Viral vector production

Abstract

An enveloped viral particle producer or packaging cell, wherein the cell is genetically engineered to reduce expression of CD47 on the surface of the cell.

Description

Field of the Invention

[0001] The present invention relates to cells that display reduced levels of surface-exposed antigens. More specifically, the present invention relates to the genetic engineering of cells to reduce expression of CD47 on the cell surface. In particular, the present invention relates to the use of such cells in the production of enveloped viral particles. Background of the Invention

[0003] Gene therapy involves the incorporation of genetic material into cells to treat or prevent disease. The genetic material can replace defective genes with functional copies of those genes, inactivate genes that are not functioning properly, or introduce genes that direct new functions into cells.

[0004] The delivery of genetic material to cells can be achieved by using vectors that facilitate nucleic acid transfer. Viruses can be engineered to deliver nucleic acids of interest (NOIs) to target cells and are commonly used as vectors in gene therapy. To date, viruses that have been used for gene therapy include retroviruses, adenoviruses (AdV), adeno-associated viruses (AAV), herpes simplex viruses (HSV), and vaccinia viruses.

[0005] Retroviruses, such as alpha-retroviruses, gamma-retroviruses, lentiviruses, and foamy viruses, are particularly useful for gene therapy because they allow stable integration of corrective genetic material into target cells. Therapeutic benefits have been achieved in clinical trials based on gamma-retrovirus-derived vectors for adenosine deaminase severe combined immunodeficiency (ADA-SCID; Aiuti, A. et al. (2009) N. Engl. J. Med. 360:447-58), X-linked severe combined immunodeficiency (SCID-X1; Hacein-Bey-Abina, S. et al. (2010) N. Engl. J. Med. 363:355-64), and Wiskott-Aldrich syndrome (WAS; Boztug, K. et al. (2010) N. Engl. J. Med. 363:1918-27). In addition, lentiviral vectors have been used as delivery vehicles for the treatment of X-linked adrenoleukodystrophy (ALD; Cartier, N. et al. (2009) Science 326:818-23), metachromatic leukodystrophy (MLD; Biffi, A. et al. (2013) Science 341:1233158), and WAS (Aiuti, A. et al. (2013) Science 341:1233151). In preclinical studies, lentiviral vectors have also been administered intravenously for liver-directed gene therapy of hemophilia in mouse and canine models of the disease (Cantore, A. et al. (2012) Blood; Matsui, H. et al. (2011) Mol Ther; Cantore, A. et al. (2015) Science Translational Medicine 7:277ra28).

[0006] Efforts have been made to obtain gene therapy vectors that can escape immune cell sensing in order to use them in stable gene replacement therapy strategies for genetic diseases. However, many applications of gene transfer vectors require efficient gene delivery to innate immune cells, for example, using vectors as oncolytic viruses (Lichty, BD et al. (2014) Nature Rev Cancer 14: 559-567) and for vaccination purposes (Rampling et al. (2015) NEJM).

[0007] Viral particle envelopes usually originate from the membrane of the producer cell. Thus, membrane proteins expressed on the cell membrane from which the viral particle buds off can be incorporated into the viral envelope. Such surface-exposed proteins can affect the utility of the viral particle as a gene therapy vector, for example by improving or preventing certain types of cell transduction, or by eliciting a harmful immune response against the viral particle or the cells they transduce. Conversely, for certain utilities, such as vaccination purposes, it can be desirable to stimulate the immune system.

[0008] Thus, there is a considerable need in the art for viral vector particles with improved cell transduction properties as well as stimulating or evading immune responses. SUMMARY

[0010] Surprisingly, the inventors found that the transfer of genes to professional phagocytes and antigen presenting cells (APCs) is limited by the presence of CD47 molecules on the LV particle.

[0011] By genetically disrupting the CD47 gene in the cells used to produce LV particles, the inventors were able to modify the protein composition of the LV envelope and obtain LV particles that lack human CD47 on their surface (CD47-null LVs). Surprisingly, the inventors have shown that the lack of surface-exposed CD47 molecules is not toxic to the cells and does not significantly affect the ability of these cells to produce enveloped viral particles.

[0012] Furthermore, the inventors have demonstrated that CD47-null LVs display retained infectivity and substantially increased susceptibility to phagocytosis. CD47-null LVs transduce professional phagocytes more efficiently ex vivo and in vivo compared to CD47-carrying LVs and induce substantially higher elevations in cytokine responses upon systemic administration to mice. CD47-null LVs improve the efficiency of gene transfer into human primary monocytes compared to previously available LVs and possess increased susceptibility to phagocytosis ex vivo by primary human macrophages and in vivo when systemically administered to mice.

[0013] Prior to the inventors' findings, with the many pathways involved in phagocytosis and viral vector uptake and entry, it was not clear that CD47-null LVs would display increased efficiency of gene transfer to APCs. Furthermore, it was not clear that the presence of CD47 signals on viral particles could negatively affect the interaction between VSV-G and its receptor on target cells.

[0014] Engineered CD47-negative cells can be used to produce LVs and other enveloped viral vector particles suitable, for example, for gene transfer into professional phagocytes for applications in vaccination, immunomodulation, and cancer immunotherapy. CD47-null LVs can be used to transfer genes into professional APCs, thereby expanding the applicability of LVs beyond genetic diseases to targeted immunotherapy strategies for cancer, infectious disease indications, and vaccination purposes. Indeed, the inventors have shown that, when administered in vivo, CD47-null LVs induce a greater release of cytokines and chemokines, which is crucial when the goal of therapy is to induce an immune response. CD47-null LVs can also be used to target macrophages when they are involved in infectious or immune-mediated diseases, such as HIV infection, inflammatory bowel disease, or other autoimmune or autoinflammatory diseases.

[0015] In one aspect, the invention provides enveloped viral particle producer cells, wherein the cells are genetically engineered to reduce the expression of CD47 on the cell surface.

[0016] In one aspect, the present invention provides enveloped viral particle packaging cells, wherein the cells are genetically engineered to reduce the expression of CD47 on the cell surface.

[0017] In one embodiment, the cell comprises a genetically engineered disruption of the gene encoding CD47. The cell may comprise a genetically engineered disruption in all copies of the gene encoding CD47.

[0018] The expression of CD47 on the surface of a cell can be reduced such that the cell is substantially devoid of surface-exposed CD47 molecules. In one embodiment, the cell does not comprise any surface-exposed CD47 molecules.

[0019] In one embodiment, the cell is further genetically engineered to reduce expression of MHC-I on the cell surface. In one embodiment, the cell comprises a genetically engineered disruption of a gene encoding β2-microglobulin. In one embodiment, the cell comprises a genetically engineered disruption of one or more genes encoding an MHC-I α chain. The cell may comprise a genetically engineered disruption in all copies of a gene encoding β2-microglobulin. The cell may comprise a genetically engineered disruption in all copies of a gene encoding an MHC-I α chain. The cell may comprise a genetically engineered disruption of a gene encoding β2-microglobulin and a genetically engineered disruption of a gene encoding an MHC-I α chain.

[0020] The expression of MHC-I on the cell surface can be reduced such that the cell is substantially devoid of surface-exposed MHC-I molecules. In one embodiment, the cell does not comprise any surface-exposed MHC-I molecules.

[0021] The term viral particle "producer cell" includes cells that produce viral particles following transient transfection, stable transfection, or vector transduction of all elements necessary for viral particle production, or any cell engineered to stably contain the elements necessary for viral particle production.

[0022] The term "packaging cell" includes cells that contain some or all of the elements necessary to package infectious recombinant viruses. Packaging cells may lack the recombinant viral vector genome. Typically, such packaging cells contain one or more vectors capable of expressing viral structural proteins. Cells that contain only certain elements required for producing enveloped viral particles can be used as intermediate reagents for generating viral particle producer cell lines by subsequent steps of transient transfection, transduction, or stable integration of each other required element. These intermediate reagents are encompassed by the term "packaging cell." The present invention also encompasses parental cells that are subsequently used to generate enveloped viral particle producers or packaging cell lines, in which the expression of CD47 on the cell surface has been reduced.

[0023] The viral particles referred to herein encompass replication-competent or replication-defective viruses, viral vectors derived therefrom, and may or may not contain a nucleic acid of interest.

[0024] In one embodiment, the enveloped virus particle producer or packaging cell is a HEK-293 cell or a derivative thereof. In one embodiment, the enveloped virus particle producer or packaging cell is a HEK-293T or HEK-293T-REx cell.

[0025] In one embodiment, the enveloped viral particle is a retroviral, herpes simplex virus, vaccinia virus, hepadnaviral, togavirus, flavivirus, arenavirus, coronavirus, orthomyxovirus, paramyxovirus, bunyaviral, bornaviral, rhabdoviral, or filoviral particle, or a viral particle derived therefrom.

[0026] In one embodiment, the enveloped viral particle is a retroviral, herpes simplex virus, or vaccinia virus particle, or a viral particle derived therefrom.

[0027] In a preferred embodiment, the enveloped viral particle is a lentiviral particle or a viral particle derived therefrom. In one embodiment, the enveloped viral particle is an HIV-1 particle or a viral particle derived therefrom.

[0028] In another aspect, the invention provides a population of enveloped viral particle producers or packaging cells of the invention.

[0029] In one embodiment, at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the cells in a population have been genetically engineered according to the present invention.

[0030] In another aspect, the present invention provides a parental cell for producing an enveloped viral particle producer or packaging cell line according to the present invention, wherein the parental cell is genetically engineered to reduce the expression of CD47 on the cell surface.

[0031] In another aspect, the present invention provides use of the enveloped virus particle producer cell of any one of the preceding items for producing enveloped virus particles.

[0032] In one embodiment, the enveloped viral vector particles comprise less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed CD47 molecules displayed on particles produced by enveloped viral particle producer cells in the absence of genetic engineering (but under otherwise substantially identical circumstances).

[0033] In one embodiment, the enveloped viral particle does not comprise any surface-exposed CD47 molecules. In one embodiment, the enveloped viral particle is substantially devoid of surface-exposed CD47 molecules.

[0034] In another aspect, the present invention provides a method for producing enveloped viral particles, the method comprising the steps of:

[0035] a) providing an enveloped viral particle producer cell according to the present invention; and

[0036] b) culturing the cells under conditions suitable for the production of enveloped viral particles.

[0037] In another aspect, the present invention provides enveloped virus particles obtainable by the enveloped virus particle production method of the present invention.

[0038] In one embodiment, the enveloped viral vector particles comprise less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed CD47 molecules displayed on particles produced by enveloped viral particle producer cells in the absence of genetic engineering (but under otherwise substantially identical circumstances).

[0039] In one embodiment, the enveloped viral particle does not comprise any surface-exposed CD47 molecules. In one embodiment, the enveloped viral particle is substantially devoid of surface-exposed CD47 molecules.

[0040] In one embodiment, the enveloped viral particle is a retrovirus, herpes simplex virus, vaccinia virus, hepadnavirus, togavirus, flavivirus, arenavirus, coronavirus, orthomyxovirus, paramyxovirus, bunyavirus, bornavirus, rhabdovirus, or filovirus particle, or a viral particle derived therefrom.

[0041] In one embodiment, the enveloped viral particle is a retroviral, herpes simplex virus, or vaccinia virus particle, or a viral particle derived therefrom.

[0042] In a preferred embodiment, the enveloped viral particle is a lentiviral particle or a viral particle derived therefrom. In one embodiment, the enveloped viral particle is an HIV-1 particle or a viral particle derived therefrom.

[0043] In one embodiment, the enveloped viral particles of the invention are used for protein transfer (Bobis-Wozowicz, S. et al. (2014) Sci Rep; Voelkel, C. et al. (2010) Proc Natl Acad Sci USA; Maetzig, T. et al. (2012) Curr Gene Ther).

[0044] In one embodiment, the enveloped viral particle comprises a nucleotide of interest (NOI).Preferably, the enveloped viral particle is an attenuated virus, such as a replication-defective virus.

[0045] In one embodiment, the enveloped viral particle comprises a transgene encoding a cytokine.

[0046] In another aspect, the invention provides a population of enveloped viral particles of the invention.

[0047] In one embodiment, at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the particles in the population are derived from the enveloped viral particle producer cells of the invention. In one embodiment, 100% of the particles in the population are derived from the enveloped viral particle producer cells of the invention. In one embodiment, the particles in the population contain substantially no surface-exposed CD47.

[0048] In another aspect, the present invention provides the use of the enveloped viral particle of the invention for transducing a macrophage, a phagocyte, an antigen presenting cell or a monocyte.

[0049] In another aspect, the present invention provides use of the enveloped viral particle of the invention for transducing hepatic macrophages.

[0050] In one embodiment, the enveloped viral particles are used to transduce macrophages, such as Kupffer cells. In one embodiment, the enveloped viral particles are used to transduce phagocytes. In one embodiment, the enveloped viral particles are used to transduce antigen presenting cells, such as dendritic cells, plasmacytoid dendritic cells (pDCs), or myeloid dendritic cells (myDCs). In one embodiment, the enveloped viral particles are used to transduce monocytes.

[0051] In one embodiment, the transduction is in vitro, ex vivo, or in vivo. In one embodiment, the transduction is in vitro. In one embodiment, the transduction is ex vivo.

[0052] In one embodiment, the enveloped viral particles are administered systemically to the subject.

[0053] In another aspect, the invention provides a cell transduced by the enveloped viral particle of the invention. The cell may be a mammalian cell, such as a primate cell or a human cell.

[0054] In one embodiment, the cell is a macrophage (e.g., Kupffer cell), a phagocyte, an antigen presenting cell (e.g., a dendritic cell, a plasmacytoid dendritic cell, pDC, or a myeloid dendritic cell, myDC), or a monocyte. In one embodiment, the cell is a hepatic macrophage.

[0055] In another aspect, the present invention provides a pharmaceutical composition comprising the enveloped virus particles or transduced cells of the present invention, and a pharmaceutically acceptable carrier, diluent or excipient.

[0056] In another aspect, the present invention provides an enveloped viral particle of the invention for use in therapy.The enveloped viral particle of the invention may be used in gene therapy.

[0057] In another aspect, the present invention provides a transduced cell of the invention for use in therapy.The transduced cell of the invention can be used in gene therapy.

[0058] In another aspect, the present invention provides an enveloped viral particle of the present invention for use in treating or preventing cancer. In another aspect, the present invention provides an enveloped viral particle of the present invention for use in treating or preventing bacterial or viral infections. In another aspect, the present invention provides an enveloped viral particle of the present invention for use in treating or preventing immune-mediated diseases or autoimmune diseases.

[0059] In another aspect, the present invention provides transduced cells of the present invention for use in treating or preventing cancer. In another aspect, the present invention provides transduced cells of the present invention for use in treating or preventing bacterial or viral infections. In another aspect, the present invention provides transduced cells of the present invention for use in treating or preventing immune-mediated diseases or autoimmune diseases.

[0060] In another aspect, the present invention provides an enveloped viral particle of the invention for use in vaccination or gene therapy, preferably for the treatment or prevention of cancer, bacterial or viral infection, immune-mediated disease or autoimmune disease.

[0061] In another aspect, the present invention provides the transduced cells of the invention for use in vaccination or gene therapy, preferably for the treatment or prevention of cancer, bacterial or viral infection, immune-mediated disease or autoimmune disease.

[0062] In another aspect, the invention provides a method of treating cancer, a bacterial or viral infection, an immune-mediated disease, or an autoimmune disease comprising transducing a cell with an enveloped viral particle of the invention.

[0063] In one embodiment, the transduction is in vitro, ex vivo, or in vivo. In one embodiment, the transduction is in vitro. In one embodiment, the transduction is ex vivo.

[0064] In another aspect, the invention provides a method of treating cancer, a bacterial or viral infection, an immune-mediated disease, or an autoimmune disease, comprising administering an enveloped viral particle or cell of the invention to a subject in need thereof.

[0065] In one embodiment, the enveloped viral particles are administered systemically to the subject.

[0066] In another aspect, the present invention provides an enveloped viral particle of the invention for use as a vaccine.

[0067] In another aspect, the present invention provides a method of vaccination comprising administering an enveloped viral particle of the present invention to a subject in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1

[0070] Generation and characterization of CD47-negative producer cells. (a) Flow cytometric analysis of unstained, untreated, CRISPR / Cas9-treated, CD47-negative, or CD47-positive sorted (as indicated) 293T cells 3 days after sorting (outline plot with outliers). (b) Percentage of CD47-negative cells (white bars) and alleles with indels (NHEJ, black bars) in 293T cells transiently transfected with 3 different sgRNAs (A, B, or C) and the indicated amounts of Cas9 and sgRNA expression plasmids 1 week after transfection. (ce) (c) Mean and SEM of infectious titers (TU / mL); (d) Physical particles (ng p24 / mL); and (e) Specific infectivity (TU / ng p24) of LVs produced by CD47-positive (black bars, n=3) or CD47-negative (white bars, n=3) 293T cells, as indicated. There were no significant differences by Mann-Whitney test.

[0071] Figure 2

[0072] Generation, imaging, and in vitro evaluation of CD47-null LVs. (ac) Representative micrographs (a) and quantitative analysis (c, d) of LV batches generated from control (LV, black circles), CD47-overexpressing (CD47hi LV, black squares), or CD47-negative 293T cells (CD47-null LV, white circles), immunostained with anti-CD47 (b) or anti-VSV.G (c) antibodies as indicated, or as a staining control without primary antibody (control, black triangles), and analyzed by electron microscopy (n = 41-70 virions per sample). Kruskal-Wallis test with Dunn's multiple comparison test. (d) Single values ​​and mean with SEM of VCN in 293T cells and primary human macrophages (n = 6 for 293T cells and n = 15 for macrophages) transduced at an MOI of 10 with LV (black circles) or LV without CD47 (white circles) and analyzed 3 days after transduction (two independent experiments using five different healthy blood donors). (e) Single values ​​and mean with SEM of the percentage of GFP-positive cells in 293T cells and primary human dendritic cells (n = 3-4 for 293T cells and n = 8-11 for dendritic cells) transduced at an MOI of 3 with LV (black circles) or LV without CD47 (white circles) and analyzed 3 days after transduction. Note that dendritic cells were transduced on day 2 of the differentiation protocol starting from human primary monocytes. Mann-Whitney test. (f) Mean and SEM of the percentage of primary human macrophages analyzed by ImageStream after incubation with LV (black dots) or LV without CD47 (white dots) and single values, showing the number of LV dots indicated on the x-axis (8 independent experiments performed with macrophages derived from 11 different normal donors). Wilcoxon matched pairs test. VSV.G: vesicular stomatitis virus G protein.

[0073] Figure 3

[0074] In vivo evaluation of CD47-deficient LVs. (ac) 1.2-2×10 10Single values ​​and mean with SEM of VCN in FACS-sorted hepatocytes (Hep), liver sinusoidal endothelial cells (LSEC), Kupffer cells (KC), or plasmacytoid dendritic cells (pDC) and whole spleen (as indicated) from C57 BL / 6 hemophilia B (n=5-9, black stars) or NOD (n=5-11, black circles) mice injected with LV (a) or CD47-deficient LV (b) (n=11-16, n=4 for pDC). VCN was measured 2 months after LV administration. Mann-Whitney test. In (c), we report the same data sets shown in (a) (LV-treated NOD mice) and (b) (CD47-deficient LV-treated NOD mice), but plotted together here to directly compare LV and CD47-deficient LV in the same mouse strain (NOD).

[0075] Figure 4

[0076] Administration of CD47-deficient LV results in a higher proinflammatory cytokine response. (af) Mean and SEM values ​​for (al) IL-6 (a, g), MCP-1 (b, h), MIP-1α (c, i), MIP-1β (d, j), CXCL1 (e, k), and G-CSF (f, l) concentrations in NOD mouse serum at the indicated times (hours) after administration of LV (black circles) or CD47-deficient LV (white circles) or at peak (gl, 3 hours after LV administration). Dashed lines show mean concentrations for the untreated group. Kruskal-Wallis test with Dunn's multiple comparison test.

[0077] Figure 5

[0078] In vivo imaging of LV, CD47hi, or CD47-null LV uptake by hepatic Kupffer cells (KCs) in mice. (a) Intravital 2-photon microscopy images of 8–12 z-stacks spaced 4 μm apart from each other from the livers of C57BL / 6 or NOD mice treated with GFP-labeled LV, CD47hi, or CD47-null LV at the indicated times (minutes, LV intravenous injection started at 2 minutes). KCs are shown in white. LV-positive KCs are marked with asterisks. (b) Percentage of LV-positive KCs over time in C57BL / 6 or NOD mice treated with LV, CD47hi, or CD47-null LV, as indicated.

[0079] Figure 6

[0080] LV-based interferon delivery to the liver. Gene expression analysis by TaqMan shows the expression of a panel of genes in the total liver of mice that were untreated or treated with the indicated doses of the LV-based IFNα delivery platform. Fold changes relative to untreated controls are shown. Detailed Description of the Invention

[0082] As used herein, the term "comprising" is synonymous with "including" or "containing" and is inclusive or open-ended and does not exclude other unrecited members, elements or steps. The term "comprising" also includes the term "consisting of.

[0083] In one aspect, the invention provides enveloped viral particle producer or packaging cells, wherein the cells are genetically engineered to reduce expression of CD47 on the cell surface.

[0084] Reduced expression of CD47 on the surface of a cell means that the number of CD47 molecules expressed on the surface of a genetically engineered cell is reduced compared to the number of CD47 molecules expressed on the surface of a cell lacking genetic engineering but under otherwise substantially identical conditions.

[0085] The expression of CD47 on the surface of a cell can be reduced such that, for example, the number of surface-exposed CD47 molecules is less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% of the number of surface-exposed CD47 molecules displayed in the absence of genetic engineering. In one embodiment, the expression of CD47 on the surface of a cell is reduced such that the number of surface-exposed CD47 molecules is less than 0% of the number of surface-exposed CD47 molecules displayed in the absence of genetic engineering.

[0086] Preferably, the expression of CD47 on the surface of a cell is reduced such that the cell is substantially devoid of surface-exposed CD47 molecules.

[0087] As used herein, the term "substantially lacking" means that the number of CD47 molecules expressed on the surface of a cell that has been genetically engineered is greatly reduced compared to the number of CD47 molecules expressed on the surface of a cell lacking the genetic engineering (but under otherwise substantially identical conditions), such that the enveloped viral particles produced by the cell exhibit a therapeutically useful increase in the ability to transduce macrophages, phagocytes, antigen-presenting cells and / or monocytes and / or induce a cytokine response upon systemic administration.

[0088] In another aspect, the invention provides enveloped viral particle producer or packaging cells, wherein the cells comprise a genetically engineered disruption of the gene encoding CD47.

[0089] In one embodiment, the cell is further genetically engineered to reduce expression of MHC-I on the cell surface.

[0090] In one embodiment, the cell further comprises a genetically engineered disruption of a gene encoding beta 2-microglobulin.

[0091] In one embodiment, the cell further comprises one or more genetically engineered disruptions of a gene encoding an MHC-I alpha chain.

[0092] In one aspect, the present application provides a population of the enveloped viral particle producer or packaging cells of the present application.

[0093] Preferably, at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population do not comprise surface exposed CD47.

[0094] Preferably, at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population do not comprise surface exposed MHC-I.

[0095] Methods of quantifying protein expression of a cell surface exposed protein in a population of cells are known in the art. Suitable methods include flow cytometry, fluorescence activated cell sorting (FACS), and fluorescence microscopy.

[0096] For example, the population of cells can be contacted with an antibody specific for CD47 or MHC-I. The antibody can be labeled to enable it to be detected. The antibody can be directly conjugated to a reporter moiety, such as a fluorescent label. Alternatively, a secondary antibody conjugated to a reporter moiety and specific for the primary antibody can be contacted with the population of cells. Suitable reporter moieties are known in the art and include, for example, Alexa Fluor and BODIPY-based fluorescent labels. Once the population of cells has been contacted with the antibody, the population can be analyzed using a technique suitable for quantifying protein expression on individual cells, such as flow cytometry. The analysis is performed without lysing the cells.

[0097] Methods for quantifying protein expression of a cell surface exposed protein can also enable sorting of the population of cells to produce a population of cells enriched for a particular characteristic (e.g., to produce a population of cells enriched for cells that do not comprise surface exposed CD47). For example, fluorescence activated cell sorting (FACS) enables such enrichment.

[0098] Similar methods can be applied to quantify protein expression of a cell surface exposed protein on a single cell. For example, the methods can employ microfluidic methods.

[0099] Cluster of differentiation 47 (CD47)

[0100] Cluster of differentiation 47 (CD47; also known as integrin-associated protein, IAP) is a transmembrane protein belonging to the immunoglobulin superfamily. CD47 binds to thrombospondin-1 (TSP-1) and signal regulatory protein alpha (SIRPα) and functions as a signaling agent in macrophages.

[0101] An example of the amino acid sequence of human CD47 is:

[0102]

[0103] Additional examples of amino acids for human CD47 are:

[0104]

[0105] Additional examples of amino acids for human CD47 are:

[0106]

[0107] Additional examples of amino acids for human CD47 are:

[0108]

[0109] Additional examples of amino acids for human CD47 are:

[0110]

[0111] Genetic engineering of CD47

[0112] The enveloped virus particle producer or packaging cell of the present invention is genetically engineered to reduce the expression of CD47 on the cell surface.

[0113] Genetic engineering is known in the art to reduce the method for protein expression.For example, this can be achieved by targeted gene knockout.In order to reduce protein expression, the gene encoding the protein itself or its regulatory sequence (such as its promoter) can be knocked out.Knockout can be achieved by deleting a part of the coding nucleic acid sequence, which can delete a part of the protein necessary for expression or stability, or change the reading frame of the coding sequence. Suitable methods for targeted gene knockout include the use of zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and RNA-guided nucleases based on CRISPR / Cas (Gaj, T. et al. (2013) Trends Biotechnol. 31: 397–405).

[0114] For example, if a CRISPR / Cas9 RNA-guided nuclease is provided with an appropriate RNA guide designed to bind to a specific locus, it can be used to catalyze double-strand breaks at that specific locus in the genome. Cas9 and guide RNA can be delivered to target cells by transfecting vectors encoding the protein and RNA. The cell attempts to repair any double-strand breaks in its DNA using the non-homologous end joining (NHEJ) pathway. This is an error-prone mechanism that inserts random nucleotides and often disrupts the reading frame of the targeted gene.

[0115] Alternatively, genetic engineering to reduce protein expression can be accomplished using RNAi technology or microRNA or antisense RNA to inhibit expression of the target gene.

[0116] Once targeted gene knockout or expression inhibition methods have been performed, the resulting cell populations can be screened to select and enrich for cells that exhibit a phenotype of interest, such as reduced expression of surface-exposed CD47. Suitable techniques for screening and enrichment are known in the art and include flow cytometry and fluorescence-activated cell sorting (FACS).

[0117] The cells may contain a genetically engineered disruption in all copies of the gene encoding CD47.

[0118] Major histocompatibility complex class I

[0119] The major histocompatibility complex class I (MHC-I) is a heterodimeric membrane protein displayed on the outer leaflet of the cell membrane (Penn, DJ (2002) Major Histocompatibility Complex (MHC) eLS, John Wiley & Sons, http: / / www.els.net / [DOI:10.1038 / npg.els.0000919]). The function of MHC-I is to bind and display peptide fragments of proteins to the extracellular environment, where they can be detected by CD8 + Cytotoxic T cell recognition. Due to central and peripheral tolerance mechanisms, peptide fragments produced from normal cell proteins will not activate cytotoxic T cells. However, foreign peptides (such as those derived from viral proteins) will cause the activation of an immune response to destroy cells.

[0120] The immune system can recognize allogeneic MHC-I proteins themselves. For example, antibodies can directly bind to MHC-I epitopes. Therefore, cells and enveloped viruses containing MHC-I proteins derived from allogeneic sources can be targeted and neutralized by the immune system.

[0121] Human MHC-I, also known as human leukocyte antigen class I (HLA-I), is expressed on nearly all nucleated cells. HLA-I consists of two polypeptide chains: the HLA-I heavy chain (α chain) and β2 microglobulin (β2M). The HLA-I α chain and β2M are non-covalently linked.

[0122] The HLA-I α chain is polymorphic. To date, six HLA-I α chains have been identified, including three classical highly polymorphic α chains (HLA-A, HLA-B, and HLA-C) and three non-classical less polymorphic α chains (HLA-E, HLA-F, and HLA-G). A skilled person will be able to easily determine the nucleic acid sequence of the HLA-I α chain. For example, HLA-I α chains can be identified in genomic sequences using their location within the major histocompatibility complex region of the chromosome (Penn, DJ (2002) Major Histocompatibility Complex (MHC) eLS, John Wiley & Sons, http: / / www.els.net / [DOI:10.1038 / npg.els.0000919]).

[0123] Nucleic acid sequences encoding β2M are known in the art. For example, the nucleic acid sequence of human β2M is deposited under GenBank accession number NM_004048.

[0124] The skilled artisan will appreciate that the present invention is applicable to variants of MHC-I sequences, such as polymorphisms of these sequences (e.g., HLA-I α chain sequences and β2M sequences). For example, a variant of an MHC-I sequence may comprise a single nucleotide polymorphism (SNP) or multiple SNPs.

[0125] In one embodiment, the enveloped viral particle producer or packaging cell comprises a genetically engineered disruption of the gene encoding β2-microglobulin. β2-microglobulin stabilizes MHC-I, and thus cells lacking β2-microglobulin exhibit reduced MHC-I expression on the cell surface. The cell may comprise a genetically engineered disruption in all copies of the gene encoding β2-microglobulin.

[0126] In another embodiment, the cell comprises a genetically engineered disruption of the gene encoding the MHC-I alpha chain.The cell may comprise a genetically engineered disruption in all copies of the gene encoding the MHC-I alpha chain.

[0127] The cell can include a genetically engineered disruption of the gene encoding β2-microglobulin and a genetically engineered disruption of the gene encoding the MHC-I α chain.

[0128] carrier

[0129] A vector is a tool that allows or facilitates the transfer of an entity from one environment to another. The viral particle of the present invention may be a vector.

[0130] The viral vector particles of the present invention are enveloped viral particles.

[0131] Enveloped virus particles comprise an outer lipid bilayer membrane. Many enveloped viruses are known in the art, including retroviruses, herpes simplex viruses, vaccinia viruses, hepadnaviruses, togaviruses, flaviviruses, arenaviruses, coronaviruses, orthomyxoviruses, paramyxoviruses, bunyaviruses, bornaviruses, rhabdoviruses, and filoviruses.

[0132] The enveloped viral particles of the present invention can be, for example, retroviral, herpes simplex, vaccinia, hepadnaviral, togaviral, flaviviral, arenaviral, coronavirus, orthomyxoviral, paramyxoviral, bunyaviral, bornaviral, rhabdoviral, or filoviral particles or viral particles derived therefrom. As used herein, the term "derived from" can refer, for example, to the incorporation of at least one component that is derivable from a certain type of virus.

[0133] Retroviral and lentiviral vectors

[0134] Retroviral vectors can be derived from or can be derived from any suitable retrovirus. Many different retroviruses have been identified. Examples include murine leukemia virus (MLV), human T-cell leukemia virus (HTLV), mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), avian myelocytomatosis virus 29 (MC29) and avian erythroblastosis virus (AEV). A detailed list of retroviruses can be found in Coffin, JM et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63.

[0135] Retroviruses can be broadly divided into two categories, "simple" and "complex." Retroviruses can be further divided into seven groups. Five of these groups represent retroviruses with oncogenic potential. The remaining two groups are lentiviruses and foamy viruses. A review of these retroviruses is presented in Coffin, J. M. et al. (1997) Retroviruses, Cold Spring Harbor Laboratory Press, 758-63.

[0136] The basic structure of retroviral and lentiviral genomes shares many features, such as the 5' long terminal repeat (LTR) and the 3' LTR. Within and between these are packaging signals that enable genome packaging, primer binding sites, integration sites that enable integration into the host cell genome, and the gag, pol, and env genes that encode packaging components—polypeptides required for viral particle assembly. Lentiviruses possess additional features, such as the rev and RRE sequences found in HIV, which enable efficient export of the integrated proviral RNA transcript from the nucleus to the cytoplasm of infected target cells.

[0137] In the provirus, these genes are flanked on both ends by regions called LTRs. LTRs are responsible for proviral integration and transcription. LTRs can also act as enhancer-promoter sequences and can control the expression of viral genes.

[0138] The LTRs themselves are identical sequences, but they can be divided into three elements: U3, R, and U5. U3 is derived from a unique sequence at the 3' end of the RNA. R is derived from a sequence repeated at both ends of the RNA. U5 is derived from a unique sequence at the 5' end of the RNA. The sizes of these three elements can vary considerably between different retroviruses.

[0139] In a defective retroviral vector genome, gag, pol and env may be absent or non-functional.

[0140] In a typical retroviral vector, at least a portion of one or more protein coding regions necessary for replication can be removed from the virus. This renders the viral vector replication-defective. Portions of the viral genome can also be replaced with a library of candidate regulatory portions encoding regulatory control regions and reporter portions operably linked to the vector genome to produce a vector comprising candidate regulatory portions capable of transducing a target host cell and / or integrating its genome into the host genome.

[0141] Lentiviral vectors are part of a large number of retroviral vectors. A detailed list of lentiviruses can be found in Coffin, JM et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63. In short, lentiviruses can be divided into primate and non-primate groups. Examples of primate lentiviruses include, but are not limited to, human immunodeficiency virus (HIV), the causative agent of human acquired immunodeficiency syndrome (AIDS); and simian immunodeficiency virus (SIV). Examples of non-primate lentiviruses include the prototype "lentivirus" visna / maedi virus (VMV), and the related caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and the recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

[0142] The lentivirus family differs from the retrovirus family in that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis, P et al. (1992) EMBO J. 11: 3053-8; Lewis, P F et al. (1994) J. Virol. 68: 510-6). In contrast, other retroviruses (e.g., MLV) are unable to infect non-dividing or slowly dividing cells, such as those that make up muscle, brain, lung, and liver tissue.

[0143] As used herein, a lentiviral vector is a vector comprising at least one component that can be derived from a lentivirus. Preferably, the component is involved in the biological mechanism by which the vector infects cells, expresses genes, or is replicated.

[0144] The lentiviral vector may be a "primate" vector. The lentiviral vector may be a "non-primate" vector (i.e., derived from a virus that does not primarily infect primates, particularly humans). Examples of non-primate lentiviruses may be any member of the family Lentiviridae that does not naturally infect primates.

[0145] As examples of lentivirus-based vectors, HIV-1 and HIV-2-based vectors are described below.

[0146] HIV-1 vectors contain cis-acting elements also found in simple retroviruses. It has been shown that sequences extending into the gag open reading frame are important for packaging HIV-1. Therefore, HIV-1 vectors typically contain the relevant portion of gag in which the translation start codon has mutated. In addition, most HIV-1 vectors also contain a portion of the env gene, which includes RRE. Rev binds to RRE, which allows full-length or single-spliced ​​mRNA to be transported from the nucleus to the cytoplasm. In the absence of Rev and / or RRE, full-length HIV-1 RNA accumulates in the nucleus. Alternatively, constitutive transport elements from certain simple retroviruses (e.g., Mason-Pfizer monkey virus) can be used to alleviate the need for Rev and RRE. Efficient transcription from the HIV-1 LTR promoter requires the viral protein Tat.

[0147] Most HIV-2-based vectors are structurally very similar to HIV-1 vectors. Similar to HIV-1-based vectors, HIV-2 vectors also require the RRE for efficient transport of full-length or singly spliced ​​viral RNA.

[0148] In one system, the vector and helper constructs are derived from two different viruses, and reduced nucleotide homology can reduce the likelihood of recombination. In addition to primate lentivirus-based vectors, FIV-based vectors have also been developed as an alternative to vectors derived from the pathogenic HIV-1 genome. The structure of these vectors is also similar to that of HIV-1-based vectors.

[0149] Preferably, the viral vector used in the present invention has a minimal viral genome.

[0150] By "minimal viral genome," it is understood that the viral vector has been manipulated to remove non-essential elements and retain essential elements to provide the functionality required for infection, transduction, and delivery of the nucleotide sequence of interest to the target host cell. Further details of this strategy can be found in WO 1998 / 017815.

[0151] Preferably, the plasmid vector used to produce the viral genome in the host cell / packaging cell will have sufficient lentiviral genetic information to allow the RNA genome to be packaged into viral particles in the presence of packaging components, which are capable of infecting target cells but are unable to replicate independently to produce infectious viral particles in the final target cell. Preferably, the vector lacks functional gag-pol and / or env genes and / or other genes essential for replication.

[0152] However, the plasmid vector used to produce the viral genome in the host cell / packaging cell will also include transcriptional regulatory sequences operably linked to the lentiviral genome to direct transcription of the genome in the host cell / packaging cell. These regulatory sequences can be native sequences associated with the transcribed viral sequence (i.e., the 5' U3 region), or they can be a heterologous promoter, such as another viral promoter (e.g., the CMV promoter).

[0153] The vector can be a self-inactivating (SIN) vector in which the viral enhancer and promoter sequences have been deleted. SIN vectors can be generated and transduce non-dividing cells in vivo with an efficacy similar to that of wild-type vectors. Transcriptional inactivation of the long terminal repeat (LTR) in the SIN provirus should prevent the mobilization of replication-competent virus. This should also enable gene expression regulated by internal promoters by eliminating any cis-action of the LTR.

[0154] The vector may be integration-defective. Integration-defective lentiviral vectors (IDLVs) can be generated, for example, by packaging the vector with a catalytically inactive integrase (e.g., HIV integrase with a D64V mutation in the catalytic site; Naldini, L. et al. (1996) Science 272:263-7; Naldini, L. et al. (1996) Proc. Natl. Acad. Sci. USA 93:11382-8; Leavitt, AD et al. (1996) J. Virol. 70:721-8) or by modifying or deleting essential att sequences from the LTR of the vector (Nightingale, SJ et al. (2006) Mol. Ther. 13:1121-32), or by a combination of the foregoing.

[0155] HIV-derived vectors

[0156] There are no particular limitations on the HIV-derived vectors used in the present invention with respect to HIV strains. Many examples of HIV strain sequences can be found in the HIV sequence database (http: / / www.hiv.lanl.gov / content / index).

[0157] Herpes simplex virus (HSV)-derived vectors

[0158] Herpes simplex virus (HSV) is an enveloped, double-stranded DNA virus that naturally infects neurons. HSV can accommodate large amounts of foreign DNA, making it an attractive vector system, and it has been used as a vehicle for delivering genes to neurons.

[0159] The use of HSV in therapeutic procedures requires that the strains be attenuated so that they cannot establish a lytic cycle. Specifically, if HSV vectors are to be used for gene therapy in humans, it is preferred that the NOI be inserted into an essential gene. This is necessary because if the vector virus encounters a wild-type virus, the heterologous gene can be transferred to the wild-type virus via recombination. However, as long as the NOI is inserted into an essential gene, recombination transfer will also delete the essential gene in the recipient virus and prevent the heterologous gene from "escaping" into the replication-competent wild-type virus population.

[0160] Vaccinia virus-derived vectors

[0161] Vaccinia virus is a large, enveloped virus with a linear, double-stranded DNA genome of approximately 190 kb. Vaccinia virus can accommodate up to approximately 25 kb of foreign DNA, making it useful for delivering large genes.

[0162] Many attenuated vaccinia virus strains suitable for gene therapy applications are known in the art, such as the MVA and NYVAC strains.

[0163] Virus particle production

[0164] In one aspect, the present invention provides use of an enveloped viral particle producer cell of the invention for producing enveloped viral particles.

[0165] In one embodiment, the enveloped viral particles each comprise fewer than 10, 5, 4, 3, 2, or 1 surface-exposed CD47 molecules.

[0166] In one embodiment, the enveloped viral particles each contain fewer than 10 surface-exposed CD47 molecules. In one embodiment, the enveloped viral particles each contain fewer than 5 surface-exposed CD47 molecules. In one embodiment, the enveloped viral particles each contain fewer than 2 surface-exposed CD47 molecules.

[0167] In one embodiment, the enveloped viral particle does not comprise any surface-exposed CD47 molecules.

[0168] In one embodiment, the enveloped viral particle comprises less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed CD47 molecules displayed on particles produced by the enveloped viral particle producer cell in the absence of genetic engineering (but under otherwise substantially identical circumstances). In another embodiment, the enveloped viral particle is substantially devoid of surface-exposed CD47 molecules.

[0169] In one embodiment, the enveloped viral particle comprises less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed MHC-I molecules displayed on particles produced by the enveloped viral particle producer cell in the absence of genetic engineering (but under otherwise substantially identical conditions). In another embodiment, the enveloped viral particle is substantially devoid of surface-exposed MHC-I molecules.

[0170] Methods for quantifying the number of surface-exposed proteins on viral particles are known in the art. Suitable methods include electron microscopy.

[0171] For example, a sample of viral particles can be adsorbed onto an electron microscopy grid (e.g., as disclosed in the Examples) and fixed thereto using paraformaldehyde. The sample can then be incubated with a primary antibody specific for a protein of interest (e.g., CD47), followed by incubation with a secondary antibody conjugated to gold particles specific for the primary antibody, followed by another fixation step using paraformaldehyde. The sample can then be visualized using an electron microscope, and the gold particles counted to quantify the number of surface-exposed proteins of interest.

[0172] Enveloped viral particle producer cells may contain the viral genome.

[0173] The viral genome is the nucleic acid sequence incorporated into the viral particle.The viral genome can be engineered to contain a nucleotide of interest (NOI).

[0174] Thus, for use in producing viral particles, enveloped viral particle producer cells can contain the viral genome and then be cultured under conditions suitable for the production of enveloped viral particles.

[0175] An "enveloped viral particle packaging cell" may, for example, contain nucleic acid sequences encoding some or all of the structural proteins required for viral particle assembly.

[0176] Cells containing only certain elements required for enveloped viral particle production can be used as intermediates for generating viral particle producer cell lines by subsequent steps of transient transfection, transduction, or stable integration of each other required element. These intermediates are encompassed by the packaging cells of the present invention. Parental cells (in which expression of CD47 on the cell surface has been reduced) that are subsequently used to generate enveloped viral particle producer or packaging cell lines represent another embodiment of the present invention.

[0177] The nucleic acid sequences encoding the components required to produce infectious enveloped viral particles can be transiently transfected or transduced into packaging or producer cells or stably maintained within packaging or producer cells (e.g., stably integrated into the cell genome or maintained episomally). Alternatively, a combination of transient transfection or transduction and stable maintenance can be used to introduce nucleic acid sequences into cells.

[0178] Thus, the cells of the present invention can be transfected or transduced with a nucleic acid comprising a viral genome or engineered to stably integrate the nucleic acid comprising a viral genome by targeted integration to achieve the production of enveloped viral particles comprising the viral genome.

[0179] Nucleic acid sequences encoding the different components required for production of infectious enveloped viral particles can be provided to the cell as separate expression cassettes.

[0180] In one embodiment, the packaging cells of the present invention comprise nucleic acid sequences encoding Gag, Gag / Pol and / or Env proteins or functional substitutes thereof. The cells may optionally comprise nucleic acid sequences encoding other proteins that may be required for assembly of retroviral vector particles, such as Rev protein.

[0181] The enveloped virus particle producer or packaging cell can be any suitable cell type capable of producing or packaging enveloped virus particles. The cell is preferably a mammalian cell, particularly a human cell. For example, the enveloped virus particle producer cell can be derived from a parent HEK-293 cell.

[0182] Nucleotide of interest

[0183] The viral particles of the invention may comprise a nucleotide of interest (NOI).

[0184] Preferably, the nucleotide of interest produces a therapeutic effect.

[0185] Suitable NOIs include, but are not limited to, encoding enzymes, cytokines, chemokines, hormones, antibodies, antioxidant molecules, engineered immunoglobulin-like molecules, single-chain antibodies, fusion proteins, immune co-stimulatory molecules, immunomodulatory molecules, antisense RNA, microRNA, shRNA, siRNA, ribozymes, miRNA target sequences, transdomain negative mutants of target proteins, toxins, conditional toxins, antigens, viral proteins, bacterial proteins, tumor suppressor proteins, growth factors, transcription factors, membrane proteins, surface receptors, anticancer molecules, vasoactive proteins and peptides, antiviral proteins and ribozymes and derivatives thereof (e.g., derivatives with associated reporter groups). NOIs may also encode prodrug activating enzymes.

[0186] In one embodiment, the enveloped viral particle comprises a transgene encoding a cytokine. In one embodiment, the enveloped viral particle comprises a transgene encoding an interferon, preferably an interferon-alpha. The present invention can achieve delivery of one or more cytokines to liver macrophages to treat or prevent cancer, such as metastasis. The present invention can achieve delivery of interferons (e.g., interferon-alpha) to the liver, such as liver macrophages.

[0187] Another example of an NOI is coagulation factor VIII or coagulation factor IX or an engineered derivative thereof which may be used in gene therapy for hemophilia, or a beta-globin chain which may be used in gene therapy for thalassemia / sickle cell disease.

[0188] Suitable proteins that can be transferred via viral vector protein transfer include, but are not limited to, nucleases, integrases, transposases, enzymes, cytokines, chemokines, hormones, antibodies, antioxidant molecules, engineered immunoglobulin-like molecules, single-chain antibodies, fusion proteins, immune co-stimulatory molecules, immune modulatory molecules, cross-domain negative mutations of target proteins, toxins, conditional toxins, antigens, viral proteins, bacterial proteins, tumor suppressor proteins, growth factors, transcription factors, membrane proteins, surface receptors, anti-cancer molecules, vasoactive proteins and peptides, antiviral proteins and ribozymes and derivatives thereof (e.g., derivatives with associated reporter groups).

[0189] Pharmaceutical composition

[0190] The enveloped viral particles or transduced cells of the invention can be formulated for administration to a subject together with a pharmaceutically acceptable carrier, diluent or excipient. Suitable carriers and diluents include isotonic saline solutions, such as phosphate buffered saline, and potentially containing human serum albumin.

[0191] Preferably, the processing of cell therapy products is carried out according to the FACT-JACIE international cell therapy standards.

[0192] Gene therapy

[0193] In one aspect, the invention provides enveloped viral particles and transduced cells for use in therapy, such as gene therapy. The enveloped viral particles may be referred to as enveloped viral vector particles.

[0194] "Transduced cells" or cells that have been "transduced by enveloped viral vector particles" are understood to mean cells into which the nucleic acid (eg, comprising NOI) carried by the enveloped viral vector particles has been transferred. The transduced cells are preferably target cells.

[0195] The enveloped viral vector particles of the present invention can be administered directly (e.g., systemically) to a subject. The viral vector particles can be engineered to target infection to specific cells in the subject. The viral vector particles can also be engineered to target expression of the NOI to specific cells in the subject. This can be achieved using tissue-specific promoters or nucleic acid sequences that help inhibit expression of the NOI in specific cells.

[0196] Enveloped viral vector particles can also be used to transduce cells that have been removed from a subject as part of an ex vivo gene therapy approach.

[0197] The transduced cells can be administered as part of an autologous cell transplant procedure or as part of an allogeneic cell transplant procedure.

[0198] An "autologous stem cell transplant procedure" is understood to mean that the starting cell population (which is then transduced with the enveloped viral vector particles of the invention) is obtained from the same subject to whom the transduced cell population is administered. Autologous transplant procedures are advantageous because they avoid problems associated with immunological incompatibility and can be used in subjects regardless of the availability of a genetically matched donor.

[0199] An "allogeneic cell transplant procedure" is understood to mean that the starting cell population (which is then transduced with the enveloped viral vector particles of the invention) is obtained from a subject different from the subject to whom the transduced cell population is administered. Preferably, the donor is genetically matched to the subject to whom the cells are administered to minimize the risk of immunological incompatibility.

[0200] For example, an appropriate dose of enveloped viral vector particles or transduced cells should be effective in treatment and / or prevention. The dose to be administered may depend on the subject and the condition to be treated, and can be readily determined by a skilled person.

[0201] The viral vector particles of the present invention are able to transduce professional phagocytes and antigen presenting cells (APCs) with greater efficiency than viral particles that do not exhibit reduced levels of surface-exposed CD47.

[0202] The viral vector particles of the present invention can be used to transfer transgenes into cells such as phagocytes and APCs. The viral vector particles can be used to treat cancer, for example, through cancer immunotherapy or through direct anti-tumor effects. In addition, the viral vector particles can be used to treat infections, immune-mediated diseases, or autoimmune diseases. These effects can be achieved by transferring the transgene into APCs.

[0203] The viral vector particles of the present invention can be used to transfer antigens into APCs for immunization (vaccination) or immunomodulatory purposes.

[0204] The viral vector particles of the present invention can also be used to target macrophages. In one aspect, the present invention provides the use of the enveloped viral particles of the present invention for transducing hepatic macrophages. Preferably, the enveloped viral particles contain a transgene encoding a cytokine.

[0205] In another aspect, the present invention provides an enveloped viral particle or a transduced cell of the present invention for use in treating or preventing cancer, preferably liver cancer (eg liver metastasis). Preferably, the enveloped viral particle comprises a transgene encoding a cytokine.

[0206] The enveloped viral vector particles or transduced cells of the present invention can be used to treat genetic diseases, such as plasma protein deficiencies, metabolic disorders, lysosomal storage diseases, mucopolysaccharidoses, immunodeficiencies, blood disorders, including but not limited to hemophilia, severe combined immunodeficiency of adenosine deaminase, Wiskott-Aldrich syndrome, metachromatic leukodystrophy, globoid leukodystrophy, β-thalassemia, and chronic granulomatous disease.

[0207] The enveloped viral vector particles or transduced cells of the present invention can be used to treat the conditions listed in WO 1998 / 005635. For ease of reference, a portion of the list is now provided: cancer, inflammation or inflammatory diseases, skin disorders, fever, cardiovascular effects, bleeding, coagulation and acute phase reactions, cachexia, loss of appetite, acute infection, HIV infection, shock states, graft-versus-host reactions, autoimmune diseases, reperfusion injury, meningitis, migraine and aspirin-dependent antithrombotic effects; tumor growth, invasion and spread, angiogenesis, metastasis, malignancy, ascites and malignant pleural effusions; cerebral ischemia, ischemic heart disease, osteoarthritis, rheumatoid arthritis, bone marrow ulcers, cerebrovascular disease, pulmonary embolism ... Osteoporosis, asthma, multiple sclerosis, neurodegeneration, Alzheimer's disease, atherosclerosis, stroke, vasculitis, Crohn's disease and ulcerative colitis; periodontitis, gingivitis; psoriasis, atopic dermatitis, chronic ulcers, epidermolysis bullosa; corneal ulcers, retinopathy and surgical wound healing; rhinitis, allergic conjunctivitis, eczema, allergic reactions; restenosis, congestive heart failure, endometriosis, atherosclerosis or endosclerosis.

[0208] Additionally or alternatively, the enveloped viral vector particles or transduced cells of the invention may be used to treat the conditions listed in WO 1998 / 007859. For ease of reference, a portion of this list is now provided: cytokine and cell proliferation / differentiation activity; immunosuppressive or immunostimulatory activity (e.g., for the treatment of immunodeficiency, including human immunodeficiency virus infection; regulation of lymphocyte growth; treatment of cancer and many autoimmune diseases, and prevention of transplant rejection or induction of tumor immunity); regulation of blood production, e.g., for the treatment of myeloid or lymphoid diseases; promotion of growth of bone, cartilage, tendon, ligament and nerve tissue, e.g., for the treatment of wounds, treatment of burns, ulcers and periodontal disease, and neurodegeneration; inhibition or activation of follicle-stimulating hormone (regulation of fertility); chemotactic / chemokine activity (e.g., for the mobilization of specific cell types to sites of injury or infection); hemostatic and thrombolytic activity (e.g., for the treatment of hemophilia and stroke); anti-inflammatory activity (e.g., for the treatment of septic shock or Crohn's disease); as antimicrobial agents; e.g., regulators of metabolism or behavior; as analgesics; treatment of specific deficiency disorders; in the treatment of e.g., psoriasis, in human or veterinary medicine.

[0209] Additionally or alternatively, the products, artificial transcriptional repressors (ATRs), polynucleotides and cells of the present invention may be used to treat the conditions listed in WO 1998 / 009985. For ease of reference, a portion of this list is now provided: macrophage inhibitory and / or T cell inhibitory activity and therefore anti-inflammatory activity; anti-immune activity, i.e., inhibitory effects on cellular and / or humoral immune responses, including responses not associated with inflammation; inhibition of the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, and upregulated fas receptor expression in T cells; inhibition of unwanted immune responses and inflammation, including arthritis, including rheumatoid arthritis, inflammation associated with hypersensitivity reactions, allergic reactions, asthma, systemic lupus erythematosus, collagen diseases and other autoimmune diseases, diseases associated with atherosclerosis; related inflammation, atherosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disease, respiratory distress syndrome or other cardiopulmonary disease, inflammation related to peptic ulcer, gastrointestinal diseases such as ulcerative colitis, liver fibrosis, cirrhosis or other liver disease, thyroiditis or other glandular disease, glomerulonephritis or other kidney and urinary disease, otitis or other otolaryngological disease, dermatitis or other skin disease, periodontal disease or other dental disease, orchitis or epididymitis (epididimo-orchitis), infertility, testicular trauma (orchidal trauma) or other immune-related testicular diseases, placental dysfunction, placental insufficiency, recurrent miscarriage, eclampsia, pre-eclampsia and other immune- and / or inflammatory-related gynecological diseases, posterior uveitis, intermediate uveitis, anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis, optic neuritis, intraocular inflammation, such as retinitis or cystoid macular edema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, immune and inflammatory components of degenerative fondus disease, inflammatory components of ocular trauma, ocular inflammation caused by infection, proliferative vitreoretinopathy, acute ischemic optic neuropathy, excessive scarring, such as after glaucoma filtering surgery, immune and / or inflammatory reactions to ocular implants and other immune- and inflammatory-related ophthalmic diseases, verification associated with autoimmune diseases or conditions or disorders, all of which are in the central nervous system (CNS) or any other organ,immunosuppression and / or inflammation suppression would be beneficial), Parkinson's disease, compliance and / or side effects from treatment of Parkinson's disease, AIDS related dementia complex, HIV related encephalopathy, Devic's disease, Sydenham chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, inflammatory components of stroke, post-polio syndrome, immune and inflammatory components of psychiatric disorders, myelitis, encephalitis, subacute sclerosing panencephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Guillaim-Barre syndrome, Sydenham chorea, myasthenia gravis, pseudo-tumour cerebri, Down's Syndrome, Huntington's disease, amyotrophic lateral sclerosis, inflammatory components of CNS compression or CNS trauma or CNS infection, inflammatory components of muscle atrophy and dystrophy, and immune and inflammation related diseases, conditions or disorders of the central and peripheral nervous system, post-traumatic inflammation, septic shock, infectious diseases, inflammatory complications or side effects of surgery, bone marrow transplant or other transplant complications and / or side effects, inflammation and / or immune complications and side effects of gene therapy, for example due to infection with viral vectors, or inflammation associated with AIDS, to suppress or inhibit humoral and / or cellular immune responses sufficient to treat or ameliorate mononuclear or leukocyte proliferative diseases, for example, leukemia (by reducing the amount of mononuclear or lymphocytic cells), to prevent and / or treat graft rejection in the case of transplantation of natural or artificial cells, tissues and organs such as corneas, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.

[0210] Therapeutic methods

[0211] It will be appreciated that all references herein to treatment include curative, palliative and prophylactic treatment; although in the context of the application reference to prophylaxis is more relevant to prophylactic treatment. Treatment of mammals, particularly humans, is preferred. Both human and veterinary treatment are within the scope of the application.

[0212] Vaccines

[0213] In one aspect, the present application provides an enveloped viral particle of the application for use as a vaccine. Preferably, the enveloped viral particle is not infectious, for example, is not able to infect a cell. Preferably, the enveloped viral particle is not able to replicate.

[0214] Attenuated viruses are commonly used in the art as vaccines to provide immunity against infection with the natural, virulent form of the virus.

[0215] The producer cells of the present invention as described above can be used to produce attenuated viruses for use as vaccines, wherein the NOI can preferably be omitted. The producer cells of the present invention achieve the production of enveloped viral particles that exhibit a reduced number of surface-exposed CD47 molecules for use as vaccines. The enveloped viral vector particles for use as vaccines can be substantially devoid of surface-exposed CD47 molecules.

[0216] In one embodiment, the enveloped viral particles used as vaccines each contain fewer than 10, 5, 4, 3, 2, or 1 surface-exposed CD47 molecules.

[0217] In one embodiment, the enveloped virus particles used as a vaccine each contain fewer than 10 surface-exposed CD47 molecules. In one embodiment, the enveloped virus particles used as a vaccine each contain fewer than 5 surface-exposed CD47 molecules. In one embodiment, the enveloped virus particles used as a vaccine each contain fewer than 2 surface-exposed CD47 molecules.

[0218] In one embodiment, the enveloped viral particles used as a vaccine each comprise less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed CD47 molecules displayed on particles produced by enveloped viral particle producer cells in the absence of genetic engineering (but under otherwise essentially identical conditions).

[0219] In one embodiment, the enveloped viral particles used as vaccines do not contain any surface-exposed CD47 molecules.

[0220] The producer cells of the present invention can also achieve the production of enveloped viral particles that exhibit a reduced number of surface-exposed MHC-I molecules for use as vaccines. The enveloped viral vector particles used as vaccines can be substantially devoid of surface-exposed MHC-I molecules.

[0221] A reduced number or absence of surface-exposed MHC-I molecules is advantageous in viruses used as vaccines because the virus is less likely to be neutralized by antibodies bound to MHC-I.

[0222] Additionally, the immune response may be directed against allogeneic MHC-I rather than against viral antigens, and thus viral particles substantially lacking allogeneic MHC-I molecules may be more effective vaccines by more efficiently inducing protective immunity.

[0223] The viruses used as vaccines can be further engineered to express additional proteins on their surface or within infected cells. Such proteins can act as antigens to generate antibodies or cellular immunity, which can further increase the body's immune defenses.

[0224] In one embodiment, the enveloped viral particle further comprises one or more antigens. The one or more antigens can be derived from, for example, a virus, a bacterium, a fungus, a protozoa and / or a parasite.

[0225] In one embodiment, the antigen is derived from a virus selected from the group consisting of Ebola virus, herpes simplex virus, varicella-zoster virus, Epstein-Barr virus, cytomegalovirus, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis delta virus, hepatitis E virus, hepatovirus G DNA virus, Picornaviridae (e.g., poliovirus), Caliciviridae, Togaviridae (e.g., rubella virus and dengue virus), Flaviviridae, Coronaviridae, Reoviridae, Birnaviridae, Rhododoviridae (e.g., rabies virus), Filoviridae, Paramyxoviridae (e.g., mumps virus, measles virus, and respiratory syncytial virus), Orthomyxoviridae (e.g., influenza A, B, and C viruses), Bunyaviridae, Arenaviridae, and Retroviridae (e.g., HIV-1, HIV-2, and SIV).

[0226] In one embodiment, the antigen is derived from a bacterium that causes diphtheria, tetanus, pertussis, or meningitis.

[0227] In one embodiment, the antigen is derived from a bacterium selected from the group consisting of Corynebacterium diphtheriae, Clostridium tetani, Bordetella pertusis, Neisseria meningitidis, including serotypes meningococcal A, B, C, Y, and WI35 (MenA, B, C, Y, and WI35), Haemophilus influenza type B (Hib), and Helicobacter pylori.

[0228] In one embodiment, the antigen is derived from a parasite that causes malaria or Lyme disease.

[0229] Those skilled in the art will understand that they can combine all features of the present invention disclosed herein without departing from the scope of the invention as disclosed.

[0230] Preferred features and embodiments of the invention will now be described by way of non-limiting examples.

[0231] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, biochemistry, molecular biology, microbiology and immunology, which are within the capabilities of one of ordinary skill in the art and are explained in the literature. See, for example, Sambrook, J., Fritsch, EF and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press; Ausubel, F Metal. (1995 and periodic supplements) Current Protocols in Molecular Biology, Chapters 9, 13 and 16, John Wiley & Sons; Roe, B., Crabtree, J. and Kahn, A. (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; Polak, JM and McGee, J.O'D. (1990) In SituHybridization: Principles and Practice, Oxford University Press; Gait, MJ (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and Lilley, DM and Dahlberg, JE (1992) Methods in Enzymology: DNA Structures Part A: Synthesis and Physical Analysis of DNA, Academic Press. Each of these general textbooks is incorporated herein by reference. Example

[0232] Example 1

[0233] result

[0234] CD47 disruption in producer cells does not affect lentiviral (LV) production

[0235] CD47 is a known inhibitor of phagocytosis through species-specific interaction with its receptor SIRPα receptor. To obtain lentivirus (LV) lacking CD47 molecules on its surface (CD47-free LV), we genetically inactivated the CD47 gene in producer cells by transient transfection with a plasmid expressing Cas9 and three different gRNAs and FACS sorted to pure CD47-negative producer cells ( Figure 1 ab). LVs produced by CD47-negative cells have the same infectivity as their CD47-positive counterparts ( Figure 1 c).

[0236] CD47-null LVs show enhanced transduction of primary human phagocytes

[0237] CD47 molecules are incorporated into LV particles at levels proportional to CD47 expression on the producer cell membrane, as shown by electron microscopy of LV particles immunostained with anti-CD47 antibodies ( Figure 2 a, b). Therefore, LV produced by CD47-negative cells is CD47-free LV. Importantly, the CD47 content on LV particles does not affect the incorporation of envelope VSV.G protein ( Figure 2 c). When matched infusions of CD47-null LV and control LV were exposed to primary human macrophages, we found significantly higher transduction of human macrophages by the former than by the latter, while transduction of reference 293T cells remained unchanged ( Figure 2 d). These data indicate that modulating the level of CD47 on LV particles affects their uptake by human macrophages. We transduced human primary monocytes with LV-GFP on day 2 of the dendritic cell differentiation protocol, measured GFP expression at the end of differentiation, and found that CD47-free LV had a higher gene transfer efficiency than control LV ( Figure 2 e). In addition, we generated fluorescent LVs carrying green fluorescent protein (GFP) fused to the membrane targeting domain of pp60Src, a chimeric protein previously shown to be efficiently incorporated into the budding HIV envelope. These fluorescent LV particles can be visualized after entry into primary human macrophages using ImageStream, a combined flow cytometry and imaging system that allows high-throughput quantification of LV entry. Using this approach, we demonstrated increased phagocytosis of CD47-null LVs compared to control LVs ( Figure 2 f).

[0238] CD47-deficient LVs show increased uptake by professional phagocytes of the liver and spleen upon in vivo administration

[0239] SIRPα has been shown to have a high affinity for human CD47 in non-obese diabetic (NOD) mice. Therefore, we compared the results of LV administration to NOD and C57BL / 6 hemophilia B mice. We found that LV copies per cell (vector copy number, VCN) were 4-fold higher in hepatocytes sorted from NOD versus C57BL / 6 mice and that VCN was 30-fold and 5-fold lower in liver macrophages and spleen, respectively ( Figure 3 a). Interestingly, LV copies were also >10-fold lower in NOD plasmacytoid dendritic cells (pDCs), which are known sensors of viral nucleic acids and reported to release type I interferon (IFN) after exposure to LV particles. These interstrain differences in biodistribution between hepatocyte types were primarily due to the interaction between NOD SIRP-α and human CD47 molecules on LV particles, as they were almost completely eliminated when we administered CD47-free LV at the same dose ( Figure 3 b). CD47-null LVs transduce liver macrophages, liver pDCs, and spleen with higher efficiency than their CD47-bearing counterparts in NOD mice ( Figure 3 c).

[0240] CD47-null LV administration leads to an increase in phagocyte-associated proinflammatory cytokines

[0241] Surface display of CD47 also affected acute cytokine and chemokine release following intravenous LV administration. Specifically, interleukin 6 (IL6), monocyte chemoattractant protein 1 (MCP-1), macrophage inflammatory protein 1 (MIP-1α), MIP-1β, chemokine (CXC motif) ligand 1 (CXCL1), and granulocyte colony-stimulating factor were significantly increased in LV-treated mice compared to untreated NOD mice 3 hours after LV administration. Interestingly, administration of CD47-null LV to NOD mice triggered the strongest increase in these macrophage-associated cytokines and proinflammatory cytokines ( Figure 4 These data are consistent with the observed regulation of professional phagocyte uptake by the CD47 content of LV particles.

[0242] In vivo imaging reveals that CD47 regulates the rate and extent of LV phagocytosis by Kupffer cells (KCs)

[0243] To study the dynamics of LV phagocytosis in the liver after intravenous administration in real time, we performed intravital 2-photon microscopy (IV2PM). To visualize LV, we used fluorescent LV produced in control 293T, CD47hi 293T, or CD47 negative 293T cells, as described herein. LV uptake was recorded in real time in the surgically exposed liver of anesthetized mice. Administration of GFP-labeled LV in C57BL / 6 mice resulted in rapid and extensive uptake by Kupffer cells (KC) (visualized by infusion of anti-F4 / 80 antibody before LV administration), which became LV positive in all examined fields within 5-10 minutes after administration ( Figure 5 ). In contrast, administration of the same LV to NOD mice showed a delay and overall decrease in KC uptake; this was even further reduced when CD47hi LV was administered, with only half the fraction of LV-positive KCs at the end of the recording (40 minutes after LV) for CD47hi compared to control LV. Importantly, the kinetics and amount of KC uptake of CD47-free LV in NOD mice were surprisingly rapid and overlapped with those of control LV injected in C57BL / 6 mice. The distinctly different timing and extent of KC uptake of LV, based on CD47 recognition and content on the LV surface, provide direct evidence for the primary role of this molecule in protecting LV from phagocytosis in vivo.

[0244] LV-based delivery of interferon to the liver

[0245] Our results indicate that LV-based delivery of interferon alpha (IFNα) induces activation of the IFN signature in the liver of treated mice ( Figure 6 ). Notably, the rationale for utilizing the aforementioned in vivo gene therapy rather than relying on exogenous cytokine administration is based on the opportunity to spare off-target tissues and achieve localized, stable, and continuous cytokine expression at near-physiological levels, thereby limiting the risks of: (i) adverse events; (ii) off-target effects; and (iii) desensitization from exposure to excessive cytokine administration. Our scale-up studies in non-human primates (NHPs) indicate that stable, robust, and hepatic LV-driven transgene expression can be achieved without any significant acute toxicity and with recovery of nearly all integrated LVs from the liver and spleen. (Milan et al. (2019) Sci Transl Med).

[0246] Materials and methods

[0247] Plasmid construction

[0248] Plasmids expressing Cas9 and sgRNA were previously described (Amabile, A. et al. (2016) Cell 167:219-232 e214). The CRISPR sequences used to generate sgRNA were: CD47 A (CTACTGAAGTATACGTAAAGTGG); B (CTTGTTTAGAGCTCCATCAAAGG); and C (ATCGAGCTAAAATATCGTGTTGG).

[0249] Vector production

[0250] Laboratory-grade VSV.G pseudotyped third generation self-inactivating (SIN) LV was produced by transient calcium phosphate transfection into 293T cells or by LV stable producer cell lines (Milani et al., EMBO Mol Med 9(11):1558-1573). 293T cells were transfected with a solution containing the selected LV genome transfer plasmid, packaging plasmids pMDLg / pRRE and a mixture of pCMV.REV, pMD2.G and pAdvantage as previously described (Milani et al., EMBO Mol Med 9(11):1558-1573). The medium was changed 14-16 hours after transfection, and the supernatant was collected 30 hours after the medium change. Alternatively, when the LV producer cells were subconfluent, LV production was induced by changing the medium with medium containing 1 μg / mL doxycycline (Sigma), and the supernatant was collected 3 days after induction. The LV-containing supernatant was sterilized by passing through a 0.22 μm filter (Millipore) and, when necessary, transferred to sterile poliallomer tubes (Beckman) and centrifuged at 20,000 g for 120 min at 20° C. (Beckman Optima XL-100K Ultracentrifuge). The LV pellet was dissolved in an appropriate volume of PBS to allow 500-1000× concentration.

[0251] LV titration

[0252] For LV titration, 1 × 10 cells were transduced with serial LV dilutions in the presence of polybrene (8 μg / mL). 5293T cells. For LV-GFP, cells were analyzed by flow cytometry 3-7 days after transduction, and the infectious titer was calculated using the formula TU / mL = ((% GFP + cells / 100) × 100,000 × (1 / dilution factor)) and expressed as transducing units 293T (TU) / mL. For all other LVs, genomic DNA (gDNA) was extracted 14 days after transduction using the Maxwell 16 Cell DNA Purification Kit (Promega) according to the manufacturer's instructions. VCN was determined by quantitative PCR (qPCR) starting from 100 ng of template gDNA using primers (HIV fw: 5'-T ACTGACGCTCTCGCACC-3'; HIV rv: 5'-TCTCGACGCAGGACTCG-3') and probe (FAM 5'-ATCTCTCTCCTTCTAGCCTC-3'), which were designed on the primer binding site region of LV. The amount of endogenous DNA was quantified using a primer / probe set designed on the human telomerase gene (Telofw: 5'-GGCACACGTGGCTTTTCG-3'; Telorv: 5'-GGTGAACCTCGTAAGTTTATGCAA-3'; Telo probe: VIC 5'-TCAGGACGTCGAGTGGACACGGTG-3'TAMRA) or the human GAPDH gene (Applied Biosystems HS00483111_cm). VCN was calculated using the formula = (ng LV / ng endogenous DNA) x VCN of the sample used as the standard curve. The standard curve was generated using a CEM cell line that stably carries one vector integron, which was previously confirmed by Southern blotting and fluorescence in situ hybridization (FISH). All reactions were performed in duplicate or triplicate in a Viia7 real-time PCR thermal cycler (Applied Biosystems). Each qPCR run was accompanied by an internal control generated using a CEM cell line stably harboring four vector integrants, previously confirmed by Southern blot and FISH analysis. Infectious titers, expressed as TU / mL, were calculated using the formula TU / mL = (VCN × 100,000 × (1 / dilution factor). LV physical particles were measured by the HIV-1 Gag p24 antigen immunocapture assay (Perkin Elmer) according to the manufacturer's instructions. LV specific infectivity was calculated based on the ratio between infectious titer and physical particles.

[0253] Mouse experiments

[0254] NOD and wild type C57BL / 6 mice were purchased from Charles River. All mice were maintained under specific pathogen-free conditions. Vector administration was performed in adult (7-10 weeks old) mice by tail vein injection. Mice were bled from the retro-orbital plexus using capillary tubes and blood was collected into 0.38% sodium citrate buffer pH 7.4. Mice were deeply anesthetized with tribromoethanol (Avertin) and euthanized by CO0 inhalation at scheduled times. All animal procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee.

[0255] Fractionation and sorting of liver cell subpopulations

[0256] In a subsequent step, the liver was perfused (2.5 mL / min) via the inferior vena cava with 12.5 mL of the following solutions: 1) PBS EDTA (0.5 mM), 2) HBSS (Hank's Balanced Salt Solution, Gibco) and HEPES (10 mM), 3) HBSS-HEPES 0.03% Collagenase IV (Sigma). The digested liver tissue was harvested, passed through a 70 pm cell strainer (BD Biosciences) and processed into a single cell suspension. The suspension was then centrifuged 3 times (30, 25 and 20 g for 3 minutes at room temperature) to obtain PC-containing pellets. The nPC-containing supernatant was centrifuged (650 g for 7 minutes at room temperature) and the recovered cells were loaded onto a 30 / 60% Percoll (Sigma) gradient (1800 g for 20 minutes at room temperature). The nPC interface was collected and washed twice. The nPC were then incubated with the following monoclonal antibodies: e-fluor 450-conjugated anti-CD45 (30-F11, e-Bioscience), allophycocyanin (APC)-conjugated anti-CD31 (MEC13.3, BD Biosciences), phycoerythrin (PE)-conjugated F4 / 80 (CI:A3-1, Biorad), PE-Cy5-conjugated anti-CD45R / B220 (from BD Biosciences), PE-Cy7-conjugated anti-CD11c (N418, e-Bioscience), purified anti-CD16 / 32 (2.4G2, BD Biosciences). nPC subpopulations (LSEC, KC, pDC) were sorted by FACS, MOFLO-DAKO-Beckman-Coulter; nPC contaminating the PC suspension were removed by FACS, excluding cells labeled with APC-conjugated anti-CD31 / anti-CD45 cocktail, thus obtaining sorted hepatocytes (Hep).

[0257] Cell culture and in vitro experiments

[0258] 293T and LV producer cell lines are maintained in the Iscove modified Dulbecco's medium (IMDM, Sigma) supplemented with 10% fetal bovine serum (FBS, Euroclone), 4mM glutamine (Lonza), penicillin and streptomycin 100IU / mL (Lonza). Primary human macrophages derive from the CD14 positive cells separated by negative selection (pan-monocyte separation kit, Miltenyi Biotec), derive from the buffy coat of healthy donors (obtained according to the scheme approved by the SRSI Ethics Committee), and differentiated 7 days in the IMDM supplemented with 5% human serum, 4mM glutamine, penicillin and streptomycin 100IU / mL. The purity of CD14 positive cells is determined by flow cytometry, and is>90%. In the presence of hGM-CFS 100ng / mL and hIL4 10ng / mL, by 7 days cultivation, CD14 positive monocytes are differentiated in dendritic cells. All cells were maintained at 37°C in a humidified atmosphere of 5% CO2. All cell lines were routinely tested for mycoplasma contamination. Human primary macrophages and 293T were transduced by spinoculation (1,100 g at 37°C) for 1 hour, then washed with PBS and cultured for 3 days.

[0259] Gene disruption and mismatch-selective endonuclease assays

[0260] Gene disruption was performed by calcium phosphate-mediated transient transfection of indicated amounts of desired sgRNA expression plasmids and Cas9 expression plasmids. The extent of mutations due to non-homologous end joining (NHEJ) at the Cas9 target site was measured using the mismatch-selective endonuclease assay (Lombardo, A. et al. (2011) Nat Methods 8: 861-869). PCR was performed using primers flanking the sgRNA binding site in the CD47 gene (fw: 5'- TTCCTTTCCAGGATCAGCTCAGC-3'; rv: 5'- TTGATTCAAAGGAGTACCTATCCC-3'). PCR products were denatured, allowed to reanneal and digested with Surveyor nuclease assay (Transgenomic). Because the enzyme cuts DNA at sites of duplex distortion, reannealing products between wild-type and mutant alleles (carrying mutations or deletions due to nuclease activity) are specifically digested. Reaction products were separated on a Spreadex EL1200 Wide Mini gel (Elchrom Scientific), stained with ethidium bromide or GelRed (Biotium) and the intensity of the bands was quantified by ImageQuant TL 5 software. The ratio of uncleaved parental fragments to the two lower-migrating cleavage products was calculated using the formula (1 - (parental fraction)1 / 2) x 100.

[0261] Flow cytometry

[0262] Flow cytometry analysis was performed using a FACSCanto analyzer (BD Biosciences) equipped with DIVA software. 100,000-500,000 cells were harvested, washed with PBS or MACS buffer (PBS pH 7.2 0.5% BSA, 2mM EDTA), treated with Fc Receptor-Block (Miltenyi Biotec) when antibody staining and then resuspended in wash buffer. Staining was performed in MACS buffer, cells were incubated with antibodies (ratios shown in the table below) for 20 minutes at 4°C in the dark. Anti-mouse IgG beads were used for single staining controls (BD Biosciences). Anti-CD47 Pacific Blue (BD Biosciences, B6H12, 1 :20).

[0263] Electron microscopy

[0264] A few microliters of concentrated LV batches were adsorbed onto glow-discharged carbon-coated Formvar copper grids and fixed with 8% paraformaldehyde in PBS for 20 minutes. After several washes in 50 mM glycine in PBS, the grids were blocked in 1% BSA in PBS and incubated with primary antibodies diluted in blocking buffer for 30-90 minutes (anti-VSV.G, KeraFAST, 1:50, anti-CD47, BD Biosciences, 1:10). After several washes with 0.1% BSA in PBS, the samples were incubated with protein A-gold (10 nm) for 30 minutes, fixed with 1% glutaraldehyde, stained with 2% uranyl acetate, and air-dried. The grids were observed using a Zeiss LEO 512 transmission electron microscope. Images were acquired using a 2k x 2k bottom-mounted slow-scan Proscan camera controlled by EsivisionPro 3.2 software. To quantify labeling density, random images of viral particles were taken at a nominal magnification of 16k, and gold particles associated with the virions were manually counted using ImageJ. Virions were defined based on expected size (approximately 120 nm) and electron-dense core.

[0265] Cytokine ELISA

[0266] The concentrations of cytokines and chemokines in mouse serum were determined by magnetic-based multiplex ELISA 23 analytes (Bio-Plex 23-Plex, Group I, Biorad) according to the manufacturer's instructions.

[0267] VCN determination

[0268] For human macrophage experiments, DNA was extracted using the QIAamp DNA Micro Kit (Qiagen) following the manufacturer’s instructions. For mouse experiments, DNA was extracted from whole liver or whole spleen samples using the Maxwell 16 Tissue DNA Purification Kit (Promega), from fractionated / sorted hepatocytes using the DNeasy Blood & Tissue Kit (Qiagen) or the QIAamp DNA Micro Kit (Qiagen) depending on the cell number. VCN was determined in human macrophages as described above (see “LV titration”). LV produced with the stable LV producer cell line transduced human primary macrophages and therefore lack of plasmid contamination. VCN in murine DNA was determined by ddPCR starting from 5-20 ng of template gDNA using primers / probes designed on the primer binding site region of the LV (see “LV titration” above). The amount of endogenous murine DNA was quantified by a primers / probes set designed on the murine sema3a gene (Sema3A fw: 5’-ACCGATTCCAGATGATTGGC-3’; Sema3A rv: 5’-TCCATATTAATGCAGTGCTTGC-3’; Sema3A probe: HEX 5’-AGAGGCCTGTCCTGCAGCTCATGG-3’ BHQ1). PCR reactions were performed with each primer (900 nM) and probe (250 nM) following the manufacturer’s instructions (Biorad), read with QX200 reader and analyzed with QuantaSoft software (Biorad).

[0269] ImageStream

[0270] LV entry in primary human macrophages and 293T cells was analyzed by imaging flow cytometry using the Imagestream X Mark II system (Ammis, Merck). The instrument was equipped with 3 lasers (405 nm, 488 nm and 642 nm), a 6-channel CCD camera, the Multimag option, but without the extended field depth option. The excitation laser settings were as follows: 405 nm (10 mW), 488 nm (200 mW). At least 5000 events were collected per sample with a 60X_0.9 NA low power objective and images were analyzed using the IDEAS 6.2 software. Single stained samples were acquired at the same laser settings of the samples but without the bright field and side scatter illumination and were used for compensation.

[0271] Live imaging

[0272] C57BL / 6 or NOD mice were surgically prepared for liver IV2PM as described (Benechet, AP et al. (2017) Methods Mol Biol 1514: 49-61). 20 minutes before imaging, mice were intravenously injected with PE-conjugated anti-F4 / 80 antibodies (clone BM8, Biolegend). 2 minutes after starting video recording, GFP-labeled LV, CD47hi or CD47-free LV were intravenously injected. Images (TriMScope II) were acquired using a Nikon Ti-U fluorescence inverted microscope and a 25x objective (NA 0.95). For four-dimensional analysis, 8 to 12 z stacks (spacing 4 μm) of 300- to 400-μm2 xy-slices were acquired every 20 seconds. Liver sinusoids were visualized by intravenously injecting non-targeted quantum dots (Quantum Dot) 655 (Invitrogen) immediately before imaging. Image stacks were sequentially converted into volume-rendered three-dimensional videos using Imaris software (Bitplane).

[0273] Statistical analysis

[0274] Statistical analyses were performed in consultation with a dedicated statistician from the Center for Biomedical Statistics at the University of San Rafael (CUSSB). Nonparametric statistical tests were performed when the assumption of normality was not met. Mann-Whitney or Kruskall-Wallis tests were performed when comparing two or more experimental groups, respectively. Two-way ANOVA was performed for repeated measures over time. For paired observations, the Wilcoxon matched-pairs test was performed.

[0275] All publications mentioned in the above description are incorporated herein by reference. Various modifications and variations of the viral particles, cells, compositions, uses and methods disclosed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the present invention has been disclosed in conjunction with specific preferred embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. Indeed, it will be apparent to those skilled in the art that various modifications of the disclosed modes for carrying out the invention are within the scope of the appended claims.

Claims

1. Enveloped virus particle producer or packaging cell, wherein: (a) the cells are genetically engineered to suppress CD47 expression; or (b) the cells comprise a genetically engineered disruption of the gene encoding CD47, The expression of CD47 on the cell surface is thereby reduced, and wherein the producer or packaging cell comprises one or more nucleic acid sequences encoding one or more viral particle structural proteins.

2. The enveloped viral particle producer or packaging cell of claim 1, wherein the number of surface-exposed CD47 molecules is less than about 10% of the number of surface-exposed CD47 molecules displayed in the absence of genetic engineering.

3. The enveloped viral particle producer or packaging cell of claim 1, wherein the cell is further genetically engineered to reduce the expression of MHC-I on the cell surface.

4. The enveloped viral particle producer or packaging cell of claim 1, wherein the cell comprises a genetically engineered disruption of a gene encoding β2-microglobulin and / or a genetically engineered disruption of one or more genes encoding an MHC-I α chain.

5. The enveloped viral particle producer or packaging cell of claim 1, wherein the cell is a HEK-293 cell or a derivative thereof.

6. The enveloped viral particle producer or packaging cell of claim 5, wherein the cell is a HEK-293T or HEK-293T-REx cell.

7. The enveloped viral particle producer or packaging cell of claim 1, wherein the enveloped viral particle is a retrovirus, herpes simplex virus, vaccinia virus, hepadnavirus, togavirus, flavivirus, arenavirus, coronavirus, orthomyxovirus, paramyxovirus, bunyavirus, bornavirus, rhabdovirus, or filovirus particle, or a viral particle derived therefrom.

8. The enveloped viral particle producer or packaging cell of claim 1, wherein the enveloped viral particle is a lentiviral particle or a viral particle derived therefrom.

9. Use of the enveloped virus particle producer cell according to any of the preceding claims for producing enveloped virus particles.

10. A method for producing enveloped virus particles comprising the steps of: a) providing an enveloped virus particle producer cell according to any one of claims 1 to 8; and b) culturing said cells under conditions suitable for production of said enveloped viral particles.

11. Enveloped virus particles obtained by the method of claim 10.

12. The enveloped viral particle of claim 11, wherein the viral particle is a retroviral, herpes simplex virus, or vaccinia virus particle, or a viral particle derived therefrom.

13. The enveloped viral particle of claim 11, wherein the enveloped viral particle is a lentiviral particle or a viral particle derived therefrom.

14. Use of the enveloped viral particle of any one of claims 11 to 13 for transducing macrophages, phagocytes, antigen presenting cells or monocytes, wherein the transduction is performed ex vivo or in vitro.

15. A cell transduced by the enveloped viral particle of claim 11.

16. A pharmaceutical composition comprising the enveloped virus particle of any one of claims 11 to 13 or the cell of claim 15, and a pharmaceutically acceptable carrier, diluent or excipient.

17. Use of the enveloped virus particle according to any one of claims 11 to 13 or the cell according to claim 15 for the preparation of a medicament.

18. The use according to claim 17, wherein the medicament is for vaccination or gene therapy.

19. The use of claim 17, wherein the medicament is for treating cancer, bacterial or viral infection, immune-mediated disease or autoimmune disease.

20. The method of claim 19, wherein the treatment comprises: (a) transducing cells with the enveloped viral particles; or (b) administering the enveloped viral particle or the cell to a subject in need thereof.

21. Use of the enveloped virus particle according to any one of claims 11 to 13 for the preparation of a vaccine.

Images