Kit for screening colorectal cancer and advanced adenoma and its application

Abstract

The present invention provides a combination of primers and probes for performing quantitative PCR, which can be used to determine the methylation status and level of BMP3 gene and NDRG4 gene in patients in need, thereby resulting in extremely high diagnostic specificity and sensitivity for diagnosing the presence or absence of colorectal cancer (CRC) and / or advanced adenoma (AA) in patients in need. Compositions and methods for performing the diagnosis are provided.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application serial number 201810502359.7 filed on May 23, 2018 and Chinese patent application serial number 201810502387.9 filed on May 23, 2018, which are incorporated herein by reference in their entirety for all purposes. Technical Field

[0003] The present invention relates to compositions and methods for screening for colorectal cancer and advanced adenomas, among other uses.

[0004] Instructions for electronically submitting text files

[0005] The contents of the text file submitted electronically herewith are incorporated herein by reference in its entirety: Computer readable format copy of the Sequence Listing (file name: NEWH-017_01WO_SeqList_ST25.txt, record date: May 22, 2019, file size: 22 kilobytes). Background Art

[0006] Colorectal cancer (CRC) is the fourth most common cancer in the world, with a mortality rate only lower than lung cancer, liver cancer, and gastric cancer. The annual death toll caused by CRC is close to 700,000. CRC is a "modern" disease, with a higher incidence in developed countries than in developing countries. In the United States, colorectal cancer remains the second leading cause of death (Clinical Interventions in Aging 2016; 11: 967-976). In China, the incidence and mortality of CRC have increased since 2000 as people's living standards have improved (CACANCER J CLIN 2016; 66: 115-132). The 5-year survival rate of patients with early localized disease (stages I and II) is close to 90%, while the survival rate of those with advanced CRC is only 13.1%. The cost of treating patients with advanced CRC is often huge and may only alleviate the symptoms of the disease (Clinical Interventions in Aging 2016; 11: 967-976).

[0007] The development of CRC is a slow process, usually asymptomatic and difficult to detect in the early stage, until the tumor grows to a size of several centimeters, which may block defecation and cause cramping, pain or obvious bleeding. The development of CRC goes through a multi-step process, involving a series of histological, morphological and genetic changes accumulated over time: that is, from health, hyperplasia, small polyps, large polyps and adenocarcinoma to cancer. Polyps are abnormal cells that grow or accumulate locally in the intestinal mucosa. The dividing cells in the polyps can accumulate enough genetic changes to penetrate the intestinal wall and eventually evolve into CRC. However, after more than ten years of development, only a few polyps evolve into CRC. The two main types of malignant potential polyps are adenomas and sessile serrated polyps (SSP), each of which develops into CRC at different risks. The risk of adenoma developing into CRC is related to its size. Generally, the larger the size of the adenoma, the greater the potential for developing into CRC. Advanced adenoma (AA) refers to a size ≥1cm or a villous component of any size with ≥25% or high-grade dysplasia. Although only about 10% of most AAs become cancerous, 60%-70% of CRCs develop from adenomas, and the remaining 25%-35% of CRCs develop from SSPs (Clinical Interventions in Aging 2016; 11:967-976). Therefore, early detection of CRC and AAs and removal of lesions can effectively block the progression of CRC to save patients' lives, significantly improve patients' 5-year survival rate, and reduce the expensive treatment costs in the late stage of CRC, thereby greatly reducing the economic burden on families and society.

[0008] Currently, there are several tests used to detect CRC, the main ones including colonoscopy, sigmoidoscopy, CT colonography, fecal occult blood test (FOBT) and fecal immunochemical test (FIT).

[0009] The sensitivity of colonoscopy for detecting CRC is >95%. Its screening interval is every 10 years. The advantages of colonoscopy are high sensitivity and it can examine the entire colon while removing lesions. However, its disadvantages are invasive examination, and bowel preparation causes discomfort and patients need sedation. There is a risk of intestinal perforation and bleeding during colonoscopy. These limitations lead to low compliance with colonoscopy screening.

[0010] Sigmoidoscopy has a sensitivity of more than 95% for detecting distal colon. In combination with FOBT, the interval for screening CRC using sigmoidoscopy is every 5 years. The advantages of using sigmoidoscopy to screen for CRC are high sensitivity, no need for systemic sedation, and the ability to remove lesions simultaneously during the examination. Its disadvantages are that it is a semi-invasive examination, which can easily cause discomfort during the examination, and the high cost of the examination.

[0011] CT colonography uses radiation to visualize the colon, has a sensitivity of >90% and is performed every 5 years. Its advantages are that it has high sensitivity, can visualize the entire colon, and does not require sedation. Disadvantages are that the test is a semi-invasive examination, making the patient prone to discomfort during the screening process. In addition, lesions cannot be removed at the same time, and radiation safety needs to be considered.

[0012] In summary, the above-mentioned tests based on imaging for detecting CRC have high sensitivity, but they are expensive, and bowel preparation is prone to cause discomfort and other side effects. Therefore, patient compliance is low. In addition, these determinations require specialized equipment, as well as doctors with professional skills and rich experience, which may not be available. Therefore, the overall screening / detection rate is low. In addition, some patients are not suitable for these determinations. For example, the success rate of bowel preparation in diabetic patients is low, and the risk of side effects is high (J Gastrointestin Liver Dis 2010; 19: 369-372, World J Gastrointest Endosc 2013; 5: 39-46).

[0013] FOBT and FIT detect hemoglobin in the patient's stool by enzyme reaction and immunochemical methods, respectively, with a sensitivity of 33%-75% and 60%-85% for CRC detection, respectively, and the tests are performed every year. Although FOBT and FIT are easy to promote, non-invasive and low-cost, the detection rate of precancerous lesions is low (Clinical Interventions inAging 2016; 11 967-976).

[0014] During the progression of polyps to CRC, mutations and methylation changes accumulate in some genes (such as APC, KRAS, p53, BRAF, NDRG4, BMP3, etc.) (Clinical Interventions in Aging 2016; 11:967-976). Therefore, detecting these mutations or methylation changes can help detect CRC and precancerous lesions.

[0015] Zou et al. (Clinical Chemistry 2012; 58: 2375-383) used methylation qPCR to detect the methylation levels of BMP3, NDRG4, VIM and TFPI2 genes in tissue samples. Among a total of 37 CRC tissue samples, 25 adenoma tissue samples and 29 healthy tissue samples were tested. At a specificity of 95%, the sensitivity of BMP3, NDRG4, VIM and TFPI2 genes to CRC detection was 84%, 92%, 86% and 92%, respectively, and the sensitivity to adenoma detection was 68%, 76%, 76% and 88%, respectively. It shows that the detection of gene methylation in colon cancer tissue has high sensitivity and specificity. However, the tissue sampling method is difficult to be widely used because the sampling process will cause certain damage to the patient's body. Therefore, it is not suitable for screening CRC and precancerous lesions in the general population.

[0016] The multi-target stool DNA (mt-sDNA) test includes methylation and mutation detection of tumor exfoliated cells and hemoglobin detection in stool samples. The test is screened every 3 years and has the advantages of high sensitivity, non-invasiveness and easy promotion (Clinical Interventions In Aging 2016; 11: 967-976). As a screening method, mt-sDNA can detect CRC and AA early, thereby greatly improving the survival rate of patients. Imperiale et al. (N Engl J Med 2014; 370: 1287-97) established a system based on mt-sDNA for methylation detection of BMP3 and NDRG4 genes, point mutation detection of KRAS gene and fecal hemoglobin detection, and then evaluated the risk of CRC and AA according to the logistic regression formula. The sensitivity of CRC and AA detection was 92.3% and 42.4%, respectively, and the specificity was 86.6%.

[0017] The use of mt-sDNA to screen sporadic CRC and AA has the advantage of being non-invasive compared to colonoscopy and being more sensitive compared to FOBT and FIT, but the sensitivity of AA detection is still much lower than that of CRC detection (Clinical Interventions in Aging 2016; 11:967-976).

[0018] Currently, mt-sDNA-based products for detecting CRC or AA include It is mainly developed for European and American populations. There are no products available for CRC and AA testing in Asian populations. Specifically, according to the US Food and Drug Administration The “Summary of safety and effectiveness data (SSED)” (www.accessdata.fda.gov / cdrh_docs / pdf13 / P130017b.pdf) was used in Caucasian and African American populations. The sensitivity of AA detection was 42.3% and 42.4%, respectively, but the sensitivity of AA detection using the same products in Asian populations was only 30.8%. Therefore, there is still a need to develop an effective system for CRC and / or AA detection in Asian populations to cope with the current increase in the incidence and mortality of colorectal cancer in Asian countries.

[0019] Although multiple studies have been conducted on methods for detecting methylation of BMP3 and NDRG4 genes in stool samples from patients with CRC and AA, there are no detailed comprehensive studies on the hypermethylated CpG sites in BMP3 and NDRG4 genes in Asian populations (ONCOLOGY LETTERS 2014; 8: 1751-1756; ONCOLOGY LETTERS 2015; 9: 1383-1387). In addition, due to limited sample size, previous studies on methylation of BMP3 and NDRG4 genes in Asian patients were not helpful in identifying the methylation sites most associated with CRC and AA. Therefore, there is still a need to determine the exact locations of the hypermethylated CpG sites of BMP3 and NDRG4 genes in Asian populations, as well as to design and optimize kits based on these methylated CpG sites to make the detection of AA more sensitive. Summary of the invention

[0020] The present disclosure provides DNA sequences consisting of hypermethylated CpG sites in the promoter regions of BMP3 and NDRG4 genes.

[0021] The present disclosure also provides preferred primers and probes for detecting methylation of the BMP3 or NDRG4 gene, and a combination thereof for detecting methylation of both the BMP3 and NDRG4 genes.

[0022] The present disclosure also provides a kit for detecting CRC and AA in Asian populations. A DNA sequence consisting of a high-methylated CpG site in the promoter region of the BMP3 and NDRG4 genes can be used as a marker for detecting CRC and / or AA in Asian populations.

[0023] Compared with other primers and probes, the preferred primer pairs and probes for detecting the methylation level of BMP3 and / or NDRG4 genes have significantly higher sensitivity and specificity for detecting tumor tissues (such as CRC and AA, and especially AA). In addition, the combination of these preferred primers and probes of the present disclosure also achieves significantly higher sensitivity and specificity for detecting tumor tissues (such as CRC and AA, and especially AA).

[0024] Also provided is a kit for detecting CRC and AA in Asian populations based on the above preferred primer and probe combination.

[0025] In some embodiments, the kit comprises: (1) a preferred combination of primer pairs and probes and corresponding qPCR reagents; (2) primers and probes for detecting seven mutations in the KRAS gene coding region and corresponding qPCR reagents; (3) reagents for detecting hemoglobin in feces.

[0026] In some embodiments, the results obtained from the assay using the kit are corrected and analyzed according to a logistic regression formula. In some embodiments, the formula is used to calculate a value for determining the presence or absence of CRC and / or AA. In some embodiments, the formula is P = e K / (1+e K ), where P is a comprehensive index, and K = a*△Ct1+b*△Ct2+c*△Ct3+d*FIT+X, where e is a natural constant, and a, b, c, d, X are clinical constants. In some embodiments, when the P value is equal to or greater than a predetermined threshold, the result indicates a positive detection of CRC and / or AA in the patient. In some embodiments, when the P value is less than a threshold, the result indicates a negative detection of CRC and / or AA in the patient, and the patient is determined to be healthy.

[0027] The present disclosure provides a kit for detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof. A patient in need thereof is a patient suspected of having CRC and / or AA, such as a patient having at least one sign of CRC and / or AA, or a patient at risk of developing CRC and / or AA, or a subject who has undergone routine medical examinations but otherwise has no signs or risks.

[0028] In some embodiments, the kit comprises a) a first primer pair and a first probe for detecting the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient. In some embodiments, the first primer pair and the first probe each comprise a continuous sequence of at least 16 nucleotides identical to, complementary to, or hybridizing under stringent hybridization conditions to SEQ ID NO.: 1.

[0029] In some embodiments, the kit comprises b) a second primer pair and a second probe for detecting the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient. In some embodiments, the second primer pair and the second probe each comprise a continuous sequence of at least 16 nucleotides identical to, complementary to, or hybridizing under stringent hybridization conditions to SEQ ID NO.: 2.

[0030] In some embodiments, the first primer pair and the first probe are selected from:

[0031] i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4, and a probe comprising SEQ ID NO.: 5;

[0032] ii) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10, and a probe comprising SEQ ID NO.: 11; and

[0033] iii) a forward primer comprising SEQ ID NO.: 15, a reverse primer comprising SEQ ID NO.: 16, and a probe comprising SEQ ID NO.: 17;

[0034] In some embodiments, wherein the second first primer pair and the second probe are selected from:

[0035] iv) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7, and a probe comprising SEQ ID NO.: 8;

[0036] v) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13, and a probe comprising SEQ ID NO.: 14; and

[0037] vi) a forward primer comprising SEQ ID NO.:18, a reverse primer comprising SEQ ID NO.:19, and a probe comprising SEQ ID NO.:20.

[0038] In some embodiments, the kit comprises:

[0039] i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4 and a probe comprising SEQ ID NO.: 5, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and

[0040] ii) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7 and a probe comprising SEQ ID NO.: 8, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

[0041] In some embodiments, the kit comprises:

[0042] i) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10 and a probe comprising SEQ ID NO.: 11, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and

[0043] ii) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13 and a probe comprising SEQ ID NO.: 14, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

[0044] In some embodiments, the kit comprises:

[0045] i) a forward primer comprising SEQ ID NO.: 15, a reverse primer comprising SEQ ID NO.: 16 and a probe comprising SEQ ID NO.: 17, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and

[0046] ii) a forward primer comprising SEQ ID NO.: 18, a reverse primer comprising SEQ ID NO.: 19 and a probe comprising SEQ ID NO.: 20, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

[0047] In some embodiments, both the first probe and the second probe comprise fluorescent donor and acceptor fluorophores.

[0048] In some embodiments, the first probe and the second probe are Probe.

[0049] In some embodiments, the kit further comprises:

[0050] (1) means for detecting the presence or absence of at least one mutation in the KRAS gene in the patient; and

[0051] (2) A means for detecting the presence or absence of hemoglobin in a biological sample obtained from the patient.

[0052] In some embodiments, the means for detecting the presence or absence of at least one mutation in the KRAS gene in a patient comprises at least one pair of primers capable of amplifying exon 12 and / or exon 13 regions of the KRAS gene in a polymerase chain reaction (PCR).

[0053] In some embodiments, the means for detecting the presence or absence of hemoglobin in a biological sample comprises an anti-hemoglobin antibody.

[0054] In some embodiments, the primers are capable of amplifying a region of the KRAS gene comprising at least one KRAS mutation selected from the group consisting of: G12D, G12V, G12C, G13D, G12A, G12R, G12S, and G13C.

[0055] In some embodiments, the antibody is a colloidal gold-conjugated antibody.

[0056] In some embodiments, the kit also includes a component for amplifying an internal quality control gene. The internal control can detect (1) contamination inhibition from the sample or extraction method, (2) detection instrument failure, (3) chemical failure (e.g., expired or degraded kits or components, or false reagent combinations), and (4) human error. In some embodiments, the internal control gene is a positive control, such as a gene that has been determined to be methylated in a positive control sample. In some embodiments, the internal control gene is a negative control, such as a gene that has been determined to be non-methylated in a negative control sample.

[0057] In some embodiments, the kit further comprises instructions for using the kit and / or interpreting test results obtained by using the kit.

[0058] In some embodiments, the kit further comprises means for detecting a complex formed by the antibody and hemoglobin in a biological sample.

[0059] In some embodiments, the biological sample obtained from the patient is a stool sample.

[0060] In some embodiments, the kit further comprises a bisulfite reagent, and a container suitable for mixing the bisulfite reagent with a biological sample from a patient or a polynucleotide obtained from a biological sample.

[0061] In some embodiments, instead of using bisulfite, the kit further comprises a methylation-sensitive restriction enzyme reagent.

[0062] In some embodiments, the kit further comprises: (1) a positive standard and a negative standard for detecting BMP3 methylation in a biological sample, and (2) a positive standard and a negative standard for detecting NDRG4 methylation in a biological sample.

[0063] In some embodiments, the positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence:

[0064] GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTT GCGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG(SEQ ID NO:67);

[0065] In some embodiments, the negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence:

[0066] GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTT GTGTGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG(SEQ ID NO:68);

[0067] In some embodiments, the positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence:

[0068] TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGC GCGAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGGTACGTTTTTCGCGGCGTATCGTTTTTAGTT(SEQ ID NO.:69).

[0069] In some embodiments, the negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence:

[0070] TGAGAAGTTGGTGGGGGTGTGGATTGATTGGGGTGTTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGGTGGAAGTTATGT GTGAGGGATTGTGGTTTGTTTGGGATTAGTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT(SEQ ID NO.:70).

[0071] Also provided are methods of detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof.

[0072] In some embodiments, the method comprises a) obtaining genomic DNA from a biological sample of the patient.

[0073] In some embodiments, the method further comprises b) treating the genomic DNA or fragment thereof of a) with one or more agents to convert its unmethylated cytosine bases to uracil or another base detectably different from cytosine in hybridization properties.

[0074] In some embodiments, the method further comprises c) contacting the treated genomic DNA or its treated fragments with a first primer pair for detecting the presence or absence of a methylation site of a gene encoding bone morphogenetic protein 3 (BMP3) in a patient. In some embodiments, the method further comprises contacting the treated genomic DNA or its fragments with a second primer pair for detecting the presence or absence of a methylation site of a gene encoding NDRG family member 4 protein (NDRG4) in a patient.

[0075] In some embodiments, the first primer pair comprises a contiguous sequence of at least 9 nucleotides that is identical to, complementary to, or hybridizes under stringent hybridization conditions to SEQ ID NO.: 1. In some embodiments, the second primer pair comprises a contiguous sequence of at least 9 nucleotides that is complementary to, or hybridizes under stringent hybridization conditions to SEQ ID NO.: 2.

[0076] In some embodiments, the treated genomic DNA or fragments thereof is amplified by the first primer pair or the second primer pair to produce at least one amplicon, or is not amplified.

[0077] In some embodiments, the method further includes d) determining the presence or absence of CRC or AA in the patient based on the presence or absence of the amplicon in the patient, the methylation status or level of at least one CpG dinucleotide of the BMP3 gene and the NDRG4 gene.

[0078] In some embodiments, quantitative PCR is used to amplify the methylated BMP3 gene in the sample. In some embodiments, quantitative PCR is used to amplify the methylated NDRG4 gene in the sample.

[0079] In some embodiments, the method further comprises amplifying a reference gene (also referred to as a normalizer, housekeeping gene, or endogenous control) using primers. In some embodiments, the reference gene in the sample is amplified using quantitative PCR.

[0080] In some embodiments, the first primer pair and the first probe are selected from:

[0081] i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4, and a probe comprising SEQ ID NO.: 5;

[0082] ii) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10, and a probe comprising SEQ ID NO.: 11; and

[0083] iii) a forward primer comprising SEQ ID NO.:15, a reverse primer comprising SEQ ID NO.:16 and a probe comprising SEQ ID NO.:17.

[0084] In some embodiments, the second first primer pair and the second probe are selected from:

[0085] iv) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7, and a probe comprising SEQ ID NO.: 8;

[0086] v) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13, and a probe comprising SEQ ID NO.: 14; and

[0087] vi) a forward primer comprising SEQ ID NO.:18, a reverse primer comprising SEQ ID NO.:19, and a probe comprising SEQ ID NO.:20.

[0088] In some embodiments, the method comprises using

[0089] i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4 and a probe comprising SEQ ID NO.: 5, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and

[0090] ii) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7 and a probe comprising SEQ ID NO.: 8, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

[0091] In some embodiments, the method comprises using

[0092] i) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10 and a probe comprising SEQ ID NO.: 11, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and

[0093] ii) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13 and a probe comprising SEQ ID NO.: 14, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

[0094] In some embodiments, the method comprises using

[0095] i) a forward primer comprising SEQ ID NO.: 15, a reverse primer comprising SEQ ID NO.: 16 and a probe comprising SEQ ID NO.: 17, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and

[0096] ii) a forward primer comprising SEQ ID NO.: 18, a reverse primer comprising SEQ ID NO.: 19 and a probe comprising SEQ ID NO.: 20, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

[0097] In some embodiments, both the first probe and the second probe comprise a fluorescent donor and an acceptor fluorophore. In some embodiments, the first probe and the second probe are Probe.

[0098] In some embodiments, the method further comprises the step of detecting the presence or absence of at least one mutation in the KRAS gene in a biological sample obtained from the patient.

[0099] In some embodiments, the method further comprises the step of detecting the presence or absence of hemoglobin in a biological sample obtained from a patient. In some embodiments, the step of detecting the presence or absence of hemoglobin in a biological sample comprises using an anti-hemoglobin antibody. In some embodiments, the antibody is a colloidal gold-conjugated antibody.

[0100] In some embodiments, the step of detecting the presence or absence of at least one mutation in the KRAS gene in the patient comprises using at least one pair of primers capable of amplifying exon 12 and / or exon 13 regions of the KRAS gene in a polymerase chain reaction (PCR). In some embodiments, the primers are capable of amplifying a region of the KRAS gene comprising at least one KRAS mutation selected from the group consisting of: G12D, G12V, G12C, G13D, G12A, G12R, G12S, and G13C.

[0101] In some embodiments, the mutant KRAS gene is amplified by one or more pairs of primers selected from the group consisting of:

[0102] (1) a forward primer G12D-F comprising SEQ ID NO.: 35, and a reverse primer Kras-R comprising SEQ ID NO.: 42;

[0103] (2) a forward primer G13D-F comprising SEQ ID NO.: 36, and a reverse primer Kras-R comprising SEQ ID NO.: 42;

[0104] (3) a forward primer G12V-F comprising SEQ ID NO.: 37, and a reverse primer Kras-R comprising SEQ ID NO.: 42;

[0105] (4) a forward primer G12C-F comprising SEQ ID NO.: 38, and a reverse primer Kras-R comprising SEQ ID NO.: 42;

[0106] (5) a forward primer G12S-F comprising SEQ ID NO.: 39, and a reverse primer Kras-R comprising SEQ ID NO.: 42;

[0107] (6) a forward primer G12A-F comprising SEQ ID NO.: 40, and a reverse primer Kras-R comprising SEQ ID NO.: 42; and

[0108] (7) A forward primer G12R-F comprising SEQ ID NO.:41, and a reverse primer Kras-R comprising SEQ ID NO.:42.

[0109] In some embodiments, the KRAS probe for qPCR comprises SEQ ID NO.:46.

[0110] In some embodiments, amplification of the BMP3 gene is performed in quantitative PCR (qPCR), and the method further comprises amplifying a first reference gene (ie, first reference gene) to determine the Ct value of BMP3 amplification as ΔCt1.

[0111] In some embodiments, amplification of the NDRG4 gene is performed in quantitative PCR (qPCR), and the method further comprises amplifying a second reference gene (ie, the second reference gene) to determine the Ct value of NDRG4 amplification as ΔCt2.

[0112] In some embodiments, amplification of the mutant KRAS gene is performed in quantitative PCR (qPCR), and the method further comprises amplifying a third reference gene (ie, the third reference gene) to determine the Ct value of mutant KRAS amplification as ΔCt3.

[0113] In some embodiments, the first reference gene is identical to the second reference gene. In some embodiments, the identical reference gene is a B2M gene.

[0114] In some embodiments, the third reference gene is the ACTB gene.In some embodiments, the qPCR primers for amplifying the ACTB gene comprise SEQ ID NOs.:43 and 44, and the probe comprises SEQ ID NO.:46.

[0115] In some embodiments, the method includes using (1) positive and negative standards for detecting BMP3 methylation in a sample, and (2) positive and negative standards for detecting NDRG4 methylation in a sample.

[0116] In some embodiments, the positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence:

[0117] GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTT GCGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG(SEQ ID NO:67);

[0118] In some embodiments, the negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence:

[0119] GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTT GTGTGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG(SEQ ID NO:68);

[0120] In some embodiments, the positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence:

[0121] TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGC GCGAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGGTACGTTTTTCGCGGCGTATCGTTTTTAGTT(SEQ ID NO.:69).

[0122] In some embodiments, the negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence:

[0123] TGAGAAGTTGGTGGGGGTGTGGATTGATTGGGGTGTTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGGTGGAAGTTATGT GTGAGGGATTGTGGTTTGTTTGGGATTAGTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT(SEQ ID NO.:70).

[0124] In some embodiments, the method includes amplifying a quality control standard.

[0125] In some embodiments, a method of detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof comprises using a kit of the present disclosure.

[0126] The present disclosure also provides a method of detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof, the method comprising:

[0127] a) obtaining unprocessed genomic DNA from a stool sample of the patient;

[0128] b) treating the genomic DNA or fragments thereof of a) with one or more agents to convert its unmethylated cytosine bases into uracil or another base that is detectably different from cytosine in hybridization properties;

[0129] c) performing quantitative PCR (qPCR) using the treated genomic DNA of b) as a template, and determining the Ct value of the BMP3 gene in the patient as ΔCt1;

[0130] d) performing qPCR using the treated genomic DNA of b) as a template, and determining the Ct value of the NDRG4 gene in the patient as ΔCt2;

[0131] e) performing qPCR using untreated genomic DNA as a template, and determining the Ct value of the mutant KRAS gene in the patient as ΔCt3;

[0132] f) performing a fecal immunochemical test on the hemoglobin in the stool sample and determining the score as FIT;

[0133] g) determining the K value, where K = a*ΔCt1+b*ΔCt2+c*ΔCt3+d*FIT+X, where a, b, c, d, X are clinical constants; and

[0134] h) Determine the value of the comprehensive index P, where P = e K / (1+e K ), where e is a natural constant.

[0135] The clinical constants a, b, c, d and X can be determined by analyzing the distribution of clinical data in a patient population.

[0136] In some embodiments, when P is equal to or greater than a predetermined threshold, the patient is determined to have CRC and / or AA, and when P is less than the predetermined threshold, the patient is determined to be healthy.

[0137] In some embodiments, the predetermined threshold is calculated from a distribution of clinical data, such as clinical data obtained from patients who have been determined to have CRC and / or AA and patients who have been determined not to have CRC and / or AA.

[0138] In some embodiments, the qPCR for amplifying the BMP3 gene comprises a first primer pair and a first probe, wherein the first primer pair and the first probe are selected from:

[0139] i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4, and a probe comprising SEQ ID NO.: 5;

[0140] ii) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10, and a probe comprising SEQ ID NO.: 11; and

[0141] iii) a forward primer comprising SEQ ID NO.:15, a reverse primer comprising SEQ ID NO.:16 and a probe comprising SEQ ID NO.:17.

[0142] In some embodiments, the qPCR for amplifying the NDRG4 gene comprises a second primer pair and a second probe, wherein the second primer pair and the second probe are selected from:

[0143] iv) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7, and a probe comprising SEQ ID NO.: 8;

[0144] v) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13, and a probe comprising SEQ ID NO.: 14; and

[0145] vi) a forward primer comprising SEQ ID NO.:18, a reverse primer comprising SEQ ID NO.:19, and a probe comprising SEQ ID NO.:20.

[0146] In some embodiments, the method comprises using

[0147] i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4 and a probe comprising SEQ ID NO.: 5, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in the sample, and

[0148] ii) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7 and a probe comprising SEQ ID NO.: 8, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in the sample.

[0149] In some embodiments, the method comprises using

[0150] i) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10 and a probe comprising SEQ ID NO.: 11, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in the sample, and

[0151] ii) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13 and a probe comprising SEQ ID NO.: 14, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in the sample.

[0152] In some embodiments, the method comprises using

[0153] i) a forward primer comprising SEQ ID NO.: 15, a reverse primer comprising SEQ ID NO.: 16 and a probe comprising SEQ ID NO.: 17, which is used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in the sample, and

[0154] ii) a forward primer comprising SEQ ID NO.: 18, a reverse primer comprising SEQ ID NO.: 19 and a probe comprising SEQ ID NO.: 20, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in the sample.

[0155] In some embodiments, both the first probe and the second probe comprise a fluorescent donor and an acceptor fluorophore. In some embodiments, the first probe and the second probe are Probe.

[0156] In some embodiments, the mutant KRAS gene comprises at least one KRAS mutation selected from the group consisting of: G12D, G12V, G12C, G13D, G12A, G12R, G12S, and G13C.

[0157] In some embodiments, the stool immunochemical test comprises a colloidal gold-conjugated antibody.

[0158] In some embodiments, step c) and step d) of the method include using the B2M gene as a reference gene.

[0159] In some embodiments, the method comprises using

[0160] (1) a positive standard and a negative standard for detecting BMP3 methylation in the sample, and

[0161] (2) Positive standards and negative standards for detecting NDRG4 methylation in the sample.

[0162] In some embodiments, the positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence:

[0163] GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTT GCGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG(SEQ ID NO:67).

[0164] In some embodiments, the negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence:

[0165] GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTT GTGTGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG(SEQ ID NO:68).

[0166] In some embodiments, the positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence:

[0167] TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGC GCGAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGGTACGTTTTTCGCGGCGTATCGTTTTTAGTT(SEQ ID NO.:69).

[0168] In some embodiments, the negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence:

[0169] TGAGAAGTTGGTGGGGGTGTGGATTGATTGGGGTGTTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGGTGGAAGTTATGT GTGAGGGATTGTGGTTTGTTTGGGATTAGTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT(SEQ ID NO.:70).

[0170] In some embodiments, the method comprises amplifying a quality control standard in step c) and step d).

[0171] Also provided are methods for diagnosing and treating colorectal cancer (CRC) and / or advanced adenoma (AA) in a patient in need thereof, the method comprising determining the presence or absence of CRC and / or AA in the patient by using a kit of the present disclosure, and treating the patient based on the presence or absence of CRC and / or AA in the patient.

[0172] Also provided are methods for diagnosing and treating colorectal cancer (CRC) and / or advanced adenoma (AA) in a patient in need thereof, the method comprising determining the presence or absence of CRC and / or AA in the patient by using the methods described herein, and treating the patient based on the presence or absence of CRC and / or AA in the patient. BRIEF DESCRIPTION OF THE DRAWINGS

[0173] Figures 1A to 1D The results of CpG island prediction and the relative positions of amplicons of two genes, BMP3 and NDRG4, are depicted. "Y" and "R" are degenerate bases. Figure 1A -The results of CpG island prediction in the promoter region of BMP3 gene; Figure 1B -Relative position of the amplicon of the BMP3 gene; Figure 1C -The results of CpG island prediction in the promoter region of NDRG4 gene; Figure 1D -Relative position of the amplicon of the NDRG4 gene.

[0174] Figure 2A Delineate the differences in methylated CpG sites of BMPs between Caucasian and Asian populations. Figure 2B Delineate the differences in methylated CpG sites of the NDRG4 gene between Caucasian and Asian populations.

[0175] Figure 3A The analytical sensitivity amplification curves for BMP3 obtained using the primers and probes in the preferred set 1 are depicted. Figure 3B The analytical sensitivity amplification curves for NDRG4 using primers and probes in Preferred Set 1 are depicted. Figure 3C The analytical sensitivity amplification curves for BMP3 obtained using the primers and probes in the preferred set 2 are depicted. Figure 3D The analytical sensitivity amplification curves for NDRG4 using primers and probes in Preferred Set 2 are depicted. Figure 3E The analytical sensitivity amplification curves for BMP3 obtained using primers and probes in the preferred set 3 are depicted. Figure 3F The analytical sensitivity amplification curves for NDRG4 using primers and probes in Preferred Set 3 are depicted. Figure 3G The analytical sensitivity amplification curve for BMP3 obtained using the primers and probe in Comparative Set 1 is depicted. Figure 3H Analytical sensitivity amplification curves for NDRG4 using primers and probes in Comparative Set 1 are depicted. Fig. 3I The analytical sensitivity amplification curves for BMP3 obtained using the primers and probes in Comparative Set 2 are depicted. Figure 3J The analytical sensitivity amplification curves for NDRG4 using the primers and probes in Comparative Set 2 are depicted. Figure 3K The analytical sensitivity amplification curves for BMP3 obtained using the primers and probes in Comparative Set 3 are depicted. Figure 3L Analytical sensitivity amplification curves for NDRG4 using primers and probes in Comparative Set 3 are depicted.

[0176] Figure 4AAssay-specific amplification curves for BMP3 using primers and probes in preferred set 1 are depicted. Figure 4B Assay-specific amplification curves for NDRG4 using primers and probes in Preferred Set 1 are depicted. Figure 4C Assay-specific amplification curves for BMP3 using primers and probes in preferred set 2 are depicted. Figure 4D Assay-specific amplification curves for NDRG4 using primers and probes in Preferred Set 2 are depicted. Figure 4E Assay-specific amplification curves for BMP3 using primers and probes in preferred set 3 are depicted. Figure 4F Assay-specific amplification curves for NDRG4 using primers and probes in preferred set 3 are depicted. Figure 4G Assay-specific amplification curves for BMP3 using primers and probes in Comparative Set 1 are depicted. Figure 4H Assay-specific amplification curves for NDRG4 using primers and probes in Comparative Set 1 are depicted. Fig. 4I Assay-specific amplification curves for BMP3 using primers and probes in Comparative Set 2 are depicted. Figure 4J Assay-specific amplification curves for NDRG4 using primers and probes in Comparative Set 2 are depicted. Figure 4K Assay-specific amplification curves for BMP3 using primers and probes in Comparative Set 3 are depicted. Figure 4L Assay-specific amplification curves for NDRG4 using primers and probes in Comparative Set 3 are depicted.

[0177] FIG. 5A to FIG. 5C Amplification curves using primers and probes in Preferred Group 1, Preferred Group 2, and Preferred Group 3, respectively, are depicted for detecting BMP3 methylation in clinical samples. FIG. 5D to FIG. 5F Amplification curves using primers and probes in Comparative Group 1, Comparative Group 2, and Comparative Group 3, respectively, are depicted for detecting BMP3 methylation in the same assay.

[0178] FIG. 6A to FIG. 6C Amplification curves using primers and probes in Preferred Group 1, Preferred Group 2, and Preferred Group 3, respectively, are depicted for detecting NDRG4 methylation in clinical samples. FIG. 6D to FIG. 6F Amplification curves using primers and probes in Comparative Group 1, Comparative Group 2, and Comparative Group 3, respectively, are depicted for detecting NDRG4 methylation in the same assay. DETAILED DESCRIPTION

[0179] definition

[0180] References to "one embodiment", "an embodiment", "one example", and "an example" indicate that one or more embodiments or one or more examples described may include a particular feature, structure, characteristic, property, element, or limitation, but not every embodiment or example must include the particular feature, structure, characteristic, property, element, or limitation. In addition, repeated use of the phrase "in one embodiment" does not necessarily refer to the same embodiment, even though it may.

[0181] As used herein, "nucleic acid" or "oligonucleotide" or "polynucleotide" means at least two nucleotides covalently linked together. The description of a single strand also defines the sequence of the complementary strand. Therefore, nucleic acid also encompasses the complementary strand of the single strand. Various variants of nucleic acid can be used for the same purpose as a given nucleic acid. Therefore, nucleic acid also encompasses substantially identical nucleic acids and their complements. The single strand provides a probe that can hybridize with a target sequence under stringent hybridization conditions. Therefore, nucleic acid also encompasses probes that hybridize under stringent hybridization conditions. Nucleic acids can be single-stranded or double-stranded, or can contain parts of both double-stranded and single-stranded sequences. Nucleic acids can be DNA (both genomic DNA and cDNA), RNA or a hybrid, wherein the nucleic acid can contain a combination of deoxyribonucleotides and ribonucleotides, and a combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods.

[0182] As used herein, the phrase "subject in need thereof" refers to an animal or human subject known to have cancer, or to be at risk of developing cancer (e.g., a genetically susceptible subject, a subject with a medical and / or family history of cancer, a subject who has been exposed to a carcinogen, an occupational hazard, an environmental hazard), and / or a subject exhibiting suspicious clinical signs of cancer (e.g., blood in the stool or melena, unexplained pain, sweating, unexplained fever, unexplained weight loss up to anorexia, changes in bowel habits (constipation and / or diarrhea), tenesmus (feeling of incomplete defecation, particularly for rectal cancer), anemia, and / or general weakness). Additionally or alternatively, a subject in need thereof may be a healthy human subject undergoing a routine health checkup.

[0183] As used herein, the term "about" refers to ± 10%.

[0184] The phrase "consisting essentially of" means that the composition or method may include additional ingredients and / or steps without materially altering the basic and novel characteristics of the claimed composition or method.

[0185] As used herein, the singular forms "a", "an", and "the" include plural referents unless the context clearly indicates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0186] As used herein, "stringent hybridization conditions" means conditions under which a first nucleic acid sequence (e.g., a probe) will hybridize to a second nucleic acid sequence (e.g., a target), such as in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions can be selected to be higher than the thermal melting point (T ) of a specific sequence at a defined ionic strength pH. m ) is about 5℃-10℃ lower. T m It can be the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (when the target sequence is present in excess, at T m Stringent conditions may be those conditions where the salt concentration is less than about 1.0 M sodium ion, such as about 0.01-1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is at least about 30° C. for short probes (e.g., about 10-50 nucleotides), and at least about 60° C. for long probes (e.g., greater than about 50 nucleotides). Stringent conditions may also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, a positive signal may be at least 2 to 10 times the background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5×SSC and 1% SDS, incubated at 42° C., or 5×SSC, 1% SDS, incubated at 65° C., and washed in 0.2×SSC and 0.1% SDS at 65° C.

[0187] As used herein, "substantially complementary" means that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides, or that the two sequences hybridize under stringent hybridization conditions.

[0188] As used herein, "substantially identical" means that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides or amino acids, or, with respect to nucleic acids, the first sequence is substantially complementary to the complement of the second sequence.

[0189] As used herein, the term "diagnosis" refers to classifying a condition or symptom, determining the severity (eg, grade or stage) of a condition, monitoring the progression of a condition, predicting the outcome of a condition, and / or the prospect of recovery.

[0190] The phrase "consisting essentially of" means that the composition or method may include additional ingredients and / or steps without materially altering the basic and novel characteristics of the claimed composition or method.

[0191] 1. DNA sequences of hypermethylated CpG sites in the promoter regions of BMP3 and NDRG4 genes in Chinese populations with CRC and AA

[0192] The present invention provides DNA sequences consisting of detailed hypermethylated CpG sites in the promoter regions of BMP3 and NDRG4 genes in Asian populations (eg, Chinese populations), which can be used as markers for CRC and AA detection.

[0193] In some embodiments, the native sequence of the BMP3 gene is provided as follows (5' to 3'), showing potential methylation sites marked by superscript "m":

[0194] GCCAGTTTGGC m CGGGTGTTCCCAAAAATAAAG m CGAGGAGGGAAGGTACAGACAGATCTTGAAACACC m CGGGCCACACA m CGC m CG m CGACCTACAGCTCTTTCTCAG m CGTTGGAGTGGAGA m CGG m CGCCCGCAG m CGCCCTG mCG m CGGGTGAGGTC m CG m CGCAGCTGCTGGGGAAGAGCCCACCTGTCAGGCTG m CGCTGGGTCAG m CGCAGCAAGTGGGGCTGGC m CGCTATCT m CGCTGCACCCGGC m CG m CGTCC m CGGGCTC m CGTG m CGCCCT m CGCCCCAG (SEQ ID NO.: 65).

[0195] In some embodiments, the native sequence of the NDRG4 gene is provided as follows (5' to 3'), showing potential methylation sites marked by superscript "m":

[0196] TGAGAAGT m CGG m CGGGGG m CG m CGGAT m CGAC m CGGGGTGTCCCCCAGGCTC m CG m CGT m CG m CGGTCCC m CGCT m CGCCCTCC m CGCC m CGCCCAC m CGGGCACCCCAGC m CG m CGCAGAAGG m CGGAAGCCA m CG m CG m CGAGGGAC m CG m CGGTC m CGTC m CGGGACTAGCCCCAGGCC m CGGCAC m CGCCC m CG m CGGGC m CGAGm CGCCCACACC m CGCCAAACCCA m CG m CGGGCA m CGCCCC m CG m CGG m CGCAC m CGCCCCCAGCC (SEQ ID NO.: 66).

[0197] After treating native genomic DNA or fragments thereof with one or more agents to convert its unmethylated cytosine bases to uracil (e.g., by bisulfite) or another base detectably different from cytosine in hybridization properties, the converted sequence of the BMP3 gene is as follows (5' to 3'), showing potential methylation sites marked by superscript "m":

[0198] GTTAGTTTGGT m CGGGTGTTTTTAAAAATAAAG m CGAGGAGGGAAGGTATAGATAGATTTTGAAATATT m CGGGTTATATA m CGT m CG m CGATTTATAGTTTTTTTTTAG m CGTTGGAGTGGAGA m CGG m CGTT m CGTAG m CGTTTTG m CG m CGGGTGAGGTT m CG m CGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTG m CGTTGGGTTAG m CGTAGTAAGTGGGGTTGGT m CGTTATTT m CGTTGTATT m CGGT m CG m CGTTT m CGGGTTT m CGTG m CGTTTT m CGTTTTAG (SEQ ID NO.: 1).

[0199] After treating native genomic DNA or fragments thereof with one or more agents to convert its unmethylated cytosine bases to uracil (e.g., by bisulfite) or another base detectably different from cytosine in hybridization properties, the converted sequence of the NDRG4 gene is as follows (5' to 3'), showing potential methylation sites marked by superscript "m":

[0200] TGAGAAGT m CGG m CGGGGG m CG m CGGAT m CGAT m CGGGGTGTTTTTTAGGTTT m CG m CGT m CG m CGGTTTT m CGTT m CGTTTTTT m CGTT m CGTTTAT m CGGGTATTTTAGT m CG m CGTAGAAGG m CGGAAGTTA m CG m CG m CGAGGGAT m CG m CGGTT m CGTT m CGGGATTAGTTTTAGGTT m CGGTAT m CGTTT m CG m CGGGT m CGAG m CGTTTATATT m CGTTAAATTTA m CG m CGGGTA m CGTTTT m CG m CGG m CGTAT m CGTTTTTAGTT (SEQ ID NO.: 2).

[0201] The DNA sequences of the present disclosure consisting of detailed hypermethylated CpG sites in the promoter region of the BMP3 and NDRG4 genes in the Asian population are particularly useful for detecting CRC and / or AA in the Asian population. For example, primers and probes can be designed to target one or more specific methylation sites in the BMP3 and / or NDRG4 genes as a tool to determine the methylation status and level of BMP3 and / or NDRG4, thereby determining the tumor status of patients in need.

[0202] 2. Three pairs of preferred primers and probes and corresponding reagents for detecting the methylation of BMP3 and NDRG4 genes respectively.

[0203] The present invention provides three pairs of preferred primers and probes, which are respectively used to detect the methylation levels of BMP3 and NDRG4 genes. These primers and probes are designed to target high-frequency methylated CpG sites in Asian populations (eg, Chinese populations).

[0204] In comparison with existing commercial products such as When compared with those primer pairs and probes in , these particular preferred primer pairs and probes have significantly higher sensitivity and specificity in detecting CRC and AA, especially for AA detection in Asian populations.

[0205] The sequences of primers and probes are as follows:

[0206]

[0207]

[0208] The oligonucleotides of the present disclosure advantageously allow for extremely specific amplification of hypermethylated CpG sites in the promoter region of BMP3 or NDRG4 in biological samples obtained from Asian patients.

[0209] In some embodiments, oligonucleotides are provided that are partially or fully complementary to the sequences of SEQ ID NOs: 3 to 20.

[0210] In some embodiments, oligonucleotides are provided that have one or more modifications compared to the probe sequences (e.g., SEQ ID NOs: 5, 11, 17, 8, 14, and 20). In some embodiments, the modifications may occur at the 5' end and / or 3' end of one of the nucleotide sequences listed in SEQ ID NOs.: 5, 11, 17, 8, 14, and 20.

[0211] Examples of modified base moieties that can be used to modify a nucleotide at any position in the nucleotide structure include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylquenoside, inosine, N-6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, methoxyaminomethyl-2-thiouracil, β-D-mannosylquercetin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-glycolic acid, pseudouracil, quercetin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-glycolic acid methyl ester, uracil-S-glycolic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, and 2,6-diaminopurine.

[0212] Examples of modified sugar moieties that can be used to modify a nucleotide at any position in the nucleotide structure include, but are not limited to, arabinose, 2-fluoroarabinose, xylose, and hexose, or modified components of the phosphate backbone, such as phosphorothioates, phosphorodithioates, phosphoramidates, phosphoramidates, phosphoroamidates, methylphosphonates, alkylphosphotriesters, or methylals or analogs thereof.

[0213] In some embodiments, the oligonucleotides in the sequences of SEQ ID NO: 5, 11, 17, 8, 14 and 20 are replaced by non-natural nucleotides (e.g., artificial nucleic acids). Artificial nucleic acids include, but are not limited to, peptide nucleic acids (PNA), morpholinos, locked nucleic acids (LNA), glycol nucleic acids (GNA), and threose nucleic acids (TNA). Each of these is distinguished from naturally occurring DNA or RNA by changes in the molecular backbone.

[0214] In some embodiments, the probes of the present disclosure comprise a label at the 5' and ends of the probe.

[0215] In some embodiments, the label at the 5' position of the probe comprises a fluorescent dye, such as a fluorophore. As used herein, a fluorophore is a fluorescent chemical compound that can re-emit light after light excitation. Fluorophores usually contain several aromatic groups combined, or planar or cyclic molecules with several π bonds. Non-protein organic fluorophores include, but are not limited to, xanthene derivatives (e.g., fluorescein, rhodamine, Oregon green, eosin, and Texas red); cyanine derivatives (e.g., cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, and merocyanine), squarylium derivatives and ring-substituted squarylium (e.g., Seta, SeTau, and Square dyes), naphthalene derivatives (e.g., dansyl and prodan derivatives), coumarin derivatives; oxadiazole derivatives (e.g., pyridyloxazole, nitrobenzoxadiazole, and benzoxadiazole); anthracene derivatives (e.g., anthraquinone, including DRAQ5, DRAQ7, and CyTR AK Orange); pyrene derivatives (cascade blue, etc.), oxazine derivatives (e.g., Nile red, Nile blue, etc.), and oxadiazole derivatives (e.g., pyridyloxazole, nitrobenzoxadiazole, and benzoxadiazole). blue), cresyl violet, oxazine 170, etc.; acridine derivatives (e.g., proflavine, acridine orange, acridine yellow, etc.); aryl methine derivatives (e.g., auramine, crystal violet, malachite green); tetrapyrrole derivatives (e.g., porphine, phthalocyanine, bilirubin). Specific examples include, but are not limited to, VIC, PET, Texas Red, Cy3, Cy5, FAM (6-carboxyfluorescein), HEX (6-carboxy-2',4,4',5',7,7'-hexachlorofluorescein), ROX (5(6)-carboxy-X-rhodamine), JOE (6-carboxy-4',5'-dichloro-21,71-dimethoxyfluorescein), TET (5'-tetrachloro-fluorescein phosphoramidite), NED (fluorescein benzoxanthene), TAMRA (6-carboxy-N,N,N,N-tetramethylrhodamine), FITC (fluorescein isothiocyanate).Examples of specific fluorophores that can be used in the probes disclosed herein are known to those skilled in the art and include those provided in U.S. Pat. No. 5,866,366 to Nazarenko et al., particularly 4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid; acridine and derivatives (such as acridine and acridine isothiocyanate), 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS), 4-amino-N-[3-vinylsulfonyl)phenyl]naphthaleneimide-3,5-disulfonate (Lucifer Yellow VS), N-(4-anilino-1-naphthyl)aquat imide, anthranilamide; brilliant yellow; coumarin and derivatives, such as coumarin, 7-amino-4-methylcoumarin (AMC, coumarin 120), 7-amino-4-trifluoromethylcoumarin (Coumaran 151); cyanosine; 4',6-diamidino-2-phenylindole (DAPI); 5',5"-dibromopyrogallol-sulfonphthalein (bromopyrogallol red); 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin; diethylenetriaminepentaacetic acid; 4,4'-diisothiocyanate dihydrocyanato-stilbene-2,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid; 5-[dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl chloride); 4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives, such as eosin and eosin isothiocyanate; erythrosin and derivatives, such as erythrosin B and erythrosin isothiocyanate; ethidium; fluorescein and derivatives, such as 5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF ), 2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), QFITC ​​(XRITC), -6-carboxy-fluorescein (HEX) and TET (tetramethylfluorescein); fluorescamine; IR144; IR1446; malachite green isothiocyanate; 4-methylumbelliferone; o-cresolphthalein; nitrotyrosine; pararosaniline; phenol red; B-phycoerythrin; o-phthalaldehyde; pyrene and derivatives such as pyrene, pyrene butyrate and 1-pyrene butyric acid succinimidyl ester; Reactive Red 4 (CIBACRON. TMBrilliant Red 3B-A); Rhodamine and derivatives, such as 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethylrhodamine and tetramethylrhodamine isothiocyanate (TRITC); sulfonyl rhodamine damine B; sulforhodamine 101 and the sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); riboflavin; rhodamine and terbium chelate derivatives; LightCycler Red 640; Cy5.5; and Cy56-carboxyfluorescein; boron dipyrromethene difluoride (BODIPY); acridine; stilbene; 6-carboxy-X-rhodamine (ROX); Cy3; Cy3.5, Cy5, Cy5.5, (Applied Biosystems); LC Red 640; LC Red 705; OregonGreen TM ;CALRed TM ; Red640; and Yakima yellow; Cyan500; Red610; Alexa647; Alexa 555; 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid (EDANS); tetramethylrhodamine (TMR); tetramethylrhodamine isocyanate (TMRITC), fluorescein isocyanate (FITC), χ-rhodamine, derivatives thereof, or any combination thereof. More fluorescent dyes are described in the following documents: U.S. Patent Nos. 5866366, 6818431, 6056859, 9140688, 9581587, 6165765, 6485909, 8158358, 7625723, 7560236, 7867701, 9150912, 7960543, 6555383, 6881570, 8198026, 5625081, 8445291, 9194801, 8835110, 7893227, 9243289, 7427674, 9512493, U.S. Patent Application Publication Nos. 20170152552, 20030170672, 2016028115 1, 20130084558, 20060281100, 20140234833, 20150072340, 20050089910, 20090081677, 2014002402220180171393, 20060188886, 20010018185, 20110151446, and WO / 2000 / 017330A1, WO / 2008 / 030071A1, WO / 2013 / 049631A1, WO / 2016 / 179090A1, WO / 2016 / 123895A1, WO / 2003 / 079022A1, each of which is incorporated herein by reference in its entirety.

[0216] In some embodiments, the probe of the present disclosure comprises a fluorescent donor and an acceptor fluorophore. As used herein, an acceptor fluorophore (e.g., a "fluorescence quencher") is a fluorophore that absorbs energy from a donor fluorophore, for example, in the range of about 400 to 900 nm. The wavelength of light absorbed by the acceptor fluorophore is generally at least 10 nm (e.g., at least 20 nm) higher than the maximum absorption wavelength of the donor fluorophore. The excitation spectrum of the acceptor fluorophore overlaps with the emission of the donor fluorophore so that the energy emitted by the donor can excite the quencher. Any acceptor fluorophore known in the art can be used. In a specific example, the acceptor fluorophore is a dark quencher, such as Dabcyl, QSY7 (Molecular Probes), QSY9 (Molecular Probes), QSY21 (Molecular Probes), QSY33 (Molecular Probes), BLACK HOLE QUENCHERS TM(GlenResearch, for example, BHQ-1, BHQ-2, BHQ-3), ECLIPSE TM Dark Quencher (Epoch Biosciences), DDQ-I, DDQ-II, Dabcyl, Eclipse, or IOWA BLACK TM (Integrated DNA Technologies, e.g., IowaBlack FQ, Iowa Black RQ). More fluorescence quenchers are described in the following documents: U.S. Patent Nos. 9957546, US9274008, U.S. Patent Publication Nos. 20140295422, 20090042205, 20160281182, 20180142284, 20140147929, and WO / 2009 / 009615A1, WO / 2016 / 160572A1, WO / 2016 / 178953A1, WO / 2018 / 229663A1, WO / 2010 / 051544A2, WO / 2013 / 152220A2, each of which is incorporated herein by reference in its entirety. Quenchers can reduce or quench the emission of the donor fluorophore. In this example, instead of detecting an increase in the emission signal of the acceptor fluorophore when sufficiently close to the donor fluorophore (or detecting a decrease in the emission signal of the acceptor fluorophore when sufficiently far away from the donor fluorophore), an increase in the emission signal of the donor fluorophore when the quencher is sufficiently far away from the donor fluorophore (or a decrease in the emission signal of the donor fluorophore when the quencher acceptor fluorophore is sufficiently close to the donor fluorophore) can be detected.

[0217] In some embodiments, the primers and probes of the present disclosure are based on fluorescence resonance energy transfer (FRET). Examples of oligonucleotides that can be used to detect amplicons using FRET include linear oligonucleotide probes, such as HybProbe; 5' nuclease oligonucleotide probes, such as probes; hairpin oligonucleotide probes, such as molecular beacons, scorpion primers, and UniPrimers; minor groove binding probes; and autofluorescent amplicons, such as sunrise primers.

[0218] In some embodiments, the primers and / or probes of the present disclosure are labeled with other functional entities, such as biotin, haptens, antigens, chemical groups, radioactive substances, enzyme labels, etc. Detection of labeled amplification products can be accomplished, for example, using fluorescence, chemiluminescence, densitometry, photometry, precipitation reactions, enzymatic reactions (including enzyme enhancement reactions, SPR ("surface plasmon resonance") methods, ellipsometry, refractive index measurements, reflectivity measurements, and the like.

[0219] In some embodiments, the primers and probes described herein can be used for quantitative PCR to determine the methylation status and level of BMP3 and / or NDRG4 genes in patients. In some embodiments, additional reactions can be included to amplify one or more reference genes. In some embodiments, the reference gene is a gene of the following patient: its activity is not affected by the presence or absence of CRC and AA, and is not affected by the methylation status and level of BMP3 and NDRG4. In some embodiments, the reference gene includes but is not limited to β-globin (HBB), telomerase (TERT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), albumin (ALB), β-actin (ACTB), β2 microglobulin (B2M) and T cell receptor γ (TRG).

[0220] In some embodiments, the B2M gene is used as a reference gene in quantitative PCR for detecting the methylation status and level of BMP3 / NDRG4.

[0221] In some embodiments, one or more other controls may be introduced, including but not limited to a no-template control (used to detect reagent or equipment contamination and to confirm positive results); a no-amplification control (used to detect background fluorescence produced by decomposed labeled probes); and a positive control (used to detect inhibitors or malfunctions, and to confirm that the reagents and equipment are working).

[0222] In some embodiments, qPCR is used to determine whether there is amplification of methylated BMP3 gene or methylated NDRG4 gene in the sample. The detected signal from the probe of BMP3 or NDRG4 is quantified by reference to a standard curve or by comparing the Ct value with the Ct value of a reference gene. The results are usually normalized using analysis of housekeeping genes. The cycle threshold (Ct) is defined as the number of cycles required for the fluorescent signal to cross a predetermined threshold (e.g., exceed the background level, such as exceed the amplification level in the negative control sample). In some embodiments, the threshold is automatically determined by the software of the qPCR instrument or other suitable methods. In some embodiments, the threshold is set to be slightly higher than (e.g., about 0.01%, 0.1%, 1%, 5% or 10%) the terminal fluorescence value in the negative control sample.

[0223] In some embodiments, when the Ct value associated with BMP3 or NDRG4 amplification in the test sample is no greater than (≤) about 35, 34, 33, 32, 31, 30 or less, the sample is determined to contain methylated BMP3 or NDRG4 and the patient suffers from CRC and / or AA (positive result), otherwise the sample is determined to be free of methylated BMP3 or NDRG4 and the patient does not suffer from CRC or AA (negative result). For reference gene amplification, when the Ct value associated with the control gene amplification in the sample is no greater than (≤) about 34, 33, 32, 31, 30, 29 or less, the reference gene amplification is determined to be positive, otherwise the reference gene amplification is determined to be negative. When the reference gene amplification is determined to be negative, the test result is invalid.

[0224] In some embodiments, the difference between the Ct value for BMP3 and the Ct value for amplification of a reference gene (ΔCt = Ct 目的基因 -Ct 参考基因 ) and is referred to as ΔCt1. In some embodiments, when ΔCt1 is not greater than a predetermined critical value (≤ critical value), the sample is determined to have BMP3 methylation (positive result), and the patient is determined to have CRC or AA. In some embodiments, when ΔCt1 is greater than a predetermined critical value (> critical value), the sample is determined to not have BMP3 methylation (negative result), and the patient is determined to be healthy. In some embodiments, the critical value is the corresponding ΔCt value of a sample comprising 5 ng / μL of a nucleotide sequence, and the methylation rate of the nucleotide sequence is 1%, such as about 8, 9, or 10.

[0225] In some embodiments, the difference between the Ct value for NDRG4 and the Ct value for amplification of a reference gene (ΔCt = Ct 目的基因 -Ct 参考基因 ) and is referred to as ΔCt2. In some embodiments, when ΔCt2 is not greater than a predetermined critical value (≤ critical value), the sample is determined to have NDRG4 methylation (positive result), and the patient is determined to have CRC or AA. In some embodiments, when ΔCt2 is greater than a predetermined critical value (> critical value), the sample is determined not to have NDRG4 methylation (negative result), and the patient is determined to be healthy. In some embodiments, the critical value is the corresponding ΔCt value of a sample comprising 5 ng / μL of a nucleotide sequence, and the methylation rate of the nucleotide sequence is 1%, such as about 8, 9, or 10.

[0226] In comparison with existing commercial products such as When compared with those primers and probes in , the preferred primers and probes of the present disclosure have extremely high sensitivity and specificity in detecting CRC and AA in Asian populations, especially for AA detection.

[0227] As used herein, the term "sensitivity" refers to the ratio of correctly detecting patients who actually suffer from CRC and / or AA in a given population. In some embodiments, the sensitivity is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or higher, or 100%. In some embodiments, the population size is at least about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000 or more.

[0228] As used herein, the term "specificity" refers to the ratio of a patient who does not actually suffer from CRC or AA in a given population to be correctly diagnosed as not suffering from the disease. In some embodiments, the specificity is at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or higher, or 100%. In some embodiments, the population size is at least about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000 or more.

[0229] As shown in the examples, the preferred primers and probes provide extremely high sensitivity and specificity in detecting methylation of BMP3 and NDRG4, resulting in extremely high sensitivity and specificity in detecting CRC and / or AA. For example, the sensitivity of CRC detection using three pairs of preferred primers and probes of the BMP3 gene is at least 85%; the sensitivity of CRC detection using three pairs of preferred primers and probes of the NDRG4 gene is at least 90%; the sensitivity of AA detection using three pairs of preferred primers and probes of the BMP3 gene is at least 66%; the sensitivity of AA detection using three pairs of preferred primers and probes of the NDRG4 gene is at least 73%. In addition, the specificity of CRC and AA detection using three pairs of preferred primers and probes of the BMP3 gene is about 97%-100% (e.g., at least about 97.8%); the specificity of CRC and AA detection using three pairs of preferred primers and probes of the NDRG4 gene is also about 97%-100% (e.g., at least about 97.8%).

[0230] 3. Three sets of preferred primer-probe combinations for detecting CRC and / or AA in patients.

[0231] The present disclosure also provides three sets of preferred primer and probe combinations for detecting the methylation levels of BMP3 and NDRG4 genes to determine the presence or absence of CRC or AA in patients. When compared with those combinations in , these specific combinations have unexpectedly higher sensitivity and specificity in detecting CRC and AA in Asian populations, especially for AA detection. The sequences of the three sets of preferred primers and probes are as follows:

[0232]

[0233]

[0234] As shown in the examples, the preferred combination of BMP3 and NDRG4 primer-probe sets provides very high sensitivity and specificity in detecting methylation of BMP3 and NDRG4, thereby leading to very high sensitivity and specificity in detecting CRC and / or AA. In some embodiments, this sensitivity and specificity is obtained when the same assay also includes KRAS gene analysis and hemoglobin testing, as explained in Example 5. For example, the overall sensitivity of CRC detection using the three preferred combinations of primers and probes for BMP3 and NDRG4 genes combined with KRAS gene analysis and hemoglobin testing is at least 95%; the sensitivity of AA detection using the three preferred combinations of primers and probes for BMP3 and NDRG4 genes combined with KRAS gene analysis and hemoglobin testing is at least 93%; the sensitivity of CRC+AA detection using the three preferred combinations of primers and probes for BMP3 and NDRG4 genes combined with KRAS gene analysis and hemoglobin testing is at least 97%; the specificity of CRC+AA detection using the three preferred combinations of primers and probes for BMP3 and NDRG4 genes combined with KRAS gene analysis and hemoglobin testing is at least 97%.

[0235] 4. Kits for detecting CRC and AA

[0236] The present disclosure provides a kit for BMP3 / NDRG4 methylation detection and / or CRC / AA detection in patients in need thereof. In some embodiments, the kit is particularly suitable for Asian patients, such as Chinese patients.

[0237] In some embodiments, the kit comprises: (1) at least one of the three preferred primer and probe combinations for detecting CRC and AA (combination numbers 4, 5 and 7 in Table 20), and corresponding qPCR reagents; (2) components for detecting seven mutations in the coding region of the KRAS gene (i.e., G12D, G13D, G12V, G12C, G12S, G12A and G13R), such as suitable primers and probes, and corresponding qPCR reagents; (3) components for detecting hemoglobin in stool samples, such as reagents based on FIT technology (e.g., anti-hemoglobin antibodies, and reagents for detecting a complex formed by the antibodies and hemoglobin in stool samples).

[0238] In some embodiments, the kit comprises at least one set of preferred primer-probe combinations as follows:

[0239] (1) Three groups of preferred primer and probe combinations are as follows:

[0240]

[0241]

[0242] (2) Triple quantitative PCR reagent used to detect the methylation levels of BMP3 and NDRG4 genes.

[0243] In some embodiments, the kit comprises reagents for performing multiplex PCR for simultaneously detecting methylation of BMP3 and NDRG4. In some embodiments, the multiplex PCR is quantitative PCR.

[0244] In some embodiments, the reagent includes Taq DNA polymerase. In some embodiments, the final concentration of Taq DNA polymerase is about 2U / reaction. In some embodiments, the reagent includes MgCl2. In some embodiments, the final concentration of MgCl2 in the reaction is 2mM. In some embodiments, the reagent includes dNTP. In some embodiments, the final concentration of dNTP is 0.2mM. In some embodiments, the reagent includes primers for amplifying BMP3, NDRG4 and reference genes of about 0.5mM to 0.75mM. In some embodiments, the reagent includes probes hybridized with the DNA sequences of BMP3, NDRG4 and reference genes of about 0.1mM to 0.25mM. In some embodiments, the reagent also includes PCR buffer, such as concentrated PCR buffer (e.g., 5x or 10x), which can be diluted to a final concentration of 1x. In some embodiments, B2M is a reference gene and is amplified for quality control in quantitative PCR.

[0245] (3) Primers and probes for detecting seven mutations in the KRAS gene coding region.

[0246] In some embodiments, the kit comprises a component for detecting a mutation in the KRAS gene. In some embodiments, the kit comprises primers and probes designed to amplify and detect seven mutant hotspots (G12D, G13D, G12V, G12C, G12S, G12A and G13R) of exon 12 and exon 13 in the open reading region of the KRAS gene. In some embodiments, the sequences of the primers and probes are as follows:

[0247] name Primer / probe Sequence ID Sequence (5' to 3') G12D-F Forward primer SEQ ID NO.:35 AACTTGTGGTAGTTGGAGGTGA G13D-F Forward primer SEQ ID NO.:36 AACTTGTGGTAGTTGGAGCTGGGGA G12V-F Forward primer SEQ ID NO.:37 AACTTGTGGTAGTTGGAGTTGT G12C-F Forward primer SEQ ID NO.:38 AAACTTGTGGTAGTTGGGGCTT G12S-F Forward primer SEQ ID NO.:39 AAACTTGTGGTAGTTGGTGCTA G12A-F Forward primer SEQ ID NO.:40 AACTTGTGGTAGTTGGAGCAGC G12R-F Forward primer SEQ ID NO.:41 AAACTTGTGGTAGTTGGAGCTC Kras-R Reverse primer SEQ ID NO.:42 GAATGGTCCTGCACCAGTAATATG ACTB-F Forward primer SEQ ID NO.:43 AGGGCTTCTTGTCCTTTCCTT ACTB-R Reverse primer SEQ ID NO.:44 CGTGCTCGATGGGGTACTTC KRAS-P Probe SEQ ID NO.:45 AGGCAAGAGTGCCTTGACGATACAGC ACTB-P Probe SEQ ID NO.:46 CGTGATGGTGGGCATGGGTCAGAAGGA

[0248] (4) Multiplex quantitative PCR reagent for detecting codon mutations of the KRAS gene.

[0249] A multiplex quantitative PCR system for detecting all seven mutations of the KRAS gene is also provided. In some embodiments, the multiplex quantitative PCR reaction comprises Taq DNA polymerase at a final concentration of 2.5 U / reaction, MgCl2 at a final concentration of 1 mM, dNTP at a final concentration of 0.1 mM, 0.3-0.9 μM primers for amplifying KRAS and ACTB genes, 0.05-0.1 μM probes hybridizing to DNA sequences of KRAS and ACTB genes, and 1× PCR buffer. ACTB is a reference gene and is amplified for quality control in quantitative PCR.

[0250] (5) Kit for detecting hemoglobin in feces

[0251] In some embodiments, the kit comprises reagents for detecting hemoglobin. In some embodiments, hemoglobin is qualitatively tested by enzyme-linked immunosorbent assay (ELISA).

[0252] 5. Logistic Regression Model

[0253] In some embodiments, after the results of the BMP3 / NDRG4 methylation test, the KRAS mutation test, and the hemoglobin test are obtained, all results are compiled and subjected to a logistic regression model to determine the presence or absence of CRC and / or AA in the patient.

[0254] In some embodiments, the method comprises calculating a value for a comprehensive cancer index value P, where P = e K / (1+e K ), where e is a natural constant.

[0255] In some embodiments, K is defined as K=a*ΔCt1+b*ΔCt2+c*ΔCt3+d*FI T+X, where a, b, c, d, X are clinical constants. ΔCt1, ΔCt2, and ΔCt3 are the Ct values ​​of BMP3, NDRG4, and KRAS minus the Ct value of the reference gene.

[0256] In some embodiments, the test result is positive when the P value is equal to or greater than a predetermined threshold, otherwise it is negative. A positive result indicates that the individual may have CRC or AA, otherwise he is healthy.

[0257] 6. Treatment Methods

[0258] In some embodiments, the methods of the present disclosure include treating a patient in need thereof after classifying the patient as having colorectal cancer and / or adenoma. In some embodiments, treatment includes but is not limited to surgery, chemotherapy, radiation therapy, immunotherapy, palliative therapy, exercise.

[0259] As used herein, the phrase "treatment regimen" refers to a treatment plan provided to a subject in need (e.g., a subject diagnosed with a condition) that specifies the type of treatment, the dosage, schedule, and / or duration of the treatment. The selected treatment regimen may be an active treatment regimen that is expected to result in the best clinical outcome (e.g., complete cure of the condition); or a milder treatment regimen that can alleviate the symptoms of the condition but still result in an incomplete cure of the condition. It should be understood that in some cases, the treatment regimen may be associated with some discomfort or adverse side effects (e.g., damage to healthy cells or tissues) caused to the subject. Treatment types may include surgical intervention (e.g., removal of lesions, diseased cells, tissues, or organs), cell replacement therapy, administration of therapeutic drugs (e.g., receptor agonists, antagonists, hormones, chemotherapeutic agents) in a local or systemic mode, exposure to radiation therapy using an external source (e.g., an external particle beam) and / or an internal source (e.g., brachytherapy), and / or any combination thereof. The dosage, schedule and duration of treatment can vary depending on the severity of the condition and the type of treatment selected, and one skilled in the art will be able to adjust the type of treatment as well as the dosage, schedule and duration of treatment.

[0260] In some embodiments, treatments include but are not limited to fluorouracil, capecitabine, oxaliplatin, irinotecan, UFT, FOLFOX, FOLFOXIRI, and FOLFIRI, anti-angiogenic drugs (such as bevacizumab), and epidermal growth factor receptor inhibitors (e.g., cetuximab and panitumumab).

[0261] 7. Advantages of the present invention

[0262] Without wishing to be bound by any particular theory, the present invention has at least the following advantages:

[0263] (1) To provide detailed methylated CpG sites in the promoter regions of BMP3 and NDRG4 genes in the Chinese population and to serve as biomarkers for the detection of CRC and / or AA.

[0264] (2) The kit is better than other similar products based on mt-sDNA such as It is more suitable for CRC and AA detection in the Chinese population because the present invention targets methylated CpG sites that are unique to the Chinese population, while previous products are targeted at the Caucasian population.

[0265] (3) Compared with other similar products based on mt-sDNA, the sensitivity and specificity of CRC detection are higher.

[0266] (4) Compared with other similar products based on mt-sDNA, the sensitivity and specificity of AA detection are significantly improved.

[0267] (5) The method is non-invasive and easy to sample at home, thus obtaining good patient compliance, making it widely used as a CRC and AA screening method. The method reduces the morbidity and mortality due to CRC in the Asian population.

[0268] Example

[0269] Example 1

[0270] Discovery of methylated CpG sites in the promoter regions of BMP3 and NDRG4 genes in Chinese CRC and AA populations, respectively.

[0271] (1) Sample collection

[0272] A total of 191 colon FFPE tissue samples were collected from patients confirmed to have CRC and AA by colonoscopy, including 50 colorectal cancer tissues and 49 paired adjacent normal tissues, 46 adenoma cancer tissues and 46 paired adjacent normal tissues.

[0273] (2) DNA extraction

[0274] Genomic DNA was extracted from FFPE samples using the TaKaRa MiniBEST FFPE DNA Extraction Kit (Catalog No. 9782). The detailed steps are described as follows:

[0275] i. Use a sterile scalpel to cut 30 mg of paraffin-embedded tissue and remove excess paraffin.

[0276] ii. Place paraffin section tissue in a 1.5 mL centrifuge tube and add 500 μL of buffer DP, mix and incubate in water at 80°C for 1 minute, then vortex for 10 seconds. Add 180 μL of buffer GL and vortex.

[0277] iii. The mixture was centrifuged at 12,000 rpm for 1 minute at room temperature, and then the solution formed two layers (upper oil phase, lower aqueous phase). 20 μL of proteinase K (20 mg / mL) and 10 μL of RNase (10 mg / mL) were added to the lower aqueous phase and mixed thoroughly by gently pipetting up and down. Care was taken to avoid disturbing the layers. Then the mixture was placed in a water bath at 56°C for 1 hour.

[0278] iv. The solution of the previous step was incubated at 90°C for 30 minutes and cooled to room temperature. Then 200 μL of buffer GB and 200 μL of 100% ethanol were added to the solution and vortexed for 10 seconds. Centrifuged at 12,000 rpm for 1 minute at room temperature, and then the solution formed two layers (upper oil phase, lower aqueous phase).

[0279] v. Place the spin column in a collection tube and add the lower aqueous phase from the previous step to the spin column. Be careful not to disturb the layers and centrifuge at 12,000 rpm for 2 minutes at room temperature and discard the waste.

[0280] vi. Add 500 μL of Buffer WA to the spin column and centrifuge at 12,000 rpm for 1 minute at room temperature and discard the waste.

[0281] vii. Add 500 μL of Buffer WB to the spin column, centrifuge at 12,000 rpm for 1 minute at room temperature, and discard the waste. Repeat once.

[0282] viii. Place the spin column in a collection tube and centrifuge at 12,000 rpm for 2 minutes at room temperature.

[0283] ix. Place the spin column in a new 1.5 mL centrifuge tube, add 50-100 μL of sterile water or elution buffer to the center of the spin column membrane, and place at room temperature for 5 minutes.

[0284] x. Centrifuge at 12,000 rpm for 2 minutes at room temperature and elute the DNA.

[0285] xi. The eluted DNA was quantified using a Nanodrop 2000 fluorometer and stored at -20°C until use.

[0286] (3) Prediction of CpG islands in the promoter regions of BMP3 and NDRG4 genes and primer design for amplicon sequencing.

[0287] i. Prediction of CpG islands in the promoter regions of BMP3 and NDRG4 genes.

[0288] The promoter sequences of BMP3 and NDRG4 genes were downloaded, including the DNA sequence of about 1000-1500 bp upstream of the transcription start site (TSS) and the 5'UTR region. The CpG islands of the sequences were predicted using MethPrimer software (www.urogene.org / methprimer / ). Figures 1A to 1D As shown in, two of the three CpG islands of the BMP3 gene are located approximately 400 bp upstream of the TSS and at the entire 5'UTR region (chr4: 81951752-81952760), and only one CpG island of the NDRG4 gene is located approximately 500 bp upstream of the TSS and at a partial 5'UTR region (chr16: 58497061-58497938). The version (build) of the human reference genome is GRCh37 / hg19.

[0289] ii. Design of primers for amplifying the sequences of the predicted CpG islands of the BMP3 and NDRG4 genes.

[0290] Based on the length of the sequence to be amplified and the length of the read segment to be sequenced, four and five pairs of primers were designed for BMP3 and NDRG4 genes, respectively. There was as much overlap as possible between adjacent amplicons so that the CpG islands of both genes could be completely sequenced. The primers for the two genes are listed in Table 1, and the relative positions of the amplicons of the two genes are shown in Figures 1A to 1D middle.

[0291] Table 1 Primers used for amplicon sequencing of BMP3 and NDRG4 genes

[0292]

[0293]

[0294] DNA samples were subjected to bisulfite treatment as described below.

[0295] (4) Bisulfite treatment

[0296] i. Thaw the extracted DNA at room temperature and dilute the DNA concentration to 20 ng / μL. Add 40 μL of the diluted DNA to a 1.5 mL centrifuge tube, then add 4 μL of 3M NaOH solution and incubate at 42°C for 20 minutes.

[0297] ii. Add 400 μL of transformation solution, mix, and incubate at 50°C in the dark for 16 hours.

[0298] iii. Add 550 μL of binding solution, mix, and transfer the solution to a DNA purification column. Centrifuge at 13,000 rpm for 90 seconds and discard the waste. Centrifuge again for 3 minutes and discard the waste.

[0299] iv. Add 600 μL of 90% ethanol to the DNA purification column, centrifuge at 13,000 rpm for 90 seconds, and discard the waste. Centrifuge again at 13,000 rpm for 15 seconds.

[0300] v. Add 300 μL of desulfurization solution (0.3 M NaOH in 90% ethanol) to the DNA purification and leave it at room temperature for 30 minutes. Centrifuge at 13,000 rpm for 90 seconds and discard the waste.

[0301] vi. Add 600 μL of 90% ethanol, centrifuge at 13,000 rpm for 90 seconds, and discard the waste. Repeat this step once and centrifuge at 13,000 rpm for another 3 minutes.

[0302] vii. Place the DNA purification column in a new 1.5 mL centrifuge tube and add 40 μL of eluent. Incubate the tube at 50°C for 30 minutes and centrifuge at 13,000 rpm for 90 seconds. Store the converted DNA solution at -20°C until use.

[0303] (5) Library preparation and amplicon sequencing

[0304] (a) Multiplex PCR amplification

[0305] i. Prepare PCR master mix as follows:

[0306] Table 2

[0307]

[0308] ii. Vortex the mixture gently and pipette 40 μL of the mixture into each PCR tube, then add 10 μL of bisulfate treated DNA.

[0309] iii. Vortex gently and perform PCR amplification as follows: one cycle of denaturation at 95°C for 15 minutes; 35 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 90 seconds, and extension at 72°C for 90 seconds; one cycle of extension at 72°C for 10 minutes; and finally hold at 4°C.

[0310] iv. 5 μL of PCR product was mixed with 6X loading buffer (TakaRa, catalog number: 9156) and loaded onto a 1% (w / v) agarose gel along with a control of DL2000 DNA marker (TakaRa, catalog number: 3427Q) and electrophoresed at 120 V for 40 minutes.

[0311] v. If nonspecific amplification occurs, the remaining 45 μL of PCR product needs to be recovered after electrophoresis according to the kit instructions (QIAGEN, catalog number: 28704).

[0312] (b) Purification and quantification of PCR products

[0313] The PCR product was purified using the MinElute PCR purification kit according to the kit instructions (QIAGEN, catalog number: 28004). TM dsDNA BR Assay Kit (Catalog No.: Q32850) was used for quantification.

[0314] (c) Adaptor ligation

[0315] The adapters were ligated to the purified PCR product using NEBNext Quick Ligation Module (NEB, catalog number: E6056L), and the reaction mixture was prepared as follows:

[0316] Table 3. Reaction mixture for adaptor ligation

[0317] serial number Reagents Volume (μL) / reaction 1 NEBNext Rapid Ligation Reaction Buffer (5×) 10 2 Adaptor 5 3 Fast T4 DNA Ligase 5 4 RNase-free water 10

[0318] 30 μL of the mixture was added to each PCR tube, followed by 20 μL of purified PCR product. The solution was mixed gently, incubated at 20°C for 15 minutes and kept at 4°C for 10 minutes.

[0319] (d) Purification of ligation product

[0320] i. Place Agencourt AMpure XP beads (Beckman, catalog number: A63882) at room temperature until ready for use.

[0321] ii. Centrifuge the PCR tube at 280 g for 1 minute at 20°C and transfer 50 μL of the ligation product to a new 96-well PCR plate.

[0322] iii. Vortex the AMpure XP beads for 30 seconds to disperse evenly, and add 56 μL of beads to each well of the PCR plate. Gently pipette the mixture 10 times to mix, and let stand at room temperature for 5 minutes.

[0323] iv. Place the 96-well PCR plate on a 96-well magnetic plate and let stand for 2 minutes until the supernatant is clear. Keep the 96-well PCR plate on the 96-well magnetic plate and remove the supernatant, then add 200 μL of freshly prepared 80% ethanol to each well and incubate at room temperature for 30 seconds, and remove the supernatant.

[0324] v. Keep the 96-well PCR plate on a 96-well magnetic plate and add 200 μL of freshly prepared 80% ethanol to each well. Then incubate at room temperature for 30 seconds. Discard the supernatant and remove the residual ethanol with a 10 μL pipette.

[0325] vi. Keep the 96-well PCR plate on a magnetic plate and allow the beads to dry naturally for 10 minutes.

[0326] vii. Remove the 96-well PCR plate from the magnetic plate and add 27.5 μL of 10 mM Tris (pH 8.5) to each well of the 96-well plate. Gently pipette up and down 10 times to mix the beads and Tris until the beads are well dispersed. Let the plate stand at room temperature for 2 minutes.

[0327] viii. Place the 96-well PCR plate on a magnetic plate and let stand for 2 minutes until the supernatant is clear. Pipette 25 μL of the supernatant into a new PCR tube and store it at -20°C until use.

[0328] (e) PCR amplification and product purification

[0329] Prepare PCR master mix as follows and mix gently. Add 40 μL of the mix to each PCR tube, followed by 5 μL of purified ligation product.

[0330] Table 4. PCR reaction mixture

[0331]

[0332] The PCR tubes were gently vortexed and briefly centrifuged, and the PCR reaction was performed under the following conditions: one cycle of denaturation at 98° C. for 30 seconds; 8 to 15 cycles of denaturation at 98° C. for 10 seconds and extension at 65° C. for 75 seconds; one cycle of denaturation at 65° C. for 5 minutes; and a final hold at 4° C. The PCR product was purified according to (d) Purification of ligation products.

[0333] (f) Library detection and sequencing

[0334] Qubit TM The concentration and size distribution of purified PCR products were analyzed using a dsDNA BR assay kit (Cat. No.: Q32850) and an Agilent 2100 Bioanalyzer. Libraries were pooled at equimolar concentrations and sequenced on an Illumina HiSeq 2500 with a read length of PE125.

[0335] (g) Sequencing data analysis

[0336] The raw data were demultiplexed according to the sample index, and the sequencing reads were mapped to the reference gene sequences of BMP3 and NDRG4 using SHRiMP V2.04 software. Methylated CpG sites were identified based on the mapping results. And finally, it was found that 26 and 39 CpG sites of BMP3 and NDRG4 genes were hypermethylated in CRC and AA tissues compared with adjacent normal tissues (p<0.05), indicating that these methylated CpG sites can be DNA biomarkers for early diagnosis of CRC and AA.

[0337] Table 5 Methylation frequencies of CpG sites of the BMP3 gene in CRC tissues and adjacent normal tissues.

[0338]

[0339]

[0340] Table 6 Methylation frequencies of CpG sites of the BMP3 gene in AA tissues and adjacent normal tissues.

[0341]

[0342]

[0343] Table 7 Methylation frequencies of CpG sites of the NDRG4 gene in CRC tissues and adjacent normal tissues.

[0344]

[0345]

[0346] Table 8 Methylation frequencies of CpG sites of the NDRG4 gene in AA tissues and adjacent normal tissues.

[0347]

[0348]

[0349] Example 2

[0350] Comparison of differentially methylated CpG sites in BMP3 and NDRG4 genes associated with CRC in different ethnic groups.

[0351] We analyzed the methylation microarray data of BMP3 and NDRG4 genes in the TCGA database (Illumina human methylation 450 data), and found that there were five significantly different methylation CpG sites (Fig. 2 and Table 9) in the promoter region of the NDRG4 gene between the Caucasian population and the Asian population. In order to further verify the differential methylation CpG sites, tissue and blood samples were collected from 106 Chinese CRC and AA patients. DNA was extracted and treated with bisulfate. The promoter regions of BMP3 and NDRG4 genes were amplified and sequenced. We analyzed the sequencing data and indeed found that in the TCGA database, the high methylation CpG sites of the Asian population were different from the high methylation CpG sites of the Caucasian population, and the high methylation CpG sites were different between CRC and AA tissue samples. According to these different methylation CpG sites, we have developed a detection kit specifically for CRC and AA screening in Asian populations (such as Chinese populations).

[0352] Table 9 Differences in methylated CpG sites of BMP3 and NDRG4 genes between Caucasian and Asian populations.

[0353]

[0354]

[0355] Example 3

[0356] Screening of primers and probes for BMP3 and NDRG4 genes

[0357] (1) Design and selection of primers and probes for BMP3 and NDRG4 genes.

[0358] qPCR primers and probes were designed based on the methylated CpG sites of BMP3 and NDRG4 genes. Three pairs of preferred primers and probes were identified. The preferred primers and probes were compared with several other candidate primers and probes of BMP3 and NDRG4 genes and positive and negative controls. The information of primers and probes is shown in Table 10.

[0359] Table 10 Preferred and other primer and probe information

[0360]

[0361]

[0362] (2) Comparison of preferred primers and probes with controls and positive and negative controls for BMP3 and NDRG4 genes.

[0363] Standard samples with different methylation ratios were formed by spiking the positive control DNA of BMP3 and NDRG4 genes into the negative control DNA at different ratios (Table 11). The analytical sensitivity was compared by amplifying the standard sample DNA with the preferred and control primers and probes of BMP3 and NDRG4 genes, respectively. The analytical specificity was compared by amplifying the negative control DNA of BMP3 and NDRG4 genes with the preferred and control primers and probes of BMP3 and NDRG4 genes, respectively, and the amount of negative control DNA was 10 4 copies / reaction, 10 5 copies / reaction, 10 6 copies / reaction, 10 7 copies / reaction and 10 8 copies / reaction.

[0364] Table 11 Standard samples of BMP3 and NDRG4 genes

[0365] Methylation ratio Methylated DNA copy number Total DNA copy number 1 <![CDATA[10 5 ]]> <![CDATA[10 5 ]]> 1 / 10 <![CDATA[10 4 ]]> <![CDATA[10 5 ]]> <![CDATA[1 / 10 2 ]]> <![CDATA[10 3 ]]> <![CDATA[10 5 ]]> <![CDATA[1 / 10 3 ]]> <![CDATA[10 2 ]]> <![CDATA[10 5 <!-- 38 -->]]> <![CDATA[1 / 10 4 ]]> 10 <![CDATA[10 5 ]]>

[0366] A master mix was prepared according to Table 5, and the quantitative PCR reaction conditions were first denaturation at 95°C for 1 minute, followed by 50 cycles of denaturation at 95°C for 20 seconds and extension at 60°C for 1 minute.

[0367] Table 12 Final concentration of methylation qPCR reagents

[0368] serial number Reagents Final concentration 1 10× PCR buffer 1× 2 <![CDATA[MgCl2]]> 2mM 3 dNTP 0.2mM 4 TaDNA polymerase 2U 5 Each primer 0.75mM 6 Each probe 0.25mM 7 DNA template 2μL 8 Ultrapure water Make up 50L

[0369] As shown in Table 13 and FIG. 3A to FIG. 3L As shown in Figure 1, using three pairs of preferred primers and probes, 1 / 10 4 Methylated DNA, but it was undetectable in the three pairs of controls.

[0370] As shown in Table 13 and FIG. 3A to FIG. 3L As shown in , the preferred three pairs of BMP3 and NDRG4 primers and probes of the present invention can stably detect methylation levels as low as one in ten thousand, while the three pairs of comparative primers and probes cannot detect methylation levels as low as one in ten thousand.

[0371] Table 13 Comparison of analytical sensitivity of preferred and control primers and probes for BMP3 and NDRG4 genes.

[0372]

[0373] Y: detected, N: undetermined

[0374] The analytical sensitivity amplification curves of BMP3 and NDRG4 for each preferred combination compared with the control group are shown in FIG. 3A to FIG. 3L middle.

[0375] Primers and probes BMP3 NDRG4 Best choice 1 Figure 3A Figure 3B Best 2 Figure 3C Figure 3D Best 3 Figure 3E Figure 3F Comparison 1 Figure 3G Figure 3H Comparison 2 Fig. 3I Figure 3J Comparison 3 Figure 3K Figure 3L

[0376] As shown in Table 14 and FIG. 4A to FIG. 4L As shown in , the three pairs of preferred primers and probes for BMP3 and NDRG4 genes had no amplification signals of unmethylated DNA at different concentrations, while the comparative primers and probes exhibited different degrees of non-specific amplification.

[0377] Table 14 Comparison of analytical specificity between preferred and control primers and probes.

[0378]

[0379] Y: no amplification, N: nonspecific amplification

[0380] Assay-specific amplification curves for BMP3 and NDRG4

[0381]

[0382] Example 4

[0383] Validation of the preferred and comparative methylation primers and probes was performed using stool samples for the BMP3 and NDRG4 genes.

[0384] Three pairs of preferred and comparative primers and probes were used to detect the methylation levels of BMP3 and NDRG4 genes in 81 stool samples. The three comparative primers and probes are:

[0385] Comparison 1: BMP3 forward primer SEQ ID NO.: 21, BMP3 reverse primer SEQ ID NO.: 22 and BMP3 probe SEQ ID NO.: 23; NDRG4 forward primer SEQ ID NO.: 24, NDRG4 reverse primer SEQ ID NO.: 25 and NDRG4 probe SEQ ID NO.: 26;

[0386] Comparison 2: BMP3 forward primer SEQ ID NO.: 27, BMP3 reverse primer SEQ ID NO.: 28 and BMP3 probe SEQ ID NO.: 29; NDRG4 forward primer SEQ ID NO.: 24, NDRG4 reverse primer SEQ ID NO.: 30 and NDRG4 probe SEQ ID NO.: 26;

[0387] Comparison 3: BMP3 forward primer SEQ ID NO.:31, BMP3 reverse primer SEQ ID NO.:32 and BMP3 probe SEQ ID NO.:33; NDRG4 forward primer SEQ ID NO.:24, NDRG4 reverse primer SEQ ID NO.:34 and NDRG4 probe SEQ ID NO.:26.

[0388] The information of stool samples is shown in Table 15.

[0389] Table 15 Statistics of 81 fecal samples

[0390] Colonoscopy quantity normal 46 Adenoma 15 Colorectal cancer 20 total 81

[0391] Fecal DNA was extracted from the samples by following the method described below.

[0392] (1) Extraction of fecal DNA

[0393] i. Add 40 mL of lysate to 4-6 g of stool sample and vortex thoroughly, then incubate at 50°C for 16 hours.

[0394] ii. Then centrifuge at 5000 rpm for 10 minutes. Before centrifugation, weigh the balance. After centrifugation, carefully remove the centrifuge tube and do not shake it violently.

[0395] iii. Pipette 9 mL of supernatant into a new 50 mL centrifuge tube, then add 1 mL of extraction adjuvant, 60 μL of magnetic beads, and 10 mL of isopropanol. Vortex for 10 seconds and incubate at 65°C for 20 minutes. Mix up and down every 5 minutes during incubation.

[0396] iv. After incubation, place the 50 mL centrifuge tube on a magnetic stand and keep it stationary for 3 minutes until the supernatant is clear, and discard the supernatant.

[0397] v. Take out the 50 mL centrifuge tube from the magnetic rack and add 12 mL of washing solution. Vortex until the magnetic beads fall off the tube wall, keep it stable for 3 minutes, and put the 50 mL centrifuge tube back into the magnetic rack for 3 minutes until the supernatant is clear, and discard the supernatant.

[0398] vi. Add 15 mL of 80% ethanol solution, vortex until the beads fall off the tube wall, and keep it steady for 3 minutes. Put the tube back into the magnetic rack and keep it steady for 3 minutes until the supernatant is clear, and discard the supernatant.

[0399] vii. Repeat the previous step once.

[0400] viii. Pipette the remaining liquid at the bottom, keep the tube open, and incubate at 65°C for 5 minutes. Remove the tube from the magnetic rack until the beads are dry, and add 1.5 mL of pre-heated Eluent I. Use a 1000 μL pipette to pipette the beads from the well into Eluent I, and transfer the mixture to a 2 mL centrifuge tube and close the cap, then incubate at 65°C for 5 minutes.

[0401] ix. Centrifuge at 13000 rpm for 3 minutes, transfer 600 μL of supernatant to a new 1.5 mL tube, then add 600 μL of binding solution and vortex thoroughly.

[0402] x. Transfer 600 μL of the above mixture to a DNA purification column, centrifuge at 13,000 rpm for 1 minute, and discard the waste.

[0403] xi. Treat the remaining mixture as in the previous step and centrifuge at 13,000 for 2 minutes.

[0404] xii. Add 600 μL of 90% ethanol solution to the DNA purification column, centrifuge at 13,000 rpm for 1 minute and discard the waste.

[0405] xiii. Repeat the previous step 2 times.

[0406] xiv. Centrifuge at 13,000 rpm for 3 minutes and place the DNA purification column in a new 1.5 mL centrifuge tube. Open the DNA purification column and incubate at 65°C for 5 minutes to dry.

[0407] xv. Add 100 μL of preheated Elution Reagent II to the middle of the DNA purification column, close the lid, and incubate at 65°C for 5 minutes. Centrifuge at 13,000 rpm for 2 minutes. Obtain the eluted DNA solution and store it at 2-8°C until use. Long-term storage should be kept at -25°C to -15°C.

[0408] (2) Bisulfite treatment

[0409] Follow the detailed operation steps of Example 3.

[0410] (3) qPCR

[0411] Prepare qPCR master mix as follows:

[0412] Table 16

[0413] serial number Reagents Final concentration 1 10× PCR buffer 1× 2 <![CDATA[MgCl2]]> 2mM 3 dNTP 0.2mM 4 TaDNA polymerase 2U 5 Each primer 0.75μM 6 Each probe 0.25μM 7 DNA template 2μL 8 Ultrapure water Make up 50L

[0414] The qPCR reaction conditions were: one cycle of denaturation at 95° C. for 2 minutes, and 50 cycles of denaturation at 95° C. for 20 seconds and extension at 95° C. for 1 minute. The B2M gene was used as a reference gene for quality control of the qPCR reaction.

[0415] (4) Results

[0416] As shown in Table 17, the sensitivity of CRC and AA detection in 81 stool samples using three pairs of preferred primers and probes of BMP3 and NDRG4 genes was as high as 85.0%-95.0% (CRC based on BMP3 methylation), 66.7%-73.3% (AA based on BMP3 methylation), and 90.0%-95.0% (CRC based on NDRG4 methylation), and 73.3%-86.7% (AA based on NDRG4 methylation). In addition, the specificity of CRC and AA detection using BMP3 methylation data or NDRG4 methylation data was about 97.8%-100.0%.

[0417] However, the sensitivity of CRC and AA detection in eighty-one stool samples using three pairs of comparative primers and probes of BMP3 and NDRG4 genes was 85.0%-90.0% (CRC based on BMP3 methylation), 46.7%-60.0% (AA based on BMP3 methylation), and 90.0%-95.0% (CRC based on NDRG4 methylation), and 66.7%-73.3% (AA based on NDRG4 methylation). In addition, the overall specificity of CRC and AA detection using BMP3 methylation data or NDRG4 methylation data was as high as about 91.3%-93.5% and 93.5%-95.7%, respectively.

[0418] It can be seen that in terms of detection of clinical samples, especially for AA detection, the preferred primers and probes are superior to the comparative primers and probes.

[0419]

[0420]

[0421]

[0422]

[0423]

[0424]

[0425] Example 5

[0426] Screening of primer and probe combinations for methylation of BMP3 and DNRG4 genes

[0427] (1) Fecal DNA extraction

[0428] Fecal DNA was extracted according to the protocol of Example 3.

[0429] (2) Methylation detection of BMP3 and NDRG4 genes

[0430] The combinations of primers and probes for BMP3 and NDRG4 genes are shown below. According to the procedure of Example 3, qPCR was performed using nine combinations.

[0431] Table 19. Primer and probe combinations

[0432] Combination No. BMP3 NDRG4 1 Best 3 Best choice 1 2 Best 3 Best 2 3 Best 3 Best 3 4 Best choice 1 Best choice 1 5 Best choice 1 Best 2 6 Best choice 1 Best 3 7 Best 2 Best choice 1 8 Best 2 Best 2 9 Best 2 Best 3

[0433] The sequences of the nine combinations of primers and probes for the BMP3 and NDRG4 genes are as follows:

[0434] Table 20. Sequences of primers and probes in the combination

[0435]

[0436]

[0437]

[0438] The qPCR master mix used in the reaction was as follows:

[0439] Table 21. qPCR Master Mix for BMP3 / NDRG4

[0440]

[0441]

[0442] The qPCR reaction conditions were: one cycle of denaturation at 95°C for 2 minutes; and 50 cycles of denaturation at 95°C for 20 seconds and extension at 60°C for 1 minute.

[0443] (3) KRAS gene variant detection

[0444] Seven mutation hotspots in codons 12 and 13 of the KRAS gene were detected. The seven mutants are G12D, G13D, G12V, G12C, G12S, G12A, and G13R, and the sequences of their primers and probes are listed in Table 22.

[0445] Table 22 Primers and probes for detecting seven mutations of the KRAS gene

[0446]

[0447]

[0448] The qPCR master mix used in the reaction was as follows:

[0449] Table 23. qPCR Master Mix for KRAS

[0450] serial number Reagents Final concentration 1 G12A-F 0.72μM 2 G12C-F 0.60μM 3 G12D-F 0.72μM 4 G12R-F 0.48μM 5 G12S-F 0.90μM 6 G12V-F 0.72μM 7 G13D-F 0.48μM 8 Kras-R 0.90μM 9 Kras-P 0.10μM 10 ACTB-F 0.30μM 11 ACTB-R 0.30μM 12 ACTB-P 0.05μM 13 <![CDATA[5×PCR Buffer, -Mg 2+ > 1× 14 <![CDATA[MgCl2]]> 1.0mM 15 dNTP 0.1mM 16 Taq DNA polymerase 2.5U 17 DNA template 2μL 18 Ultrapure water Make up to 50 μL

[0451] The qPCR reaction conditions were: one cycle of denaturation at 95°C for 5 min; and 45 cycles of denaturation at 95°C for 15 s, annealing at 71°C for 60 s, and extension at 55°C for 50 s.

[0452] qPCR reaction quality control was performed using ACTB as a reference gene.

[0453] (4) Fecal hemoglobin measurement

[0454] Fecal hemoglobin is detected using the fecal immunochemical test (FIT) and the results are either positive or negative.

[0455] (5) Generating scores using formulas

[0456] The Ct values ​​of qPCR detection of BMP3, NDRG4, and KRAS genes and the positive and negative results of fecal hemoglobin test were substituted into the following logistic regression formula:

[0457] P=e K / (1+e K )

[0458] Where: P is the comprehensive index, K==a*ΔCt1+b*ΔCt2+c*ΔCt3+d*FIT+X, e is the natural constant, a, b, c, d, X are clinical constants. ΔCt1, ΔCt2 and ΔCt3 are the Ct values ​​of the target gene minus the Ct values ​​of the reference gene.

[0459] If the P value is equal to or greater than a predetermined threshold, the test result is positive, otherwise it is negative. A positive result indicates that the subject may have CRC or AA.

[0460] (6) Test results

[0461] Eighty-one stool samples of Example 3 were tested, and the results of different combinations of primers and probes for BMP3 and NDRG4 genes are shown in Table 24.

[0462]

[0463] It can be seen that: (1) Combination numbers 4, 5 and 7 are superior to the other six combinations. Considering that all primers and probes tested are preferred and superior to other primers and probes (see Example 3), the three specific combinations are superior to any known combination of BMP3 and NDRG4 primers / probes. (2) The sensitivity and specificity of the kit for CRC and AA detection and fecal hemoglobin detection containing BMP3, NDRG4, KRAS genes are significantly higher than the sensitivity and specificity of BMP3 or NDRG4 single gene methylation detection. (3) The sensitivity and specificity of the kit for CRC detection in Asian populations (e.g., Chinese populations) are significantly better than existing similar products, such as (4) The sensitivity and specificity of the kit for AA detection in Asian populations (e.g., Chinese population) are significantly better than existing similar products, such as

[0464] The disclosure of each patent, patent application, and publication cited herein, including claims, drawings, and / or diagrams, is hereby incorporated by reference in its entirety.

[0465] Unless otherwise defined, all technical terms and scientific terms herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, preferred methods and materials are described herein. All publications, patents, and patent publications cited are incorporated herein by reference in their entirety for all purposes.

[0466] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

[0467] Although the invention has been described in conjunction with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any changes, uses, or adaptations of the invention which are in accordance with the principles of the invention and which include such departures from the present disclosure as come within known or customary practice in the art to which the invention pertains and which may be applied to the essential features hereinbefore described and which fall within the scope of the appended claims. Sequence Listing <110> Hangzhou Nova Health Technology Co., Ltd. Li Cunyao Li Hui Zheng Weixian Yang Jiao Liu Gang Lu Ning Chen Yiyou <120> Kit for screening colorectal cancer and advanced adenoma and its application <130> NEWH-017 / 01WO 333709-2028 <150> CN 201810502387.9 <151> 2018-05-23 <150> CN 201810502359.7 <151> 2018-05-23 <160> 70 <170> PatentIn Version 3.5 <210> 1 <211> 271 <212> DNA <213> Homo sapiens <220> <221> Modified bases <222> (12)..(12) <223> Methylated <220> <221> Modified bases <222> (33)..(33) <223> Methylated <220> <221> Modified bases <222> (69)..(69) <223> Methylated <220> <221> Modified bases <222> (80)..(80) <223> Methylated <220> <221> Modified bases <222> (83)..(83) <223> Methylated <220> <221> Modified bases <222> (85)..(85) <223> Methylated <220> <221> Modified bases <222> (106)..(106) <223> Methylated <220> <221> Modified bases <222> (120)..(120) <223> Methylated <220> <221> Modified bases <222> (123)..(123) <223> Methylated <220> <221> Modified bases <222> (127)..(127) <223> Methylated <220> <221> Modified bases <222> (132)..(132) <223> Methylated <220> <221> Modified bases <222> (139)..(139) <223> Methylated <220> <221> Modified bases <222> (141)..(141) <223> Methylated <220> <221> Modified bases <222> (152)..(152) <223> Methylated <220> <221> Modified bases <222> (154)..(154) <223> Methylated <220> <221> Modified bases <222> (189)..(189) <223> Methylated <220> <221> Modified bases <222> (200)..(200) <223> Methylated <220> <221> Modified bases <222> (219)..(219) <223> Methylated <220> <221> Modified bases <222> (227)..(227) <223> Methylated <220> <221> Modified bases <222> (236)..(236) <223> Methylated <220> <221> Modified bases <222> (240)..(240) <223> Methylated <220> <221> Modified bases <222> (242)..(242) <223> Methylated <220> <221> Modified bases <222> (247)..(247) <223> Methylated <220> <221> Modified bases <222> (254)..(254) <223> Methylated <220> <221> Modified bases <222> (258)..(258) <223> Methylated <220> <221> Modified bases <222> (264)..(264) <223> Methylated <400> 1 gttagtttgg tcgggtgttt ttaaaaataa agcgaggagg gaaggtatag atagattttg 60 aaaatattcg ggttatatac gtcgcgattt atagtttttt tttagcgttg gagtggagac 120 ggcgttcgta gcgttttgcg cgggtgaggt tcgcgtagtt gttggggaag agtttatttg 180 ttaggttgcg ttgggttagc gtagtaagtg gggttggtcg ttatttcgtt gtattcggtc 240 gcgtttcggg tttcgtgcgt tttcgtttta g 271 <210> 2 <211> 236 <212> DNA <213> Homo sapiens <220> <221> Modified bases <222> (9)..(9) <223> Methylated <220> <221> Modified bases <222> (12)..(12) <223> Methylated <220> <221> Modified bases <222> (18) <223> Methylated <220> <221> Modified bases <222> (20)..(20) <223> Methylated <220> <221> Modified bases <222> (25)..(25) <223> Methylated <220> <221> Modified bases <222> (29)..(29) <223> Methylated <220> <221> Modified bases <222> (48)..(48) <223> Methylated <220> <221> Modified bases <222> (50)..(50) <223> Methylated <220> <221> Modified bases <222> (53)..(53) <223> Methylated <220> <221> Modified bases <222> (55)..(55) <223> Methylated <220> <221> Modified bases <222> (62)..(62) <223> Methylated <220> <221> Modified bases <222> (66)..(66) <223> Methylated <220> <221> Modified bases <222> (74)..(74) <223> Methylated <220> <221> Modified bases <222> (78)..(78) <223> Methylated <220> <221> Modified bases <222> (85)..(85) <223> Methylated <220> <221> Modified bases <222> (98)..(98) <223> Methylated <220> <221> Modified bases <222> (100)..(100) <223> Methylated <220> <221> Modified bases <222> (109)..(109) <223> Methylated <220> <221> Modified bases <222> (118)..(118) <223> Methylated <220> <221> Modified bases <222> (120)..(120) <223> Methylated <220> <221> Modified bases <222> (122)..(122) <223> Methylated <220> <221> Modified bases <222> (130)..(130) <223> Methylated <220> <221> Modified bases <222> (132)..(132) <223> Methylated <220> <221> Modified bases <222> (137)..(137) <223> Methylated <220> <221> Modified bases <222> (141)..(141) <223> Methylated <220> <221> Modified bases <222> (159)..(159) <223> Methylated <220> <221> Modified bases <222> (165)..(165) <223> Methylated <220> <221> Modified bases <222> (170)..(170) <223> Methylated <220> <221> Modified bases <222> (172)..(172) <223> Methylated <220> <221> Modified bases <222> (177)..(177) <223> Methylated <220> <221> Modified bases <222> (181)..(181) <223> Methylated <220> <221> Modified bases <222> (191)..(191) <223> Methylated <220> <221> Modified bases <222> (202)..(202) <223> Methylated <220> <221> Modified bases <222> (204)..(204) <223> Methylated <220> <221> Modified bases <222> (210)..(210) <223> Methylated <220> <221> Modified bases <222> (216)..(216) <223> Methylated <220> <221> Modified bases <222> (218)..(218) <223> Methylated <220> <221> Modified bases <222> (221)..(221) <223> Methylated <220> <221> Modified base <222> (226)..(226) <223> Methylated <400> 2 tgagaagtcg gcgggggcgc ggatcgatcg gggtgttttt taggtttcgc gtcgcggttt 60 tcgttcgttt tttcgttcgt ttatcgggta ttttagtcgc gtagaaggcg gaagttacgc 120 gcgagggatc gcggttcgtt cgggattagt tttaggttcg gtatcgtttc gcgggtcgag 180 cgtttatatt cgttaaattt acgcgggtac gttttcgcgg cgtatcgttt ttagtt 236 <210> 3 <211> 29 <212> DNA <213> Homo sapiens <400> 3 tttgaaaata ttcgggttat atacgtcgc 29 <210> 4 <211> 28 <212> DNA <213> Homo sapiens <400> 4 ataaactctt ccccaacaac tacgcgaa 28 <210> 5 <211> 25 <212> DNA <213> Homo sapiens <400> 5 agcgttggag tggagacggc gttcg 25 <210> 6 <211> 26 <212> DNA <213> Man(Homo sapiens) <400> 6 atcgatcggg gtgtttttta ggtttc <210> 7 <211> 26 <212> DNA <213> Man (Homo sapiens) <400> 7 ccttctacgc cccgat <210> 8 <211> 31 <212> DNA <213> Man(Homo sapiens) <400> 8 cgtcgcggtt ttcgttcgtt ttttcgttcg t <210> 9 <211> 25 <212> DNA <213> Man (Homo sapiens) <400> 9 aatattcggg ttatatacgt cgcga <210> 10 <211> 28 <212> DNA <213> Man(Homo sapiens) <400> 10 gcacctac aataactc ttccccac <210> 11 <211> 26 <212> DNA <213> Man(Homo sapiens) <400> 11 tggagtggag acggcgttcg tagcgt <210> 12 <211> 17 <212> DNA <213> Homo sapiens <400> 12 gcgggtgaga agtcggc 17 <210> 13 <211> 20 <212> DNA <213> Homo sapiens <400> 13 gtaacttccg ccttctacgc 20 <210> 14 <211> 25 <212> DNA <213> Homo sapiens <400> 14 taggtttcgc gtcgcggttt tcgtt 25 <210> 15 <211> 27 <212> DNA <213> Homo sapiens <400> 15 aatattcggg ttatatacgt cgcgatt 27 <210> 16 <211> twenty one <212> DNA <213> Homo sapiens <400> 16 acttactacg ctaacccaac g 21 <210> 17 <211> 28 <212> DNA <213> Homo sapiens <400> 17 tagcgttgga gtggagacgg cgttcgta 28 <210> 18 <211> twenty one <212> DNA <213> Homo sapiens <400> 18 cggttttcgt tcgttttttc g 21 <210> 19 <211> 26 <212> DNA <213> Homo sapiens <400> 19 aacctaaaac taatcccgaa cgaacc 26 <210> 20 <211> 28 <212> DNA <213> Homo sapiens <400> 20 tcgtttatcg ggtattttag tcgcgtag 28 <210> 21 <211> 20 <212> DNA <213> Homo sapiens <400> 21 gagtggagac ggcgttcgta 20 <210> 22 <211> 23 <212> DNA <213> Homo sapiens <400> 22 ccacttacta cgctaaccca acg 23 <210> 23 <211> 26 <212> DNA <213> Homo sapiens <400> 23 cgggtgaggt tcgcgtagtt gttggg 26 <210> 24 <211> 23 <212> DNA <213> Homo sapiens <400> 24 gggtgttttt taggtttcgc gtc 23 <210> 25 <211> 21 <212> DNA <213> Homo sapiens <400> 25 cgtaacttcc gccttctacg c 21 <210> 26 <211> 40 <212> DNA <213> Homo sapiens <400> 26 acgcgactaa aatacccgat aaacgaacga aaaaacgaac 40 <210> 27 <211> 21 <212> DNA <213> Homo sapiens <400> 27 ttaggttgcg ttgggttagc g 21 <210> 28 <211> 22 <212> DNA <213> Homo sapiens <400> 28 actccgaaaa cgcaaaaaac cg 22 <210> 29 <211> 26 <212> DNA <213> Homo sapiens <400> 29 attcggtcgc gtttcgggtt tcgtgc 26 <210> 30 <211> 19 <212> DNA <213> Homo sapiens <400> 30 gacccgcgaa acgataccg 19 <210> 31 <211> 21 <212> DNA <213> Homo sapiens <400> 31 tattcgggtt atatacgtcg c 21 <210> 32 <211> 20 <212> DNA <213> Homo sapiens <400> 32 cttactacgc taacccaacg 20 <210> 33 <211> 26 <212> DNA <213> Homo sapiens <400> 33 cccaacaact acgcgaacct cacccg 26 <210> 34 <211> 20 <212> DNA <213> Homo sapiens <400> 34 tcgcgcgtaa cttccgcctt 20 <210> 35 <211> 22 <212> DNA <213> Homo sapiens <400> 35 aacttgtggt agttggaggt ga 22 <210> 36 <211> 25 <212> DNA <213> Homo sapiens <400> 36 aacttgtggt agttggagct gggga 25 <210> 37 <211> 22 <212> DNA <213> Man(Homo sapiens) <400> 37 aacttgtggt agttggagtt gt <210> 38 <211> 22 <212> DNA <213> Man(Homo sapiens) <400> 38 aaacttgtgg tagttggggc tt <210> 39 <211> 22 <212> DNA <213> Man(Homo sapiens) <400> 39 aaacttgtgg tagttggtgc ta <210> 40 <211> 22 <212> DNA <213> Man(Homo sapiens) <400> 40 aacttgtggt agttggagca gc <210> 41 <211> 22 <212> DNA <213> Man(Homo sapiens) <400> 41 aaacttgtgg tagttggagc tc <210> 42 <211> 24 <212> DNA <213> Man(Homo sapiens) <400> 42 gaatggtcct gcaccagtaa tatg <210> 43 <211> 21 <212> DNA <213> Homo sapiens <400> 43 agggcttctt gtcctttcct t 21 <210> 44 <211> 20 <212> DNA <213> Homo sapiens <400> 44 cgtgctcgat ggggtacttc 20 <210> 45 <211> 26 <212> DNA <213> Homo sapiens <400> 45 aggcaagagt gccttgacga tacagc 26 <210> 46 <211> 27 <212> DNA <213> Homo sapiens <400> 46 cgtgatggtg ggcatgggtc agaagga 27 <210> 47 <211> 20 <212> DNA <213> Homo sapiens <400> 47 agtttggtgt aagttaagag 20 <210> 48 <211> 21 <212> DNA <213> Homo sapiens <400> 48 ctaactctat tttaaacrcc a 21 <210> 49 <211> 23 <212> DNA <213> Homo sapiens <400> 49 gttttaattt ttggaaaagg taa 23 <210> 50 <211> 21 <212> DNA <213> Homo sapiens <400> 50 acctaacaaa taaactcttc c 21 <210> 51 <211> 22 <212> DNA <213> Homo sapiens <400> 51 gaaggtatag atagattttg aa 22 <210> 52 <211> 24 <212> DNA <213> Homo sapiens <400> 52 cacctaacac aactttacra aact 24 <210> 53 <211> 26 <212> DNA <213> Homo sapiens <400> 53 gtatttagtt atggttgggg ygagta 26 <210> 54 <211> 21 <212> DNA <213> Homo sapiens <400> 54 ctcacctact actaccgccc r 21 <210> 55 <211> 25 <212> DNA <213> Homo sapiens <400> 55 aggtttttga gtttttggtt ttttt 25 <210> 56 <211> 20 <212> DNA <213> Homo sapiens <400> 56 ccctccaaac cccctataac 20 <210> 57 <211> 20 <212> DNA <213> Homo sapiens <400> 57 ggatggggat gtttttgtag 20 <210> 58 <211> 20 <212> DNA <213> Homo sapiens <400> 58 rgrgaaacct aaaaaacacc 20 <210> 59 <211> 18 <212> DNA <213> Homo sapiens <400> 59 gyggagyggg tgagaagt 18 <210> 60 <211> 20 <212> DNA <213> Homo sapiens <400> 60 craacaacca aaaacccctc 20 <210> 61 <211> 23 <212> DNA <213> Homo sapiens <400> 61 gttygttygg gattagtttt agg 23 <210> 62 <211> 19 <212> DNA <213> Homo sapiens <400> 62 crcaaacraa aaacraaac 19 <210> 63 <211> 18 <212> DNA <213> Homo sapiens <400> 63 gyggygtttt ygtttttg 18 <210> 64 <211> 20 <212> DNA <213> Homo sapiens <400> 64 cracractaa aaatccccaa 20 <210> 65 <211> 271 <212> DNA <213> Homo sapiens <220> <221> Modified bases <222> (12)..(12) <223> Methylated <220> <221> Modified bases <222> (33)..(33) <223> Methylated <220> <221> Modified bases <222> (69)..(69) <223> Methylated <220> <221> Modified bases <222> (80)..(80) <223> Methylated <220> <221> Modified bases <222> (83)..(83) <223> Methylated <220> <221> Modified bases <222> (85)..(85) <223> Methylated <220> <221> Modified bases <222> (106)..(106) <223> Methylated <220> <221> Modified bases <222> (120)..(120) <223> Methylated <220> <221> Modified bases <222> (123)..(123) <223> Methylated <220> <221> Modified bases <222> (132)..(132) <223> Methylated <220> <221> Modified bases <222> (139)..(139) <223> Methylated <220> <221> Modified bases <222> (141)..(141) <223> Methylated <220> <221> Modified bases <222> (152)..(152) <223> Methylated <220> <221> Modified bases <222> (154)..(154) <223> Methylated <220> <221> Modified bases <222> (189)..(189) <223> Methylated <220> <221> Modified bases <222> (200)..(200) <223> Methylated <220> <221> Modified bases <222> (219)..(219) <223> Methylated <220> <221> Modified bases <222> (227)..(227) <223> Methylated <220> <221> Modified bases <222> (240)..(240) <223> Methylated <220> <221> Modified bases <222> (242)..(242) <223> Methylated <220> <221> Modified bases <222> (247)..(247) <223> Methylated <220> <221> Modified bases <222> (254)..(254) <223> Methylated <220> <221> Modified bases <222> (258)..(258) <223> Methylated <220> <221> Modified bases <222> (264)..(264) <223> Methylated <400> 65 gccagtttgg ccgggtgttc ccaaaaataa agcgaggagg gaaggtacag acagatcttg 60 aaaacacccg ggccacacac gccgcgacct acagctcttt ctcagcgttg gagtggagac 120 ggcgcccgca gcgccctgcg cgggtgaggt ccgcgcagct gctggggaag agcccacctg 180 tcaggctgcg ctgggtcagc gcagcaagtg gggctggccg ctatctcgct gcacccggcc 240 gcgtcccggg ctccgtgcgc cctcgcccca g 271 <210> 66 <211> 236 <212> DNA <213> Homo sapiens <220> <221> Modified bases <222> (9)..(9) <223> Methylated <220> <221> Modified bases <222> (12)..(12) <223> Methylated <220> <221> Modified bases <222> (18) <223> Methylated <220> <221> Modified bases <222> (20)..(20) <223> Methylated <220> <221> Modified bases <222> (25)..(25) <223> Methylated <220> <221> Modified bases <222> (29)..(29) <223> Methylated <220> <221> Modified bases <222> (48)..(48) <223> Methylated <220> <221> Modified bases <222> (50)..(50) <223> Methylated <220> <221> Modified bases <222> (53)..(53) <223> Methylated <220> <221> Modified bases <222> (55)..(55) <223> Methylated <220> <221> Modified bases <222> (62)..(62) <223> Methylated <220> <221> Modified bases <222> (66)..(66) <223> Methylated <220> <221> Modified bases <222> (74)..(74) <223> Methylated <220> <221> Modified bases <222> (78)..(78) <223> Methylated <220> <221> Modified bases <222> (85)..(85) <223> Methylated <220> <221> Modified bases <222> (98)..(98) <223> Methylated <220> <221> Modified bases <222> (100)..(100) <223> Methylated <220> <221> Modified bases <222> (109)..(109) <223> Methylated <220> <221> Modified bases <222> (118)..(118) <223> Methylated <220> <221> Modified bases <222> (120)..(120) <223> Methylated <220> <221> Modified bases <222> (122)..(122) <223> Methylated <220> <221> Modified bases <222> (130)..(130) <223> Methylated <220> <221> Modified bases <222> (132)..(132) <223> Methylated <220> <221> Modified bases <222> (137)..(137) <223> Methylated <220> <221> Modified bases <222> (141)..(141) <223> Methylated <220> <221> Modified bases <222> (159)..(159) <223> Methylated <220> <221> Modified bases <222> (165)..(165) <223> Methylated <220> <221> Modified bases <222> (170)..(170) <223> Methylated <220> <221> Modified bases <222> (172)..(172) <223> Methylated <220> <221> Modified bases <222> (177)..(177) <223> Methylated <220> <221> Modified bases <222> (181)..(181) <223> Methylated <220> <221> Modified bases <222> (191)..(191) <223> Methylated <220> <221> Modified bases <222> (202)..(202) <223> Methylated <220> <221> Modified bases <222> (204)..(204) <223> Methylated <220> <221> Modified bases <222> (210)..(210) <223> Methylated <220> <221> Modified bases <222> (216)..(216) <223> Methylated <220> <221> Modified bases <222> (218)..(218) <223> Methylated <220> <221> Modified bases <222> (221)..(221) <223> Methylated <220> <221> Modified base <222> (226)..(226) <223> Methylated <400> 66 tgagaagtcg gcgggggcgc ggatcgaccg gggtgtcccc caggctccgc gtcgcggtcc 60 ccgctcgccc tcccgcccgc ccaccgggca ccccagccgc gcagaaggcg gaagccacgc 120 gcgagggacc gcggtccgtc cgggactagc cccaggcccg gcaccgcccc gcgggccgag 180 cgcccacacc cgccaaaccc acgcgggcac gcccccgcgg cgcaccgccc ccagcc 236 <210> 67 <211> 271 <212> DNA <213> Homo sapiens <400> 67 gttagtttgg tcgggtgttt ttaaaaataa agcgaggagg gaaggtatag atagattttg 60 aaaatattcg ggttatatac gtcgcgattt atagtttttt tttagcgttg gagtggagac 120 ggcgttcgta gcgttttgcg cgggtgaggt tcgcgtagtt gttggggaag agtttatttg 180 ttaggttgcg ttgggttagc gtagtaagtg gggttggtcg ttatttcgtt gtattcggtc 240 gcgtttcggg tttcgtgcgt tttcgtttta g 271 <210> 68 <211> 271 <212> DNA <213> Homo sapiens <400> 68 gttagtttgg ttgggtgttt ttaaaaataa agtgaggagg gaaggtatag atagattttg 60 aaaatatttg ggttatatat gttgtgattt atagtttttt tttagtgttg gagtggagat 120 ggtgtttgta gtgttttgtg tgggtgaggt ttgtgtagtt gttggggaag agtttatttg 180 ttaggttgtg ttgggttagt gtagtaagtg gggttggttg ttattttgtt gtatttggtt 240 gtgttttggg ttttgtgtgt ttttgtttta g 271 <210> 69 <211> 236 <212> DNA <213> Homo sapiens <400> 69 tgagaagtcg gcgggggcgc ggatcgatcg gggtgttttt taggtttcgc gtcgcggttt 60 tcgttcgttt tttcgttcgt ttatcgggta ttttagtcgc gtagaaggcg gaagttacgc 120 gcgagggatc gcggttcgtt cgggattagt tttaggttcg gtatcgtttc gcgggtcgag 180 cgtttatatt cgttaaattt acgcgggtac gttttcgcgg cgtatcgttt ttagtt 236 <210> 70 <211> 236 <212> DNA <213> Homo sapiens <400> 70 tgagaagttg gtggggtgt ggattgattg gggtgttttt taggttttgt gttgtggttt 60 ttgtttgttt tttgttttttt ttattgggta tttagttgt gtagaaggtg gaagttatgt 120 gtgagggatt gtggtttgtt tgggattagt tttaggtttg gtattgtttt gtgggttgag 180 tgtttatatt tgttaaattt atgtgggtat gtttttgtgg tgtattgttt ttagtt 236

Claims

1. A kit for detecting the presence or absence of colorectal cancer or advanced adenoma in a patient in need thereof, the kit comprising: a) a first primer pair and a first probe for detecting the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, wherein the first primer pair and the first probe each comprise a continuous sequence of at least 16 nucleotides identical to, complementary to, or hybridizing under stringent hybridization conditions to SEQ ID NO.: 1, b) a second primer pair and a second probe for detecting the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient, wherein the second primer pair and the second probe each comprise a continuous sequence of at least 16 nucleotides that are identical to, complementary to, or hybridize under stringent hybridization conditions to SEQ ID NO.: 2, Wherein the first primer pair and the first probe are selected from: i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4, and a probe comprising SEQ ID NO.: 5; ii) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10, and a probe comprising SEQ ID NO.: 11; and iii) a forward primer comprising SEQ ID NO.: 15, a reverse primer comprising SEQ ID NO.: 16, and a probe comprising SEQ ID NO.: 17; And wherein the second primer pair and the second probe are selected from: iv) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7, and a probe comprising SEQ ID NO.: 8; v) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13, and a probe comprising SEQ ID NO.: 14; and vi) a forward primer comprising SEQ ID NO.: 18, a reverse primer comprising SEQ ID NO.: 19, and a probe comprising SEQ ID NO.:

20.

2. The kit according to claim 1, wherein the kit comprises: i) the forward primer comprising SEQ ID NO.: 3, the reverse primer comprising SEQ ID NO.: 4 and the probe comprising SEQ ID NO.: 5, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and ii) the forward primer comprising SEQ ID NO.: 6, the reverse primer comprising SEQ ID NO.: 7 and the probe comprising SEQ ID NO.: 8, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

3. The kit according to claim 1, wherein the kit comprises: i) the forward primer comprising SEQ ID NO.: 9, the reverse primer comprising SEQ ID NO.: 10 and the probe comprising SEQ ID NO.: 11, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and ii) the forward primer comprising SEQ ID NO.: 12, the reverse primer comprising SEQ ID NO.: 13 and the probe comprising SEQ ID NO.: 14, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

4. The kit according to claim 1, wherein the kit comprises: i) the forward primer comprising SEQ ID NO.: 15, the reverse primer comprising SEQ ID NO.: 16 and the probe comprising SEQ ID NO.: 17, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and ii) the forward primer comprising SEQ ID NO.: 18, the reverse primer comprising SEQ ID NO.: 19 and the probe comprising SEQ ID NO.: 20, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

5. The kit according to any one of claims 1 to 4, wherein both the first probe and the second probe comprise fluorescent donor and acceptor fluorophores.

6. The kit according to claim 5, wherein the first probe and the second probe are TAQMAN® probes.

7. The kit according to any one of claims 1 to 4, wherein the kit further comprises: (1) means for detecting the presence or absence of at least one mutation in the KRAS gene in the patient; and (2) means for detecting the presence or absence of hemoglobin in a biological sample obtained from the patient.

8. The kit according to claim 7, wherein the means for detecting the presence or absence of at least one mutation in the KRAS gene in the patient comprises at least one pair of primers capable of amplifying the exon 12 and / or exon 13 region of the KRAS gene in a polymerase chain reaction.

9. The kit according to claim 7, wherein the means for detecting the presence or absence of hemoglobin in the biological sample comprises an anti-hemoglobin antibody.

10. The kit of claim 8, wherein the primers are capable of amplifying a KRAS gene region comprising at least one KRAS mutation selected from the group consisting of: G12D, G12V, G12C, G13D, G12A, G12R, G12S, and G13C, wherein the primers comprise: (1) a forward primer G12D-F comprising SEQ ID NO.: 35, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (2) a forward primer G13D-F comprising SEQ ID NO.: 36, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (3) a forward primer G12V-F comprising SEQ ID NO.: 37, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (4) a forward primer G12C-F comprising SEQ ID NO.: 38, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (5) a forward primer G12S-F comprising SEQ ID NO.: 39, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (6) a forward primer G12A-F comprising SEQ ID NO.: 40, and a reverse primer Kras-R comprising SEQ ID NO.: 42; and (7) a forward primer G12R-F comprising SEQ ID NO.: 41, and a reverse primer Kras-R comprising SEQ ID NO.: 42; And wherein the construct further comprises a KRAS probe comprising SEQ ID NO.:

45. The kit according to claim 9 , wherein the antibody is a colloidal gold-conjugated antibody.

12. The kit according to any one of claims 1 to 4, wherein the kit further comprises a component for amplifying a reference gene for quantification.

13. The kit according to any one of claims 1 to 4, wherein the kit further comprises instructions for using the kit and / or interpreting test results obtained by using the kit.

14. The kit according to claim 9, wherein the kit further comprises a means for detecting a complex formed by the antibody and hemoglobin in the biological sample.

15. The kit according to any one of claims 1 to 4, wherein the biological sample obtained from the patient is a stool sample.

16. The kit according to any one of claims 1 to 4, wherein the kit further comprises a bisulfite reagent, and a container suitable for mixing the bisulfite reagent with the patient's biological sample or a polynucleotide obtained from the biological sample.

17. The kit according to any one of claims 1 to 4, wherein the kit further comprises a methylation-sensitive restriction enzyme reagent.

18. The kit according to any one of claims 1 to 4, wherein the kit further comprises (1) a positive standard and a negative standard for detecting BMP3 methylation in the biological sample, and (2) A positive standard and a negative standard for detecting NDRG4 methylation in the biological sample.

19. The kit according to claim 18, wherein The positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTT TTGCGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG (SEQ ID NO: 67); The negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTT TTGTGTGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG (SEQ ID NO: 68); The positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGCGCGAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGGTACGTTTTTCGCGGCGTATCGTTTTTAGTT (SEQ ID NO.: 69); and The negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTTGGTGGGGGTGTGGATTGATTGGGGTGTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGGTGGAAGTTATGTGTGAGGGATTGTGGTTTGTTTGGGATTAGTTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT (SEQ ID NO.: 70).

20. The kit according to claim 12, wherein the means for amplifying the internal control gene comprises primers for amplifying the positive control gene and / or the negative control gene.

21. Use of a combination of a first primer pair and a first probe and a combination of a second primer pair and a second probe in the preparation of a kit for detecting the presence or absence of colorectal cancer or advanced adenoma in a patient in need thereof, comprising: a) obtaining genomic DNA from a biological sample of the patient; b) treating the genomic DNA or fragments thereof of a) with one or more agents to convert its unmethylated cytosine bases into uracil or another base that is detectably different from cytosine in hybridization properties; c) contacting the treated genomic DNA or treated fragments thereof with a first primer pair for detecting the presence or absence of a methylation site of a gene encoding bone morphogenetic protein 3 (BMP3) in the patient and a second primer pair for detecting the presence or absence of a methylation site of a gene encoding NDRG family member 4 protein (NDRG4) in the patient, wherein the first primer pair comprises a continuous sequence of at least 9 nucleotides that is identical to, complementary to, or hybridizes under stringent hybridization conditions to SEQ ID NO.: 1, and wherein the second primer pair comprises a continuous sequence of at least 9 nucleotides that is complementary to, or hybridizes under stringent hybridization conditions to SEQ ID NO.: 2, wherein the treated genomic DNA or fragments thereof are amplified by the first primer pair or the second primer pair to produce at least one amplicon, or are not amplified; and d) determining the presence or absence of colorectal cancer or advanced adenoma in the patient based on the presence or absence of the amplicon in the patient, the methylation state or level of at least one CpG dinucleotide of the BMP3 gene and the NDRG4 gene using a first probe for detecting the presence or absence of a methylation site of the BMP3 gene and a second probe for detecting the presence or absence of a methylation site of the NDRG4 gene, Wherein the first primer pair and the first probe are selected from: i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4, and a probe comprising SEQ ID NO.: 5; ii) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10, and a probe comprising SEQ ID NO.: 11; and iii) a forward primer comprising SEQ ID NO.: 15, a reverse primer comprising SEQ ID NO.: 16, and a probe comprising SEQ ID NO.: 17; And wherein the second primer pair and the second probe are selected from: iv) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7, and a probe comprising SEQ ID NO.: 8; v) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13, and a probe comprising SEQ ID NO.: 14; and vi) a forward primer comprising SEQ ID NO.: 18, a reverse primer comprising SEQ ID NO.: 19, and a probe comprising SEQ ID NO.:

20.

22. The use according to claim 21, comprising using i) the forward primer comprising SEQ ID NO.: 3, the reverse primer comprising SEQ ID NO.: 4 and the probe comprising SEQ ID NO.: 5, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and ii) the forward primer comprising SEQ ID NO.: 6, the reverse primer comprising SEQ ID NO.: 7 and the probe comprising SEQ ID NO.: 8, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

23. The use according to claim 21, comprising using i) the forward primer comprising SEQ ID NO.: 9, the reverse primer comprising SEQ ID NO.: 10 and the probe comprising SEQ ID NO.: 11, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and ii) the forward primer comprising SEQ ID NO.: 12, the reverse primer comprising SEQ ID NO.: 13 and the probe comprising SEQ ID NO.: 14, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

24. The use according to claim 21, comprising using i) the forward primer comprising SEQ ID NO.: 15, the reverse primer comprising SEQ ID NO.: 16 and the probe comprising SEQ ID NO.: 17, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from the patient, and ii) the forward primer comprising SEQ ID NO.: 18, the reverse primer comprising SEQ ID NO.: 19 and the probe comprising SEQ ID NO.: 20, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from the patient.

25. The use according to any one of claims 21 to 24, wherein both the first probe and the second probe comprise fluorescent donor and acceptor fluorophores.

26. The use according to any one of claims 21 to 24, wherein the first probe and the second probe are TAQMAN® probes.

27. The use according to any one of claims 21 to 24, further comprising the step of detecting the presence or absence of at least one mutation of the KRAS gene in a biological sample obtained from the patient, and the step of detecting the presence or absence of hemoglobin in a biological sample obtained from the patient.

28. The use according to claim 27, wherein the step of detecting the presence or absence of at least one mutation in the KRAS gene in the patient comprises using at least one pair of primers capable of amplifying the exon 12 and / or exon 13 region of the KRAS gene in a polymerase chain reaction.

29. The use according to claim 27, wherein the step of detecting the presence or absence of hemoglobin in the biological sample comprises using an anti-hemoglobin antibody.

30. The use according to claim 28, wherein the primers are capable of amplifying a region of the KRAS gene comprising at least one KRAS mutation selected from the group consisting of G12D, G12V, G12C, G13D, G12A, G12R, G12S and G13C.

31. The use according to claim 29, wherein the antibody is a colloidal gold-conjugated antibody.

32. The use according to any one of claims 21 to 24, wherein the amplification of the BMP3 gene is performed in a quantitative polymerase chain reaction, and further comprises amplifying a first reference gene to determine the Ct value of the BMP3 amplification as ΔCt1.

33. The use according to any one of claims 21 to 24, wherein the amplification of the NDRG4 gene is performed in a quantitative polymerase chain reaction, and further comprises amplifying a second reference gene to determine the Ct value of the NDRG4 amplification as ΔCt2.

34. The use according to claim 32, wherein the amplification of the NDRG4 gene is performed in a quantitative polymerase chain reaction, and further comprises amplifying a second reference gene to determine the Ct value of the NDRG4 amplification as ΔCt2.

35. The use according to any one of claims 28 to 31, wherein amplification of the mutant KRAS gene is performed in a quantitative polymerase chain reaction and further comprises amplifying a third reference gene to determine the Ct value of the mutant KRAS amplification as ΔCt3.

36. The use of claim 34, wherein the first reference gene and the second reference gene are the same.

37. Use according to claim 36, wherein the same reference gene is the B2M gene.

38. The use according to claim 35, wherein the mutant KRAS gene comprises a mutation selected from the group consisting of: G12D, G13D, G12V, G12C, G12S, G12A and G13R.

39. The use according to claim 38, wherein the mutant KRAS gene is amplified by one or more pairs of primers selected from the group consisting of: (1) a forward primer G12D-F comprising SEQ ID NO.: 35, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (2) a forward primer G13D-F comprising SEQ ID NO.: 36, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (3) a forward primer G12V-F comprising SEQ ID NO.: 37, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (4) a forward primer G12C-F comprising SEQ ID NO.: 38, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (5) a forward primer G12S-F comprising SEQ ID NO.: 39, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (6) a forward primer G12A-F comprising SEQ ID NO.: 40, and a reverse primer Kras-R comprising SEQ ID NO.: 42; and (7) a forward primer G12R-F comprising SEQ ID NO.: 41, and a reverse primer Kras-R comprising SEQ ID NO.: 42, And wherein the KRAS probe for quantitative polymerase chain reaction comprises SEQ ID NO.:

45.

40. The use according to claim 35, wherein the third reference gene is the ACTB gene.

41. The use according to claim 40, wherein the quantitative polymerase chain reaction primers for amplifying the ACTB gene comprise SEQ ID NO.: 43 and 44, and the probe comprises SEQ ID NO.:

46.

42. The use according to any one of claims 21 to 24, comprising using (1) a positive standard and a negative standard for detecting BMP3 methylation in the sample, and (2) Positive standards and negative standards for detecting NDRG4 methylation in the sample.

43. The use according to claim 42, wherein The positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTT TTGCGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG (SEQ ID NO: 67); The negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTT TTGTGTGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG (SEQ ID NO: 68); The positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGCGCGAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGGTACGTTTTTCGCGGCGTATCGTTTTTAGTT (SEQ ID NO.: 69); and The negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTTGGTGGGGGTGTGGATTGATTGGGGTGTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGGTGGAAGTTATGTGTGAGGGATTGTGGTTTGTTTGGGATTAGTTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT (SEQ ID NO.: 70).

44. Use according to any one of claims 21 to 24, comprising amplification of quality control standards.

45. Use of a combination of a first primer pair and a first probe and a combination of a second primer pair and a second probe in the preparation of a kit for detecting the presence or absence of colorectal cancer or advanced adenoma in a patient in need thereof, comprising: a) obtaining unprocessed genomic DNA from a stool sample of the patient; b) treating the genomic DNA or fragments thereof of a) with one or more agents to convert its unmethylated cytosine bases into uracil or another base that is detectably different from cytosine in hybridization properties; c) performing a quantitative polymerase chain reaction using the treated genomic DNA of b) as a template, and determining ΔCt1 by subtracting the Ct value of the BMP3 gene in the patient from the Ct value of the first reference gene; d) performing a quantitative polymerase chain reaction using the treated genomic DNA of b) as a template, and determining ΔCt2 by subtracting the Ct value of the NDRG4 gene in the patient from the Ct value of the first reference gene; e) performing a quantitative polymerase chain reaction using untreated genomic DNA as a template, and determining ΔCt3 by subtracting the Ct value of the mutant KRAS gene in the patient from the Ct value of the second reference gene; f) performing a fecal immunochemical test on hemoglobin in the stool sample and determining the score as FIT; g) determine the value of K, where K = a*△Ct1+b*△Ct2+c*△Ct3+d*FIT+X, where a, b, c, d, X are clinical constants; and h) determining a value of a comprehensive index P, wherein P = eK / (1+eK), wherein e is a natural constant, wherein when P is equal to or greater than a predetermined threshold, the patient is determined to have colorectal cancer and / or advanced adenoma, and when P is less than the threshold, the patient is determined to be free of colorectal cancer, The quantitative polymerase chain reaction for amplifying the BMP3 gene comprises a first primer pair and a first probe, wherein the first primer pair and the first probe are selected from: i) a forward primer comprising SEQ ID NO.: 3, a reverse primer comprising SEQ ID NO.: 4, and a probe comprising SEQ ID NO.: 5; ii) a forward primer comprising SEQ ID NO.: 9, a reverse primer comprising SEQ ID NO.: 10, and a probe comprising SEQ ID NO.: 11; and iii) a forward primer comprising SEQ ID NO.: 15, a reverse primer comprising SEQ ID NO.: 16, and a probe comprising SEQ ID NO.: 17; And wherein the quantitative polymerase chain reaction for amplifying the NDRG4 gene comprises a second primer pair and a second probe, wherein the second primer pair and the second probe are selected from: iv) a forward primer comprising SEQ ID NO.: 6, a reverse primer comprising SEQ ID NO.: 7, and a probe comprising SEQ ID NO.: 8; v) a forward primer comprising SEQ ID NO.: 12, a reverse primer comprising SEQ ID NO.: 13, and a probe comprising SEQ ID NO.: 14; and vi) a forward primer comprising SEQ ID NO.: 18, a reverse primer comprising SEQ ID NO.: 19, and a probe comprising SEQ ID NO.:

20.

46. ​​The use according to claim 45, comprising using i) comprising the forward primer of SEQ ID NO.: 3, the reverse primer of SEQ ID NO.: 4 and the probe of SEQ ID NO.: 5, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in the sample, and ii) comprising the forward primer of SEQ ID NO.: 6, the reverse primer of SEQ ID NO.: 7 and the probe of SEQ ID NO.: 8, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in the sample.

47. The use according to claim 45, comprising using i) the forward primer comprising SEQ ID NO.: 9, the reverse primer comprising SEQ ID NO.: 10 and the probe comprising SEQ ID NO.: 11, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in the sample, and ii) comprising the forward primer of SEQ ID NO.: 12, the reverse primer of SEQ ID NO.: 13 and the probe of SEQ ID NO.: 14, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in the sample.

48. The use according to claim 45, comprising using i) comprising the forward primer of SEQ ID NO.: 15, the reverse primer of SEQ ID NO.: 16 and the probe of SEQ ID NO.: 17, which are used to detect the methylation state or level of at least one CpG dinucleotide of the BMP3 gene in the sample, and ii) comprising the forward primer of SEQ ID NO.: 18, the reverse primer of SEQ ID NO.: 19 and the probe of SEQ ID NO.: 20, which are used to detect the methylation state or level of at least one CpG dinucleotide of the NDRG4 gene in the sample.

49. The use according to any one of claims 45 to 48, wherein both the first probe and the second probe comprise fluorescent donor and acceptor fluorophores.

50. The use according to any one of claims 45 to 48, wherein the first probe and the second probe are TAQMAN® probes.

51. The use of any one of claims 45 to 48, wherein the mutant KRAS gene comprises at least one KRAS mutation selected from the group consisting of: G12D, G12V, G12C, G13D, G12A, G12R, G12S and G13C.

52. The use according to any one of claims 45 to 48, wherein the fecal immunochemical test comprises a colloidal gold-conjugated antibody.

53. The use according to any one of claims 45 to 48, wherein steps c) and d) comprise using the B2M gene as the first reference gene.

54. The use according to claim 51, wherein the mutant KRAS gene is amplified by one or more pairs of primers selected from the group consisting of: (1) a forward primer G12D-F comprising SEQ ID NO.: 35, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (2) a forward primer G13D-F comprising SEQ ID NO.: 36, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (3) a forward primer G12V-F comprising SEQ ID NO.: 37, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (4) a forward primer G12C-F comprising SEQ ID NO.: 38, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (5) a forward primer G12S-F comprising SEQ ID NO.: 39, and a reverse primer Kras-R comprising SEQ ID NO.: 42; (6) a forward primer G12A-F comprising SEQ ID NO.: 40, and a reverse primer Kras-R comprising SEQ ID NO.: 42; and (7) a forward primer G12R-F comprising SEQ ID NO.: 41, and a reverse primer Kras-R comprising SEQ ID NO.: 42, And wherein the amplified quantitative polymerase chain reaction product of the mutant KRAS gene is detected by a KRAS probe comprising SEQ ID NO.:

45.

55. The use according to claim 54, wherein the ACTB gene is used as the second reference gene in the quantitative polymerase chain reaction for amplifying the mutant KRAS gene.

56. The use according to claim 55, wherein the quantitative polymerase chain reaction primers for amplifying the ACTB gene comprise SEQ ID NOs.: 43 and 44, and the quantitative polymerase chain reaction probe for the ACTB gene comprises SEQ ID NO.:

46.

57. The use according to any one of claims 45 to 48, comprising using (1) a positive standard and a negative standard for detecting BMP3 methylation in the sample, and (2) Positive standards and negative standards for detecting NDRG4 methylation in the sample.

58. The use according to claim 57, wherein The positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTT TTGCGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG (SEQ ID NO: 67); The negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTT TTGTGTGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG (SEQ ID NO: 68); The positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGCGCGAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGGTACGTTTTTCGCGGCGTATCGTTTTTAGTT (SEQ ID NO.: 69); and The negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTTGGTGGGGGTGTGGATTGATTGGGGTGTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGGTGGAAGTTATGTGTGAGGGATTGTGGTTTGTTTGGGATTAGTTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT (SEQ ID NO.: 70).

59. Use according to any one of claims 45 to 48, comprising amplifying a quality control standard in step c) and step d).

Images