation of rice.
[0361] Under field conditions, after the rice matures, select 20 individual plants; cut these individual plants at ground level.
[0362] All aboveground plant tissues were placed in a 60℃ oven and baked for two weeks; the dry matter weight of each individual plant was then measured. Compared with wild plants, under low-nitrogen cultivation conditions, the aboveground dry biomass of the mir396ef mutant increased by 25% per plant. Figure 10 Analysis revealed no significant difference in the photosynthetic rate per unit leaf area between the flag leaf and the wild type. Therefore, the increased plant height, larger flag leaf area, and increased total photosynthetic rate of the mutant, leading to the accumulation of more photosynthetic products, along with increased nitrogen absorption and utilization rates, all contribute to the increased dry matter content of the mir396ef mutant plant.
[0363] Example 4: mir396ef regulates grain and ear type development through the miR396-GRF4 / 6 / 8-GIF1 / 2 / 3 pathway.
[0364] All 12 GRF transcription factor genes in rice carry the miR396 target site. We found that, compared with the wild type, only OsGRF4, OsGRF6, and OsGRF8 were upregulated in the mir396ef mutant plant. RLM-race (5' RNA ligase-mediated rapid amplification of cDNA ends) analysis showed that miR396 can directly cleave the mRNA of OsGRF4 and OsGRF6 at specific locations in the miR396 pairing region in vivo.
[0365] To investigate the regulation of seed and spike development by OsGRF4, OsGRF6, and OsGRF8 mediated by mir396, we constructed mir396-targeting resistance gene sequences for OsGRF4, OsGRF6, and OsGRF8 (named np:rGRF4, np:rGRF6, and np:rGRF8, respectively). Figure 11 a), and under the regulation of their own promoters, they were transferred into rice. We found that: (1) the grains of np:rGRF4, np:rGRF6 and np:rGRF8 were larger than those of wild-type plants, with np:rGRF4 showing the greatest grain size growth and np:rGRF6 showing the smallest grain size growth ( Figure 11 b). (2) The spike length of both np:rGRF6 and np:rGRF8 increased ( Figure 11 c) The spike length and number of branches of np:rGRF4 were similar to those of the wild type. These results indicate that the mir396ef molecule regulates seed and spike development by modulating its target genes OsGRF4, OsGRF6, and OsGRF8.
[0366] GRFs have been shown to interact with transcriptional co-activators GIFs. To identify GIFs interacting with GRF4 and GRF6, we performed a yeast two-hybrid screening. We found that OsGIF1, OsGIF2, and OsGIF3 interact with OsGRF4, and OsGIF3 also interacts with OsGRF6. Figure 11 d). The GIF1 mutant was generated using CRISPR / Cas9 technology, and the expected short-leaf phenotype was observed. Compared to the wild type, the gif1 mutant also exhibited smaller plant size and aborted seeds. Figure 11 e). These results indicate that the development of rice plant architecture and grain type is regulated by the miR396EF-GRF4 / 6 / 8-GIF1 / 2 / 3 module.
[0367] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> Shandong Shunfeng Biotechnology Co., Ltd. <120> P2019-0896 <130> Application of a mutant of miR396 or its encoding gene in regulating plant agronomic traits <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 184 <212> RNA <213> Artificial sequence <400> 1 gcgggcaugc uuuccacagg cuuucuugaa cugugaacuc gugggggugu augugcucau 60 guugggauug uggucggugg ccuccaauuc ucugaaaaga aagcugaauu gucgagcucc 120 ccguucuguc uuuggucguc ucuaccuguu gaugguucaa gaaagcccau ggaaaccaug 180 ccgc 184 <210> 2 <211> 176 <212> RNA <213> artificial sequence <400> 2 gccaugcucu ccacaggcuu ucuugaacug ugaacucgug ugugcaugcu ccucauauau 60 uguucuagau cccaugcaug augcauaucg aucgaucuga ucugaauuag gucaucgaug 120 cgcaucugga uccccaucuu guugauaguu caagaaaguc cuuggaaaac auggug 176 <210> 3 <211> 422 <212> PRT <213> Oryza sativa <400> 3 Met Pro Pro Cys Leu Arg Arg Trp Pro Thr Thr Ala Arg Pro Arg Gln 1 5 10 15 Pro Arg Pro Pro Pro Ser Ser Pro Ser Ala Ala Pro Pro Arg Ser Pro 20 25 30 Arg Lys Gln Arg Glu Pro Ala Ala Thr Thr His Phe Leu Gly Ser Ser 35 40 45 Gly Ala Cys Asp Asn Thr Val Arg Arg Cys Val Trp Val Gly Gly Cys 50 55 60 Arg Gly Gly Gly Gly Val Ala Met Gly Glu Asp Ala Pro Met Thr Ala 65 70 75 80 Arg Trp Pro Pro Ala Ala Ala Ala Arg Leu Pro Pro Phe Thr Ala Ala 85 90 95 Gln Tyr Glu Glu Leu Glu Gln Gln Ala Leu Ile Tyr Lys Tyr Leu Val 100 105 110 Ala Gly Val Pro Val Pro Pro Asp Leu Val Leu Pro Ile Arg Arg Gly 115 120 125 Leu Asp Ser Leu Ala Ala Arg Phe Tyr Asn His Pro Ala Leu Gly Tyr 130 135 140 Gly Pro Tyr Phe Gly Lys Lys Leu Asp Pro Glu Pro Gly Arg Cys Arg 145 150 155 160 Arg Thr Asp Gly Lys Lys Trp Arg Cys Ser Lys Glu Ala Ala Pro Asp 165 170 175 Ser Lys Tyr Cys Glu Arg His Met His Arg Gly Arg Asn Arg Ser Arg 180 185 190 Lys Pro Val Glu Thr Gln Leu Val Ala Gln Ser Gln Pro Pro Ser Ser 195 200 205 Val Val Gly Ser Ala Ala Ala Pro Leu Ala Ala Ala Ser Asn Gly Ser 210 215 220 Ser Phe Gln Asn His Ser Leu Tyr Pro Ala Ile Ala Gly Ser Asn Gly 225 230 235 240 Gly Gly Gly Gly Arg Asn Met Pro Ser Ser Phe Gly Ser Ala Leu Gly 245 250 255 Ser Gln Leu His Met Asp Asn Ala Ala Pro Tyr Ala Ala Val Gly Gly 260 265 270 Gly Thr Gly Lys Asp Leu Arg Tyr Thr Ala Tyr Gly Thr Arg Ser Leu 275 280 285 Ala Asp Glu Gln Ser Gln Leu Ile Thr Glu Ala Ile Asn Thr Ser Ile 290 295 300 Glu Asn Pro Trp Arg Leu Leu Pro Ser Gln Asn Ser Pro Phe Pro Leu 305 310 315 320 Ser Ser Tyr Ser Gln Leu Gly Ala Leu Ser Asp Leu Gly Gln Asn Thr 325 330 335 Pro Ser Ser Leu Ser Lys Val Gln Arg Gln Pro Leu Ser Phe Phe Gly 340 345 350 Asn Asp Tyr Ala Ala Val Asp Ser Val Lys Gln Glu Asn Gln Thr Leu 355 360 365 Arg Pro Phe Phe Asp Glu Trp Pro Lys Gly Arg Asp Ser Trp Ser Asp 370 375 380 Leu Ala Asp Glu Asn Ala Asn Leu Ser Ser Phe Ser Gly Thr Gln Leu 385 390 395 400 Ser Ile Ser Ile Pro Met Ala Ser Ser Asp Phe Ser Ala Ala Ser Ser 405 410 415 Arg Ser Thr Asn Gly Asp 420 <210> 4 <211> 394 <212> PRT <213> Rice (Oryza sativa) <400> 4 Met Ala Met Pro Tyr Ala Ser Leu Ser Pro Ala Val Ala Asp His Arg 1 5 10 15 Ser Ser Pro Ala Ala Ala Thr Ala Ser Leu Leu Pro Phe Cys Arg Ser 20 25 30 Thr Pro Leu Ser Ala Gly Gly Gly Gly Val Ala Met Gly Glu Asp Ala 35 40 45 Pro Met Thr Ala Arg Trp Pro Pro Ala Ala Ala Ala Arg Leu Pro Pro 50 55 60 Phe Thr Ala Ala Gln Tyr Glu Glu Leu Glu Gln Gln Ala Leu Ile Tyr 65 70 75 80 Lys Tyr Leu Val Ala Gly Val Pro Val Pro Pro Asp Leu Val Leu Pro 85 90 95 Ile Arg Arg Gly Leu Asp Ser Leu Ala Ala Arg Phe Tyr Asn His Pro 100 105 110 Ala Leu Gly Tyr Gly Pro Tyr Phe Gly Lys Lys Leu Asp Pro Glu Pro 115 120 125 Gly Arg Cys Arg Arg Thr Asp Gly Lys Lys Trp Arg Cys Ser Lys Glu 130 135 140 Ala Ala Pro Asp Ser Lys Tyr Cys Glu Arg His Met His Arg Gly Arg 145 150 155 160 Asn Arg Ser Arg Lys Pro Val Glu Thr Gln Leu Val Ala Gln Ser Gln 165 170 175 Pro Pro Ser Ser Val Val Gly Ser Ala Ala Ala Pro Leu Ala Ala Ala 180 185 190 Ser Asn Gly Ser Ser Phe Gln Asn His Ser Leu Tyr Pro Ala Ile Ala 195 200 205 Gly Ser Asn Gly Gly Gly Gly Gly Arg Asn Met Pro Ser Ser Phe Gly 210 215 220 Ser Ala Leu Gly Ser Gln Leu His Met Asp Asn Ala Ala Pro Tyr Ala 225 230 235 240 Ala Val Gly Gly Gly Thr Gly Lys Asp Leu Arg Tyr Thr Ala Tyr Gly 245 250 255 Thr Arg Ser Leu Ala Asp Glu Gln Ser Gln Leu Ile Thr Glu Ala Ile 260 265 270 Asn Thr Ser Ile Glu Asn Pro Trp Arg Leu Leu Pro Ser Gln Asn Ser 275 280 285 Pro Phe Pro Leu Ser Ser Tyr Ser Gln Leu Gly Ala Leu Ser Asp Leu 290 295 300 Gly Gln Asn Thr Pro Ser Ser Leu Ser Lys Val Gln Arg Gln Pro Leu 305 310 315 320 Ser Phe Phe Gly Asn Asp Tyr Ala Ala Val Asp Ser Val Lys Gln Glu 325 330 335 Asn Gln Thr Leu Arg Pro Phe Phe Asp Glu Trp Pro Lys Gly Arg Asp 340 345 350 Ser Trp Ser Asp Leu Ala Asp Glu Asn Ala Asn Leu Ser Ser Phe Ser 355 360 365 Gly Thr Gln Leu Ser Ile Ser Ile Pro Met Ala Ser Ser Asp Phe Ser 370 375 380 Ala Ala Ser Ser Arg Ser Thr Asn Gly Asp 385 390 <210> 5 <211> 3825 <212> DNA <213> Rice (Oryza sativa) <400> 5 aaagcaccat tactaaagac cgcggcgtgt gcttgcgttg cgagcgagcg agagcgagag 60 agagattgag agagagagag ggaagggatg gcgatgccgt atgcctccct gtctccggcg 120 gtggccgacc accgctcgtc cccggcagcc gcgaccgcct ccctcctccc cttctgccgc 180 tccaccccgc tctccgcgta agcaacgcga acccgcggct acaacccatt ttcttggctc 240 cagtggtgca tgtgacaaca cggtgagacg ttgtgtgtgg gtgggtgggt gcaggggcgg 300 tggtggcgtc gcgatggggg aggacgcgcc gatgaccgcg aggtggccgc cggcggcggc 360 ggcgaggctg ccgccgttca ccgcggcgca gtacgaggag ctggagcagc aggcgctcat 420 atacaagtac ctggtggcag gcgtgcccgt cccgccggat ctcgtgctcc ccatccgccg 480 cggactcgac tccctcgccg cccgcttcta caaccatccc gcccgtacgt cgtgttccta 540 tttcttgcct ctcctctacc atcgctgcat tgcttttgga tgcttgttta gtgtcggctt 600 ctttgtttat tccgatcagg cgtactttgc ttccatttgt taattggctc cgggtcattt 660 gttaatccgg gttacgcgat tcaagaaaca tgcgtgtgtg tttttatgct atcctccgga 720 tttggtaata aaaaggcttg tttttaaatc caaaactcgt gctcgcttca cgattagcgc 780 atcatttttt ttttttgggg gggggggggg ggaagtttgc ccatcattct gtctctgttt 840 gatctgatag aggacgtgca cacgctcttg tctgaaataa aatcttttgt ttatcagtat 900 gcccatggga taagccattt tctctgtgaa ccaacaccct ggcaaactgt ttttttgctc 960 gccatttttg agcgattgct aagaacagat aactatgccc tgcatatgga tcggatatgg 1020 acttctcaaa tattcaaatg ccattctatt aggaactcaa aatgcattac caacaaatgc 1080 attcttgtgt gtaacacggt tgctacgatg tgcctgtttt tgtacagttg gatatggtcc 1140 gtacttcggc aagaagctgg acccagagcc agggcggtgc cggcgtacgg acggcaagaa 1200 atggcggtgc tcgaaggagg ccgcgccgga ttccaagtac tgcgagcgcc acatgcaccg 1260 cggccgcaac cgttcaagaa agcctgtgga aacgcagctg gtcgcccagt cccaaccgcc 1320 ctcatctgtt gtcggttctg cggcggcgcc ccttgctgct gcctccaatg gcagcagctt 1380 ccaaaaccac tctctttacc ctgctattgc cggcagcaat ggcgggggcg gggggaggaa 1440 catgcccagc tcatttggct cggcgttggg ttctcagctg cacatggata atgctgcccc 1500 ttatgcagct gttggtggtg gaacaggcaa agatctcagg tgattgttca tttctttttt 1560 tttaatcaaa cgccatattt acttgtttag cactgtcttg aatcatgata tgtatccttc 1620 cgttgtctaa aaaaaaggtg ccatgctcta actgattggt gtcaggtgga tgcagttatg 1680 aatctgtatt tttcattgtg atcggttaat aactgtgtcc catttgtttg cattggtggc 1740 aatcgaatca gctgtccatg ctcagtagta ctacttcgat ttggtgctgc aatcactgaa 1800 agtctgaaac tttactctct gcactgcaaa aatttgtgtt atgtttaggt ttccagagtg 1860 ctgcctcttt gcccttccca tactttctgg tatcagtttt cagccccaga agccggggac 1920 agtctccata agagatttct gctcaggtga aactggggtg cagggtctta acatggcttt 1980 ggcccagtag tttgaaacat gtactgtcca taaagatgat actactacat atttgtgtct 2040 gccctcgcag tgcttgtgcc tgctggtagc tgatcatggc ttcccttggc atttactcca 2100 cttctttatt cctccacaga atccagttgt ttctgtctct gctcttcagg ggcagtcaat 2160 tatttggccc ttgcaaaata ctgtctctga agatgtctca ccgatcacca ctatacctga 2220 aacattttcc agtggccagc gtgagctgca tgatgctcca agtcaactct atactcatcc 2280 aatgttgatg attagatttt aacaatgcaa ctctttgatt tatcttccct acaaaaaaaa 2340 aggaactctt tgatttatct tcggtgaatc tcagtctgac cttagtacct agcctcatta 2400 tttacttcac caaatgtata actctacagt gcttgttcgt gttgatttgg tttagtttag 2460 ttattgaatt attcggtcac cttagtcttt gattgttttt ttctttctgc tcttgtcatc 2520 aactgtttag ggttcagctg acttgctgct gcaactaaac tgtcttctgg ttttactgca 2580 aaatagaatg tttcttgggc catgatctgc tgctatatat gattagttaa accatggttc 2640 tatgttttct tatatgaatt catgacaaga atactaactt ttggaaaagg taattttatt 2700 ttttttgtat gataataatg ctttggattc tttctagttt atctgtcgga cttaggttaa 2760 ctacatttcc tccggtacat ggatttattt cattcttaca attgagccct tatgaatatt 2820 ttcttcctaa ttctgttcta aaaagttaga attgacatat tttcgatagg tacatgccta 2880 gcacttgcat tcgtgtttcc tactaattcc caatcactgt atcttctcaa attcaggtat 2940 actgcttatg gcacaagatc tttggcggat gagcagagtc aactcattac tgaagctatc 3000 aacacatcta ttgaaaatcc atggcggctg ctgccatctc agaactcgcc atttcccctt 3060 tcaagctatt ctcagctggg ggcactaagt gaccttggtc agaacacccc cagctcactt 3120 tcaaaggttc agaggcagcc actttcgttc tttgggaacg actatgcggc tgtcgattct 3180 gtgaagcaag agaaccagac gctgcgtccc ttctttgatg agtggccaaa gggaagggat 3240 tcatggtcag acctcgctga tgagaatgct aatctttcgt cattctcagg cacccaactg 3300 tcgatctcca taccaatggc atcctctgac ttctcggcgg ccagttctcg atcaactaat 3360 ggtacgacta cttgatctcc ccccaattac ttcgtgcgtg tttatgtctg tatcctgcaa 3420 tgtctgaaga tttcttactg aaaacgtcat ctggtctgtg tgcaggtgac tgaatgctgc 3480 gtggatgatg atcctgctgc ccagtgaact catactggcc ttgttgctgt cttgctctgc 3540 gattttctgc ctgctcgcgc ccaccgtacg atagtagcaa aacattctat gcttctgtaa 3600 tttaccagtg ttcccctgtc agatttgcgt gtgaaatcga tcaaactccg tggtctcctt 3660 tggacgaagg gagatgtcaa cgttttcctt gatgtttact gctagtaaca tcttattact 3720 tcccaaatgc tgatcagcct ctgcttgcta tgctctcctg tttgtcgact caacagtgcc 3780 gtcaacatca gtgcagcaac gtgaggctca tgctttttaa ggtca 3825 <210> 6 <211> 356< <212> PRT <213> Rice (Oryza sativa) <400> 6 Met Leu Ser Ser Ser Pro Ser Ala Ala Ala Pro Gly Ile Gly Gly Tyr 1 5 10 15 Gln Pro Gln Arg Gly Ala Ala Val Phe Thr Ala Ala Gln Trp Ala Glu 20 25 30 Leu Glu Gln Gln Ala Leu Ile Tyr Lys Tyr Leu Val Ala Gly Val Pro 35 40 45 Val Pro Gly Asp Leu Leu Leu Pro Ile Arg Pro His Ser Ser Ala Ala 50 55 60 Ala Thr Tyr Ser Phe Ala Asn Pro Ala Ala Ala Pro Phe Tyr His His 65 70 75 80 His His His Pro Ser Leu Ser Tyr Tyr Ala Tyr Tyr Gly Lys Lys Leu 85 90 95 Asp Pro Glu Pro Trp Arg Cys Arg Arg Thr Asp Gly Lys Lys Trp Arg It should be noted that there seems to be a space issue in the tag ` ` in the original text, which is corrected to ` ` in the translation for consistency. Also, the format might need to be further adjusted according to the specific requirements of the patent text processing system. 100 105 110 Cys Ser Lys Glu Ala His Pro Asp Ser Lys Tyr Cys Glu Arg His Met 115 120 125 His Arg Gly Arg Asn Arg Ser Arg Lys Pro Val Glu Ser Lys Thr Ala 130 135 140 Ala Pro Ala Pro Gln Ser Gln Pro Gln Leu Ser Asn Val Thr Thr Ala 145 150 155 160 Thr His Asp Thr Asp Ala Pro Leu Pro Ser Leu Thr Val Gly Ala Lys 165 170 175 Thr His Gly Leu Ser Leu Gly Gly Ala Gly Ser Ser Gln Phe His Val 180 185 190 Asp Ala Pro Ser Tyr Gly Ser Lys Tyr Ser Leu Gly Ala Lys Ala Asp 195 200 205 Val Gly Glu Leu Ser Phe Phe Ser Gly Ala Ser Gly Asn Thr Arg Gly 210 215 220 Phe Thr Ile Asp Ser Pro Thr Asp Ser Ser Trp His Ser Leu Pro Ser 225 230 235 240 Ser Val Pro Pro Tyr Pro Met Ser Lys Pro Arg Asp Ser Gly Leu Leu 245 250 255 Pro Gly Ala Tyr Ser Tyr Ser His Leu Glu Pro Ser Gln Glu Leu Gly 260 265 270 Gln Val Thr Ile Ala Ser Leu Ser Gln Glu Gln Glu Arg Arg Ser Phe 275 280 285 Gly Gly Gly Ala Gly Gly Met Leu Gly Asn Val Lys His Glu Asn Gln 290 295 300 Pro Leu Arg Pro Phe Phe Asp Glu Trp Pro Gly Arg Arg Asp Ser Trp 305 310 315 320 Ser Glu Met Asp Glu Glu Arg Ser Asn Gln Thr Ser Phe Ser Thr Thr 325 330 335 Gln Leu Ser Ile Ser Ile Pro Met Pro Arg Cys Gly Ser Pro Ile Gly 340 345 350 Pro Arg Leu Pro 355 <210> 7 <211> 3275 <212> DNA <213> Rice (Oryza sativa) <400> 7 ccccctctcc tctccctctc acactcacac gctgcagcag cagcagcagc agcagctttc 60 [[ID=四]]ccaccgactc ctccccctcc tccattaatg gccgccacca agaaccctcc aacccccacg 120 tgacctcctc ctcccctccc cctccccctc cccctcccga cctcgccgcc ggcgacctcc 180 It should be noted that there is an error in the Chinese character "四" in your original text at line . It should be "0" in the English translation. I have corrected it in the translation. cttcttcttc ctgcttgcct gctcgcttgc ctgcctggtt cgaccgatgc tgagctcgtc 240 gccctcggcg gcggcgccgg ggataggagg gtaccagccg cagcgcgggg cggcggtctt 300 cacggcggcg cagtgggcgg agctggagca gcaggcgctc atttacaagt acctcgtcgc 360 cggtgtcccc gtcccgggcg atctcctcct cccaatccgc ccccactcct ccgccgccgc 420 cacctactcc ttcgccaacc ccgccgccgc gcccttctac caccaccacc accacccctc 480 tcgtaagctc tctctccatc ttttttccac aaatggtcca tctcttgttt gcttcatgct 540 tgggtattca aatctgagaa aaatttatat atgtgtgcgc gtgtgctttc ttgggacttt 600 ttcttttttt tttgtttctt ctttcaggac aggatctctt tgctgccctg ctcattggga 660 ttgatttgct attgctctca cgatttattg atagatgaac gtacacggat ctttgcttat 720 agtatgtccg tttaagctgt tcgattgatt ctttgctcac tcttatatcc taagcaaatt 780 aagcatatag tagttattac cattaccaac tttgcattgg gttgatgaaa tgttgaagtg 840 gtgcattttg atctagtttt aatatgaaca atgatgaatg ctgatatgga ttcaatgtgc 900 ctgtgctcat gtcactgcag tgagctatta tgcctactat ggcaagaagc ttgaccctga 960 gccgtggcgt tgccgccgca ccgacggcaa gaagtggcgg tgctccaagg aggcgcaccc 1020 cgactccaag tactgcgagc gccacatgca ccgtggccgc aaccgttcaa gaaagcctgt 1080 ggaatccaag accgctgccc ctgcgcccca gtcgcagccc cagctgtcca atgtcacgac 1140 cgcgactcac gacaccgatg cgcctctccc gtcactcact gtgggtgcta aaacccacgg 1200 tctgtccctt ggtggtgctg gctcgtcgca gttccatgtc gacgcaccat cgtacggcag 1260 caagtatccc ctctaatctc attgactctg tgttgaatgc ttattgaat taagcttgcc 1320 tagattgatt gcatattatg ctggaataga gctgatctgg tagctttctt aaaagggttt 1380 agacactcaa aatagtattt gagctctaat gttgttgatg cttattgctc aagtagtgaa 1440 cctaccctca ttccagtaat tataagtgtg tgaggctgcc taagaatttg tcgatcagag 1500 cttattcaat gagttagtca gatgagtgat actgccaatt tacatgtgac cataacccca 1560 actaaaaatt ttgtacctgg attatgttag ttaaatctgt gtattgcatt ccatccatcc 1620 ttgatgctac aaacctctgt gggcacaatg tcataagcat atgtctgttg cttgtgcctt 1680 tagccctatt atactgttgc tttttgcagt aatattgtac gcttttccag atcacctaag 1740 ccctagctga ttttgacctt tattgcccta actcctgatt atgttttgag aaatagtgtt 1800 aacagttgtc atgttctggg gtgtttttgg tccatgccct ctaaaatctt ggtaccgtct 1860 tttttatgct ggaaaatttt gcttgtgtca tcttttttgt gtgccatacc ttagtttagt 1920 atttcctcct ctgctagcaa tcacaaaata aaaatattgt accttcgaca ccatccttat 1980 gcttgtgctg catgcatggc atatgttcta gtttcgtgtc attttgcatt tgcatcttgc 2040 tagatgactg acaaagctta ttttgctcct tcgactattt ttcgttcttt ttcctttttt 2100 aactatagta ggttgtctta ttatcgtttt ggtagcattt ttcctatgca gctgctttta 2160 tgtcctcccc ttgagttgta gaaatccctt agctactgtg aacctgtaat catcccatta 2220 tattccattt gatgctgcgc aaatctacat gtactgtgtc tgagtctggt gtctggtcct 2280 aattttcatg tatcaatggc tatgcaggta ctctcttgga gctaaagctg atgtgggtga 2340 actgagcttc ttctcaggag catcaggaaa caccaggggc ttcaccattg attctccaac 2400 agatagctca tggcattcac tgccttccag tgtaccccca tacccgatgt caaagccaag 2460 ggactctggc ctcctaccag gtgcctactc ctactcccac cttgaacctt cacaggaact 2520 tggccaggtc accatcgcct cgctgtccca agagcaggag cgccgctctt ttggtggtgg 2580 agcggggggg atgctaggaa atgtgaagca cgagaaccag ccgctgaggc ctttcttcga 2640 tgagtggcct gggaggcgag actcgtggtc ggagatggat gaggagaggt ccaaccagac 2700 ctccttctcg acaacccagc tctcgatctc catcccgatg cccagatgtg ggtcccctat 2760 cggtccgcgt ctaccttgag catcccttca ccaacatttc tctcacacaa ttcattccat 2820 tttctttgat gatgcaggtg attgagaact ttgctgcttg tggcagcggg gtggacctct 2880 accccgcatt ttaccgctgc tagtgagttg gatcagtgat tgcgcctccc ctggttcttt 2940 gttcaattgt atcgtgctat gaactagtta agagaaccct actttttttt tctagtagaa 3000 gagacagaaa actcttatcc atcatcatgt tttaagattc cacgatgttt tgtacctgca 3060 acccacgacc tgccggctgc tggaagttac tggctgtctg taatgtttgt agtagatgat 3120 ctatgatgta tcatgtatct atctacttgt tccgaattgc ggaaaccaaa gccgataatc 3180 tggcatgtgc caacgtcctc cttaaagctc ttgtgctatg tattttgctt ttggtgggaa 3240 aaaagaagaa aagaaggttc catttttctt aataa 3275 <210> 8 <211> 409 <212> PRT <213> Rice (Oryza sativa) <400> 8 Met Leu Ser Ser Cys Gly Gly His Gly His Gly Asn Pro Arg Ser Leu 1 5 10 15 Gln Glu Glu His His Gly Arg Cys Gly Glu Gln Gln Gly Gly Gly Gly 20 25 30 Gly Gly Gly Gln Glu Gln Glu Gln Asp Gly Phe Leu Val Arg Glu Ala 35 40 45 Arg Ala Ser Pro Pro Ser Pro Ser Ser Ser Ser Phe Leu Gly Ser Thr 50 55 60 Ser Ser Ser Cys Ser Gly Gly Gly Gly Gly Gly Gln Met Leu Ser Phe 65 70 75 80 Ser Ser Pro Asn Gly Thr Ala Gly Leu Gly Leu Ser Ser Gly Gly Ser 85 90 95 Met Gln Gly Val Leu Ala Arg Val Arg Gly Pro Phe Thr Pro Thr Gln 100 105 110 Trp Met Glu Leu Glu His Gln Ala Leu Ile Tyr Lys His Ile Ala Ala 115 120 125 Asn Val Ser Val Pro Ser Ser Leu Leu Leu Pro Ile Arg Arg Ser Leu 130 135 140 His Pro Trp Gly Trp Gly Ser Phe Pro Pro Gly Cys Ala Asp Val Glu 145 150 155 160 Pro Arg Arg Cys Arg Arg Thr Asp Gly Lys Lys Trp Arg Cys Ser Arg 165 170 175 Asp Ala Val Gly Asp Gln Lys Tyr Cys Glu Arg His Ile Asn Arg Gly 180 185 190 Arg His Arg Ser Arg Lys His Val Glu Gly Arg Lys Ala Thr Leu Thr 195 200 205 Ile Ala Glu Pro Ser Thr Val Ile Ala Ala Gly Val Ser Ser Arg Gly 210 215 220 His Thr Val Ala Arg Gln Lys Gln Val Lys Gly Ser Ala Ala Thr Val 225 230 235 240 Ser Asp Pro Phe Ser Arg Gln Ser Asn Arg Lys Phe Leu Glu Lys Gln 245 250 255 Asn Val Val Asp Gln Leu Ser Pro Met Asp Ser Phe Asp Phe Ser Ser 260 265 270 Thr Gln Ser Ser Pro Asn Tyr Asp Asn Val Ala Leu Ser Pro Leu Lys 275 280 285 Leu His His Asp His Asp Glu Ser Tyr Ile Gly His Gly Ala Gly Ser 290 295 300 Ser Ser Glu Lys Gly Ser Met Met Tyr Glu Ser Arg Leu Thr Val Ser 305 310 315 320 Lys Glu Thr Leu Asp Asp Gly Pro Leu Gly Glu Val Phe Lys Arg Lys 325 330 335 Asn Cys Gln Ser Ala Ser Thr Glu Ile Leu Thr Glu Lys Trp Thr Glu 340 345 350 Asn Pro Asn Leu His Cys Pro Ser Gly Ile Leu Gln Met Ala Thr Lys 355 360 365 Phe Asn Ser Ile Ser Ser Gly Asn Thr Val Asn Ser Gly Gly Thr Ala 370 375 380 Val Glu Asn Leu Ile Thr Asp Asn Gly Tyr Leu Thr Ala Arg Met Met 385 390 395 400 Asn Pro His Ile Val Pro Thr Leu Leu 405 <210> 9 <211> 3601 <212> DNA <213> Rice (Oryza sativa) <400> 9 gttggctagt ccaggactag agggtgcagt gcattcaatt gcttgcttcc tcttcctccc 60 ctcctccttc cccaaagcag caaggccagc ctgtgtttcc caaacaccca cagccatcac 120 ctcctcttct tcctctctgc agtaggggtg ctaggctagg gtagctagct agctaccatc 180 atcatgagct caatgccaca agaagccatt gctccccatc cttcctaacc ttcctgctgg 240 ttttgcaaac atcccacaca cacacaaagc agtgacagtg agtgccaatg ctgagctctt 300 gtggtggcca tggccatgga aatccaagaa gcttgcaaga agaacaccat ggcagatgtg 360 gtgagcagca aggtggagga ggaggaggag ggcaagagca agagcaagat gggttcttgg 420 tgagagaggc aagggcatcc ccaccatctc catcttcttc atcatttctt ggatccacaa 480 gctcttcttg ttctggagga ggaggaggag ggcagatgtt gagcttctcc tcccccaatg 540 gaacagcagg tgagatgaac tgatgatgct gatgctgcag tgcaaagaac cagggaaaaa 600 aagatttatt tgcttttttt tttagtcttc tctggtgaat gtactgttgc atccgtggtg 660 tgtgtgtgtc tgtggggttt gatcgatccc cagctggtga ttgtttttgc ccatcatggt 720 ctgagagtct ctcatggcat catcctgcaa aagcccctgc ctttggggtc ttgtcaatag 780 caaaaggagg gctcttctct tgttattccc ctccacacac actcttttgc ttttcttgca 840 acccacctcc acctcaagga tgtgtcttgt ccccaaagat gtgagctttt tcttccccct 900 tcatcccaag aaaaaataaa gctaaagaag gcagcagcag cagcaagcac cgacttgtgt 960 tgtgctgctg tttccttaaa atcttgcatg tgttggaacc aggaaaccat acaccacatg 1020 ctcatgggca tctttggcat caggcctatt tgctcttctt ggctttagta gtgagtactt 1080 catcatttgt gctcatcagt tttgcttgtg ttgtgatgaa gggttgggct tgagctcagg 1140 aggaagcatg cagggggtct tggcaagggt cagggggccg ttcaccccaa cacagtggat 1200 ggagctggag caccaggcac tgatctacaa gcacattgct gcaaatgttt ctgtcccttc 1260 cagcttgctc ctccccatca ggagaagcct ccatccatgg ggtactacct tttttattca 1320 gctcatgtga ttgttatct gttctgcgtc atatcccctt tctgttgtaa atagctcaag 1380 ataggaataa aggaataagt acttagaaaa tatgaaagaa gaaaatgcag gtcatatggt 1440 tgcagttgcc tgttagtttc agatgtataa aggtgtccca gattggggtt ctgttgtgtt 1500 gaggttggta gttatatctt gttgtctttc ttgggacagg atggctttgt gattaattag 1560 1620 taggcattat aatgatttga agattgcatt gatactagaa atgtactgct tttggatgtt 1680 tgcatgatgc tcatgtgcta atatttccag ttaccaatgt ggtgcttctt gagtttagat 1740 ataaactct tctcttacat tgggattctg attttttttt agttgtgcct ctagtctttt 1800 ccacaacaag atctccaaat gtagtcataa agtgttctga ttccctttaa ctggcgtcat 1860 gtttggtatg tacaactaa gttcttatgc agacctggga ggaatgttgc tgaaatagtg 1920 caagaatata tcgttttgag gtggtttata tatttctgac atgaaatggg cattctattt 1980 tgcaccagga tggggatcat tccctcctgg ctgtgctgat gtagaaccca gaagatgccg 2040 ccgcacagac ggcaagaagt ggcggtgctc cagagatgct gttggggatc agaagtattg 2100 tgagcgacac ataaaccgtg gtcgccatcg ttcaagaaag catgtggaag gccgaaaggc 2160 gacactcacc attgcagaac catccacggt tattgctgct ggtgtatcat ctcgcggcca 2220 cactgtggct cggcagaagc aggtgaaagg ctcagctgct actgtctctg atcctttctc 2280 gagacaatcc aacaggtgaa gttgcctgat cctacatgaa tatgcatttt gtgcttcttg 2340 catgatgtgt ggacactgtg aggtggtctt tgtcaaaata aatgacatct gttgccgata 2400 gtaattta gtccagcatg tggtaatgga ggtgccaaat cctaacaacc tataagtaat 2460 ttatgtatgt atcaggattc taggcagcat aataaaacat ctaacaaata gatatgtac 2520 agaaaagtta agaatgaattt gaccaagcta gtgatatcaa tatacagtag gaaagtcctc 2580 acacaattat ttagtttgat tatactccag tttctgtgat tgcattagtc attcatttaa 2640 ttatgagtta atgtccctac aatgaactcc attttttctg ctctctctct ctctctcctt 2700 tgtaatgaag gaaattcatt tcttctttaa cctgctgcaa ttaacagaag gaaaatttgc 2760 2820 acgttgtcga ccaattgtct cccatggatt catttgattt ctcatccaca caatcttctc 2880 2940 acatcgggca tggagcaggc agttcatcag aaaaaggcag tatgatgtac gaaagtcggt 3000 taacagtctc taggaaaca cttgatgatg gacctttagg tgaagtttc aaaagaaaga 3060 attgccaatc agcttctaca gaaatcttaa ctgaaaaatg gactgagaac cccaacttac 3120 attgcccatc tggaatccta caaatggcta ctaagttcaa ttcaatttcc agcggcaaca 3180 footaatag tggtggcacc gcagtggaga atcttatcac tgataatgga tatcttactg 3240 caagaatgat gaatcctcat attgtcccaa cacttctcta aggctgtgtt tgaaagttca 3300 tgttggattc gcaaatgatt gaagtacgt ttatggatgg ttctataagt tcctgttgtt 3360 tccttcgtta tgtgttcttg tgttcctcac ctttttatct tttggttgag gttggtatgt 3420 tgtaattttc tcctgtgcta ccttgtaata tgctgaagtt aaatgctctt ctaaaaaattt 3480 ctgttgcaat ccaagattca ggatttatgt gtccaattct gaattttaat gaatcatgcc 3540 ccttaaatgt aaagggaatt gtatatttca ttaatttgac aaaaacgttg ccttctgctc 3600 c 3601 <210> 10 <211> 20 <212> RNA <213> Artificial sequence <400> 10 gcucauguug ggauuguggu 20
Claims
1. A method for improving agronomic traits of rice, characterized in that, include: Reduce the expression or activity of miR396 in rice, wherein miR396 is miR396e and miR396f; The improved rice agronomic traits refer to one or more agronomic traits of rice selected from the group below under low nitrogen conditions: (a) Yield and / or biomass; (b) Ear and / or grain development; (c) Particle length; (d) Particle width; (e) Ear length; (f) Thousand-grain weight; (g) Leaf length.
2. The use of a composition for improving agronomic traits of rice under low-nitrogen conditions, characterized in that, The composition comprises: (i) miR396 inhibitors, wherein the miR396 is miR396e and miR396f; and (ii) An agronomically acceptable carrier; Used to improve the agronomic traits of rice under low nitrogen conditions; The agronomic traits of the rice are selected from one or more of the following groups: (a) Yield and / or biomass; (b) Ear and / or grain development; (c) Particle length; (d) Particle width; (e) Ear length; (f) Thousand-grain weight; (g) Leaf length.
Citation Information
Patent Citations
Gene capable of increasing nitrogen fertilizer utilization efficiency and yield of rice and application thereof
CN107937416A
Application of miR396e and miR396f in regulation and control of plant type, panicle type and grain weight of rice
CN108660245A