Adeno-associated viral vector for the treatment of vitelliform macular degeneration

Abstract

Some aspects of the present disclosure relate to methods and compositions useful for treating vitelliform macular dystrophy (eg, vitelliform macular degeneration).

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of the filing dates of U.S. Provisional Application No. 62 / 726,184, filed on August 31, 2018, U.S. Provisional Application No. 62 / 749,622, filed on October 23, 2018, and U.S. Provisional Application No. 62 / 754,530, filed on November 1, 2018, the entire contents of each of which are incorporated by reference.

[0003] Government support

[0004] This invention was made with government support under Grant No. EY021721 awarded by the National Institutes of Health. The government has certain rights in this invention. Background Art

[0005] Mutations in the BEST1 gene (also known as VMD2) lead to several forms of retinal degeneration, including Best vitelliform macular dystrophy, also known as vitelliform macular degeneration (BestDisease, which may also be referred to as Best macular dystrophy, vitelline dystrophy, and vitelliform macular dystrophy). Bestrophinopathy is caused by more than 200 different mutations in the human BEST1 gene, which encodes a protein (bestrophin or BEST1) that functions as a calcium-dependent chloride channel associated with the basolateral membrane of the retinal pigment epithelium. In vitelliform macular dystrophy, defective fluid transport on the RPE impairs the interaction between the RPE and photoreceptor cells. This damage causes the retina to peel off from its supporting layers and accumulates oxidized proteolipids (lipofuscin) in the RPE and subretinal cavity. Eventually, photoreceptors in the macular region, which is primarily responsible for central vision, lose activity. In humans, BEST1 mutations are usually autosomal dominant, meaning that one defective copy causes the disease regardless of whether the normal (wild-type) gene inherited from the other parent is present. However, autosomal recessive yolk-like macular dystrophy (ARB) has also been reported.

[0006] Vitellogenous macular degeneration, as a rare disease, is a slowly progressive macular dystrophy that usually develops in childhood and sometimes in the late teens. Affected individuals initially have normal vision, followed by a decrease in central visual acuity and metamorphopsia. Individuals retain normal peripheral vision and dark adaptation. Individuals develop a mass on the macula that resembles egg yolk. The mass eventually breaks off and spreads throughout the macula, resulting in decreased central vision. Vitellogenous macular degeneration can be diagnosed based on family history or an ophthalmological examination, such as fundus findings or an electrooculogram (EOG).

[0007] Inherited retinal degenerations (IRDs) encompass a large group of blinding disorders that are molecularly heterogeneous and pathophysiologically distinct. Genetic defects usually act primarily on rod or cone photoreceptors (PRs), or both, and specific defects may involve phototransduction, ciliary transport, morphogenesis, neurotransmission, or others. Less common are primary defects involving the retinal pigment epithelium (RPE), although they have received increasing attention due to high-profile clinical trials.

[0008] The most common IRD caused by primary RPE defects is caused by mutations in BEST1, a transmembrane protein encoding the basolateral part of the RPE. BEST1 (BEST1) is a multifunctional channel protein responsible for mediating transepithelial ion transport, regulating intracellular calcium signaling and RPE cell capacity, and regulating the homeostatic environment in the subretinal cavity. In eukaryotic cells, BEST1 forms a stable homopentamer through four transmembrane helices, N and C-terminals of the cytoplasm, and a continuous central hole sensitive to calcium-dependent control of chloride ion penetration.

[0009] In humans, BEST1 mutations lead to a wide range of IRDs, grouped together as vitelliform macular dystrophy that often involves a specific macular lesion. Despite the presence of panretinal electrophysiological defects on EOG, retinal areas distal to the lesion tend to appear remarkably normal, reflecting abnormalities in the standing potential of the eye. Naturally occurring biallelic mutations in the canine BEST1 gene (canine BEST1, cBEST1) result in canine IRDs with marked phenotypic similarities to both dominant and recessive forms of human vitelliform macular dystrophy, including a marked predilection for subretinal lesions to the fovea-like area in dogs.

[0010] Correct anatomical juxtaposition and the continuous interaction between the RPE top microvilli (microvilli, MV) and the PR outer segment (outer segment, OS) are considered to be crucial for normal vision. The ion composition and volume regulation of the subretinal space are essential for maintaining the precise molecular proximity of the complex and the steady state of the RPE-PR interface. For a long time, in vitro and ex vivo studies have shown that genetic mutations, metabolic disturbances and light stimulation have changed the ion composition of the subretinal space and the physiological response of RPE and / or PR. Recently, the microscopic dissection of the outer retina in health and disease and the in vivo study of its response to light have become more and more information-based along with modern retinal imaging modes.

[0011] Mutations in the BEST1 gene lead to retinal detachment and photoreceptor (PR) cell degeneration due to a primary channelopathy of adjacent retinal pigment epithelial (RPE) cells. The pathophysiology of the interaction between RPE and PR cells that precedes retinal detachment remains poorly understood. Summary of the invention

[0012] Some aspects of the present disclosure relate to compositions for treating yolk-like macular dystrophy (e.g., Best yolk-like macular dystrophy) in a subject (e.g., in humans). Some aspects of the present disclosure are designed to inhibit the expression of endogenous BEST1 mRNA (e.g., both mutations and normal copies). In some embodiments, RNA interference is used to inhibit expression. In some embodiments, endogenous BEST1 mRNA is simultaneously replaced by normal BEST1 mRNA to produce only normal protein. In some embodiments, an intron-free copy of the BEST1 gene plus a small hairpin RNA (shRNA) gene is delivered using an adeno-associated virus (AAV), which results in the production of small interfering RNA (siRNA).

[0013] In some embodiments, one or both alleles of the BEST1 gene of an object (e.g., a human) are silenced by administering a short hairpin RNA (shRNA) molecule to an object (e.g., an object with yolk-like macular degeneration, such as a human with yolk-like macular degeneration). In some embodiments, an alternative BEST1 coding sequence is also administered to the object to provide a protein of a functional bestrophin, such as to restore the photoreceptor function of the object. In some embodiments, the alternative BEST1 coding sequence has one or more nucleotide substitutions relative to one or more endogenous gene alleles, which renders the alternative gene resistant to the effects of interfering RNA. In some embodiments, the alternative BEST1 coding sequence is a human BEST1 coding sequence (e.g., a wild-type human BEST1 coding sequence) comprising one or more (e.g., 1, 2, 3, 4, 5 or more) substitutions to render the gene resistant to shRNA-mediated degradation. In some embodiments, the alternative BEST1 coding sequence comprises one or more silent mutations (base changes in the third position of the codon) in the target site to render the gene "off-target" for shRNA-mediated degradation.

[0014] In some aspects, the disclosure provides short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2), an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3), and a loop. In some embodiments, the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO: 7).

[0015] In some aspects, the disclosure provides short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO: 6), an antisense strand comprising the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO: 5), and a loop. In some embodiments, the loop comprises the nucleotide sequence CUCGAG (SEQ ID NO: 8).

[0016] In some embodiments, the disclosure provides a short hairpin RNA (shRNA) comprising an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3).

[0017] In some aspects, the disclosure provides vectors comprising a genetic sequence encoding the shRNA described in the preceding paragraphs.

[0018] In some aspects, the disclosure provides a vector further comprising a recombinant functional (e.g., wild-type) BEST1 coding sequence, the BEST1 coding sequence not comprising a sequence targeted by shRNA. In some aspects, the vector further comprises a recombinant functional BEST1 coding sequence codon-optimized for expression in human cells.

[0019] In some aspects, the disclosure provides a vector comprising a recombinant BEST1 coding sequence comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 9. In some aspects, the disclosure provides a vector comprising a recombinant BEST1 coding sequence comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 10.

[0020] In some aspects, the disclosure provides a vector that is a plasmid or a viral vector. In some aspects, the viral vector is a recombinant adeno-associated virus (rAAV) vector. In some aspects, the rAAV vector is self-complementary.

[0021] In some aspects, the present disclosure provides rAAV viral particles that are AAV serotype 2 viral particles.

[0022] In some aspects, the disclosure provides compositions comprising a vector or rAAV particle and a pharmaceutically acceptable carrier.

[0023] In some aspects, the disclosure provides methods for regulating BEST1 expression in an object, the method comprising administering to an object (e.g., a human object) a composition comprising a vector or rAAV particles and a pharmaceutically acceptable carrier. In some aspects, the disclosure provides methods for treating vitelliform macular dystrophy (e.g., vitelliform macular degeneration and ARB) in an object, the method comprising administering a composition.

[0024] In some embodiments, vectors encoding functional BEST1 sequences are provided to complement or correct (eg, at least partially complement or correct) cellular BEST1 function without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequence is codon-optimized.

[0025] In some embodiments, a vector encoding a functional BEST1 sequence is provided to supplement or correct (e.g., at least partially supplement or correct) cell BEST1 function, and an shRNA sequence is provided to knock down endogenous BEST1 gene expression. In some embodiments, shRNA is used to knock down endogenous Best1 expression. In some embodiments, the BEST1 sequence is codon optimized. In some embodiments, the BEST1 sequence is modified to be resistant to shRNA. In some embodiments, BEST1 and shRNA sequences are encoded on the same AAV vector.

[0026] In some aspects, the disclosure provides compositions for treating yolk-like macular degeneration and compositions for manufacturing drugs for treating yolk-like macular degeneration. In some aspects, the disclosure provides compositions comprising vectors or rAAV particles for treating ARBs (wherein the vector encodes a functional BEST1 sequence) and compositions for manufacturing drugs for treating ARBs.

[0027] These and other aspects are described in the following figures, examples and appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The following drawings constitute part of this specification and are included to further illustrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in conjunction with the detailed description of specific embodiments given herein. It should be understood that the data shown in the drawings in no way limit the scope of the present disclosure.

[0029] Figures 1A to 1D Shown is the panretinal pathology of RPE apical microvillous projections associated with BEST1 mutations in dogs. Figure 1A and 1B An example is shown with wild type ( Figure 1A )(42 weeks) compared to cBest(R25* / R25*; 89 weeks)( Figure 1B ) Confocal images of molecular pathology of retinal cryosections were immunolabeled with anti-EZRIN and human cone arrestin and combined with peanut agglutinin, lectin, and DAPI. Figure 1C Representative micrographs of 6-week-old canine wild-type and cBest mutant (R25* / P463fs) retinas immunolabeled with anti-BEST1 and anti-SLC16A1 are shown. White arrows point to subpopulations of cone-MVs. Figure 1DQuantification of cone-MV numbers across the retina between cBest mutants and age-matched control eyes is shown. The y-axis represents the mean cone-MV number / square millimeter for each color-coded retinal area examined. Abbreviations: H&E, hematoxylin & eosin staining; PRL, photoreceptor IS / OS layer; i, inferior; N, nasal; S, superior; T, temporal.

[0030] Figures 2A to 2F Shown are light-mediated changes in outer retinal structure in wild type and cBest(R25* / P463fs) mutants. Figure 2A Shown are cross-sectional images along the horizontal meridian through the middle of the central area (fovea-like area) in 15-week-old normal (WT) dogs and 11-week-old cBest (R25* / P463fs) under less and more light adaptation (LA) conditions. The thin white arrow indicates the superior temporal location of the OCT. Figure 2B The longitudinal reflectivity profile (LRP) at 3° nasal from the foveal-like region (T, temporal retina) and the nasal edge of the optic nerve head (N, nasal retina) in WT dogs (12 eyes, 15 to 17 weeks of age) is shown compared to cBest treated dogs (6 eyes, 11 weeks of age) with less and more LA (average of 85 single LRPs). Arrows indicate IS / OS and RPE / T peaks; single and double arrows mark additional low-reflection layers in cBest. Figure 2C The distance between IS / OS and RPE / T peak in WT and cBest eyes under both LA conditions is shown. Symbols with error bars represent the mean distance at two locations for each group of eyes (±2SD). Figure 2D is a schematic description of the dark adaptation and light adaptation protocol. Animals were dark adapted (D / A) overnight and OCT imaging was performed. Then, five increasing light exposures (L1 to L5) were used. Figure 2D Also shown are magnified views of OCT scans in cBest with overlaid LRP after overnight dark adaptation (left) and after maximum light exposure (right). Figure 2E Shown are the results of using a simplified protocol involving only L4 and L5 exposure in different subgroups of cBest eyes (n=3; colored traces). Figure 2F Spatial topography of the distance of IS / OS to RPE / T in average WT compared with two representative cBest eyes is shown [group; EM356-OS: 297 weeks old cmr1 / cmr3(R25* / P463fs); LH30-OD: 12 weeks old cmr3(P463fs / P463fs)].

[0031] Figures 3A to 3D It is shown that BEST1 gene enhancement therapy in cBest mutants leads to sustained reversal of foveal macular lesions and restoration of RPE-PR interface structure. Figure 3A Shown is the natural history of central subretinal detachment recorded by in vivo imaging in the right eye of a cBest dog (EM356-OD; R25* / P463fs) at three time points. Insets show autofluorescence and OCT images. Figure 3B Shown in Figure 3A AAV2-cBEST1 (1.5 × 10 10 Fundus images taken before (at 52 weeks of age) and after 43 weeks of retinal bleb injection (vg / mL). The subretinal bleb area is indicated by the dotted circle. Images acquired at 43 and 245 weeks after injection documented the continued reversal of the central lesion and the complete reattachment of the retina in the treated area. The middle and right insets show the autofluorescence and OCT images. Figure 3C and 3D Shown is the restoration of RPE-photoreceptor interface structure after AAV-hBEST1 treatment in the cBest (R25* / R25*) model compared to controls. The bubble boundary is marked by a dotted circle; the position of the corresponding OCT scan that pierced the subretinal lesion before injection or passed through the matching position mapped after injection is marked by a horizontal line; the retinotomy site is indicated by an arrow.

[0032] Figures 4A to 4F Shown is the reversal of microdetachment on retinal areas after subretinal gene therapy in cBest mutant dogs [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), or cmr3(P463fs / P463fs)] injected subretinaly with BSS or AAV-hBEST1. Figure 4A Figures showing IS / OS-RPE / T distance topography in cBest mutant dogs [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), or cmr3(P463fs / P463fs)] injected subretina with BSS or AAV-hBEST1. Treatment boundaries were based on fundus photographs of blebs taken at the time of injection (dashed lines) and, if visible, on the demarcation apparent at imaging (dashed lines). All eyes are shown as equivalent right eyes with the optic nerve and large vessels (black), the border of the reflective uveal layer (white), and the foveal-like area (white ellipse) superimposed for ease of comparison. Figure 4BIS / OS-RPE / T distance differences with WT at upper and lower retinal locations in cBest eyes are shown within the treated bleb (Tx; solid symbols) and untreated outer bleb (control; open symbols) regions. The dotted line defines the 95th percentile of normal variability. Topographic maps showing IS / OS-RPE / T distances before (left) and after (right) treatment. Figure 4C and 4E Grayscale graph depicting the difference between each cBest eye and the average WT control. White represents severe retinal detachment. Figure 4D and 4F They are shown for Figure 4C and 4E Measurements of the difference in colocalization of the IS / OS-RPE / T distance between WT and cBest before (PreTx) and after (Tx) treatment for the eyes shown in FIG.

[0033] Figures 5A to 5G Retinal localization phenotypes in two human subjects with ARB are shown. Figure 5A Shown is RPE health across the retina of two ARB patients P1 and P2 imaged with short-wavelength reduced-illuminance autofluorescence imaging (SW-RAFI) using the natural RPE fluorophore lipofuscin. White arrows show the periphery outline and location of the OCT scan; rectangles show the region of interest shown in other figures; and black arrows define the disease-to-health transition in the nasal mid-peripheral retina. Figure 5B Peripheral light sensitivity of rods in the dark-adapted eye (top) and cones in the light-adapted eye (bottom) measured across the horizontal meridian is shown. The gray area represents normal sensitivity except for the physiological blind spot corresponding to the optic nerve (ONH). Figure 5C A cross section of the retina using OCT along the horizontal meridian across the fovea is shown. Figure 5D and 5E The parapapillary retina ( Figure 5D ) and the intermediate peripheral nasal retina ( Figure 5E ) Details of the outer retinal lamination in a patient at two areas of interest. Colors indicate the interface adjacent to the COS tip and the interface adjacent to the ROS tip and the RPE apical process, and bricks indicate the interface adjacent to the RPE and Bruch's membrane. Fig. 5F and 5G It is shown that in P1, at the peri-pupillary site ( Fig. 5F ) and in P2 at the mid-lateral peripheral part of the nose ( Figure 5G) The dark adaptation kinetics were measured. Time 0 refers to the end of light adaptation.

[0034] Figures 6A to 6D Shown are RPE-PR interdigitating junctions in a canine model of CNGB3-related achromatopsia (ACHM3). Fig. 6A and 6B Six-week-old CNGB3-D262N-mutant ( Fig. 6A ) and CNGB3-empty ( Figure 6B ; CNGB3 - / - ) Representative fluorescence microscopy images of the retina, demonstrating normal expression of BEST1 is restricted to the basolateral plasma membrane of RPE cells and SLC16A1, a marker of RPE apical processes. Arrows point to a subpopulation of cone-associated RPE apical microvilli (c-MVs). Fig. 6A and 6B Anti-CNGB3 and anti-EZRIN co-labeling is also shown, with age-matched wild-type retinas shown for reference. Figure 6C and 6D The results show that Figure 6C ) and 57 weeks of age ( Fig.6D ) Immunohistochemical evaluation of the RPE-PR interface in the CNGB3 mutant retina of affected dogs. The RPE apical surface and its microvillous extensions were immunolabeled with EZRIN, and a subpopulation of c-MVs is indicated by arrows. Abbreviations: ACHM3, achromatopsia type 3; cCNGB3, canine CNGB3 gene; c-MV, cone-associated RPE apical microvilli; CNGB3, cyclic nucleotide-gated channel β3 protein; hCAR, human cone arrestin; SLC16A1, solute carrier family 16 member 1.

[0035] Figure 7 Two cBest-affected (R25* / P463fs) eyes [43 (right) and 52 (left) weeks of age] were dark-adapted overnight and compared with Figure 2A The results shown in were similar to those shown in .

[0036] Figures 8A to 8B Shown is the ultrathick ONL at the retinal area with microdetachment in cBest's eye and its correction under gene therapy. Fig. 8A The uninjected cBest eye ( Figures 2A to 2F and Figures 4A to 4F The IS / OS-RPE / T thickness map (shown in Figure 5) demonstrated hyperthick ONL corresponding to large areas of retinal microdetachment, as well as focal thinning of the ONL above severe lesions and adjacent to foveal-like areas in some eyes. Figure 8B The processed cBest eye (in Figures 4A to 4FFigure 2 (Shown as IS / OS-RPE / T thickness maps in Figure 2) shows normal ONL thickness in AAV-treated areas surrounded by hyperthick, normal, or thin ONL in untreated areas. OD, right eye; OS, left eye.

[0037] Figures 9A to 9F Shown is the evolution of focal macular lesions in a cBest affected (R25* / P463fs) dog (EM356-OS). Fig.9A shows discrete separation of the photoreceptor layer from the underlying RPE progressing toward the apparent formation of a large subretinal macroscopic detachment (vitelline lesion), and Fig. 9B The corresponding OCT scan at 23 weeks of age is shown. Fig. 9C Shown are the first signs of accumulation of hyperautofluorescent material within subretinal lesions observed after 8 weeks (31 weeks; early pseudopurulent lesions). Fig.9D Shown is that at 66 weeks of age, a typical pseudopyometra appearance was documented, followed by yolk-rupture-like lesions and dispersion of autofluorescent material at 172 and 297 weeks of age (inset, close-up). Fig.9E and 9F The significant thinning of the ONL is shown to be evident by OCT scans. The dark line defines the location of the corresponding SD-OCT scan.

[0038] Fig.10 Retinal protection following AAV-hBEST1 treatment compared to wild-type controls and cBest untreated eyes is shown in three cBest models [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), and cmr3(P463fs / P463fs)].

[0039] Figures 11A to 11D Shown is the dose-response effect of BEST1 transgenic expression on RPE cytoskeletal rescue in cBest(R25* / P463fs) retinas. Fig.11A Shown is a cross-sectional overview from the surgical bleb region (left), through the adjacent penumbra region (middle), and toward the continuum beyond the injection region (right). Fig. 11B A significant extension of the RPE apical projection within the treated area with enhanced BEST1 is shown; Fig. 11C The presence of residual microvilli and rod-MVs in the alveolar penumbra associated with patchy distribution of BEST1 (faint signals within individual RPE cells) and RPE-PR microdetachment is shown; Fig.11D Shown is the formation of subretinal lesions outside the treated area in the absence of both BEST1 expression and RPE apical processes.

[0040] Figures 12A to 12BRod and cone function in ARB patient P1 ( Fig. 12A ) and P2( Fig. 12B Figure 2. Interocular symmetry of the eyes of two patients with ARB. Figure 2. Rod sensitivity loss (RSL) and cone sensitivity loss (CSL) in both eyes of two patients with ARB.

[0041] Fig.13 A map of the 6262 bp plasmid pTR-VMD2-hBest human benzygospondin is shown.

[0042] Fig.14 A map of the 6222 bp plasmid pTR-VMD2-cBest canine spotted strophin is shown.

[0043] Fig.15 A map of the 6209 bp plasmid pTR-SB-VMD2-HBest1-shRNA05, which contains resistance Best1, is shown.

[0044] Fig.16 A map of the 6145 bp plasmid pTR-SB-VMD2-DTBest1-shRNA744, which contains the off-target Best1, is shown.

[0045] Fig.17 It was shown that the VMD2 promoter works well in cell culture. HEK293T cells were transfected with plasmids expressing GFP or Best1 using either the Chicken beta actin (CBA) promoter or the VMD2 promoter. Protein lysates were separated on polyacrylamide gels and expression of Best1 was detected by Western blotting and normalized to β-tubulin expression to show uniform gel loading.

[0046] Figures 18A to 18B Shows that Best1-specific siRNA is functional. Western blot ( Fig.18A ) and quantified in bar graphs ( Fig.18B ) showed that transfection of HEK293T cells stably expressing BEST1 resulted in a 75% decrease in Best1 protein.

[0047] Figures 19A to 19B Shown that Best1 shRNA is active: HEK293T-BEST1 cells were transfected with 4 μg of the indicated plasmids.

[0048] Fig. 20Off-target of Best1 is shown. Silent mutation (base change at the third position of codon) is used to remove siRNA target site from Best1 mRNA. The disclosed embodiment is for shRNA744. SEQ ID NO: 15 to 17 correspond to the sequence from top to bottom: wild-type BEST1 target site; (complementary sequence) shRNA744 target site and off-target DTBEST1 siRNA target site. DETAILED DESCRIPTION

[0049] Some aspects of the present application provide methods and compositions useful for treating vitelliform macular degeneration in a subject (eg, in a human subject having vitelliform macular degeneration).

[0050] In some embodiments, the disclosure provides methods and compositions for delivering functional bestrophin protein to an object with one or more mutant BEST1 genes. In some embodiments, a recombinant BEST1 gene (e.g., a coding sequence, such as cDNA or an open reading frame) is provided in a viral vector (e.g., an rAAV vector). In some embodiments, the expression of one or two alleles of an endogenous BEST1 gene is also knocked down. For example, in some embodiments, siRNA (e.g., shRNA) is delivered to an object together with the recombinant BEST1 gene. In some embodiments, a viral vector (e.g., an rAAV vector) encodes both a recombinant BEST1 gene and one or more siRNAs targeting an endogenous BEST1 gene. In some embodiments, the recombinant BEST1 gene is modified to include one or more nucleotide replacements, so that it is resistant to the targeting of one or more siRNAs. In some embodiments, the recombinant BEST1 gene is codon-optimized (e.g., for expression in an object (e.g., in a human object)).

[0051] In some embodiments, the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2), an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3), and a loop. In some embodiments, the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO: 7).

[0052] In other embodiments, the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO: 6), an antisense strand comprising the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO: 5), and a loop. In some embodiments, the loop comprises the nucleotide sequence CUCGAG (SEQ ID NO: 8).

[0053] In some embodiments, the disclosure provides a short hairpin RNA (shRNA) comprising an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3).

[0054] In some embodiments, shRNA can be delivered as a shRNA driven by a promoter (e.g., human H1 RNA promoter) using a vector. In some embodiments, the vector is a plasmid. In some embodiments, the vector is a viral vector, such as an adeno-associated virus (AAV) vector. In some embodiments, the vector is a double-stranded or self-complementary AAV vector. In some embodiments, the vector sequence encoding the shRNA comprises a BEST1 sequence.

[0055] Thus, in some embodiments, the shRNA may be composed of a sequence having CCGTCAAAGCTTCACAGTGT TTCAAGAGA A nucleic acid of the sequence ACACTGTGAAGCTTTGACG (SEQ ID NO: 18) is encoded on a DNA vector (eg, a viral vector), wherein the loop sequence is underlined. In some embodiments, a different loop sequence replaces the loop sequence shown in SEQ ID NO:7.

[0056] Additionally, in some embodiments, the shRNA may be composed of a polypeptide having a GCTGCTATATGGCGAGTTCTT CTCGAG A nucleic acid of the sequence AAGAACTCGCCATATAGCAGC (SEQ ID NO: 19) is encoded on a DNA vector (eg, a viral vector), wherein the loop sequence is underlined. In some embodiments, a different loop sequence replaces the loop sequence shown in SEQ ID NO:8.

[0057] In some embodiments, the same vector comprises a coding sequence encoding a normal (eg, wild-type) Best1 protein but resistant to the action of the shRNA expressed by the vector.

[0058] In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:9.

[0059] In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 10. In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 11.

[0060] In some embodiments, the BEST1 coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:15.

[0061] The 1757-bp wild-type BEST1 sequence is defined as follows (SEQ ID NO: 9):

[0062]

[0063] In some embodiments, the BEST1 coding sequence comprises a short off-target sequence corresponding to a region of the wild-type BEST1 gene. An exemplary off-target sequence that can be used with a vector sequence encoding the shRNA744 sequence is defined as follows (SEQ ID NO: 10): CTACTGTACGGAGAATTTCT.

[0064] Other nucleotide substitutions can be made to de-target the BEST1 sequence. For example, in some embodiments, the off-target sequence is located at a different position on the BEST1 coding sequence and corresponds to a different region of the wild-type BEST1 gene. An exemplary off-target sequence that can be used with a vector sequence encoding the shRNA05 sequence is defined as follows (SEQ ID NO: 11): CCAGCAAGCTGCACAGCGT.

[0065] In some embodiments, an shRNA (e.g., shRNA05) encoded by a nucleic acid comprising a sequence of SEQ ID NO: 1 (and / or its complementary sequence) is transcribed in a host cell (e.g., in a subject, e.g., in a human subject) treated with the vector. In some embodiments, two or more different shRNAs (e.g., having different start sites and / or stop sites, e.g., differing from shRNA05 by one or two additional or fewer nucleotides) are transcribed in a host cell.

[0066] In some embodiments, the BEST1 coding sequence is driven by a promoter (e.g., the human opsin proximal promoter). In some embodiments, the promoter comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the following SEQ ID NO: 12.

[0067] In some embodiments, the promoter driving the expression of the shRNA comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the following SEQ ID NO: 13. In some embodiments, the promoter driving the expression of the shRNA comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the following SEQ ID NO: 14.

[0068] The sequence of an exemplary promoter is as follows:

[0069] VMD2 promoter, 623 bp fragment (SEQ ID NO: 12)

[0070]

[0071] H1 promoter (SEQ ID NO: 13)

[0072]

[0073] U6 promoter (SEQ ID NO: 14)

[0074]

[0075] In some embodiments, the BEST1 coding sequence is in a vector, such as an AAV vector or plasmid.

[0076] In some embodiments, the vectors described herein comprise a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the off-target BEST1 sequence SEQ ID NO:10.

[0077] In some embodiments, vectors encoding functional BEST1 sequences are provided to complement or correct (eg, at least partially complement or correct) cellular BEST1 function without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequence is codon-optimized.

[0078] In some embodiments, a vector encoding a functional BEST1 sequence and a shRNA sequence is provided to supplement or correct (e.g., at least partially supplement or correct) cell BEST1 function and knock down endogenous BEST1 gene expression. In some embodiments, shRNA is used to knock down endogenous Best1 expression. In some embodiments, the BEST1 sequence is codon optimized. In some embodiments, the BEST1 sequence is modified to be resistant to shRNA. In some embodiments, BEST1 and shRNA sequences are encoded on the same AAV vector.

[0079] In some embodiments, the disclosure provides methods of regulating BEST1 expression in an object, the method comprising administering to an object (e.g., a human subject) a composition comprising a vector or rAAV particles and a pharmaceutically acceptable carrier. In some aspects, the disclosure provides methods of treating vitelliform macular dystrophy (e.g., vitelliform macular degeneration and ARB) in an object, the method comprising administering a composition.

[0080] In some embodiments, the present disclosure provides compositions for treating yolk-like macular degeneration and compositions for manufacturing drugs for treating yolk-like macular degeneration. In some aspects, the present disclosure provides compositions comprising vectors or rAAV particles for treating ARBs (wherein the vector encodes a functional BEST1 sequence) and compositions for manufacturing drugs for treating ARBs.

[0081] Some aspects of the present disclosure relate to recombinant adeno-associated virus (rAAV) particles for delivering rAAV vectors as described herein (e.g., encoding shRNA and / or replacing BEST1) to various tissues, organs and / or cells. In some embodiments, rAAV particles include capsid proteins as described herein, such as AAV2 capsid proteins. In some embodiments, the vector contained in the rAAV particle encodes the target RNA (e.g., shRNA comprising the sequence of SEQ ID NO: 1) and comprises a replacement BEST1 coding sequence (e.g., a sequence comprising SEQ ID NO: 10).

[0082] The recombinant AAV (rAAV) vector contained in the rAAV particle may include at least (a) one or more heterologous nucleic acid regions (e.g., encoding shRNA and / or Best1 protein) and (b) one or more regions containing inverted terminal repeat (ITR) sequences (e.g., wild-type ITR sequences or modified ITR sequences) (or transgenes) flanking the one or more heterologous nucleic acid regions. In some embodiments, the heterologous nucleic acid region encodes a target RNA (e.g., an shRNA containing a sequence of SEQ ID NO: 3) and contains an alternative BEST1 coding sequence (e.g., a sequence containing SEQ ID NO: 10). In some embodiments, the size of the rAAV vector is 4 kb to 5 kb (e.g., a size of 4.2 to 4.7 kb). The rAAV vector may be encapsidated by a viral capsid (e.g., an AAV2 capsid). In some embodiments, the rAAV vector is single-stranded. In some embodiments, the rAAV vector is double-stranded. In some embodiments, a double-stranded rAAV vector can be, for example, a self-complementary vector that comprises a region of the vector that is complementary to another region of the vector, thereby resulting in the formation of double-strandedness of the vector.

[0083] As disclosed herein, analysis of Best1 constructs with targeted mutations indicates that loss of retinal pigment epithelial apical microvilli and resulting retinal microdetachments represent the earliest features of canine vitelliform macular dystrophy. Retinal light exposure amplifies microdetachments, and dark adaptation reduces microdetachments. Subretinal adeno-associated virus-based gene therapy corrects both vitelliform lesions and light-modulated microdetachments.

[0084] Molecular pathological studies in canine BEST1 disease models reveal panretinal abnormalities associated with defects in RPE microvilli ensheathment and insoluble interphotoreceptor matrix associated with cone PR at the RPE-PR interface. In vivo imaging showed panretinal RPE-PR micropeeling, which contracted with dark adaptation and extended after exposure to moderate intensity light. Subretinal BEST1 gene enhancement therapy using adeno-associated virus 2 not only reversed clinically detectable subretinal lesions, but also reversed diffuse micropeeling. Immunohistochemical analysis shows correction of structural changes at the RPE-PR interface in areas with BEST1 transgenic expression. Successful therapeutic effects were demonstrated in three different canine BEST1 genotypes, with vector titers at 0.1 × 10 11 Up to 5×10 11 In the range of 1 vector genome / mL, patients with biallelic BEST1 mutations exhibited large areas of retinal lamination defects, severe loss of PR sensitivity, and slowed retinoid recycling. Human translation of canine BEST1 gene therapy successfully reversed macro- and micro-detachments by restoring cellular architecture at the RPE-PR interface, with the prospect of leading to improved visual function and preventing disease progression in patients with vitelliform macular dystrophy.

[0085] As further disclosed herein, adeno-associated virus (AAV)2-mediated augmentation of the BEST1 gene was found to correct this major subclinical defect and disease.

[0086] The rAAV particles can be any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, or 2 / 9). As used herein, the serotype of the rAAV particle refers to the serotype of the capsid protein. In some embodiments, the rAAV particle is AAV2. Some non-limiting examples of derivatives and pseudotypes include rAAV2 / 1, rAAV2 / 5, rAAV2 / 8, rAAV2 / 9, AAV2-AAV3 hybrids, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV2.6, AAV2.7, AAV2.8, AAV2.9, AAV2.10, AAV2.11, AAV2.12, AAV2.13, AAV2.14, AAV2.15, AAV2.16, AAV2.17, AAV2.18, AAV2.19, AAV2.20, AAV2.21 AV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2. AAV clones 32 / 83, AAVShH10, AAV2(Y->F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41 and AAVr3.45. Such AAV serotypes and derivatives / pseudotypes and methods of generating such derivatives / pseudotypes are known in the art (see, e.g., Mol Ther. 2012 Apr; 20(4): 699-708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan A1, Schaffer DV, Samulski RJ.). In some embodiments, the rAAV particle is a pseudotyped rAAV particle comprising: (a) a nucleic acid vector comprising ITRs from one serotype (e.g., AAV2), and (b) a capsid comprising a capsid protein derived from another serotype (e.g., AAV5). Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671, 2001; Halbert et al., J. Virol., 74:1524-1532, 2000; Zolotukhin et al., Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).

[0087] Methods for producing rAAV particles and rAAV vectors are also known in the art and are commercially available (see, e.g., Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Publication Nos. US2007 / 0015238 and US 2012 / 0322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid comprising an rAAV vector can be combined with one or more helper plasmids (e.g., comprising rep genes (e.g., encoding Rep78, Rep68, Rep52, and Rep40) and cap genes (e.g., encoding VP1, VP2, and VP3, including modified VP3 regions as described herein)) and transfected into a production cell line so that the rAAV particles can be packaged and subsequently purified.

[0088] In some embodiments, one or more helper plasmids include a first helper plasmid comprising a rep gene and a cap gene (e.g., encoding a rAAV capsid protein as described herein) and a second helper plasmid comprising an E1a gene, an E1b gene, an E4 gene, an E2a gene, and a VA gene. In some embodiments, the rep gene is a rep gene derived from AAV2, and the cap gene is derived from AAV2 and may include modifications to the gene to produce a modified capsid protein as described herein. Helper plasmids and methods for making such plasmids are known in the art and are commercially available (see, e.g., pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E / R585E), and pDP8.ape plasmids from PlasmidFactory, Bielefeld, Germany; other products and services available from Vector Biolabs, Philadelphia, PA; Cellbiolabs, San Diego, CA; Agilent Technologies, Santa Clara, CA; and Addgene, Cambridge, MA; pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kern, A. et al. (2003), Identification of a Heparin-Binding Motifon Adeno-Associated Virus Type 2Capsids, Journal of Virology, Volume 77, 11072-11081; Grimm et al. (2003), Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1to6, Molecular Therapy, Volume 7, 839-850; Kronenberg et al.(2005), AConformationalChange in the Adeno-Associated Virus Type 2Capsid Leads to the Exposure ofHidden VP1N Termini, Journal of Virology, Volume 79, 5296-5303; and Moullier, P. and Snyder, RO (2008), International efforts for recombinant adeno-associatedviral vector reference standards, Molecular Therapy, Vol. 16, 1185-1188). .

[0089] Next, an exemplary non-limiting method for producing rAAV particles is described. One or more helper plasmids are generated or obtained, which contain the rep and cap ORFs of the desired AAV serotype and the adenovirus VA, E2A (DBP) and E4 genes under the transcriptional control of their native promoters. The cap ORF may also contain one or more modifications to produce a modified capsid protein as described herein. One or more helper plasmids and a plasmid containing a heterologous nucleic acid vector as described herein (e.g., containing a plasmid containing a nucleic acid vector as described herein) are used. Fig.13 , 14 , 15 or 16) by CaPO4-mediated transfection, lipid or polymer molecules such as polyethyleneimine (PEI) transfection of HEK293 cells (available from ). The HEK293 cells are then incubated for at least 60 hours to allow rAAV particles to be produced. Alternatively, in another example, a stable production cell line based on Sf9 is infected with a single recombinant baculovirus containing a nucleic acid vector. As another alternative, in another example, a HEK293 or BHK cell line is infected with an HSV containing a nucleic acid vector and optionally one or more helper HSVs containing adenovirus VA, E2A (DBP) and E4 genes under the transcriptional control of their native promoters as described herein. The HEK293, BHK or Sf9 cells are then incubated for at least 60 hours to allow rAAV particles to be produced. The rAAV particles can then be purified using any method known in the art or described herein, such as by iodixanol step gradients, CsCl gradients, chromatography or polyethylene glycol (PEG) precipitation.

[0090] The present disclosure also contemplates host cells comprising shRNA, vectors or rAAV particles as described herein. Such host cells include mammalian host cells, of which human host cells are preferred, and may be isolated, for example in cell or tissue culture. In some embodiments, the host cell is an eye cell.

[0091] In some aspects, the present disclosure provides formulations of one or more rAAV-based compositions disclosed herein in a pharmaceutically acceptable solution for administration to cells or animals, alone or in combination with one or more other therapeutic modalities, and in particular for the treatment of human cells, tissues, and diseases affecting humans.

[0092] Therefore, in some embodiments, a composition is provided, which comprises shRNA, a vector or rAAV particles as described herein and optionally a pharmaceutically acceptable carrier. In some embodiments, the composition described herein may be applied to an object in need of treatment. In some embodiments, the object suffers from or is suspected of suffering from one or more disorders, diseases or disorders (e.g., yolk-shaped macular degeneration) of the brain and / or eyes. In some embodiments, the object suffers from or is suspected of suffering from one or more disorders, diseases and disorders disclosed herein (e.g., yolk-shaped macular degeneration). In some embodiments, the object has one or more endogenous mutation BEST1 alleles (e.g., related to a disease or disorder of the eye or retina or causing a disease or disorder of the eye or retina). In some embodiments, the object has at least one autosomal dominant mutation BEST1 allele (e.g., it causes yolk-shaped macular degeneration). In some embodiments, the object is a person. In some embodiments, the object is a non-human primate. Some non-limiting examples of non-human primate subjects include macaques (e.g., cynomolgus or rhesus monkeys), marmosets, tamarins, spider monkeys, owl monkeys, vervet monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans. Other exemplary subjects include domestic animals, such as dogs and cats; livestock, such as horses, cattle, pigs, sheep, goats, and chickens; and other animals, such as mice, rats, guinea pigs, and hamsters.

[0093] In some embodiments, the dose of rAAV particles administered to a cell or subject can be about 10 6 Up to 10 14 particles / mL or 10 3 Up to 10 15 particles / mL, or any value between any ranges thereof, such as about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 1012 , 10 13 or 10 14 In one embodiment, administration of more than 10 13 In some embodiments, the dose of rAAV particles administered to a subject can be about 10 6 Up to 10 14 Vector genome (vg) / mL, or 10 3 Up to 10 15 vg / mL, or any value between any range thereof, for example, about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 or 10 14 In one embodiment, administration of more than 10 13 vg / mL of rAAV particles. The rAAV particles may be administered as a single dose or divided into two or more doses, as may be required to achieve treatment of the particular disease or disorder being treated. In some embodiments, 0.0001 mL to 10 mL (e.g., 0.0001 mL, 0.001 mL, 0.01 mL, 0.1 mL, 1 mL, 10 mL) is delivered to the subject in one dose.

[0094] In some embodiments, the rAAV particle titer is 1×10 10 Up to 5×10 13 In some embodiments, the rAAV particle titer may be about 1×10 10 , 2.5×10 10 , 5×10 10 , 1×10 11 , 2.5×10 11 , 5×10 11 , 1×10 12 , 2.5×10 12 , 5×10 12 , 1×10 13 , 2.5×10 13 , or 5×10 13 vg / mL. In some embodiments, the particle titer is less than 1×10 10 vg / mL. In some embodiments, the rAAV particle titer is greater than 1×10 15 vg / mL. In some embodiments, the rAAV particle titer is greater than 5×10 13vg / mL. In some embodiments, the rAAV particle titer is about 2×10 11 or 2.5 × 10 11 In some embodiments, the rAAV particles are administered by a method further described herein (eg, subretinal or intravitreal).

[0095] The rAAV particles may be administered as a single dose or divided into two or more administrations, as may be required to achieve the treatment of the particular disease or disorder being treated. In some embodiments, 1 to 500 microliters of the composition described in this application (e.g., it comprises rAAV particles) are applied to one or both eyes of the subject. For example, in some embodiments, about 1, about 10, about 50, about 100, about 200, about 300, about 400, or about 500 microliters may be applied to each eye. However, it should be understood that smaller or larger volumes may be applied in some embodiments.

[0096] If desired, rAAV particles or nucleic acid vectors may also be administered in combination with other agents, such as proteins or polypeptides or a variety of pharmaceutically active agents, including one or more systemic or topical administrations of therapeutic polypeptides, biologically active fragments, or variants thereof. In fact, there are almost no restrictions on other components that may also be included, as long as the additional agent does not cause significant adverse effects when in contact with target cells or host tissues. Thus, in certain circumstances, rAAV particles may be delivered with a variety of other agents as desired. Such compositions may be purified from host cells or other biological sources, or alternatively, may be chemically synthesized as described herein.

[0097] In other aspects, the disclosure provides a formulation of one or more plasmids encoding shRNA as disclosed herein in a pharmaceutically acceptable solution for administration to cells or animals alone or in combination with one or more other therapeutic modalities, and particularly for the treatment of human cells, tissues, and diseases affecting humans. The disclosure also provides methods for administering plasmids encoding shRNA as disclosed herein. Exemplary methods include methods for administering plasmids to mammals (e.g., humans).

[0098] In some embodiments, the disclosed plasmid formulation for use in mammals (e.g., humans) comprises a DNA plasmid vector in phosphate buffered saline (PBS). The concentration of the vector may be 1 mg / ml to 3 mg / ml. In certain embodiments, the concentration is about 2 mg / ml. In other embodiments, the concentration is about 1.6 mg / ml, about 1.7 mg / ml, about 1.75 mg / ml, about 1.8 mg / ml, about 1.85 mg / ml, about 1.9 mg / ml, about 1.95 mg / ml, about 2.05 mg / ml, about 2.1 mg / ml, or about 2.15 mg / ml.

[0099] The formulation of pharmaceutically acceptable excipients and carrier solutions is well within the skill of those skilled in the art, as is the development of appropriate dosing and treatment regimens for use of the specific compositions described herein in a variety of treatment regimens including, for example, oral, parenteral, intravenous, intranasal, intraarticular, and intramuscular administration and formulations.

[0100] Generally speaking, these formulations may contain at least about 0.1% of the therapeutic agent (e.g., rAAV particles or plasmid) or more, but the percentage of the one or more active ingredients may of course vary and may conveniently be from about 1% or 2% to about 70% or 80% or more, by weight or volume of the total formulation. Naturally, the amount of one or more therapeutic agents (e.g., rAAV particles) in each therapeutically useful composition may be prepared in such a way that a suitable dose will be obtained in any given unit dose of the compound. Those skilled in the art of preparing such pharmaceutical formulations will consider factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations, and therefore a variety of dosages and treatment regimens may be desired.

[0101] In certain cases, it is desirable to deliver the shRNA, vector or rAAV particles as described herein in an appropriately formulated pharmaceutical composition disclosed herein subcutaneously, intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection into one or more cells, tissues or organs.

[0102] The pharmaceutical form of the composition suitable for injectable use (for example, comprising shRNA, carrier or rAAV particles as described herein) includes sterile aqueous solution or dispersion. In some embodiments, the form is sterile and is fluid to the extent that there is easy injectability. In some embodiments, the form is stable under manufacturing and storage conditions, and is preserved to resist the contamination of microorganisms (such as bacteria and fungi). The carrier can be a solvent or dispersion medium, which includes, for example, water, saline, ethanol, polyols (for example, glycerol, propylene glycol and liquid polyethylene glycol, etc.), a suitable mixture thereof, and / or vegetable oil. Suitable fluidity can be maintained, for example, by using a coating (such as lecithin), by maintaining the required particle size in the case of a dispersion, and by using a surfactant.

[0103] The term "carrier" refers to a diluent, adjuvant, excipient or vehicle with which the shRNA, vector or rAAV particles described herein are administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, such as mineral oil; vegetable oils, such as peanut oil, soybean oil and sesame oil; animal oils; or oils of synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers.

[0104] The compositions of the present disclosure can be delivered to the eye by a variety of routes. It can be delivered intraocularly, by surface application to the eye, or by intraocular injection into, for example, the vitreous body (intravitreal injection) or the subretinal (subretinal injection) interphotoreceptor space. In some embodiments, it is delivered to the rod photoreceptor cells. Alternatively, it can be delivered locally by insertion or injection into the tissue surrounding the eye. It can be delivered systemically by oral routes or by subcutaneous, intravenous or intramuscular injection. Alternatively, it can be delivered by catheter or by implant, wherein such implant is made of porous, non-porous or gel material (including membrane, such as silicone rubber membrane or fiber, biodegradable polymer or proteinaceous material). It can be applied before the onset of the disease to prevent it from occurring, such as during surgery on the eye, or immediately after the onset of a pathological disease or during the occurrence of acute or long-term diseases.

[0105] For the use of injectable aqueous solution, for example, if necessary, the solution can be appropriately buffered, and first the liquid diluent can be made isotonic with enough saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, intravitreal, subcutaneous and intraperitoneal administration. In this respect, according to the present disclosure, those skilled in the art will know that the sterile aqueous medium can be used. For example, a dose can be dissolved in 1ml isotonic NaCl solution, then added to 1000ml subcutaneous perfusion fluid or injected in the infusion site of suggestion (see, for example, " Remington's Pharmaceutical Sciences " the 15th edition, pp. 1035-1038 and 1570-1580). According to the situation of the treated object, some changes in dosage will inevitably occur. In any case, the personnel responsible for administration determine the appropriate dose for individual objects. In addition, for people to use, the preparation should meet the sterility, pyrogenicity and general safety and purity standards required by the FDA Biological Standards Office, for example.

[0106] Sterile injectable solutions can be prepared by incorporating the desired amount of shRNA, vector or rAAV particles as described herein into a suitable solvent (which has several other ingredients listed above as needed) and then filtering and sterilizing. Generally speaking, dispersions are prepared by introducing a variety of sterilized active ingredients into a sterile carrier, which contains a basic dispersion medium and other ingredients from those listed above as needed. In the case of sterile powders for the preparation of sterile injectable solutions, preferred preparation methods are vacuum drying and freeze drying techniques, which produce powders of the active ingredient plus any additional desired ingredients from a previously sterile filtered solution thereof.

[0107] The amount of a composition (e.g., comprising an shRNA, vector, or rAAV particle as described herein) and the time of administration of such a composition will be within the scope of a skilled artisan having the benefit of the present teachings. However, it is likely that administration of a therapeutically effective amount of a disclosed composition may be achieved by a single administration, such as a single injection of a sufficient number of rAAV particles to provide a therapeutic benefit to a patient receiving such treatment. Alternatively, in some cases, it may be desirable to provide multiple or continuous administrations of a composition over a relatively short or relatively extended period of time, which may be determined by the medical personnel supervising the administration of such a composition.

[0108] In some embodiments, the rod photoreceptor cells remain structurally intact and / or viable after silencing the expression of the cellular BEST1 gene. In some embodiments, the rod photoreceptor cells in which the expression of the cellular BEST1 gene is silenced may have shortened outer segments that normally contain BEST1. In some embodiments, the length of the outer segments can be maintained or restored (e.g., partially or completely) using exogenous addition (hardening) of a BEST1 gene whose expression is resistant to silencing using the compositions described in the present application.

[0109] "Treating" a disease as the term is used herein means reducing the frequency or severity of at least one sign or symptom of a disease or disorder (e.g., yolk macular degeneration) experienced by a subject. The above-mentioned composition is usually administered to a subject in an effective amount (i.e., an amount capable of producing a desired result). The desired result will depend on the active agent administered. For example, an effective amount of rAAV particles can be an amount of particles capable of transferring a heterologous nucleic acid to a host organ, tissue, or cell.

[0110] The toxicity and efficacy of the compositions used in the methods of the present disclosure can be determined by standard pharmaceutical methods using cells in culture or experimental animals to determine the LD50 (the dose that is lethal to 50% of the population). The dose ratio between toxicity and efficacy is the therapeutic index, and it can be expressed as the ratio LD50 / ED50. Compositions that exhibit large therapeutic indices are preferred. Although those that exhibit toxic side effects can be used, care should be taken to design a delivery system that minimizes the potential damage of such side effects. The dosage of the compositions described herein is generally within the range that includes the ED50 and has little or no toxicity. Depending on the dosage form employed and the route of administration used, the dosage may vary within this range.

[0111] Without further elaboration, it is believed that those skilled in the art can make the most of the present disclosure based on the above description. Therefore, the following specific embodiments should be interpreted as being merely illustrative and not limiting the remainder of the present disclosure in any way. All publications cited herein are incorporated by reference for the purpose or subject matter cited herein.

[0112] Example

[0113] Example 1

[0114] Early panretinal pathology at the RPE-PR interface.

[0115] To understand the pathophysiology behind impaired RPE-PR interactions, cBest retinas with clinically apparent disease were evaluated. Key features of the RPE apical membrane responsible for direct interactions with PR OS were examined by immunohistochemistry (IHC) against EZRIN, a membrane-cytoskeleton linker protein essential for the formation of RPE apical MVs, in combination with human cone arrestin (hCAR) and peanut agglutinin lectin (PNA) markers to distinguish cone-PR matrix-specific interfaces. Confocal microscopy and analysis of 3D reconstructed images from wild-type (WT) retinas exposed a complex sheet-like structure of two intrinsic components of the RPE apical membrane: cone- and rod-associated MVs. Cone-MVs (also called RPE apical cone sheaths) are more distinct than rod-MVs and form a highly organized wrapper ( Figure 1A In the subretinal space, the intercellular complex is further surrounded by an equally complex cone-specific insoluble extracellular matrix sheath (cone-IPM) detected by selective binding of PNA lectins ( Figure 1A ). However, in diseased cBest retinas, such complex extracellular compartmentalization of COS is lost, and the lack of microvilli ensheathment is accompanied by hypertrophic RPE cells that are overloaded with lipid lipofuscin granules and have impaired insoluble cone IPM ( Figure 1B These observations were confirmed in three different cBEST1 genotypes (R25* / R25*, P463fs / P463fs, and R25* / P463fs) examined in both the reflective and non-reflective pigmented portions of the retina in 22 eyes after disease onset (45 to 270 weeks of age).

[0116] To evaluate the possibility that cone-MV structural abnormalities are secondary to cone dysfunction and disease, we examined the RPE-COS interaction in different canine IRD models: primary cone photoreceptor channelopathy, CNGB3-related achromatopsia. The RPE-COS complex was first examined at 6 weeks of age; CNGB3 mutant retinas with missense or locus deletion mutations did not show obvious irregularities at the RPE-PR interface, and correct localization of RPE apical markers was associated with specific anti-BEST1 labeling ( Fig. 6A and 6B Double immunostaining demonstrated the specific distribution of EZRIN along cone-MVs that interdigitated with hCAR-positive but CNGB3-negative COs. Due to CNGB3 channel subunit dysfunction in aged mutant retinas (57 and 85 weeks of age) that underwent progressive cone PR degeneration, microvillar ensheathment in the apical domain of the RPE remained largely intact ( Figure 6C and 6D ).

[0117] The findings in CNGB3 mutant retinas suggest that structural alterations in cBest associated with cone-MV ensheathment are not secondary to cone defects but are specific to the RPE channelopathy triggered by BEST1 mutations. These experiments focused on a 6-week time point just prior to the onset of clinical disease in dogs and near the end of postnatal retinal differentiation ( Figure 1C and 1D In contrast to age-matched WT controls, the lack of specific basolateral BEST1 immunolabeling in cBest RPE was associated with a rather smooth apical surface and apparently hypoplastic (vestigial) apical microvilli ( Figure 1C , arrows). The spatial density of cone-MVs and the lengths of cone-MVs and rod-MVs were quantified on deconvoluted 3D Z-stack projections at four retinal locations ( Figure 1D ). Significant differences in the mean number of cone-MVs were found between cBest and WT in every retinal area examined (P<0.0001). Although the number of cone photoreceptors was comparable to controls, cone-MVs in cBest were much fewer and sparsely distributed, and consistently appeared shorter and much more elaborate than those in controls regardless of topographic location. In control (WT) eyes, the mean length of cone-MVs in the superior temporal quadrant of the epipylegs was 17.4 (±0.25) μm and 12.3 (±0.23) μm in the inferior non-epiped retina, while the lengths of rod-MVs in the epipylegs and non-epiped parts of the retina were 6.7 (±0.11) μm and 5.3 (±0.27) μm, respectively. However, in cBest, the mean length of the rare cone-MV extensions identified was significantly reduced (6.0±0.31 and 6.5±0.74 μm in the central epipylegs and inferior non-epiped parts, respectively). Quantitative assessment of tiny rod-MVs in cBest exceeds the limits of optical resolution.

[0118] cBEST1-mutant eyes have whole-retinal microdetachments that extend with light exposure.

[0119] To determine the in vivo relevance of early RPE-PR interface abnormalities detected by IHC, non-destructive imaging using optical coherence tomography (OCT) was evaluated in young cBest eyes, long before lesions could be detected by ophthalmoscopy. Qualitatively, the central retina of all evaluated eyes showed an additional low-scattering layer in the outer retina located distal to the outer nuclear layer (ONL), which was not detectable in WT eyes ( Figure 2A, arrows and double arrows). Unexpectedly, the low-scattering layer can vary with repeated recordings in the same eye within a single experimental session. Further analysis revealed that the width of the low-scattering layer was greater in scans obtained at the end of the imaging session when the retina was exposed to greater retinal irradiance due to intervening autofluorescence imaging with bright short-wavelength light ( Figure 2A , double arrow, more LA). The width of the low-scattering layer is smaller in scans acquired early in the imaging process, before autofluorescence imaging ( Figure 2A , arrow, less LA).

[0120] Quantitative studies were performed by obtaining longitudinal reflectance spectra and measuring at both nasal and temporal retinal locations. WT eyes (n=12, 15-17 weeks of age) showed outer retinal hyperscattering peaks at the outer plexiform layer (OPL) and external limiting membrane (ELM), defining an intervening low-scattering layer as the ONL ( Figure 2B Distal to the ELM is a high-scattering peak corresponding to the junction between the inner and outer segments (IS / OS) of the photoreceptors, a main peak originating near the RPE-pigment interface (RPE / T) and an intervening small hyperscattering peak corresponding to the tip of the photoreceptor OS, which is often difficult to resolve ( Figure 2B In cBest eyes (n = 6, 11 weeks of age), an abnormal low-scattering layer ( Figure 2B , arrows). With greater light exposure, the low-scattering layer becomes deeper and more pronounced ( Figure 2B , double arrow); both nasal and temporal retinal locations showed the same effect. The distance between the IS / OS and RPE / T peaks was measured ( Figure 2A and 2B , arrow). In WT eyes, the distance was 41.3 (±4.5) μm, whereas in cBest eyes, this distance was significantly greater (P < 0.001) at 46.8 (±6.7) μm and 45.2 (±6.8) μm (less light exposure) and 55.8 (±10.5) μm and 53.5 (±6.3) μm (more light exposure) in the nasal and temporal retinal areas, respectively ( ( Figure 2C ).

[0121] Two types of experiments were performed to better understand the thickness of the low scattering layer as a function of light exposure. In the main experiment (WT, n = 12, 15 to 17 weeks of age; cBest, n = 3, 13 weeks of age), eyes were dark-adapted overnight and then imaged continuously over 2-hour periods in darkness and subjected to five intervening brief 488 nm light exposures of increasing intensity ranging from very dim light to moderate light produced by a standard clinical ophthalmic device ( Figure 2D In a shorter experimental protocol, only the highest two light exposures were used in different eyes (cBest, n = 3, 13 weeks of age). After overnight dark adaptation, the IS / OS-RPE / T distance in WT eyes was 40.0 (± 4.5) μm, while in cBest it was 47.1 (± 4.8) μm ( Figure 2E ); the difference was statistically significant (P<0.001). Increasingly bright light exposure resulted in a monotonic increase in the IS / OS-RPE / T distance in cBest's eyes, reaching an apparent plateau of 59.4 (±8.7) μm ( Figure 2E ). In WT eyes, the effect of light exposure was negligible or small, and the IS / OS-RPE / T distance reached a plateau of 40.9 (±4.3) μm. Thus, light exposure was shown to induce acute retinal microdetachments of up to 18.4 (±8.7) μm in cBest eyes within minutes of age before any detectable ophthalmoscopic findings. Light-mediated microdetachments disappeared within a time span of less than 24 hours ( Figure 7 ).

[0122] In preparation for topical gene therapy, the retinal localization distribution of light-driven microdissection was evaluated in fully light-adapted cBest and WT eyes ( Figure 2F ). The mean IS / OS-RPE / T distances in WT eyes (n=4, 104 weeks of age) were relatively uniform throughout the superior and inferior retinal regions, with sharp boundaries corresponding to the transition between the uveal and pigmented (non-uveal) retina. The larger distances in the uveal retina of WT eyes are most likely due to the difference in the main contributors of the high scattering peak (uveal vs. pigmented RPE in the uveal retina). In cBest eyes (R25* / P463fs) aged 297 weeks, there was relatively diffuse panretinal microdetachment in addition to a very obvious retinal detachment at the foveal-like area ( Figure 2F , defined by darker colors). In the younger cBest eyes (P463fs / P463fs) at 12 weeks of age, although the abnormalities were less obvious by ophthalmoscopy, there were still distinct bands of greater microdetachment along the visual streak and around the optic nerve head. The difference map between mutant eyes and average WT demonstrates the spatial distribution of the extent of microdetachment ( Figure 2F ,right).

[0123] To assess potential adverse consequences for photoreceptors, ONL thickness was morphometrically mapped in retinal areas with microdetachment ( Fig. 8A and 8B ). Microdetachment did not result in ONL thinning as would be expected from photoreceptor degeneration. Instead, the ONL in cBest tended to be uniformly thicker than in WT; the hyperthickness area typically included the central-upper reflective uveal retina but could also extend into the lower non-reflective uveal retina ( Fig. 8A Importantly, when examined microscopically, the ultra-thick regions of the ONL had comparable numbers of PR nuclei to controls. This suggests an extension of the internuclear distance as a possible cause of the ultra-thick ONL observed by imaging.

[0124] The natural history of canine vitelliform macular dystrophy.

[0125] As a prerequisite for evaluating the outcome of gene therapy, the natural history of cBest was determined from a group of 18 dogs [12 males (M) and 6 females (F); age range 6 to 297 weeks] ( Table 1 ). cBest dogs were continuously monitored by ophthalmoscopy and non-invasive imaging to detect the earliest onset of disease and to understand disease progression. Based on systematic in vivo imaging, the first signs of disease were detected as early as 11 weeks of age (mean 15 weeks) as subtle focal retinal elevations in the canine foveal-like area. Fig.9A This discrete separation of the photoreceptor layer from the underlying RPE progressed at 23 weeks of age to form a large subretinal macrodetachment (yolk-like lesion) that was evident on en face and corresponding OCT scans ( Fig. 9B This discrete RPE-PR detachment on cross-sectional imaging (but not on oriented imaging) was found to be consistent in the cBest eyes examined (n=34) regardless of genotype. Starting from a subclinical stage, the disease progresses to form a macroscopic detachment (vitelloid stage) that is confined to the canine fovea and surrounded by microdetachments ( Figure 3A , left). The primary lesion gradually evolves into a characteristic bullous exfoliation with a central area containing a foveal-like area ( Figure 3A , middle and right pictures and Figures 9B to 9D The presence of a unique hyperautofluorescence is evident in the sublesional portion ( Figure 3A , middle inset; pseudo-empyema stage). Advanced disease stages involve partial reabsorption and dispersion of hyperautofluorescent material within the central lesion, which is associated with significant thinning of the ONL ( Fig.9E and 9F ).

[0126] In each case with subsequent serial imaging (Table 1), cBest was bidirectional and almost always presented with remarkable symmetry, although the rate of progression was variable ( Figure 3A and Figures 9A to 9F In both eyes, severe retinal detachments visualized by ophthalmoscopy remained confined to the central retina or became more extensive with scattered extracentral lesions, still strongly biased toward the central cone-rich area, and associated with an extremely thick ONL.

[0127] Table 1. Summary of AAV-BEST1 treated and control eyes used in this study.

[0128]

[0129]

[0130]

[0131] Keywords: BSS, balanced salt solution; cBEST1, canine transgenic; hBEST1, human transgenic; Inj., injected; OD, right eye; OS, left eye; OU, bilateral; pi, post-injection; UnTx, untreated; vg, vector genome; WT, wild type. cBEST1 mutations: R25* / R25*, p.Arg25Ter-homozygous; P463fs / P463fs, p.Pro463fs-homozygous; R25* / P463fs, p.Arg25Ter / p.Pro463fs-compound heterozygous.

[0132] Subretinal BEST1 gene enhancement therapy stably corrects the disease.

[0133] To evaluate the proof-of-concept of AAV2-mediated subretinal gene augmentation therapy, 22 cBest eyes were injected with canine (cBEST1) or human (hBEST1) transgene driven by the human VMD2 promoter at weeks 27 to 69 [vector titers ranged from 0.1 to 5 × 10 11 Vector genome (vg) / mL or balanced salt solution (BSS) control] (Table 1). Figures of exemplary AAV vectors containing hBEST1 and cBEST1 heterologous nucleic acids for preparing the disclosed rAAV particles are respectively Fig.13 and 14cBest dogs presenting with various stages of focal or multifocal retinal detachment were injected unilaterally with AAV (leaving the fellow eye uninjected) or with AAV injected in one eye and a control (BSS) injection in the fellow eye; three cases presenting with multifocal disease were injected bilaterally with AAV targeting the superior temporal quadrant, while the retinal area outside the surgical bleb was used as an internal control (Table 1).

[0134] Representative results are shown for a compound heterozygous (R25* / P463fs) dog that exhibited advanced central retinal detachment in the right eye (EM356-OD) ( Figure 3A ), the right eye received subretinal injection of cBEST1 ( Figure 3B , left), while the contralateral eye (EM356-OS) was not injected ( Figures 9A to 9F Both eyes were monitored clinically and by in vivo imaging. Disease reversal was first evident in the injected eye at 4 weeks post-injection (pi) and was sustained over the long term, as exemplified at 43 and 245 weeks pi ( Figure 3B In this and other cases with advanced disease showing extensive accumulation of autofluorescent material within subretinal macroscopic detachments (n = 13 eyes), hyperautofluorescent signals were detectable several months after AAV injection but gradually diminished over time ( Figure 3B , inset). Based on non-destructive imaging, both focal lesions within the AAV-BEST1 treated area and extracentral lesions were able to regress at 4 to 12 weeks pi, and local retinal reattachment remained stable thereafter (Table 1). There was no evidence of an inflammatory response in any of the AAV-treated eyes, and longitudinal in vivo evaluation did not reveal adverse effects on the RPE or neural retina.

[0135] AAV-mediated treatment with hBEST1 also resulted in lesion reversal and long-term disease correction (n=13 eyes). Representative in vivo imaging results and IHC evaluation from cBest dogs (R25* / R25*) ( Figure 3C and 3D ) showed that the early bilateral lesions existing before treatment were significantly reduced after AAV-hBEST1 (2×10 11 vg / mL) in the study eye (EMC3-OS) and then disappeared ( Figure 3D ), while the lesions in the contralateral control eyes (EMC3-OD) injected with BSS continued to expand ( Figure 3C Based on funduscopy, in the illustrated examples and in all other cases, transient retinal detachments associated with vector or BSS delivery resolved within 24 to 48 hours pi; however, retinal lesions injected with BSS reappeared as early as 1 week pi and progressed along the natural disease course ( Figure 3CThis is in stark contrast to AAV-treated eyes, where early as well as more advanced lesions regressed within the first 6 weeks after hBEST1 gene therapy, and where the treated areas remained disease-free thereafter ( Figure 3D ). Ophthalmological examinations and IHC assessments using RPE- and PR-specific markers revealed no adverse effects on the retina until 207 weeks pi (Figures 3, 10, and 11). Of particular importance, assessment of retinal protection at pi revealed a significant restoration of retinal architecture at the RPE-PR interface, including extension of cone-MVs and actin cytoskeletal rescue, corresponding to the region of vector-treated blebs with either canine or human BEST1 transgenes ( Figure 3C and 3D , below, and Fig.10 and 11). No differences between sexes were observed in clinical manifestations or responses to AAV-BEST1 treatment.

[0136] Compared with wild-type controls and cBest-untreated eyes, the retina was protected after AAV-hBEST1 treatment in three cBest models [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), and cmr3(P463fs / P463fs)]. cBest eyes were injected with AAV-hBEST1 (2×10 11 vg / mL) and were evaluated by IHC at 103, 51, or 207 weeks pi ( Fig.10 ). No obvious abnormalities were detected in the treated area until 207 weeks pi. Note that in all treated eyes, the RPE apex extends and projects into the subretinal space (EZRIN). The untreated cBest control (rightmost figure) shows a lack of RPE apical microvilli, RPE hypertrophy (EZRIN, RPE65), and accumulation of lipofuscin granules within the RPE monolayer and autofluorescent deposition in the subretinal space.

[0137] Representative confocal micrographs of Fig.11A Figure 2 shows the AAV-hBEST1 injection (2.5×10 11 vg / mL) and cBest(R25* / P463fs) retinas double labeled with BEST1 (RPE, darker color) and SLC16A1 (RPE, lighter color). Figures 11B to 11D The figure shows the area from the surgical bleb ( Fig. 11B ), through the adjacent penumbra region ( Fig. 11C ), and towards the continuous range outside the injection area ( Fig.11D). As highlighted in the magnified image, a direct correlation was observed between the extent of restoration of the RPE-PR interface structure and BEST1 transgenic expression. A significant extension of the RPE apical projection within the treated area with enhanced BEST1 was observed ( Fig. 11B ); Residual microvilli [c-MV (lighter arrows) and rod-MV (darker arrows)] are present in the alveolar penumbra associated with patchy distribution of BEST1 (weak red signal within individual RPE cells) and RPE-PR microdetachment ( Fig. 11C ); outside the treated area, in the absence of both BEST1 expression and RPE apical processes, subretinal lesion formation ( Fig.11D ). Scalloped and rough RPE apical surfaces as well as numerous intracellular deposits appeared as granular aggregates within the cBest mutant RPE ( Fig.11A , top, no injection; Fig.11D , close-up). In the dissection area, cellular debris (asterisks) mixed into the subretinal space correspond to Muller glia and reflect retinal remodeling in response to stress. [Scale bars are 100 μm (top) and 10 μm ( Figures 11A to 11D )].

[0138] Correction of photoregulated microdissection using gene therapy.

[0139] To understand the consequences of BEST1 gene enhancement therapy on retinal areas with retinal detachment that were not detectable by ophthalmoscopy, morphometric measurements of the IS / OS-RPE / T distances within and outside the subretinal bleb were performed. Representative results from control subretinal BSS injections in cBest(R25* / P463fs) dogs at 69 weeks of age show uniform microdetachment covering all imaged retina at 87 weeks of age ( Figure 4A The mean extent of microdetachment (IS / OS-RPE / T distance in BSS-injected mutant dogs subtracted from colocalization measurements made in WT eyes) was 11.6 μm in the superior retina and 16.7 μm in the inferior retina ( Figure 4B ), which is consistent with the eyes not injected with cBest. On the other hand, subretinal AAV gene therapy resulted in a significant decrease in the IS / OS-RPE / T distance in the treated area. EMC3-OS, EML4-OS, and LH21-OS demonstrated the results of the three genotypes treated with gene therapy using the human BEST1 transgene, with a titer of approximately 2×10 11 vg / mL( Figure 4A and Table 1). In each case, the IS / OS-RPE / T distance was significantly reduced in the treated blebs. Of note, severe retinal detachment (darker colors) was detectable only outside the treated area ( Figure 4AQuantitative measurements showed complete improvement of microdetachment, with the IS / OS-RPE / T distance restored to WT levels in both the superior and inferior retinal areas treated with subretinal gene therapy ( Figure 4B , solid symbols), but did not recover to WT levels in retinal areas away from the treated blebs ( Figure 4B , unfilled symbols).

[0140] The area of ​​efficacy of subretinal gene therapy has generally been shown to extend beyond the bleb formed at surgery to include the penumbra region. In the cBest dog where gene therapy was successful, the penumbra region was also present but appeared to be qualitatively larger than typically encountered previously ( Figure 4A In some of the most extreme examples, pre-processing images of panretinal microdetachment were found to be necessary to demonstrate the extent of penumbra extension. For example, EML9-OD at 29 weeks of age showed panretinal microdetachment most evident along ultra-high-speed scans of vision and included several areas with severe retinal detachment ( Figure 4C Gene therapy was continued at week 69. At week 87, microdetachments throughout the imaged retina and most severe retinal detachments had resolved ( Figure 4C ), and quantitative measurements showed normal or thin IS / OS-RPE / T distances at superior and inferior retinal locations ( Figure 4D ). Importantly, the IS / OS-RPE / T distance showed significant improvement in the retinal location corresponding to the bubble formed at the time of injection and in the nasal retinal control area of ​​the same eye. This clear example of penumbra extension can be explained by the following: the vector diffused more through the micro-detachment in the cBest eye, resulting in RPE transduction at a site significantly farther away than the initial bubble. For comparison, a more typical example with defined penumbra extension is illustrated. EML13-OS at 37 weeks of age showed panretinal micro-detachment, which was particularly prominent in the temporal retina and along the visual ultra-high-speed scan; there were also several severe retinal detachments along the visual ultra-high-speed scan ( Figure 4E ). Gene therapy was performed at 45 weeks. At 81 weeks of age, both the superior and inferior retinas temporal to the optic nerve lacked micro- and macro-detachments, whereas the untreated nasal retinas retained micro-detachments and developed extensive macro-detachments ( Figure 4E Quantitative results confirmed the therapeutic effect ( Figure 4F ), which did not reach the nasal retina, unlike EML9-OD.

[0141] To understand the potential consequences of gene therapy on retinal degeneration, ONL thickness was mapped in treated eyes ( Figure 8BTreated retinal areas showing disappearance of microdetachments also tended to correspond to normal ONL thickness, whereas untreated areas that maintained microdetachments tended to show either hyperthick or normal ONL or, in some areas, thinned ONL ( Figure 8B ). In conclusion, AAV-mediated gene enhancement therapy was shown to promote sustained reversal of severe retinal detachment, re-establishment of close contacts between the RPE and PR, and restoration of ONL thickness to normal values ​​in canine vitelliform macular dystrophy.

[0142] Human autosomal recessive vitelliform macular dystrophy: structure and function.

[0143] To facilitate clinical translation of successful gene therapy in dogs with BEST1 mutations, several studies were performed to better understand the human pathophysiology of autosomal recessive vitelliform macular dystrophy (ARB) and to gain insight into the distribution of panretinal disease beyond the gross lesions detectable by ophthalmoscopy as previously described. Data from two patients are shown ( Figures 5A to 5G ): P1 is a 39-year-old female with best-corrected visual acuity of 20 / 100 who carried biallelic BEST1 mutations (c.341T>C / c.400C>G), while P2 is a 36-year-old male with acuity of 20 / 60 who also carried biallelic mutations in BEST1 (c.95T>C / c.102C>T). In both patients, the mutant alleles segregated from the clinically unaffected parents. Ultrawide imaging of RPE health using the natural autofluorescence of the lipofuscin granules they contain revealed widespread and numerous abnormalities, including areas of relatively high or low autofluorescence and focal heterogeneity. Notably, there was a distinct transition zone in the nasal intermediate peripheral retina ( Figure 5A , arrow), which defines the healthier nasal peripheral retina.

[0144] Rod and cone function were sampled at high density along the horizontal meridian to better understand the topography of visual loss and its correspondence with retinal structural abnormalities. Two patients showed profound (>3log) loss of rod-mediated sensitivity centrally in the chronically dark-adapted eye; there was relative preservation of rod function in the temporal visual field (nasal retina) in two patients and in the parapupillary area in one patient. Figure 5B , upper panel). Unexpectedly, cone-mediated function showed only moderate loss (<1 log) or normal or near-normal results in light-adapted eyes ( Figure 5B , bottom). Rod and cone function sampled across the entire visual field confirmed and extended these findings and showed strong interocular symmetry ( Fig. 12A and 12B). Maps of rod sensitivity loss (RSL) and cone sensitivity loss (CSL) in both eyes of two patients with ARB. A large, symmetrical central area of ​​severe RSL is surrounded by relatively preserved function in the temporal field. Cone function is relatively less affected and CSL is relatively uniform across the visual field. In the temporal field, the physiological blind spot is shown as a black square at 12°.

[0145] Cross-sectional imaging with OCT was performed to evaluate retinal lamination abnormalities along the horizontal meridian through the fovea ( Figure 5C ). There was no consistent history of light exposure during OCT imaging. Both patients showed significant ONL loss and abnormal photoreceptor IS / OS levels in the outer retina through most of the central retina. In addition, P2 showed intraretinal cystic spaces and detachment of the central retina from the RPE, most likely due to accumulation of subretinal fluid. Retinal lamination in the parapupillary area ( Figure 5C , dark rectangle) and beyond the mid-lateral peripheral transition of the nasal side ( Figure 5C , light rectangle) showed relative normalization. Analysis of the two target regions showed that abnormally thin ONL was detectable in both patients, and low peak signals were detected in the IS / OS and cone outer segment tip (COST) ( Figure 5D and 5E In P1, the distances from ELM to IS / OS and from IS / OS to COST were comparable to those in normal range. A low scattering layer was shown distal to COST, and RPE was hyperthick ( Figure 5D , middle figure). In P2, the distance from ELM to IS / OS is shorter than normal, while the distance from IS / OS to COST is comparable to that of normal. The distance from COST to ROST / RPE is larger than normal, with an indistinct low-scattering layer in the middle; the thickness of RPE is comparable to that of normal ( Figure 5D , right). Analysis of the outer retina in the nasal mid-peripheral region at P1 showed that the distances from ELM to IS / OS, IS / OS to COST, and COST to ROST / RPE were greater than normal, and RPE thickness was comparable to normal ( Figure 5E , middle figure). P2 is characterized by an intermediate between P1 and normal ( Figure 5E , right).

[0146] To understand the impact of structural abnormalities at the level of the outer retina and RPE on the dynamics of retinoid transfer between these cell layers, dark adaptation tests were performed. Figure 5D At the parapupillary position shown in , the dark adaptation threshold of P1 is rod-mediated but elevated by 1.3 log units ( Fig. 5FBy 22.5 minutes after light exposure, the P1 results remained cone-mediated at the plateau, while normal was within 1 log unit of the final dark-adapted threshold. By 50 minutes, the P1 rod results were still elevated by 1 log, while normal recovery was complete ( Fig. 5F ).exist Figure 5E At the mid-peripheral nasal retinal location shown in , the dark adaptation threshold of P2 is rod-mediated and is elevated by approximately 0.5 log units compared with normal ( Figure 5G ). By 14.5 minutes after light exposure, rod function was first shown to be slower than normal with cone-rod breakdown at only 11 minutes. Rod recovery was similar to normal ( Figure 5G In summary, rod dark adaptation dynamics at the parapupillary site of P1 showed an extremely slow time course, whereas rod dark adaptation dynamics at the mid-peripheral site of P2 were closer to normal ( Fig. 5F and 5G ).

[0147] The RPE has a critical role in maintaining the metabolically active environment of the subretinal space. Due to the dynamic relationship with adjacent retinal layers, mutations in RPE-specific genes often have adverse effects on adjacent sensory neurons, leading to loss of visual function and PR degeneration. Mutations in BEST1 are known to disrupt transepithelial ion and fluid transport in response to abnormal levels of intracellular calcium. Aberrant RPE calcium signaling is also thought to mediate the regulation of Ca2+ expression by altering the Ca2+ signaling pathway. 2+ The expression and interaction of sensitive proteins can lead to dysfunction of other pathways. Based on the findings in cBest, one such protein is EZRIN, which is a membrane-cytoskeleton linker essential for the formation and correct maturation of RPE apical MVs. It has been demonstrated that activation of the EZRIN membrane-F-actin cross-linking function is responsive to Ca 2+ Transients occur directly and show a significant reduction in the processing of RPE MVs in Ezrin-KO mice. The marked underdevelopment of RPE apical MVs found in BEST1 mutant RPE is consistent with these findings. Moreover, comparative IHC assessments with other IRD models suggest that these major structural changes associated with microvillar ensheathment are specific to primary RPE channelopathy triggered by BEST1 mutations and are not secondary to cone dysfunction and degeneration.

[0148] The structural components of the RPE apical projections are very different from those of non-motile intestinal microvilli. The presence of contractile proteins (such as myosin) in the RPE apical microvilli and molecules usually found at the cell attachment site indicates that the RPE actively adheres to the neural retina and exerts tension on it. In the cBest, there is a lack of proper microvilli sheathing at the RPE-PR interface, and therefore there is no physical and electrostatic support for PROS from these projections, which is expected to weaken adhesion and lead to the separation of the RPE-PR complex from the entire retina. In the early stages of the disease, the micro-peeling of the PR layer found in the cBest from the underlying RPE will be consistent with this process. In addition, the presence of contractile elements in the RPE apical projections and the fact that they have evolved from cells where pigment migration occurs indicate that MVs are able to actively contract while interlacing with PR OS and are destined to promote diurnal phagocytic activity. A single RPE cell can accommodate approximately 30 to 50 PRs, depending on the retinal location and packing density; the fine network of microvilli allows each RPE cell to handle such a high metabolic load every day. Insights from proteomic analysis support this argument. The enriched fractions contained retinoid processing proteins expressed along the RPE apical MVs, as well as a number of channel proteins and transporters (e.g., Na + / K +ATPase), which is extremely important for the effective transport of water, ions and metabolites between RPE and PR OS. Considering the topographic differences of RPE cell size, and considering the density and length of quantitative MV in this study, MV extension has expanded the functional surface of single RPE cell by 20 to 30 times in the central retina, which is consistent with early estimates. This number is even higher (about 50 times) for the small RPE cells in the macula region, and the small RPE cells adapt to the higher POS turnover rate when facing the most densely packed PR. The sharp reduction of such total top surface area in BEST1 mutant RPE will lead to the long-term delay of metabolite processing, and prevent RPE from maintaining the ability of both appropriate cell volume and chemical composition and physiological pH level in the subretinal cavity. Because these factors are crucial for retinal adhesion, any restriction in the RPE transport system will change the balance of hydrostatic force, and cause the permeability characteristics of RPE-PR complex to be reduced, and the subsequent separation with neural retina. In fact, the primary serous peeling of human and dog yolk-like macular dystrophy is first shown in the fovea centralis (central area with the highest metabolic activity). The absence of highly extended RPE apical processes, which in a structurally intact retina tightly wrap the COS around the ellipsoid, would explain the predilection of this cone-rich structure for its primary detachment in vitelliform macular dystrophy. The presence of an almost exclusive reliance on frictional interactions with the MV is consistent with observations in cBest documenting the formation of focal anterior vitelliform lesions within the foveal-like region of the canine central zone, as well as the susceptibility of other central cone-rich areas (e.g., visual ultrafast scanning) to subretinal detachment.

[0149] After exposure to dim and medium light intensity, the main extension of micro-peeling in cBest is an unexpected result. It is known that light exposure changes the molecular composition of the subretinal cavity in normal eyes. There is also evidence that measurable structural changes occur in the normal outer retina under light exposure, such as outer segment length, hydration of the subretinal cavity, actin staining along the top MV of RPE, and changes in the phototropism of the outer segment. However, all normal changes are significantly less than those measured in cBest. For example, compared with the extension of about 18 μm of the subretinal cavity driven by light in cBest, the change in the outer retina shown by the normal human eye is about 1 μm, and the change in the outer retina shown by the normal mouse eye is about 4 μm. People's ARB has only recently been recognized and the literature on the earliest stage of the disease is limited. Recessive c yolk-like macular degeneration shows that both dominant and recessive yolk-like macular dystrophy with people have phenotypic similarity. In patients with vitelliform macular degeneration (BVMD), there is some controversy about the structural features of the retinal area surrounding the vitelliform or advanced lesions or the retina in the previtelliform stage of the disease. Some studies have shown smaller abnormalities at the level of the RPE-PR interface, while results from other studies do not support detectable structural defects. The controversy may be caused by genotype, the resolution of the different methodological methods used, or the light history before imaging. In fact, light-dependent outer retinal changes have been described in BVMD using methods such as those disclosed in this article; nevertheless, the amplitude of changes in patients is smaller than that in cBest (about 2 μm). However, in general, the abnormal response of the affected retina to light stimulation may be associated with a significantly reduced light peak / dark valley ratio in the electrooculogram, a finding that is consistent in all, even presymptomatic vitelliform macular degeneration patients.

[0150] Importantly, both micro-peeling and macro-peeling in cBest have adverse effects on photoreceptor health: areas of micro-peeling tend to correspond to ultra-thick ONL, while large lesions with severe macro-peeling show ONL thinning. Smaller lesions with macro-peeling cannot be evaluated with the sampling method used here. The ONL contains the nuclei of all rods and cones, and classic studies in animal models and human eye donors generally show that the ONL thins as the disease progresses. Little is known about the earliest stages of retinal disease that are shown as ONL thickening, which only becomes measurable with the advancement of in vivo imaging methods. Human studies have previously demonstrated that such ONL thickens in the early stages of retinal disease. There is also evidence in animal studies that ONL thickening associated with retinal stress. When examined microscopically, the ultra-thick areas of the ONL mapped in cBest show that the number of PR nuclei is comparable to that of the control, indicating that the nuclear spacing within the ONL is larger, which may correspond to retinal stress levels below the apoptotic threshold. On the other hand, severe retinal detachment can lead to greater retinal stress and progressive degeneration.

[0151] In order to prevent the photoreceptors and vision loss associated with BEST1 mutations, subretinal gene enhancement therapy for retinal areas with macro-peeling and micro-peeling was carried out. The results showed that AAV-mediated BEST1 gene enhancement was safe, reversed clinically obvious lesions, improved diffuse micro-peeling, and caused the normalization of ultra-thick ONL. In addition, gene therapy was successful in three different BEST1 genotypes with both focal and multifocal manifestations, and confirmed the long-term persistence of the therapeutic effect. At the molecular level, it was confirmed that the position of the canine and human BEST1 transgenic correction RPE-PR complex and the ability to restore the cell structure of the key interface. This study shows that the early and more advanced stages of autosomal recessive diseases are suitable for the method of using this treatment. Further research using the RPE model derived from the human inducible pluripotent stem cell (human inducible pluripotent stem cell, hiPSC) source of patients with autosomal Best1 mutations will determine whether the gene enhancement method will also be beneficial to BVMD patients.

[0152] In order to promote the clinical transformation of successful gene enhancement therapy, ARB patients are studied to gain a deeper understanding of their panretinal diseases. Consistent with most (but not all) previous descriptions, retinal diseases in ARB patients extend far beyond the macula into the middle periphery. Facing and cross-sectional imaging and retinal localization mapping of rod and cone function indicate that there is a clear transition from disease to health in the middle peripheral retina, a feature that has not been emphasized before. Within the diseased area, severe abnormalities in retinal structure are associated with severe loss of rod function; unexpectedly, cone function is relatively preserved. Rod dysfunction in the central retina is also associated with an extreme slowing of the retinoid cycle, while healthier peripheries show a near-normal cycle of retinoids. There are at least two retinoid cycles that provide 11-cis-retinal chromophores for photoreceptor pigments. Typical retinoid cycles function in the RPE to produce chromophores for rod and cone PRs. On the other hand, it is believed that the retinal retinoid cycle regenerates chromophores in the retina for specific uses of cones. The abnormal RPE-PR interface in vitelliform macular degeneration will most likely affect chromophore delivery from the typical RPE retinoid cycle; the retinal retinoid cycle may be relatively unaffected, thus explaining the greater preservation of cone function.

[0153] In a word, as disclosed herein, unexpectedly found new molecular contributors to the pathophysiology of yolk-like macular dystrophy at RPE-PR interface.Found the earliest expression of disease-diffuse micropeeling strengthened by light exposure, which can be easily detected by in vivo imaging.AAV-mediated BEST1 enhanced gene therapy reversed both very obvious lesions and micropeeling, and restored the cellular structure of RPE-PR interface.Evaluation of ARB patients shows that the characteristics of retinal localization distribution and structural and functional defects exceed the expectation of PR degeneration.Such visual dysfunction can be expected to be improved after successfully applying BEST1 gene enhanced therapy to the patient affected by yolk-like macular dystrophy.

[0154] Example 2

[0155] The vector technology of embodiment 2 is designed to suppress the expression of endogenous BEST1mRNA (mutation and normal copy) using RNA interference. These vectors simultaneously replace endogenous BEST1 mRNA with normal BEST1mRNA to produce only normal protein. This technology uses adeno-associated virus to deliver the gene of the intron-free copy of BEST1 gene plus small hairpin RNA (shRNA), thereby causing the production of small interfering RNA (siRNA). Due to the silent mutation in the BEST1 gene reading frame, it is resistant to siRNA. Two shRNAs have been designed, and two modified human BEST1 genes have been designed thus. Both BEST1 genes are driven by the human VMD2 promoter of 623bp fragment. Before BEST1 cDNA, a synthetic intron and subsequently a polyadenylation sequence, both of which are derived from SV40 virus. In one case, shRNA05 is driven by RNA polymerase III (polIII) H1 promoter, and in another case, shRNA744 is driven by pol III U6 promoter. The sequence of six thymidines is used as the terminator sequence of each shRNA. To identify these active shRNAs, nine potential siRNA or shRNA sequences were screened.

[0156] The genetic sequence encoding the shRNA is as follows:

[0157]

[0158] Fig.15 and 16 , respectively, show a diagram of an exemplary AAV vector comprising heterologous nucleic acids encoding shRNA05 and shRNA744 and an hBEST1 gene comprising an off-target sequence (e.g., one of SEQ ID NO: 10 or 11), which is used to produce the disclosed rAAV particles. Both sequences are driven by the VMD2 promoter.

[0159] In some embodiments, the disclosure provides a shRNA05 sense strand comprising: a sense strand comprising a nucleotide sequence of SEQ ID NO: 2, plus an additional nucleotide immediately preceding the first cytosine of the sequence. In certain embodiments, the additional nucleotide comprises cytosine (C).

[0160] In some embodiments, the present disclosure provides shRNA05, which comprises an antisense strand comprising a nucleotide sequence of SEQ ID NO:3.

[0161] Exemplary genetic sequences corresponding to the regions of the vector encoding the pol III H1 promoter, shRNA05, and termination sequences are as follows:

[0162]

[0163] (SEQ ID NO: 20). The sequence also includes a BamHI endonuclease site (ggatcc) to facilitate screening and ensure that the start site of shRNA05 will be located 25 nucleotides downstream of the H1 promoter TATA box (TATAA). Therefore, in some embodiments, an shRNA (e.g., shRNA05) encoded by a nucleic acid comprising the sequence (and / or its complementary sequence) is transcribed in a host cell (e.g., in an object treated with a vector, such as a human subject). In some embodiments, two or more different shRNAs (e.g., having different start sites and / or stop sites, such as differing from shRNA05 by one or two additional or fewer nucleotides) are transcribed in a host cell.

[0164] Fig.17 It was shown that the VMD2 promoter works well in cell culture. HEK293T cells were transfected with plasmids expressing GFP or Best1 using the chicken β-actin promoter (CBA) or the VMD2 promoter. Protein lysates were separated on polyacrylamide gels and expression of Bestrophin (Best1) was detected by Western blotting and normalized to β-tubulin expression to show uniform gel loading. Fig.18A and 18B It was shown that the Best1-specific siRNA is functional. Transfection of HEK293T cells stably expressing BEST1 resulted in a 75% reduction in Best1 protein. Cells were analyzed 48 hours after transfection using 20 nM siRNA. Western blot ( Fig.18A ), and the knockdown of BEST1 was compared by normalizing the band intensity between Best1 and tubulin (Best1 / tubulin). Fig.18B ). Fig.19A and19B Showing that Best1 shRNA is active: HEK293T-BEST1 cells were transfected with 4 μg of the indicated plasmids. Cells were harvested 48 hours after transfection. Expression of BEST1 was determined by Western blotting ( Fig.19A The knockdown of BEST1 was compared by normalizing the band intensity between Best1 and tubulin (Best1 / tubulin). Fig.19B ). Fig. 20 Off-target of Best1 is shown. Silent mutation (base change at the third position of the codon) was used to remove the siRNA target site from Best1 mRNA. The disclosed example is for shRNA744. SEQ ID NOs: 15 to 17 correspond to the sequences from top to bottom.

[0165] Materials and methods

[0166] Canine BEST1 model and in vivo retinal imaging.

[0167] cBest mutant dogs (n=18) of both sexes (12M and 6F) were included, carrying homozygous (c.73C>T)(p.R25* / R25*) or (c.1388delC)(p.P463fs / P463fs) or biallelic mutations (c.73C>T / 1388delC)(p.R25* / P463fs) of cBEST1 (GB*NM_001097545). For ease of annotation of multiple sets of figures, the three genotypes are referred to as cmr1, cmr3, and cmr1 / cmr3, respectively. The study was performed in comparison with control crossbred dogs (n=12; 7M and 5F) (Table 1). All animals were bred and maintained at the Retinal Disease Studies Facility (RDSF). This study was performed in strict accordance with the recommendations in the NIH Guide for the Care and Use of Laboratory Animals and adhered to the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. The protocol was approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania (IACUC nos. 804956 and 803422). Dogs were subjected to en face and cross-sectional retinal imaging under general anesthesia as described previously.

[0168] Person object.

[0169] Light adaptation and dichromatic dark adaptation functions were measured at 2° intervals (central 60° along horizontal and vertical meridians) throughout the central visual field and at 12° intervals throughout the visual field. Photoreceptor mediation under dark-adapted conditions was determined by the difference in sensitivity between 500nm and 650nm stimulation. Dark adaptation dynamics were evaluated similar to previously described techniques (92-94) using an LED-based dark adaptation meter (Roland Consult) and short-duration (30 seconds) moderate light exposure from a clinical short-wavelength autofluorescence imaging device (25% laser output; Spectralis HRA; Heidelberg Engineering). Optical coherence tomography (OCT) was used to analyze the lamellar structure throughout the retina. Retinal cross-sections were recorded using a spectral-domain (SD) OCT system (RTVue-100; Optovue). Post-acquisition data analysis was performed using a custom program (MATLAB7.5; MathWorks). Recording and analysis techniques have been described previously (30, 31, 94). Longitudinal reflectivity spectra (LRP) were used to identify retinal features. A confocal laser scanning ophthalmoscope (Spectralis HRA; Heidelberg Engineering) was used to record oriented images and to assess RPE health using short-wavelength reduced illumination autofluorescence imaging (SW-RAFI) as previously described (95). All images were acquired in high-speed mode (30° × 30° square field or 50° circular field).

[0170] Canine BEST1 model and in vivo retinal imaging.

[0171] Overlapping facing images of reflectivity under near-infrared illumination (820 nm) were obtained with lenses of 30° and 55° diameter (Spectralis HRA+OCT) to delineate fundus features such as the optic nerve, retinal vessels, boundaries of injection blebs, retinotomy sites, and other local changes. Individual images were digitally stitched into full-retinal panoramas using a custom program (MATLAB 7.5; MathWorks). Short-wavelength autofluorescence and reflectance imaging were used to delineate the boundaries of the reflective pigment layer and the pigmented RPE. Spectraldomain optical coherence tomography (SD-OCT) was performed with overlapping (30°×25°) raster scans over large areas of the retina. Post-acquisition processing of OCT data was performed using a custom program (MATLAB 7.5). For full-retinal topography analysis, the integrated backscattered intensity of each raster scan was used to locate its precise position and orientation relative to retinal features visible on a full-retinal mosaic formed from near-infrared reflectance (NIR) images. Individual LRPs forming all recorded raster scans were assigned to regularly spaced bins (1°×1°) in a rectangular coordinate system centered on the optic nerve; the LRPs in each bin were aligned and averaged. Intraretinal peaks and boundaries corresponding to the OPL, ELM, IS / OS, and RPE / T were segmented using both the intensity and slope information of the backscattered signal along each LRP. Topographic maps of ONL thickness were generated from the distance from the OPL to the ELM, and maps of IS / OS to RPE / T thickness were generated from the distances between these peaks. For all topographic results, the locations of blood vessels, optic nerve head, bleb, uveal layer, and foveal-like area (24) were overlaid for reference. First, maps from WT dogs were recorded through the center of the optic nerve head and rotated to align the foveal-like area, and an average WT topographic map was derived. The foveal-like area of ​​the cBest mutant dog was determined by superimposing the WT template on the mutant eye by aligning the optic nerve head, major superior blood vessels, and uveal layer boundaries. Next, cBEST1 mutant maps were recorded on WT maps through the center of the optic nerve and an estimated foveal-like area, and difference maps were derived. Difference maps were sampled both inside and outside the treated bleb for each eye. The relationship between light exposure and changes in outer retinal structure was evaluated by two methods. In a subset of eyes, cross-sectional OCT imaging was performed early in the course of each experiment, followed first by autofluorescence imaging with bright, short-wavelength light, followed by further OCT imaging. OCT recordings obtained early in such a course are thought to be from a retina exposed to less light than recordings obtained later, although the exact light exposure cannot be quantified.In another subset of eight eyes, OCT recordings were performed continuously in a dark room after overnight dark adaptation and then after short intervals of short-wavelength light exposure from cSLO. In three eyes, five increasingly intense light exposures were used: L1: laser, 20%; duration 60 s; L2: laser, 25%; duration 30 s; L3: laser, 50%; duration 30 s; L4: laser, 100%; duration 30 s; L5: laser, 100%; duration 300 s. In three eyes, only L4 and L5 were used. In the other two eyes, only L5 was used to track the recovery of light-mediated microdesorption over a 24-h period. The standard (100%) laser setting was estimated to correspond to a human retinal irradiance of 330 μW·cm-2 at a wavelength of 488 nm (98). In both methods, the area selected for analysis was based on near-infrared imaging of the fundus performed with cSLO before the start of the study, and areas with obvious clinically visible macrodesorption were excluded.

[0172] Subretinal injections and postoperative procedures.

[0173] Subretinal injections of recombinant AAV2 / 2 delivering cBEST1 or hBEST1 transgene under the control of human VMD2 promoter (46) were performed under general anesthesia according to previously published procedures (46, 82, 97). Vector production and validation have been described in detail previously (46). Injection volumes of 50 to 180 μL of viral vector solution (titer ranged from 0.1 to 5 × 10 11 vg / mL) (Table 1) was delivered subretinally via a transvitreal approach without vitrectomy using a custom-modified RetinaJect subretinal injector (SurModics) (97) under direct observation of a surgical microscope. Anterior chamber paracentesis was performed immediately after injection to prevent increased intraocular pressure. The formation of subretinal blebs was recorded immediately after injection by fundus photography (RetCam Shuttle; Clarity Medical Systems). In all cases, the surgical bleb flattened and the retina reattached within 24 to 48 hours pi. Ophthalmic examinations, including biomicroscopy, indirect ophthalmoscopy, and fundus photography, were performed regularly (24 hours, 48 ​​hours, and 5 days pi, and then once a week for the first 2 months, followed by monthly eye examinations) throughout the injection-endpoint evaluation interval. Postoperative management was performed as previously described (46).

[0174] Histological and immunohistochemical evaluation.

[0175] Eye tissues for ex vivo analysis were collected as previously described (24, 99). Every effort was made to improve animal welfare and minimize discomfort. For all ex vivo evaluations, cBest and control (WT) eyes were fixed in 4% paraformaldehyde, embedded in optimal cutting temperature medium, and processed as previously reported (99). Histological evaluation was performed using standard hematoxylin / eosin (H&E) staining, and all immunohistochemical experiments were performed on 10 μm thick frozen sections according to the established protocol (46, 99). Briefly, retinal frozen sections were permeabilized with 1×PBS / 0.25% Triton X-100, blocked for 1 hour at room temperature, and incubated overnight with primary antibodies (Table 2). For multicolor labeling, the primary antibody was combined with Alexa Fluor 488 phalloidin (Thermo Fisher Scientific) or PNA-AF647 (L32460; Molecular Probes), followed by incubation for 1 hour with the corresponding secondary antibody (Alexa Fluor). Slides were examined by epifluorescence or transmitted light microscopy (Axioplan; Carl Zeiss Meditec), and digital images were collected with a Spot 4.0 camera (Diagnostic Instruments).

[0176] Table 2. List of primary antibodies used for immunohistochemical evaluation.

[0177]

[0178]

[0179] Confocal microscopy and image analysis.

[0180] Confocal images were acquired on a TCS-SP5 confocal microscope system (Leica Microsystems) or an A1R laser scanning confocal microscope (Nikon Instruments). To obtain counts of cone-associated MVs (cone-MVs), two adjacent fields of 155 μm in length per region of interest (ROI) were imaged 4 mm from the optic nerve head in 10 retinal sections per retinal quadrant (temporal, superior, inferior, and nasal) (n=80 ROI / eye) from both eyes of 6-week-old cBest (R25* / P463fs) and age-matched WT controls. Image stacks were acquired with a 0.25-μm Z-step and deconvolved with Huygens Deconvolution software version 17.04 (Scientific Volume Imaging). All deconvolved images were rendered in the Leica LAS X 3D rendering module, where cone-MVs were counted manually. The lengths of cone- and rod-MVs were assessed from the maximum projection images within the Leica LAS X software. Data were analyzed in Microsoft Excel and quantified using Prism software version 7 (GraphPad).

[0181] References

[0182] 1. Bramall AN, Wright AF, Jacobson SG, McInnes RR (2010) The genomic, biochemical, and cellular responses of the retina in inherited photoreceptordegenerations and prospects for the treatment of these disorders. Annu RevNeurosci 33: 441472.

[0183] 2. Veleri S, et al. (2015) Biology and therapy of inherited retinaldegenerative disease: Insights from mouse models. Dis Model Mech 8: 109-129.

[0184] 3.Cideciyan AV(2010)Leber congenital amaurosis due to RPE65 mutationsand its treatment with gene therapy.Prog Retin Eye Res 29:398-427.

[0185] 4.Ghazi NG,et al.(2016)Treatment of retinitis pigmentosa due to MERTKmutations by ocular subretinal injection of adeno-associated virus genevector:Results of a phase I trial.Hum Genet 135:327-343.

[0186] 5.Russell S,et al.(2017)Efficacy and safety of voretigene neparvovec(AAV2-hRPE65v2)in patients with RPE65-mediated inherited retinal dystrophy:Arandomised,controlled,open-label,phase 3trial.Lancet390:849-860.

[0187] 6.Best F(1905)Uber eine hereditare Maculaaffektion.Z Augenheilkd 13:199-212.

[0188] 7.Petrukhin K,et al.(1998)Identification of the gene responsible forBest macular dystrophy.Nat Genet 19:241-247.

[0189] 8.Boon CJ,et al.(2009)The spectrum of ocular phenotypes caused bymutations in the BESTl gene.Prog Retin Eye Res 28:187-205.

[0190] 9.Marmorstein AD,et al.(2000)Bestrophin,the product ofthe Bestvitelliform macular dystrophy gene(VMD2),localizes to the basolateral plasmamembrane of the retinal pigment epithelium.Proc Natl Acad Sci USA 97:12758-12763.

[0191] 10.Sun H,Tsunenari T,Yau KW,Nathans J(2002)The vitelliform maculardystrophy protein defines a new family of chloride channels.Proc Natl AcadSci USA 99:4008-4013.

[0192] 11.Neussert R,Müller C,Milenkovic VM,Strauss O(2010)The presence ofbestrophin1 modulatesthe Ca2+recruitment from Ca2+stores in the ER.PflugersArch 460:163-175.

[0193] 12.Hartzell HC,Qu Z,Yu K,Xiao Q,Chien LT(2008)Molecular physiology ofbestrophins:Multifunctional membrane proteinslinked toBest disease and otherretinopathies.Physiol Rev 88:639-672.

[0194] 13.StrauB O,Müller C,Reichhart N,Tamm ER,Gomez NM(2014)The role ofbestrophin1 in intracellular Ca(2+)signaling.Adv Exp Med Biol 801:113-119.

[0195] 14.Fischmeister R,Hartzell HC(2005)Volume sensitivity of thebestrophin family of chloride channels.J Physiol 562:477-491.

[0196] 15.Milenkovic A,et al.(2015)Bestrophin 1is indispensable for volumeregulation in human retinal pigment epithelium cells.Proc Natl Acad Sci USA112:E2630-E2639.

[0197] 16.Mullins RF,Kuehn MH,Faidley EA,Syed NA,Stone EM(2007)Differentialmacular and peripheral expression of bestrophin in human eyes and itsimplication for Best disease.Invest Ophthalmol Vis Sci 48:3372-3380.

[0198] 17.Guziewicz KE,et al.(2017)Bestrophinopathy:An RPE-photoreceptorinterface disease.Prog Retin Eye Res 58:70-88.

[0199] 18.Kane Dickson V,Pedi L,Long SB(2014)Structure and insights into thefunction of a Ca(2+)-activated Cl(-)channel.Nature 516:213-218.

[0200] 19.Yang T,et al.(2014)Structure and selectivity in bestrophin ionchannels.Sciencg 346:355-359.

[0201] 20.Vaisey G,Miller AN,Long SB(2016)Distinct regions that control ionselectivity and calcium-dependent activation in the bestrophin ionchannel.Proc Natl Acad Sci USA 113:E7399-E7408.

[0202] 21.Deutman AF(1969)Electro-oculography in families with vitelliformdystrophy ofthe fovea.Detection ofthe carrier state.Arch Ophthalmol 81:305-316.

[0203] 22.Arden GB,Constable PA(2006)The electro-oculogram.Prog Retin EyeRes 25:207-248.

[0204] 23.Guziewicz KE,et al.(2007)Bestrophin gene mutations cause caninemultifocal retinopathy:A novel animal model for best disease.InvestOphthalmol Vis Sci 48:1959-1967.

[0205] 24.Beltran WA,et al.(2014)Canine retina has a primate fovea-likebouquet of cone photoreceptors which is affected by inherited maculardegenerations.PLoS One 9:e90390.

[0206] 25.Hageman GS,Johnson LV(1991)The photoreceptor-retinal pigmentepithelium interface.Principles and Practise of Clinical Electrophysiology ofVision,eds Heckenlively JR,ArdeB GB(Mosby-Year Book,St.Louis),pp 53-68.

[0207] 26.Strauss O(2005)The retinal pigment epithelium in visualfunction.Physiol Rev 85:845-881.

[0208] 27.Huang B,Karwoski CJ(1992)Light-evoked expansion of subretinalspace volume in the retina ofthe frog.J Neurosci 12:4243-4252.

[0209] 28.Putting BJ,Zweypfenning RC,Vrensen GF,Oosterhuis JA,van Best JA(1992)Bloodretinal barrier dysfunction at the pigmentepithelium induced bybluelight.Invest Ophthalmol Vis Sci 33:3385-3393.

[0210] 29.Li JD,Govardovskii VI,Steinberg RH(1994)Light-dependent hydrationof the space surrouBding photoreceptors in the cat retina.Vis Neurosci 11:743-752.

[0211] 30.Huang Y,et al.(1998)Relation of optical coherence tomography tomicroanatomy in normal and rd chickens.Invest Ophthalmol Vis Sci 39:2405-2416.

[0212] 31.Pianta MJ,et al.(2003)In vivo micropathology of Best maculardystrophy with optical coherence tomography.Exp Eye Res 76:203-211.

[0213] 32.Cideciyan AV,et al.(2005)In vivo dynamics of retinal injury andrepair in the rhodopsin mutant dog model of human retinitis pigmentosa.ProcNatl Acad Sci USA 102:5233-5238.

[0214] 33.Bizheva K,et al.(2006)Optophysiology:Depth-resolved probing ofretinal physiology with functional ultrahigh-resolution optical coherencetomography.Proc Natl Acad Sci USA103:5066-5071.

[0215] 34.Kay CN,et al.(2012)Three-dimensional distribution of thevitelliform lesion,photoreceptors,and retinal pigment epithelium in themacula of patients with best vitelliform macular dystrophy.Arch Ophthalmol130:357-364.

[0216] 35.Bissig D,Berkowitz BA(2012)Light-dependentchanges in outer retinalwater diffusion in rats in vivo.Mol Vis 18:2561.

[0217] 36.Abràmoff MD,et al.(2013)Human photoreceptor outer scgments shortenduring light adaptation.Invest Ophthalmol Vis Sci 54:3721-3728.

[0218] 37.Li Y,FarissRN,Qian JW,Cohen ED,Qian H(2016)Light-inducedthickeningof photoreceptor outer segment layer detected by ultra-high resolution OCTimaging.Invest Ophthalmol Vis Sci 57:OCT105-OCT111.

[0219] 38.Lu Y,Wang B,Pepperberg DR,Yao X(2016)Stimulus-evoked outer segmentchanges occur before the hyperpolarization of retinal photoreceptors.BiomedOpt Express 8:38-47.

[0220] 39.Zhang P,et al.(2017)In vivo optophysiology reveals that G-proteinactivation triggers osmotic swelling and increasedlight scattering of rodphotoreceptors.Proc Natl Acad Sci USA 114:E2937-E2946.

[0221] 40.Lu CD,et al.(2017)Photoreceptor layer thickness changes duringdark adaptation observed with ultrahigh-resolutionoptical coherencetomography.Invest Ophthalmol Vis Sci 58:4632-4643.

[0222] 41.Steinberg RH(1985)Interactions between the retinal pigmentepithelium and the neural retina.Doc Ophthalmol 60:327-346.

[0223] 42.Mieziewska K(1996)The interphotoreceptor matrix,a space insight.Microsc Res Tech 35:463-471.

[0224] 43.Sidjanin DJ,et al.(2002)Canine CNGB3 mutations establish conedegeneration as orthologous to the human achromatopsia locus ACHM3.Hum MolGenet 11:1823-1833.

[0225] 44.Komáromy AM,et al.(2013)Transient photoreceptor deconstruction byCNTF enhances rAAV-mediated cone functional rescue in late stage CNGB3-achromatopsia.Mol Ther 21:1131-1141.

[0226] 45.Acland GM,Aguirre GD(1987)Retinal degenerations in the dog:IV.Early retinal degeneration(erd)in Norwegian elkhounds.Exp Eye Res 44:491-521.

[0227] 46.Guziewicz KE,et al.(2013)Recombinant AAV-mediated BEST1 transferto the retinal pigment epithelium:Analysis of serotype-dependent retinaleffects.PLoS One 8:e75666.

[0228] 47.Bruewer AR,et al.(2013)Evaluation of lateral spread of transgeneexpression following subrretinal AAV-mediated gene delivery in dogs.PLoS One8:e60218.

[0229] 48.Beltran WA,et al.(2017)Optimization of retinal gene therapy for X-linked retinitis pigmentosa due to RPGR mutations.Mol Ther 25:1866-1880.

[0230] 49.Sparrow JR,Hicks D,Hamel CP(2010)The retinal pigment epithelium inhealth and disease.Curr Mol Med 10:802-823.

[0231] 50.Jacobson SG,et al.(2008)Photoreceptor layer topography in childrenwith Leber congenital amaurosis caused by RPE65 mutations.Invest OphthalmolVis Sci 49:4573-4577.

[0232] 51.Charbel Issa P,et al.(2009)Characterisation of severe rod-conedystrophy in a consanguineous

[0233] family with a splice site mutation in the MERTK gene.Br J Ophthalmol93:920-925.

[0234] 52.Meunier I,et al.(2016)A dominant mutation in MAPKAPK3,an actor ofp38 signaling pathway,causes a new retinal dystrophy involving Bruch’smembrane and retinal pigment epithelium.Hum Mol Genet 25:916-926.

[0235] 53.Singh R,et al.(2013)iPS cell modeling of Best disease:Insightsinto the pathophysiology of an inherited macular degeneration.Hum MolGenet22:593-607.

[0236] 54.Bonilha VL,Finnemann SC,Rodriguez-Boulan E(1999)Ezrin promotesmorphogenesis of apical microvilli and basal infoldings in retinal pigmentepithelium.J Cell Biol147:1533-1548.

[0237] 55.Koltzscher M,Neumann C, S,Gerke V(2003)Ca2+-dependent bindingand activation of dormant Ezrin by dimeric S 100P.Mol Biol Cell14:2372-2384.

[0238] 56.Bonilha VL,et al.(2006)The retinal pigment epithelium apicalmicrovilli and retinal function.Adv Exp Med Biol572:519-524.

[0239] 57.Bonilha VL,Rayborn ME,Saotome I,McClatchey AI,Hollyfield JG(2006)Microvilli defects in retinas of ezrin knockout mice.Exp Eye Res82:720-729.

[0240] 58.Philp NJ,Nachmias VT(1985)Components of the cytoskeleton in theretinal pigmented epithelium of the chick.J Cell Biol 101:358-362.

[0241] 59.Bonilha VL,et al.(2004)Proteomic characterization of isolatedretinal pignent epithelium microvilli.Mol Cell Proteomics3:1119-1127.

[0242] 60.Gao H,Hollyfield JG(1992)Aging of the human retina.Differentialloss of neurons and retinal pigment epithelial cells.Invest Ophthalmol VisSci 33:1-17.

[0243] 61.Kiser PD,Golczak M,Palczewski K(2014)Chemistry of the retinoid(visual)cycle.Chem Rev 114:194-232.

[0244] 62.Miller SS,Steinberg RH(1977)Passive ionic properties of frogretinal pigment epithelium.J Membr Biol 36:337-372.

[0245] 63.Volland S,Esteve-Rudd J,Hoo J,Yee C,Williams DS(2015)A comparisonof some organizational characteristics of the mouse central retina and thehuman macula.PLoS One 10:e0125631.

[0246] 64.Cuenca N, -Lizarán I,Pinilla I(October 13,2017)Cellularcharacterization of optical coherence tomography and outer retinal bandsusing specific immunohistochemistry markers and clinicalimplications.Ophthalmology,10.1016 / j.ophtha.2017.09.016.

[0247] 65.Uehara F,Matthes MT,Yasumura D,LaVail MM(1990)Light-evoked changesin the interphotoreceptor matrix.Science 248:1633-1636.

[0248] 66.Jonnal RS,Kocaoglu OP,Wang Q,Lee S,Miller DT(2012)Phase-sensitiveimaging of the outer retina using optical coherenncetomography and adaptiveoptics.Biomed Opt Express 3:104-124.

[0249] 67.Hillmann D,et al.(2016)In vivo optical imaging ofphysiologicalresponses to photostimulation in human photoreceptors.Proc Natl Acad Sci USA113:13138-13143.

[0250] 68.Bialek S,Miller SS(1994)K+and Cl-transport mechanisms in bovinepigment epithelium that could modulate subretinal space volume andcomposition.J Physiol 475:401-417.

[0251] 69.Lu R,Levy AM,Zhang Q,Pittler SJ,Yao X(2013)Dynamic near-infraredimaging reveals transient phototropic change in retinal rod photoreceptors.JBiomed Opt 18:106013.70.Querques G,et al.(2011)The spectrum of subclinicalBest vitelliform macular dystrophy in subjeets with mutations in BESTlgene.Invest Ophthalmol Vis Sci 52:4678-4684.

[0252] 71.Qian CX,et al.(2017)Optical coherence tomography examination ofthe retinal pigment epithelium in Best vitelliform maculardystrophy.Ophthalmology 124:456-463.

[0253] 72.Kay DB,et al.(2013)Outer retinal structure in best vitelliformmacular dystrophy.JAMA Ophthalmol131:1207-1215.

[0254] 73.Arora R,et al.(2016)Unilateral BEST1-associated retinopathy.Am JOphthalmol 169:24-32.

[0255] 74.Scoles D,et al.(2017)Photoreceptor inner segment morphology inBest vitelliform macular dystrophy.Retina 37:741-748.

[0256] 75.Abràmoff MD,Mullins RF,Stone EM(2014)Outer segment length indiffferent Best disease genotypes.JAMA Ophthalmol132:1152-1153.

[0257] 76.Faktorovich EG,Steinberg RH,Yasumura D,Matthes MT,LaVail MM(1990)Photoreceptor degeneration in inherited retinal dystrophy delayed by basicfibroblast growth factor.Nature 347:83-86.

[0258] 77.Milam AH,Li ZY,Fariss RN(1998)Histopathology of the human retinain retinitis pigmentosa.Prog Retin Eye Res 17:175-205.

[0259] 78.Jacobson SG,et al.(2006)Remodeling of the human retina inchoroideremia:Rab escort protein 1(REP-1)mutations.Invest Ophthalmol Vis Sci47:4113-4120.

[0260] 79.Jacobson SG,Cideciyan AV(2010)Treatment possibilities forretinitis pigmentosa.N Engl J Med 363:1669-1671.

[0261] 80.Cideciyan AV,et al.(2011)Cone photoreceptors are the main targetsfor geBe therapy of NPHP5(IQCB1)or NPHP6(CEP290)blindness:Generation of anall-cone Nphp6

[0262] hypomorph mouse that mimicsthe human retinal ciliopathy.Hum Mol Genet20:1411-1423.81.Sadigh S,et al.(2013)Abnormal thickening as well as thinningof the photoreceptor layer in intermediate age-related maculardegeneration.Invest Ophthalmol Vis Sci 54:1603-1612.82.Beltran WA,et al.(2015)Successful arrest of photoreceptor and vision loss expands thetherapeutic window of retinal gene therapy to laterstages of disease.ProcNatl Acad Sci USA112:E5844-E5853.

[0263] 83.Johnson AA,et al.(2017)Bestrophin 1 and retinal disease.Prog RetinEye Res 58:45-69.

[0264] 84.Schatz P,Klar J,Andréasson S,Ponjavic V,Dahl N(2006)Variantphenotype of Best vitelliform macular dystrophy associated with compoundheterozygous mutations in VMD2.Ophthalmic Genet 27:51-56.

[0265] 85.Burgess R,et al.(2008)Biallelic mutation of BEST1 causes adistinct retinopathy in humans.Am J Hum Genet 82:19-31.

[0266] 86.Kinnick TR,et al.(2011)Autosomal recessive vitelliform maculardystrophy in a large cohort of vitelliform macular dystrophy patients.Retina31:581-595.

[0267] 87.Bitner H,et al.(2011)A homozygous frameshift mutation in BEST1causes the classical form of Best disease in an autosomal recessivemode.Invest Ophthalmol Vis Sci 52:5332-5338.

[0268] 88.Boon CJ,et al.(2013)Autosomal recessive bestrophinopathy:Differential diagnosis and treatment options.Ophthalmology 120:809-820.

[0269] 89.Lamb TD,Pugh EN,Jr(2004)Dark adaptation and the retinoid cycle ofvision.Prog Retin Eye Res 23:307-380.

[0270] 90.Wang JS,Kefalov VJ(2011)The cone-specific visual cycle.Prog RetinEye Res 30:115-128.

[0271] 91.Kaylor JJ,et al.(2013)Identification of DES1 as a vitamin Aisomerase in Müller glial cells of the retina.Nat Chem Biol 9:30-36.

[0272] 92.Cideciyan AV,Pugh EN,Jr,Lamb TD,Huang Y,Jacobson SG(1997)Rodplateau during dark adaptation in Sorsby’s fundus dystrophy and vitamin Adeficiency.Invest Ophthalmol Vis Sci 38:1786-1794.

[0273] 93.Cideciyan AV,et al.(2000)Rod and cone visual cycle consequences ofa null mutation in the 11-cis-retinol dehydrogenase gene in man.Vis Neurosci17:667-678.

[0274] 94.Cideciyan AV,et al.(2013)Human cone visual pigment deletions sparesufficient photoreceptors towarrant gene therapy.Hum Gene Ther 24:993-100)6.

[0275] 95. Cideciyan AV, et al. (2007) Reduced-illuminance autofluorescence imaging in ABCA4-associated retinal degenerations. J Opt Soc Am A Opt Image Sci Vis 24: 1457-1467.

[0276] 96. National Research Council (2011) Guide for the Care and Use of Laboratory Animals (Natl Acad Press, Washington, DC), 8th Ed.

[0277] 97. Komáromy AM, Varner SE, de Juan E, Acland GM, Aguirre GD (2006) Application of a new subretinal injection device in the dog. Cell Transplant 15: 511-519.

[0278] 98. Delori F, et al. (2011) Quantitative measurements of autolluorescence with the scanning laser ophthalnoscope. Invest Ophthalmol Vis Sci 52: 9379-9390.

[0279] 99. Beltran WA, Hammond P, Acland GM, Aguirre GD (2006) A frameshift mutation in RPGR exon ORF15 causes photoreceptor degeneration and inner retina remodeling in a model of X-linked retinitis pigmentosa. Invest Ophthalnol Vis Sci 47: 1669-1681.

[0280] Other embodiments

[0281] All features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature having the same, equivalent or similar purpose. Therefore, unless otherwise expressly stated, each feature disclosed is only an example of a series of equivalent or similar general features.

[0282] Based on the above description, those skilled in the art can easily determine the basic characteristics of the present disclosure, and without departing from the spirit and scope of the present disclosure, various changes and modifications can be made to the present disclosure to adapt it to multiple uses and situations. Therefore, other embodiments are also within the claims.

[0283] Equivalent solution

[0284] Although several embodiments of the present invention have been described and illustrated herein, it will be readily apparent to those of ordinary skill in the art that a variety of other methods and / or structures are used to achieve the functions described herein and / or to obtain the results and / or one or more advantages described herein, and it is believed that each of such changes and / or modifications is within the scope of the embodiments of the present invention described herein. More generally, it will be readily understood by those skilled in the art that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that actual parameters, dimensions, materials, and / or configurations will depend on the specific application for which the present invention is used. Those skilled in the art will recognize or be able to determine many equivalents of the specific embodiments of the present invention described herein using only routine experiments. Therefore, it should be understood that the aforementioned embodiments are shown only as examples, and within the scope of the appended claims and their equivalents, embodiments of the present invention may be implemented in a manner different from that specifically described and claimed. The embodiments of the present invention of the present disclosure relate to each individual feature, system, product, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits and / or methods is also included within the inventive scope of the present disclosure if such features, systems, articles, materials, kits and / or methods are not mutually inconsistent.

[0285] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0286] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which they are individually cited, which in some cases may be incorporated in their entirety.

[0287] Unless explicitly stated to the contrary, nouns used herein in the specification and claims without quantifiers should be understood to mean "at least one".

[0288] The phrase "and / or" as used herein in the specification and claims should be understood to mean "either or both" of the elements that are so connected, that is, in some cases, present in conjunction and in other cases, not present in conjunction. Multiple elements listed with "and / or" should be understood in the same way, that is, "one or more" of the elements so connected. In addition to the elements specifically indicated by the "and / or" clause, other elements may also be optionally present, whether related or unrelated to those specifically indicated. Thus, as a non-limiting example, when used in conjunction with open language such as "comprising", reference to "A and / or B" may refer to only A (optionally including elements other than B) in one embodiment; to only B (optionally including elements other than A) in another embodiment; to both A and B (optionally including other elements) in yet another embodiment; and so on.

[0289] As used herein in the specification and claims, "or / or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or / or" or "and / or" should be interpreted as inclusive, i.e., including at least one of a plurality of elements or a list of elements, but also including more than one, and optionally including additional unlisted items. Only explicitly indicating the opposite term, such as "only one of" or "exactly one of", or "consisting of" when used in the claims, means including exactly one element in a plurality of elements or a list of elements. In general, when there is an exclusive term (such as "either", "one of", "only one of" or "exactly one of") before, the term "or / or" used herein should only be interpreted as representing an exclusive alternative (i.e., "one or the other, not both"). "Substantially consisting of" when used in the claims should have its general meaning used in the field of patent law.

[0290] As used herein in the specification and claims, the phrase "at least one" when referring to a list of one or more elements should be understood to mean at least one element selected from any one or more elements in the list of elements, but does not necessarily include at least one of each and every element specifically listed in the list of elements, and does not exclude any combination of elements in the list of elements. This definition also allows for the optional presence of elements in the list of elements other than the specifically identified elements referred to by the phrase "at least one", whether related or unrelated to those specifically identified elements. Thus, as a non-limiting example, "at least one of A and B" (or equivalently, "at least one of A or B", or equivalently, "at least one of A and / or B") may refer, in one embodiment, to at least one A, optionally including more than one A, but no B (and optionally including elements other than B); in another embodiment, to at least one B, optionally including more than one B, but no A (and optionally including elements other than A); in yet another embodiment, to at least one A, optionally including more than one A, and at least one B, optionally including more than one B (and optionally including other elements); and so on.

[0291] It should also be understood that in any method claimed herein that includes more than one step or action, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are listed unless explicitly indicated to the contrary.

[0292] In the claims and in the foregoing specification, all conjunctions such as "comprising", "including", "carrying", "having", "containing", "involving", "holding", "consisting of", etc. should be understood as open-ended, that is, meaning including but not limited to. As described in Section 2111.03 of the United States Patent Office Manual of Patent Examining Procedures, only the conjunctions "consisting of" and "consisting essentially of" shall be closed or semi-closed conjunctions, respectively. It should be understood that the embodiments described in this document using open conjunctions (e.g., "comprising / including") are also considered in some alternative embodiments to be "consisting of the features described by the open conjunctions" and "consisting essentially of the features described by the open conjunctions". For example, if the disclosure describes "a composition comprising A and B", the disclosure also considers the following alternative embodiments: "a composition consisting of A and B" and "a composition consisting essentially of A and B". Sequence Listing <110> University of Florida Research Foundation, Inc. <120> Adeno-associated viral vector for the treatment of vitelliform macular degeneration <130> U1197.70139WO00 <140> Not yet assigned <141> at the same time <150> US 62 / 754,530 <151> 2018-11-01 <150> US 62 / 749,622 <151> 2018-10-23 <150> US 62 / 726,184 <151> 2018-08-31 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 48 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 1 ccgucaaagc uucacagugu uucaagagaa cacugugaag cuuugacg 48 <210> 2 <211> 19 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 2 cgucaaagc uucacagugu 19 <210> 3 <211> 19 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 3 acacugugaa gcuuugacg 19 <210> 4 <211> 48 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 4 aagaacucgc cauauagcag ccucgaggcu gcuauauggc gaguucuu 48 <210> 5 <211> twenty one <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 5 aagaacucgc cauauagcag c 21 <210> 6 <211> twenty one <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 6 gcugcuauau ggcgaguucu u 21 <210> 7 <211> 9 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 7 uucaagaga 9 <210> 8 <211> 6 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 8 cucgag 6 <210> 9 <211> 1758 <212> DNA <213> Homo sapiens <220> <221> misc_feature <222> (213)..(213) <223> n is a, c, g or t <220> <221> misc_feature <222> (1410)..(1410) <223> n is a, c, g or t <400> 9 atgaccatca cttacacaag ccaagtggct aatgcccgct taggctcctt ctcccgcctg 60 ctgctgtgct ggcggggcag catctacaag ctgctatatg gcgagttctt aatcttcctg 120 ctctgctact acatcatccg ctttatttat aggctggccc tcacggaaga acaacagctg 180 atgtttgaga aactgactct gtattgcgac agntacatcc agctcatccc catttccttc 240 gtgctgggct tctacgtgac gctggtcgtg acccgctggt ggaaccagta cgagaacctg 300 ccgtggcccg accgcctcat gagcctggtg tcgggcttcg tcgaaggcaa ggacgagcaa 360 ggccggctgc tgcggcgcac gctcatccgc tacgccaacc tgggcaacgt gctcatcctg 420 cgcagcgtca gcaccgcagt ctacaagcgc ttccccagcg cccagcacct ggtgcaagca 480 ggctttatga ctccggcaga acacaagcag ttggagaaac tgagcctacc acacaacatg 540 ttctgggtgc cctgggtgtg gtttgccaac ctgtcaatga aggcgtggct tggaggtcga atccgggacc ctatcctgct ccagagcctg ctgaacgaga tgaacacctt gcgtactcag 660 tgtggacacc tgtatgccta cgactggatt agtatcccac tggtgtatac acaggtggtg 720 actgtggcgg tgtacagctt cttcctgact tgtctagttg ggcggcagtt tctgaaccca 780 gccaaggcct accctggcca tgagctggac ctcgttgtgc ccgtcttcac gttcctgcag 840 ttcttcttct atgttggctg gctgaaggtg gcagagcagc tcatcaaccc ctttggagag900 960. gatgatgatg attttgagac caactggatt gtcgacagga atttgcaggt gtccctgttg gctgtggatg agatgcacca ggacctgcct cggatggagc cggacatgta ctggaataag cccgagccac agccccccta cacagctgct tccgcccagt tccgtcgagc ctcctttatg 1080 ggctccacct tcaacatcag cctgaacaaa gaggagatgg agttccagcc caatcaggag gacgaggagg atgctcacgc tggcatcatt ggccgcttcc taggcctgca gtcccatgat caccatcctc ccagggcaaa ctcaaggacc aaactactgt ggcccaagag ggaatccctt ctccacgagg gcctgcccaa aaaccacaag gcagccaaac agaacgttag gggccaggaa 1320 gacaacaagg cctggaagct taaggctgtg gacgccttca agtctgcccc actgtatcag 1380 aggccaggct actacagtgc cccacagacn cccctcagcc ccactcccat gttcttcccc 1440 ctagaaccat cagcgccgtc aaagcttcac agtgtcacag gcatagacac caaagacaaa 1500 agcttaaaga ctgtgagttc tggggccaag aaaagttttg aattgctctc agagagcgat 1560 ggggccttga tggagcaccc agaagtatct caagtgagga ggaaaactgt ggagtttaac 1620 ctgacggata tgccagagat ccccgaaaat cacctcaaag aacctttgga acaatcacca 1680 accaacatac acactacact caaagatcac atggatcctt attgggcctt ggaaaacagg 1740 gatgaagcac attcctaa 1758 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 10 ctactgtacg gagaatttct 20 <210> 11 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 11 ccagcaagct gcacagcgt 19 <210> 12 <211> 623 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 12 aattctgtca ttttactagg gtgatgaaat tcccaagcaa caccatcctt ttcagataag 60 ggcactgagg ctgagagagg agctgaaacc tacccggcgt caccacacac aggtggcaag 120 gctgggacca gaaaccagga ctgttgactg cagcccggta ttcattcttt ccatagccca 180 cagggctgtc aaagacccca gggcctagtc agaggctcct ccttcctgga gagttcctgg 240 cacagaagtt gaagctcagc acagccccct aacccccaac tctctctgca aggcctcagg 300 ggtcagaaca ctggtggagc agatccttta gcctctggat tttagggcca tggtagaggg 360 ggtgttgccc taaattccag ccctggtctc agcccaacac cctccaagaa gaaattagag 420 gggccatggc caggctgtgc tagccgttgc ttctgagcag attacaagaa gggaccaaga 480 caaggactcc tttgtggagg tcctggctta gggagtcaag tgacggcggc tcagcactca 540 cgtgggcagt gccagcctct aagagtgggc aggggcactg gccacagagt cccagggagt 600 cccaccagcc tagtcgccag acc 623 <210> 13 <211> 114 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 13 taaaacgacg gccagtgaat tcatatttgc atgtcgctat gtgttctggg aaatcaccat 60 aaacgtgaaa tgtctttgga tttgggaatc ttataagttc tgtatgagac cact 114 <210> 14 <211> 241 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 14 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 c 241 <210> 15 <211> 24 <212> DNA <213> Homo sapiens <400> 15 aagctgctat atggcgagtt ctta 24 <210> 16 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 16 cgacgatata ccgctcaaga a 21 <210> 17 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 17 aagctgctgt acggcgagtt cctg 24 <210> 18 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 18 ccgtcaaagc ttcacagtgt ttcaagagaa cactgtgaag ctttgacg 48 <210> 19 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotides <400> 19 gctgctatat ggcgagttct tctcgagaag aactcgccat atagcagc 48 <210> 20 <211> 174 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 20 taaaacgacg gccagtgaat tcatatttgc atgtcgctat gtgttctggg aaatcaccat 60 aaacgtgaaa tgtctttgga tttgggaatc ttataagttc tgtatgagac cactcggatc 120 ccgtcaaagc ttcacagtgt ttcaagagaa cactgtgaag ctttgacgtt tttt 174

Claims

1. Short hairpin RNA (shRNA) consisting of: a) a sense strand consisting of the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2) and an antisense strand consisting of the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3); and b) a loop consisting of the nucleotide sequence UUCAAGAGA (SEQ ID NO:7), wherein the loop is located between SEQ ID NO:2 and SEQ ID NO:

3.

2. A short hairpin RNA (shRNA) consisting of the nucleotide sequence CCGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG (SEQ ID NO: 1).

3. A vector encoding the shRNA according to any one of claims 1 or 2.

4. The vector of claim 3, further comprising a recombinant bestrophin 1 (BEST1) coding sequence, wherein the recombinant BEST1 coding sequence does not contain a sequence targeted by the shRNA, wherein the recombinant BEST1 coding sequence comprises an off-target sequence that makes the recombinant BEST1 coding sequence off-target for degradation by the shRNA, wherein the off-target sequence is a nucleotide sequence of SEQ ID NO: 11, wherein the off-target sequence comprises one or more silent mutations.

5. A vector comprising the nucleotide sequence of SEQ ID NO: 20 encoding the shRNA sequence. The vector according to claim 5 , wherein the nucleotide sequence encoding the shRNA is shown as SEQ ID NO:

18.

7. The vector of claim 3, wherein the vector is a plasmid.

8. The vector of claim 3, wherein the vector is a viral vector.

9. The vector of claim 8, wherein the viral vector is a recombinant adeno-associated virus (rAAV) vector.

10. The vector of claim 9, wherein the rAAV vector is self-complementary.

11. A recombinant adeno-associated virus (rAAV) particle comprising the rAAV vector of claim 9.

12. The rAAV particle of claim 11, wherein the rAAV particle is a recombinant AAV serotype 2 (AAV2) particle.

13. A composition comprising the vector of claim 3, or the rAAV particle of claim 11 or 12, and a pharmaceutically acceptable carrier.

14. The composition of claim 13, for use in a method of regulating BEST1 expression in a subject, the method comprising administering the composition to the subject.

15. The composition of claim 13 for use in a method comprising administering the composition to a subject suffering from vitelliform macular degeneration.

16. The composition of claim 14 or 15, wherein the subject is a human subject.

17. The composition of claim 13, for use in treating vitelliform macular degeneration.

18. The composition of claim 13, which is used for manufacturing a medicament for treating vitelliform macular degeneration.

19. The composition of claim 13 for use in a method comprising administering the composition to a subject suffering from autosomal recessive vitelliform macular dystrophy (ARB).

20. The composition of claim 19, wherein the subject is a human subject.

21. The composition of claim 13, for use in the treatment of ARB.

22. The composition of claim 13, for use in the manufacture of a medicament for treating ARB.

23. Use of the composition of claim 13 in the manufacture of a medicament for modulating BEST1 expression in a subject suffering from vitelliform macular degeneration.

24. Use of the composition of claim 13 in the manufacture of a medicament for treating vitelliform macular degeneration.

25. Use of the composition of claim 13 in the manufacture of a medicament for modulating BEST1 expression in a subject suffering from ARB.

26. Use of the composition of claim 13 in the manufacture of a medicament for treating ARB.

Images