Process for the production of 3-hydroxy-4-aminobenzoic acids

By using specific peptides and gene recombination technology to enhance microbial fermentation, the problem of low efficiency in the microbial production of 3-hydroxy-4-aminobenzoic acid was solved, and the efficient conversion of 4-aminobenzoic acid to 3-hydroxy-4-aminobenzoic acid was achieved, meeting the production requirements of polybenzoxazole monomer.

CN112673108BActive Publication Date: 2025-11-11KAO CORP
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN201980059483.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2018-09-13
Filing Date
2019-09-06
Publication Date
2025-11-11
Estimated Expiration
2039-09-06

AI Technical Summary

Technical Problem

In the existing technology, the microbial method for producing 3-hydroxy-4-aminobenzoic acid is inefficient, and the activity of 4-hydroxybenzoic acid hydroxylase is insufficient, making it difficult to efficiently carry out the 3-position hydroxide reaction of 4-aminobenzoic acid.

Method used

Using peptides with specific amino acid sequences or peptides with 4-hydroxybenzoic acid hydroxylase activity, 4-aminobenzoic acid is converted into 3-hydroxy-4-aminobenzoic acid through microbial fermentation. The expression of polynucleotides is enhanced by gene recombination technology and introduced into the host microorganism, and the contact conditions are optimized to improve the conversion efficiency.

Benefits of technology

The efficient manufacturing of 3-hydroxy-4-aminobenzoic acid was achieved, increasing production capacity by 46% to 114%, thus meeting the demand for polybenzoxazole monomers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FDA0005590639600000011
    Figure FDA0005590639600000011
  • Figure FDA0005590639600000012
    Figure FDA0005590639600000012
  • Figure GDA0002971857720000031
    Figure GDA0002971857720000031
Patent Text Reader

Abstract

This invention provides a method for manufacturing 3-hydroxy-4-aminobenzoic acid derivatives using microorganisms. The method for manufacturing 3-hydroxy-4-aminobenzoic acid derivatives of this invention includes a step of contacting 4-aminobenzoic acid derivatives with microorganisms that produce polypeptides of either (A) or (B), where (A) is a polypeptide composed of the amino acid sequence shown in Serial No. 2, or a polypeptide composed of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Serial No. 2 and having 4-hydroxybenzoic acid hydroxylase activity; and (B) is a polypeptide composed of the amino acid sequence shown in Serial No. 6, or a polypeptide composed of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Serial No. 6 and having 4-hydroxybenzoic acid hydroxylase activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for manufacturing 3-hydroxy-4-aminobenzoic acid derivatives using microorganisms. Background Technology

[0002] Polybenzoxazole (PBO) is known as an engineering plastic with excellent heat resistance and mechanical strength, and is used in fiber materials and insulating films for semiconductor devices (Non-Patent Literature 1).

[0003] The benzoxazole skeleton is formed by the condensation of the o-aminophenol skeleton with a carboxylic acid. Therefore, 3-hydroxy-4-aminobenzoic acid (HABA) compounds with these functional groups intramolecularly are expected to be useful as PBO monomers. In fact, the synthesis and property evaluation of polybenzoxazoles using HABA were investigated (Non-Patent Literature 2).

[0004] In recent years, methods for manufacturing compounds using renewable energy sources through microbial fermentation, aimed at reducing the environmental burden on the Earth, have attracted much attention. For example, research has been conducted on the production and polymerization of 3-amino-4-hydroxybenzoic acid (AHBA) with a structure similar to HABA (Patent Document 1).

[0005] Regarding the production of HABA, methods such as chemical reduction and synthesis of nitro aromatic compounds are known to date (Patent Document 2). As a countermeasure to enable the fermentation production of HABA using microbial methods, it is possible to consider hydroxylating the 3-position of 4-aminobenzoic acid (ABA), which can be biosynthesized within microorganisms. However, regarding this reaction, only a small amount of 4-hydroxybenzoic acid hydroxylase has been reported to have slight activity (Non-Patent Documents 3, 4).

[0006] Patent Document 1: Japanese Patent No. 5445453

[0007] Patent Document 2: Japanese Patent No. 3821350

[0008] Non-Patent Literature 1: Hiroki Murase, SENI GAKKAISHI (Fibers and Industry), Vol.66, No.6 (2010)

[0009] Non-patent literature 2: Lon J. Mathias et al., Macromolecules, Vol.18, No.4, pp.616-622 (1985)

[0010] Non-patent literature 3: Barrie Entsch et al., The Journal of Biological Chemistry, Vol. 262, No. 13, pp. 6060-6068 (1987)

[0011] Non-patent literature 4: Domenico L. Gatti et al., Biochemistry, Vol.35, No.2, pp.567-578 (1996) Summary of the Invention

[0012] This invention relates to the following:

[0013] A method for manufacturing 3-hydroxy-4-aminobenzoic acid, comprising a step of contacting the 4-aminobenzoic acid with microorganisms that produce polypeptides of (A) or (B) below.

[0014] (A) A polypeptide consisting of the amino acid sequence shown in Serial No. 2, or a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Serial No. 2 and having 4-hydroxybenzoic acid hydroxylase activity.

[0015] (B) A polypeptide consisting of the amino acid sequence shown in Serial No. 6, or a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Serial No. 6 and having 4-hydroxybenzoic acid hydroxylase activity. Detailed Implementation

[0016] This invention relates to a method for manufacturing 3-hydroxy-4-aminobenzoic acid derivatives using microorganisms.

[0017] The inventors have discovered that by using microorganisms that produce specific 4-hydroxybenzoic acid hydroxylases, the 3-position of 4-aminobenzoic acid (ABA) can be hydroxylated efficiently.

[0018] According to the present invention, 3-hydroxy-4-aminobenzoic acid derivatives can be manufactured efficiently.

[0019] (1) Definition

[0020] In this specification, the identity of amino acid or nucleotide sequences is calculated using the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated using the homology analysis (Search Homology) program of the genetic information processing software GENTYX Ver. 12, with the unit size to compare (ktup) set to 2.

[0021] In this specification, "at least 90% identity" of an amino acid sequence or nucleotide sequence means 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and preferably 99% or more.

[0022] In this specification, "amino acid sequences with one or more amino acids deleted, substituted, added, or inserted" refers to amino acid sequences with one or more but less than 10, preferably one or more but less than 8, more preferably one or more but less than 5, and even more preferably one or more but less than 3 amino acids deleted, substituted, added, or inserted. Furthermore, in this specification, "nucleotide sequences with one or more nucleotides deleted, substituted, added, or inserted" refers to nucleotide sequences with one or more but less than 30, preferably one or more but less than 24, more preferably one or more but less than 15, and even more preferably one or more but less than 9 nucleotides deleted, substituted, added, or inserted. In this specification, the term "addition" of amino acids or nucleotides includes the addition of amino acids or nucleotides at one or both ends of the sequence.

[0023] In this specification, a “functionally connected” control region and gene means that the gene and control region are connected in a manner that enables the gene to be expressed under the control of the control region. The order of the “functionally connected” gene and control region is well known to those skilled in the art.

[0024] In this specification, the term "originally" used to describe the function, trait, or characteristic of a cell is used to indicate that the function, trait, or characteristic is present in the wild type of that cell. In contrast, the term "exogenous" is used to indicate a function, trait, or characteristic introduced from outside the cell, rather than originating from it. For example, an "exogenous" gene or polynucleotide is a gene or polynucleotide introduced into the cell from outside. Exogenous genes or polynucleotides can be of the same biological origin as the cell into which they are introduced, or they can be of a different biological origin (i.e., xenogeneic genes or polynucleotides).

[0025] (2) Manufacturing of 3-hydroxy-4-aminobenzoic acid derivatives

[0026] The method of the present invention is a method for producing 3-hydroxy-4-aminobenzoic acid from 4-aminobenzoic acid using microorganisms.

[0027] Specifically, examples of 4-aminobenzoic acids include 4-aminobenzoic acid derivatives represented by the following general formula (1):

[0028]

[0029] [In the formula, R] 1 Represents hydrogen atom, hydroxyl group (-OH), methoxy group (-OCH3), amino group (-NH2), fluorine atom (-F), chlorine atom (-Cl), bromine atom (-Br), iodine atom (-I), carboxyl group (-COOH), methyl group (-CH3), ethyl group (-CH2CH3), R 2It represents hydrogen atom, hydroxyl (-OH), methoxy (-OCH3), amino (-NH2), fluorine (-F), chlorine (-Cl), bromine (-Br), iodine (-I), carboxyl (-COOH), methyl (-CH3) or ethyl (-CH2CH3)].

[0030] Examples of 3-hydroxy-4-aminobenzoic acid derivatives can be exemplified by the general formula (2) below:

[0031]

[0032] [In the formula, R] 1 and R 2 The same groups as above are represented, where one of X represents a hydrogen atom and the other represents a hydroxyl group.

[0033] As R 1 The functional groups shown are preferably hydrogen atoms, hydroxyl groups (-OH), methoxy groups (-OCH3), fluorine atoms (-F), or methyl groups (-CH3).

[0034] As R 2 The functional groups shown are preferably hydrogen atoms, hydroxyl groups (-OH), methoxy groups (-OCH3), fluorine atoms (-F), or methyl groups (-CH3).

[0035] More preferably R 1 and R 2 All are hydrogen atoms.

[0036] The microorganisms used in this invention are microorganisms that produce polypeptides (hereinafter also referred to as "polypeptides of this invention") as described in (A) or (B).

[0037] (A) A polypeptide consisting of the amino acid sequence shown in Serial No. 2, or a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Serial No. 2 and having 4-hydroxybenzoic acid hydroxylase activity.

[0038] (B) A polypeptide consisting of the amino acid sequence shown in Serial No. 6, or a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Serial No. 6 and having 4-hydroxybenzoic acid hydroxylase activity.

[0039] Here, the polypeptide consisting of the amino acid sequence shown in Serial No. 2 (also known as “HFM122”) and the polypeptide consisting of the amino acid sequence shown in Serial No. 6 (also known as “HFM689”) are known as 4-hydroxybenzoic acid-3-monooxygenase (EC1.14.13.2).

[0040] As an example of an amino acid sequence that has at least 90% identity with the amino acid sequence shown in sequence number 2 or 6, one can be cited as an amino acid sequence that has one or more amino acids missing, substituted, added, or inserted relative to the amino acid sequence shown in sequence number 2 or 6.

[0041] "4-hydroxybenzoic acid hydroxylase activity" refers to the catalytic activity exhibited by 4-hydroxybenzoic acid hydroxylase, which is an enzyme that catalyzes the hydroxide oxidation of 4-hydroxybenzoic acid, preferably 4-hydroxybenzoic acid-3-monooxygenase that catalyzes the hydroxide oxidation of 4-hydroxybenzoic acid at the 3-position and has one or both of the catalytic activities of promoting the formation of protocatechuic acid and its reverse reaction.

[0042] 4-hydroxybenzoic acid hydroxylase activity can be determined by, for example, well-known methods (Yan Huang et al., Appl. Microbiol. Biotechnol., 78, 75-83 (2008).).

[0043] Methods for introducing mutations into amino acid sequences, such as deletions, substitutions, additions, or insertions, can include methods for introducing mutations into nucleotide sequences encoding those amino acid sequences, such as deletions, substitutions, additions, or insertions. Methods for introducing mutations into nucleotide sequences include, for example, mutagenesis induced by chemical mutagens such as ethyl methanesulfonate, N-methyl-N-nitrosoguanidine, and nitrous acid, or physical mutagens such as ultraviolet light, X-rays, gamma rays, and ion beams; site-specific mutation introduction methods; and methods described by Dieffenbach et al. (Cold Spring Harbar Laboratory Press, New York, 581-621, 1995). Methods for introducing site-specific mutations include Splicing overlap extension (SOE) PCR (Horton et al., Gene 77, 61-68, 1989), ODA method (Hashimoto-Gotoh et al., Gene, 152, 271-276, 1995), and Kunkel method (Kunkel, TA, Proc. Natl. Acad. Sci. USA, 1985, 82, 488). Alternatively, the Site-Directed Mutagenesis System Mutan-SuperExpress Km kit (Takara Bio) and Transformer can be used. TMCommercially available site-specific mutation introduction kits include the Site-Directed Mutagenesis Kit (Clonetech) and the KOD-Plus-Mutagenesis Kit (Toyobo).

[0044] In the "microorganism that produces polypeptides" of the present invention, the polypeptide is not limited to foreign substances, but also includes substances that are naturally present in the microorganism. As long as it contains the polynucleotide required for the expression of the polypeptide in an expressible state, it is preferred to be a microorganism in which the polynucleotide is introduced in an expressible manner, a microorganism in which the expression of the polynucleotide is enhanced, that is, a recombinant microorganism.

[0045] Here, as a polynucleotide, examples of polynucleotides (a) or (b) described below (hereinafter also referred to as "polynucleotides of the present invention") can be cited.

[0046] (a) A polynucleotide consisting of the nucleotide sequence shown in Serial No. 1, or a polynucleotide consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in Serial No. 1 and encoding a polypeptide having 4-hydroxybenzoic acid hydroxylase activity.

[0047] (b) A polynucleotide consisting of the nucleotide sequence shown in Serial No. 5, or a polynucleotide consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in Serial No. 5 and encoding a polypeptide having 4-hydroxybenzoic acid hydroxylase activity.

[0048] Examples of nucleotide sequences having at least 90% identity with the nucleotide sequence shown in sequence number 1 or 5 include nucleotide sequences with one or more nucleotides deleted, substituted, added, or inserted relative to the nucleotide sequence shown in sequence number 1 or 5. Methods for introducing mutations such as deletions, substitutions, additions, or insertions of nucleotides into the nucleotide sequence are described above. The aforementioned polynucleotide can be in the form of a single strand or two strands, or it can be DNA or RNA. The DNA can be artificial DNA such as cDNA or chemically synthesized DNA.

[0049] The aforementioned polynucleotides can be recombined into a vector. Preferably, the vector containing the polynucleotides of the present invention is an expression vector. Furthermore, it is preferable that the vector is an expression vector capable of introducing the polynucleotides of the present invention into a host microorganism and expressing the polynucleotides within the host microorganism. Preferably, the vector contains the polynucleotides of the present invention and a control region functionally linked thereto. The vector can be a vector capable of self-replication and replication outside the chromosome, such as a plasmid, or it can be a vector recombining within the chromosome.

[0050] Examples of specific vectors include: pBluescript II SK(-) (Stratagene), pUC18 / 19, pUC118 / 119 and other pUC-based vectors (Takara Bio), pET-based vectors (Takara Bio), pGEX-based vectors (GE Healthcare), pCold-based vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Mckenzie, T. et al., 1986, Plasmid 15(2):93-103), pBR322 (Takara Bio), pRS403 (Stratagene), pMW218 / 219 (Nippon Gene), pRI 909 / 910 and other pRI-based vectors (Takara Bio), pBI-based vectors (Clontech), IN3-based vectors (Inplanta Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (DJBallance et al.). al., Gene, 36, 321-331, 1985), pAB4-1 (van Hartingsveldt W et al., Mol Gen Genet, 206, 71-75, 1987), pLeu4 (MIGRoncero et al., Gene, 84, 335-343, 1989), pPyr 225 (CDSkory et al., Mol Genet) Genomics, 268, 397-406, 2002), pFG1 (Gruber, F. et al., Curr Genet, 18, 447-451, 1990), etc.

[0051] Furthermore, the aforementioned polynucleotide can also be constructed as a DNA fragment containing the polynucleotide. Examples of such DNA fragments include PCR-amplified DNA fragments and restriction endonuclease-cleaved DNA fragments. Preferably, the DNA fragment can be an expression cassette containing the polynucleotide of the present invention and a control region functionally linked thereto.

[0052] The control regions contained in the aforementioned vectors or DNA fragments are sequences of polynucleotides for expressing the present invention within host cells in which the vectors or DNA fragments have been introduced. Examples include expression regulatory regions such as promoters or terminators, and replication origins. The type of control region can be appropriately selected based on the type of host microorganism into which the vector or DNA fragment is introduced. If necessary, the vector or DNA fragment may also contain selection markers such as antibiotic resistance genes or amino acid synthesis-related genes.

[0053] As a means of introducing the polynucleotides of the present invention into host cells in an expressible manner or enhancing the expression of the polynucleotides of the present invention, examples include: introducing a vector or DNA fragment containing the polynucleotides of the present invention that are functionally linked to a control region, preferably a strong control region (a control region that can enhance expression compared to the wild type) into a host microorganism; or configuring the strong control region to be functionally linked to the polynucleotides of the present invention on the genome of the host microorganism (e.g., replacing the control region sequence of the polynucleotides of the present invention on the genome of the mother cell with the strong control region), etc.

[0054] The host cell can be any of fungi, yeast, actinomycetes, Escherichia coli, Bacillus subtilis, etc., but Escherichia coli and actinomycetes are preferred. Examples of actinomycetes include Corynebacterium, Mycobacterium, Rhodococcus, Streptomyces, and Propionibacterium, with Corynebacterium being preferred, and Corynebacterium glutamicum being more preferred.

[0055] When introducing vectors or DNA fragments into the aforementioned microorganisms, common transformation methods can be used, such as electroporation, transformation, transfection, splicing, protoplast method, particle gun method, Agrobacterium method, etc.

[0056] Microorganisms introduced with target vectors or DNA fragments can be selected using selection markers. For example, when the selection marker is an antibiotic resistance gene, microorganisms (transformants) introduced with the target vector or DNA fragment can be selected by culturing them in a medium supplemented with that antibiotic. Furthermore, for example, when the selection marker is an amino acid synthesis-related gene, after gene introduction into a host microorganism requiring that amino acid, microorganisms introduced with the target vector or DNA fragment can be selected based on the presence or absence of that amino acid requirement. Alternatively, the introduction of the target vector or DNA fragment can be confirmed by examining the DNA sequence of the transformant using methods such as PCR.

[0057] In addition, examples of well-known high-expression promoters such as the T7 promoter, lac promoter, tac promoter, and trp promoter can be cited as strong control regions, but are not specifically limited to these.

[0058] As a method to replace the control region of the aforementioned polynucleotides present on the genome of a host microorganism with a strong control region, examples include introducing a DNA fragment containing a polynucleotide sequence of a strong control region and a selection marker into a host cell, and selecting microorganisms transformed through homologous recombination or non-homologous recombination.

[0059] By culturing the polypeptide-producing microorganisms of the present invention thus prepared, evaluating the productivity of 3-hydroxy-4-aminobenzoic acid derivatives, and selecting appropriate recombinants, a useful 3-hydroxy-4-aminobenzoic acid-producing strain can be obtained. The determination of the product can be performed according to the methods described in the reference examples below.

[0060] The method for producing 3-hydroxy-4-aminobenzoic acid derivatives of the present invention is carried out by contacting 4-aminobenzoic acid derivatives with microorganisms that produce the aforementioned polypeptides. The contact conditions between the microorganisms and 4-aminobenzoic acid derivatives can be appropriately designed according to the microorganisms used.

[0061] That is, the culture medium for culturing the microorganisms of the present invention can be any of the natural or synthetic culture media, as long as it contains a carbon source, a nitrogen source, inorganic salts, etc., and is capable of efficiently culturing the microorganisms. For example, sugars such as glucose, polyols such as glycerol, alcohols such as ethanol, or organic acids such as pyruvic acid, succinic acid, or citric acid can be used as carbon sources. Furthermore, for example, peptone, meat extract, yeast extract, casein hydrolysate, basic soybean meal extract, alkylamines such as methylamine, or ammonia or its salts can be used. In addition, salts such as phosphates, carbonates, sulfates, magnesium, calcium, potassium, iron, manganese, and zinc, specific amino acids, specific vitamins, and antifoaming agents can be used as needed.

[0062] Culture can typically be carried out at 10°C to 40°C for 6 to 72 hours, preferably 9 to 60 hours, and more preferably 12 to 48 hours, with stirring or shaking as needed. Furthermore, antibiotics such as ampicillin or kanamycin can be added to the culture medium as needed during the culture.

[0063] There are no particular restrictions on the contact method between the culture (including culture medium, culture supernatant, cultured cells, and cell fragments, etc.) and 4-aminobenzoic acid derivatives. Contact can occur during microbial culture or separately after culture. Furthermore, 4-aminobenzoic acid derivatives can be biosynthesized within the cells during culture or added externally. There are no particular restrictions on the contact conditions; typically, contact can be carried out at 20°C to 50°C with stirring or vibration for 5 minutes to 72 hours, preferably 1 hour to 60 hours, and more preferably 1 hour to 24 hours, as needed.

[0064] When 3-hydroxy-4-aminobenzoic acid is produced within bacteria after contact with 4-aminobenzoic acid, the bacteria can be destroyed using commonly known methods, such as mechanical methods, enzymatic methods like lysozyme, or chemical treatment with surfactants, thereby extracting the 3-hydroxy-4-aminobenzoic acid. Alternatively, when 3-hydroxy-4-aminobenzoic acid is produced outside the bacteria, the culture medium can be used directly, or the bacteria can be removed by centrifugation or other methods.

[0065] There are no particular restrictions on the methods for collecting and separating 3-hydroxy-4-aminobenzoic acids from cultures. That is, it can be carried out by combining known methods such as ion exchange resin methods, precipitation methods, crystallization methods, recrystallization methods, and concentration methods. For example, after removing bacterial cells by centrifugation, ionic substances can be removed using cation and anion exchange resins, and then concentrated to obtain 3-hydroxy-4-aminobenzoic acids. 3-hydroxy-4-aminobenzoic acids accumulated in cultures can be used directly without separation.

[0066] Regarding the above-described embodiments, the following methods are also disclosed in this invention.

[0067] <1> A method for manufacturing 3-hydroxy-4-aminobenzoic acid, comprising a step of contacting the 4-aminobenzoic acid with microorganisms that produce polypeptides of (A) or (B) below.

[0068] (A) A polypeptide consisting of the amino acid sequence shown in Serial No. 2, or a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Serial No. 2 and having 4-hydroxybenzoic acid hydroxylase activity.

[0069] (B) A polypeptide consisting of the amino acid sequence shown in Serial No. 6, or a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Serial No. 6 and having 4-hydroxybenzoic acid hydroxylase activity.

[0070] <2> according to <1> The method wherein the microorganism contains the polynucleotide described in (a) or (b) in a state capable of expressing the polynucleotide described in (a) or (b).

[0071] (a) A polynucleotide consisting of the nucleotide sequence shown in Serial No. 1, or a polynucleotide consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in Serial No. 1 and encoding a polypeptide having 4-hydroxybenzoic acid hydroxylase activity.

[0072] (b) A polynucleotide consisting of the nucleotide sequence shown in Serial No. 5, or a polynucleotide consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in Serial No. 5 and encoding a polypeptide having 4-hydroxybenzoic acid hydroxylase activity.

[0073] <3> according to <1> or <2> The method wherein the microorganism is Escherichia coli or Corynebacterium spp.

[0074] <4> according to <1> ~ <3> In any one of the methods, the 4-aminobenzoic acid is a 4-aminobenzoic acid derivative represented by the following general formula (1):

[0075]

[0076] [In the formula, R] 1 Represents hydrogen atom, hydroxyl group (-OH), methoxy group (-OCH3), amino group (-NH2), fluorine atom (-F), chlorine atom (-Cl), bromine atom (-Br), iodine atom (-I), carboxyl group (-COOH), methyl group (-CH3), ethyl group (-CH2CH3), R 2 [Represents hydrogen atom, hydroxyl group (-OH), methoxy group (-OCH3), amino group (-NH2), fluorine atom (-F), chlorine atom (-Cl), bromine atom (-Br), iodine atom (-I), carboxyl group (-COOH), methyl group (-CH3), or ethyl group (-CH2CH3)]

[0077] 3-Hydroxy-4-aminobenzoic acids are 3-hydroxy-4-aminobenzoic acid derivatives represented by the following general formula (2):

[0078]

[0079] [In the formula, R1 and R2 represent the same groups as above, and one of X represents a hydrogen atom and the other represents a hydroxyl group].

[0080] <5> according to <4> The method, wherein, in the 4-aminobenzoic acid derivative represented by formula (1) and the 3-hydroxy-4-aminobenzoic acid derivative represented by formula (2), R 1 Preferably, it contains hydrogen atoms, hydroxyl groups (-OH), methoxy groups (-OCH3), fluorine atoms (-F), or methyl groups (-CH3).

[0081] <6> according to <4> or <5> The method, wherein, in the 4-aminobenzoic acid derivative represented by formula (1) and the 3-hydroxy-4-aminobenzoic acid derivative represented by formula (2), R 2 Preferably, it contains hydrogen atoms, hydroxyl groups (-OH), methoxy groups (-OCH3), fluorine atoms (-F), or methyl groups (-CH3).

[0082] <7> according to <4> The method, wherein, in the 4-aminobenzoic acid derivative represented by formula (1) and the 3-hydroxy-4-aminobenzoic acid derivative represented by formula (2), R 1 and R 2 All are hydrogen atoms.

[0083] <8> according to <1> ~ <7> In any one of the methods, the contact between 4-aminobenzoic acid and microorganisms is to contact the lysate of microorganisms with 4-aminobenzoic acid at 20°C to 50°C for 5 minutes to 72 hours, preferably 1 hour to 60 hours, more preferably 1 hour to 24 hours.

[0084] Example

[0085] The present invention will now be described in more detail based on embodiments, but the present invention is not limited thereto.

[0086] Example 1: Preparation of Transformed Strains

[0087] The PCR primers used in this embodiment are shown in Table 1.

[0088] [Table 1]

[0089] Primers Sequence (5'→3') Serial Number pET HFM122F GAAGGAGATATACATATGCGCACTCAGGTGGCTAT 7 pET HFM122R GTGGTGGTGGGTGGTGTTATACGAGGTGGCAGTCCTA 8 pET PHHYart_Pa F GAAGGAGATATACATATGAAAACTCAGGTGGCTAT 9 pET PHHYart_Pa R GTGGTGGTGGGTGGTGTTACTCGATTCTCCTCGTAAG 10 pET HFM689art F GAAGGAGATATACATATGAAAACCCAGGTTGCCAT 11 pET HFM689art R GTGGTGGTGGTGGTGTTAGACGGGGCAGACCGACGT 12 pET21a vec R ATGTATATCTCCTTCTTAAAGTTAAAC 13 pET21a vec F CACCACCACCACCACCACTGAGATC 14 forCPCR pET21a F CGAAATTAATACGACTCACTATAGGGGAATTGTG 15 forCPCR pET21a R CCAAGGGGTTATGCTAGTTATTGCTCAG 16

[0090] <Preparation of plasmid vectors>

[0091] A plasmid containing genes (sequence numbers 1, 3, and 5) encoding three 4-hydroxybenzoic acid hydroxylases (HFM122, HFM300, and HFM689) selected from flavin monooxygenases was synthesized using artificial gene synthesis. Using this plasmid as a template, the insert DNA fragment was synthesized by PCR using primers pET HFM122 F (sequence number 7), pET HFM122 R (sequence number 8), pET PHHYart_Pa F (sequence number 9), pETPHHYart_Pa R (sequence number 10), pET HFM689art F (sequence number 11), and pET HFM689art R (sequence number 12). Next, using plasmid pET21a as a template, the vector DNA fragment was amplified by PCR using primers pET21a vec R (sequence number 13) and pET21a vec F (sequence number 14). The above fragments were ligated using the In-Fusion HD Cloning Kit (Clontech) to construct plasmid vectors pET-HFM122, pET-HFM300, and pET-HFM689.

[0092] <Amplification of plasmid vectors>

[0093] The plasmid vectors pET-HFM122, pET-HFM300, and pET-HFM689 prepared above were used to transform *E. coli* DH5α strain (Nippon Gene) via competent cell transformation. The transformed cell culture was plated on LBamp agar medium (1% bacterial trypton, 0.5% yeast extract, 1% NaCl, 50 μg / mL ampicillin sodium, 1.5% agar) and incubated overnight at 37°C. The resulting colonies were then subjected to PCR using Sapphire Amp (TAKARA) and primers for CPCR pET21a F (SEQ ID NO. 15) and for CPCR pET21a R (SEQ ID NO. 16). Strains that confirmed the introduction of the target DNA fragment were selected as transformants. The transformants were inoculated into 1 mL of LBamp liquid medium (1% bacterial trypton, 0.5% yeast extract, 1% NaCl, and 50 μg / mL ampicillin sodium) and incubated overnight at 37°C. The plasmid vectors were then purified from the culture medium using a high-purity plasmid isolation kit (Roche Life Science).

[0094] <Introduction of plasmid vectors into host cells>

[0095] The plasmid vectors pET-HFM122, pET-HFM300, and pET-HFM689 obtained above were used to transform Escherichia coli strain BL21(DE3) (Nippon Gene) via competent cell transformation. The transformed cell culture was plated on LBamp agar and incubated overnight at 37°C. The resulting colonies were used as the transformed strains (HFM122, HFM300, and HFM689).

[0096] Example 2 Production of 3-hydroxy-4-aminobenzoic acid using transformants

[0097] <Cultivation of Transformed Strains>

[0098] The HFM122, HFM300, and HFM689 strains obtained above were inoculated into 1 mL of LBamp liquid medium (1% bacterial trypton, 0.5% yeast extract, 1% NaCl, and 50 μg / mL ampicillin sodium) and incubated overnight at 37°C. 100 μL of the resulting culture was then inoculated into 10 mL of Overnight Express medium (Merck) and incubated at 37°C for approximately 24 hours. The bacterial cells were then recovered by centrifugation.

[0099] <Preparation of bacterial cell lysate>

[0100] The bacterial cells of HFM122, HFM300 and HFM689 obtained above were suspended in 1 mL of Bugbuster Protein Extraction Reagent (Merck), shaken at 30°C for 20 minutes, and the substance after removing insoluble components by centrifugation was used as the bacterial cell lysis solution.

[0101] <Production capacity of 3-hydroxy-4-aminobenzoic acid>

[0102] 80 μL of 100 mM phosphate buffer (pH 7.0), 20 μL of 100 mM NADPH, and 20 μL of 20 mM 4-aminobenzoic acid were added to a 96-well plate (IWAKI) containing 80 μL of the cell lysate of strains HFM122, HFM300, and HFM689 obtained above. After standing for 1 hour, the 3-hydroxy-4-aminobenzoic acid was quantified in the order described in Reference Example 1 below.

[0103] The total protein content of the bacterial cell lysate was quantified using the Bio-Rad protein assay. The production capacity and enhancement rate of 3-hydroxy-4-aminobenzoic acid in strains HFM122 and HFM689 were calculated according to the following formula.

[0104] 3-Hydroxy-4-aminobenzoic acid production capacity = (3-hydroxy-4-aminobenzoic acid concentration after reaction / total protein content)

[0105] Production capacity improvement rate (%) = (3-hydroxy-4-aminobenzoic acid production capacity of HFM122 and HFM689 strains / 3-hydroxy-4-aminobenzoic acid production capacity of HFM300 strain) × 100 - 100

[0106] The results are shown in Table 2. Compared with HFM300, which is inspired by non-patent literature 3 and 4, an increase in productivity of 46% and 114% was observed in HFM122 and HFM689, respectively.

[0107] [Table 2]

[0108] Plant name 3-Hydroxy-4-aminobenzoic acid concentration (g / L) Production capacity increase rate (%) HFM122 strain 0.082 46 HFM300 strain 0.056 - HFM689 strain 0.120 114

[0109] Reference Example 1: Quantitative analysis of 3-hydroxy-4-aminobenzoic acid

[0110] The quantification of 3-hydroxy-4-aminobenzoic acid after the reaction was performed by HPLC. The reaction solution used for HPLC analysis was appropriately diluted with 0.1% phosphoric acid, and insoluble matter was removed using an AcroPrep 96-well plate (0.2 μm GHP membrane, Nihon Pall).

[0111] The HPLC apparatus used was a LaChrom Elite (Hitachi High-Technologies). An L-column ODS (4.6 mm ID × 50 cm, Chemical Substance Evaluation Institute) was used. Elution buffer A was set to 0.1% phosphoric acid, and eluent B to 70% methanol, with gradient elution performed at a flow rate of 1.0 mL / min and a column temperature of 40 °C. For the detection of 3-hydroxy-4-aminobenzoic acid, a UV detector (detection wavelength 280 nm) was used. A concentration calibration curve was prepared using a standard sample [3-hydroxy-4-aminobenzoic acid (marketer code A1194, Tokyo Chemical Industry Co., Ltd.)], and quantification of 3-hydroxy-4-aminobenzoic acid was performed based on the calibration curve. sequence list <110> Kao Co., Ltd. <120> Method for manufacturing 3-hydroxy-4-aminobenzoic acid derivatives <130> KS1630 <150> JP 2018-171849 <151> 2018-9-13 <160> 16 <170> PatentIn version 3.5 <210> 1 <211> 1176 <212> DNA <213> Artificial sequence <220> <223> Codon-optimized oligonucleotides <400> 1 atgcgcactc aggtggctat cgtaggagca ggcccagctg gcctgttctt gggccatctc 60 ctccgtcaag ctggtgtgga cgtcgtgatt ctggaacgca aagaccgtgc ttatgtcgaa 120 ggccgagttc gggctggtgt cctggaacgt atcacggtgg agctgatgga gcgtcttggt 180 gtggatgagc gaatgcgccg agagggcttg gtgcatgctg gcgctaatct tgcgtctgat 240 ggcgagatgt tccgtatcga catggcagag ctcacgggtg gttccaccgt catggtttac 300 ggccaacagg aggtgatgaa ggacctgttt gatgcagcag agcagcgcga tctgcgaatt 360 gtctttgacg ccgatgcagt gcgtctgcac gatgtggaag gcgaacgtcc tcacatcacc 420 tggcgcaaag acggggcaga acaccgcctg gactgcgatt tcattgccgg ctgcgacggc 480 taccacggag tttctcgtgc gaccattccc gataaggttc tcaagacctt cgaacgggtg 540 tatccctttg ggtggttggg aatcctggct gaagcacctc cgtgtgacca cgagttgatc 600 tactcgaacc atgatcgcgg ttttgccctg gcgtcgatgc gctcaccgac acgctcccgc 660 tattacgtgc agtgctcact cgacgatcgc ctcgaggatt ggtccgatga acggttctgg 720 gatgaagttt cggttcgcct gggaccggaa gcagccgctc ggatcgttcg cgcaccttcc 780 ttcgagaaga gcattgcccc acttcgctcc ttcgtttccg agcctatgcg gtatggccgc 840 cttttcctcg cgggtgatgc ggctcatatc gttccaccca ctggagcgaa agggatgaac 900 ttggccgtat cagacgtcat catgctgtcc gaagccctgg tcgaacacta ccacgaacgc 960 tcttccgctg gtatcgatgg ttacagcgca cgtgcacttg cccgcgtctg gaaggcggag 1020 cgtttcagct ggtggtttac ctcccttact caccgcttcc cagaccagga cggcttcgac 1080 cgcaagatgc aagtcgccga attggcatac atcaagggtt ctcgcgctgc ccaggtcacc 1140 ctggcggaga actacgtagg actgccactc gtataa 1176 <210> 2 <211> 391 <212> PRT <213> Caulobacter vibrioides <400> 2 Met Arg Thr Gln Val Ala Ile Val Gly Ala Gly Pro Ala Gly Leu Phe 1 5 10 15 Leu Gly His Leu Leu Arg Gln Ala Gly Val Asp Val Val Ile Leu Glu 20 25 30 Arg Lys Asp Arg Ala Tyr Val Glu Gly Arg Val Arg Ala Gly Val Leu 35 40 45 Glu Arg Ile Thr Val Glu Leu Met Glu Arg Leu Gly Val Asp Glu Arg 50 55 60 Met Arg Arg Glu Gly Leu Val His Ala Gly Ala Asn Leu Ala Ser Asp 65 70 75 80 Gly Glu Met Phe Arg Ile Asp Met Ala Glu Leu Thr Gly Gly Ser Thr 85 90 95 Val Met Val Tyr Gly Gln Gln Glu Val Met Lys Asp Leu Phe Asp Ala 100 105 110 Ala Glu Gln Arg Asp Leu Arg Ile Val Phe Asp Ala Asp Ala Val Arg 115 120 125 Leu His Asp Val Glu Gly Glu Arg Pro His Ile Thr Trp Arg Lys Asp 130 135 140 Gly Ala Glu His Arg Leu Asp Cys Asp Phe Ile Ala Gly Cys Asp Gly 145 150 155 160 Tyr His Gly Val Ser Arg Ala Thr Ile Pro Asp Lys Val Leu Lys Thr 165 170 175 Phe Glu Arg Val Tyr Pro Phe Gly Trp Leu Gly Ile Leu Ala Glu Ala 180 185 190 Pro Pro Cys Asp His Glu Leu Ile Tyr Ser Asn His Asp Arg Gly Phe 195 200 205 Ala Leu Ala Ser Met Arg Ser Pro Thr Arg Ser Arg Tyr Tyr Val Gln 210 215 220 Cys Ser Leu Asp Asp Arg Leu Glu Asp Trp Ser Asp Glu Arg Phe Trp 225 230 235 240 Asp Glu Val Ser Val Arg Leu Gly Pro Glu Ala Ala Ala Arg Ile Val 245 250 255 Arg Ala Pro Ser Phe Glu Lys Ser Ile Ala Pro Leu Arg Ser Phe Val 260 265 270 Ser Glu Pro Met Arg Tyr Gly Arg Leu Phe Leu Ala Gly Asp Ala Ala 275 280 285 His Ile Val Pro Pro Thr Gly Ala Lys Gly Met Asn Leu Ala Val Ser 290 295 300 Asp Val Ile Met Leu Ser Glu Ala Leu Val Glu His Tyr His Glu Arg 305 310 315 320 Ser Ser Ala Gly Ile Asp Gly Tyr Ser Ala Arg Ala Leu Ala Arg Val 325 330 335 Trp Lys Ala Glu Arg Phe Ser Trp Trp Phe Thr Ser Leu Thr His Arg 340 345 350 Phe Pro Asp Gln Asp Gly Phe Asp Arg Lys Met Gln Val Ala Glu Leu 355 360 365 Ala Tyr Ile Lys Gly Ser Arg Ala Ala Gln Val Thr Leu Ala Glu Asn 370 375 380 Tyr Val Gly Leu Pro Leu Val 385 390 <210> 3 <211> 1185 <212> DNA <213> Artificial sequence <220> <223> Codon‑optimized oligonucleotide <400> 3 atgaaaactc aggtggctat cattggcgcg ggtccgtccg gactcctcct tgggcagttg 60 ctgcacaaag ctgggattga caacgtcatt ctcgagcgac agaccccaga ctatgttctg 120 ggacgcatcc gcgctggcgt cttggagcaa ggtatggttg acctgttgcg ggaagcagga 180 gtcgaccgtc gaatggcacg cgatggcctg gtacacgaag gagtcgaaat cgcattcgcg 240 ggtcaacgcc gccgtatcga cctgaagcgc ctgtctggcg gcaagaccgt aaccgtctat 300 ggtcagacgg aagtgacccg tgacctgatg gaggctcgag aagcatgtgg tgctaccacc 360 gtttaccagg ctgcggaggt tcgcctccac gatcttcaag gcgaacgccc gtatgtgacc 420 ttcgaacgcg atggtgagcg cttgcgcctt gattgcgact atatcgctgg atgcgatggc 480 ttccacggga tttcccggca atccatccct gcggaacgcc tgaaagtgtt cgagcgggtc 540 tacccgttcg ggtggctcgg tctgcttgct gacactccac cagtgtctca cgaactcatc 600 tacgccaacc atcctcgtgg tttcgcgttg tgctcacaac gttcagccac tcgctcgcgt 660 tactacgtac aggttccact ctccgaaaag gtggaggatt ggtccgacga gcgcttttgg 720 accgaactca aagcacgtct gccctctgag gtcgcggaga agttggttac tggcccctct 780 ttggagaaga gcattgcccc actgcgctcg tttgtcgtgg aacccatgca gcatggacgc 840 ctgtttctgg ccggcgatgc agcacacatc gtgcctccaa caggtgccaa gggccttaat ctcgcggcat ccgatgtgtc gaccctctat cgtctgctgc ttaaggcata ccgggaaggc cgtggcgagc ttcttgaacg gtactccgcc atctgtctgc gccgtatctg gaaggccgaa cgcttctcct ggtggatgac gagcgttctg catcgctttc cggataccga tgccttctcc 1080 cagcgaattc agcagacgga actcgagtac tacttgggca gcgaagctgg tctggctaca atcgcagaga actacgttgg cctgccttac gaggagatcg agtaa <210> 4 <211> 394 <212> PRT <213> Prescription(Pseudomonas aeruginosa) <400> 4 Met Lys Thr Gln Val Ala Ile Ile Gly Ala Gly Pro Ser Gly Leu Leu 1 5 10 15 Leu Gly Gln Leu Leu His Lys Ala Gly Ile Asp Asn Val Ile Leu Glu 20 25 30 Arg Gln Thr Pro Asp Tyr Val Leu Gly Arg Ile Arg Ala Gly Val Leu 35 40 45 Glu Gln Gly Met Val Asp Leu Leu Arg Glu Ala Gly Val Asp Arg Arg 50 55 60 Met Ala Arg Asp Gly Leu Val His Glu Gly Val Glu Ile Ala Phe Ala 65 70 75 80 Gly Gln Arg Arg Arg Ile Asp Leu Lys Arg Leu Ser Gly Gly Lys Thr 85 90 95 Val Thr Val Tyr Gly Gln Thr Glu Val Thr Arg Asp Leu Met Glu Ala 100 105 110 Arg Glu Ala Cys Gly Ala Thr Thr Val Tyr Gln Ala Ala Glu Val Arg 115 120 125 Leu His Asp Leu Gln Gly Glu Arg Pro Tyr Val Thr Phe Glu Arg Asp 130 135 140 Gly Glu Arg Leu Arg Leu Asp Cys Asp Tyr Ile Ala Gly Cys Asp Gly 145 150 155 160 Phe His Gly Ile Ser Arg Gln Ser Ile Pro Ala Glu Arg Leu Lys Val 165 170 175 Phe Glu Arg Val Tyr Pro Phe Gly Trp Leu Gly Leu Leu Ala Asp Thr 180 185 190 Pro Pro Val Ser His Glu Leu Ile Tyr Ala Asn His Pro Arg Gly Phe 195 200 205 Ala Leu Cys Ser Gln Arg Ser Ala Thr Arg Ser Arg Tyr Tyr Val Gln 210 215 220 Val Pro Leu Ser Glu Lys Val Glu Asp Trp Ser Asp Glu Arg Phe Trp 225 230 235 240 Thr Glu Leu Lys Ala Arg Leu Pro Ser Glu Val Ala Glu Lys Leu Val 245 250 255 Thr Gly Pro Ser Leu Glu Lys Ser Ile Ala Pro Leu Arg Ser Phe Val 260 265 270 Val Glu Pro Met Gln His Gly Arg Leu Phe Leu Ala Gly Asp Ala Ala 275 280 285 His Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Ala Ser 290 295 300 Asp Val Ser Thr Leu Tyr Arg Leu Leu Leu Lys Ala Tyr Arg Glu Gly 305 310 315 320 Arg Gly Glu Leu Leu Glu Arg Tyr Ser Ala Ile Cys Leu Arg Arg Ile 325 330 335 Trp Lys Ala Glu Arg Phe Ser Trp Trp Met Thr Ser Val Leu His Arg 340 345 350 Phe Pro Asp Thr Asp Ala Phe Ser Gln Arg Ile Gln Gln Thr Glu Leu 355 360 365 Glu Tyr Tyr Leu Gly Ser Glu Ala Gly Leu Ala Thr Ile Ala Glu Asn 370 375 380 Tyr Val Gly Leu Pro Tyr Glu Glu Ile Glu 385 390 <210> 5 <211> 1170 <212> DNA <213> Artificial sequence <220> <223> Codon-optimized oligonucleotide <400> 5 atgaaaaccc aggttgccat cattggtgca ggaccagcag gcttgttgct cggtcacttg 60 ctcaaagccg aaggaatcga ctgcgtggtg ctggagcgcc aaacgccaga ctacgtactt 120 ggacggattc gcgcgggtgt tctggagcag atcaccgtgg gtctgatgga acgtcttggc 180 ctggatgctc gactgaaggc tgagggcctg gttgaggagg gctttaacct tgccgatggc 240 gaacgcctca ttcgcatcga cgtcgctaac ttgactggca agactgtcgt ggtgtatggc 300 cagaccgaga tcaccaaaga cttgatggac gctgcacctg aacgtggcct ccaggttatc 360 tacggtgcta gcgaagtggc actgttcgac atcgagtccg atgcccctta tgtcacctac 420 gtccatgacg gggctcctcg tcgaattgat gcacggttca tcgttgggtg tgacggcttt 480 cacggtccgt cacgtaaggc gattccggct tcggtggccc gcgaatacga acgcgtctat 540 ccgtttgggt ggctcggcat cctcgcagat gttccaccat gcaatcacga gctgatctac 600 gccaatcacg aacgcggttt cgcgctggct tccatgcgtt cccacacgcg tagccgctat 660 tacgtagatg ttcccctcac tgagaaggtg gaagattggt ctgacgaacg catttgggac 720 gaactggcag tacgccttgg ccccgaagca gccgctaaca tcacacgagg tccttcgatc 780 gagaagtcca tcgctccgct tcggtcctac gtgttcgagc caatgcgcca tggttccctg 840 cttctgtgcg gagatgcagc gcacattgtc ccaccaacag gcgctaaagg cctgaacttg 900 gcggcctctg atgtgcacta tgcggcagaa gcactgaccg gattcttcaa gcgcgcagat 960 aacgatgcag ttccgcgtta cagcgccaaa gcgcttgctc gggtttggaa gtctgaacgc 1020 ttctcctggt cactgaccaa gctcatgcat cgcttccctg aggacggacc ctttgaacgt 1080 gccatgcaag tcgcagagct cgagtacatc gcgacctcca aggctgcgca gacctctatc 1140 gccgagaact acgtcggtct gcccgtctaa 1170 <210> 6 <211> 389 <212> PRT <213> Novosphingobium aromaticivorans <400> 6 Met Lys Thr Gln Val Ala Ile Ile Gly Ala Gly Pro Ala Gly Leu Leu 1 5 10 15 Leu Gly His Leu Leu Lys Ala Glu Gly Ile Asp Cys Val Val Leu Glu 20 25 30 Arg Gln Thr Pro Asp Tyr Val Leu Gly Arg Ile Arg Ala Gly Val Leu 35 40 45 Glu Gln Ile Thr Val Gly Leu Met Glu Arg Leu Gly Leu Asp Ala Arg 50 55 60 Leu Lys Ala Glu Gly Leu Val Glu Glu Gly Phe Asn Leu Ala Asp Gly 65 70 75 80 Glu Arg Leu Ile Arg Ile Asp Val Ala Asn Leu Thr Gly Lys Thr Val 85 90 95 Val Val Tyr Gly Gln Thr Glu Ile Thr Lys Asp Leu Met Asp Ala Ala 100 105 110 Pro Glu Arg Gly Leu Gln Val Ile Tyr Gly Ala Ser Glu Val Ala Leu 115 120 125 Phe Asp Ile Glu Ser Asp Ala Pro Tyr Val Thr Tyr Val His Asp Gly 130 135 140 Ala Pro Arg Arg Ile Asp Ala Arg Phe Ile Val Gly Cys Asp Gly Phe 145 150 155 160 His Gly Pro Ser Arg Lys Ala Ile Pro Ala Ser Val Ala Arg Glu Tyr 165 170 175 Glu Arg Val Tyr Pro Phe Gly Trp Leu Gly Ile Leu Ala Asp Val Pro 180 185 190 Pro Cys Asn His Glu Leu Ile Tyr Ala Asn His Glu Arg Gly Phe Ala 195 200 205 Leu Ala Ser Met Arg Ser His Thr Arg Ser Arg Tyr Tyr Val Asp Val 210 215 220 Pro Leu Thr Glu Lys Val Glu Asp Trp Ser Asp Glu Arg Ile Trp Asp 225 230 235 240 Glu Leu Ala Val Arg Leu Gly Pro Glu Ala Ala Ala Asn Ile Thr Arg 245 250 255 Gly Pro Ser Ile Glu Lys Ser Ile Ala Pro Leu Arg Ser Tyr Val Phe 260 265 270 Glu Pro Met Arg His Gly Ser Leu Leu Leu Cys Gly Asp Ala Ala His 275 280 285 Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Ala Ser Asp 290 295 300 Val His Tyr Ala Ala Glu Ala Leu Thr Gly Phe Phe Lys Arg Ala Asp 305 310 315 320 Asn Asp Ala Val Pro Arg Tyr Ser Ala Lys Ala Leu Ala Arg Val Trp 325 330 335 Lys Ser Glu Arg Phe Ser Trp Ser Leu Thr Lys Leu Met His Arg Phe 340 345 350 Pro Glu Asp Gly Pro Phe Glu Arg Ala Met Gln Val Ala Glu Leu Glu 355 360 365 Tyr Ile Ala Thr Ser Lys Ala Ala Gln Thr Ser Ile Ala Glu Asn Tyr 370 375 380 Val Gly Leu Pro Val 385 <210> 7 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 7 gaaggagata tacatatgcg cactcaggtg gctat 35 <210> 8 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 8 gtggtggtgg tggtgttata cgagtggcag tccta 35 <210> 9 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 9 gaaggagata tacatatgaa aactcaggtg gctat 35 <210> 10 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 10 gtggtggtgg tggtgttat cgatctcctc gtaag 35 <210> 11 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 11 gaaggagata tacatatgaa aacccaggtt gccat 35 <210> 12 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 12 gtggtggtgg tggtgttaga cgggcagacc gacgt 35 <210> 13 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 13 atgtatatct ccttcttaaa gttaaac 27 <210> 14 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 14 caccaccacc accaccactg agatc 25 <210> 15 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 15 cgaaattaat acgactcact ataggggaat tgtg 34 <210> 16 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 16 ccaaggggtt atgctagtta ttgctcag 28

Claims

1. A method for manufacturing 3-hydroxy-4-aminobenzoic acid, wherein, The process includes contacting 4-aminobenzoic acid with microorganisms that produce polypeptides (A) or (B) below. (A) A polypeptide consisting of the amino acid sequence shown in Serial Number 2; (B) A polypeptide consisting of the amino acid sequence shown in Serial Number 6. The microorganism is Escherichia coli. Contact between 4-aminobenzoic acid and microorganisms involves contacting the lysate of microbial cells with 4-aminobenzoic acid at 20°C to 50°C for 5 minutes to 72 hours.

2. The method according to claim 1, wherein, Microorganisms contain polynucleotides of (a) or (b) in a state capable of expressing (a) or (b) below. (a) A polynucleotide consisting of the nucleotide sequence shown in sequence number 1; (b) A polynucleotide consisting of the nucleotide sequence shown in sequence number 5.

3. The method according to claim 1 or 2, wherein, 4-Aminobenzoic acids are 4-aminobenzoic acid derivatives represented by the following general formula (1): In the formula, R 1 Represents hydrogen atom, hydroxyl group, methoxy group, amino group, fluorine atom, chlorine atom, bromine atom, iodine atom, carboxyl group, methyl group, ethyl group, R 2 This represents hydrogen atom, hydroxyl group, methoxy group, amino group, fluorine atom, chlorine atom, bromine atom, iodine atom, carboxyl group, methyl group, or ethyl group. 3-Hydroxy-4-aminobenzoic acids are 3-hydroxy-4-aminobenzoic acid derivatives represented by the following general formula (2): In the formula, R 1 Represents hydrogen atom, hydroxyl group, methoxy group, amino group, fluorine atom, chlorine atom, bromine atom, iodine atom, carboxyl group, methyl group, ethyl group, R 2 The group X represents a hydrogen atom, hydroxyl group, methoxy group, amino group, fluorine atom, chlorine atom, bromine atom, iodine atom, carboxyl group, methyl group, or ethyl group. One of the groups X represents a hydrogen atom, and the other represents a hydroxyl group.

4. The method according to claim 3, wherein, In the 4-aminobenzoic acid derivative shown in formula (1) and the 3-hydroxy-4-aminobenzoic acid derivative shown in formula (2), R 1 It can be a hydrogen atom, hydroxyl group, methoxy group, fluorine atom, or methyl group.

5. The method according to claim 3, wherein, In the 4-aminobenzoic acid derivative shown in formula (1) and the 3-hydroxy-4-aminobenzoic acid derivative shown in formula (2), R 2 It can be a hydrogen atom, hydroxyl group, methoxy group, fluorine atom, or methyl group.

6. The method according to claim 3, wherein, In the 4-aminobenzoic acid derivative shown in formula (1) and the 3-hydroxy-4-aminobenzoic acid derivative shown in formula (2), R 1 and R 2 All are hydrogen atoms.

Citation Information

Patent Citations

  • Laminate, package material, package and production method thereof

    JP2018171849A