CRISPR / cas system and its use in constructing inha mutant high-fertility pig nuclear transfer donor cells
By editing the pig INHA gene using the CRISPR/Cas9 system and combining it with somatic cell nuclear transfer technology, the problem of improving pig fertility in existing technologies has been solved, achieving efficient and stable improvement of pig fertility, which is suitable for pigs as human disease models.
Patent Information
- Application Number
- CN202110171581.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-02-08
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2041-02-08
AI Technical Summary
Existing technologies are insufficient to effectively improve the fertility of pigs, especially by using gene editing to enhance ovulation rate and reproductive capacity. Furthermore, traditional methods suffer from high costs and low efficiency in other animal models.
The INHA gene in pigs was edited using the CRISPR/Cas9 system. Specific gRNA targets were designed and a highly efficient Cas9 expression vector was constructed. Combined with somatic cell nuclear transfer technology, the INHA gene was knocked out, thereby improving the reproductive capacity of pigs.
It significantly improved the ovulation rate and fertility of pigs, shortened the production cycle of gene-edited pigs, reduced costs, and achieved an editing efficiency of up to 75%, stabilizing genetic mutations and making it suitable for use as a human disease model in pigs.
Smart Images

Figure GDA0005230777650000071 
Figure GDA0005230777650000141 
Figure GDA0005230777650000151
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to a CRISPR / cas9 system and its application in constructing INHA mutant high-fertility cloned pig nuclear donor cells. BACKGROUND
[0002] Pig is one of the earliest domesticated livestock in China, and has been an important meat animal for human beings in the long history. Chinese people love to eat pork, which is related to the eating culture for thousands of years. Since 2000, pork has accounted for more than 70% in the meat consumption in China, and is the most important consumption meat in China. At present, there are more than 40 million sows in stock in China, and if each sow can produce one more piglet per litter on average, and according to two litters per year, China can reduce 3-4 million sows, which will reduce the feeding cost of each meat pig and improve the economic benefit of pig production.
[0003] One of the important factors affecting the number of piglets is the number of ovulation, which is affected by the level of follicle stimulating hormone (FSH), and the secretion of FSH is regulated by a gonadal hormone, i.e. inhibin. Inhibin has a strong inhibitory effect on the secretion of FSH, which can feedback inhibit the release of FSH in the anterior pituitary, thereby inhibiting the growth and development of follicles. Inhibin is a glycoprotein hormone secreted by the gonads, which is composed of an alpha subunit and a beta subunit. There are two subtypes of beta subunit: β A and β B , αβ A constitutes Inhibin A, and αβ B constitutes Inhibin B. INHA gene encodes Inhibin alpha subunit, which is essential for the physiological function of inhibin. Studies have shown that inhibiting the expression of INHA gene can promote the development of follicles and increase the ovulation rate.
[0004] Gene editing is a biological technology that has made great progress in recent years, which includes gene editing based on homologous recombination, ZFN, TALEN, CRISPR / Cas9 based nuclease editing technology, among which CRISPR / Cas9 technology is the most advanced gene editing technology. Therefore, the present application mutates INHA gene based on CRISPR / cas9 system, and obtains single-cell clones of Inhibin gene knockout, which lays a foundation for breeding high-fertility pig species by somatic cell nuclear transfer animal cloning technology in the later stage. Loss of function of INHA can effectively improve the ovulation rate of female cloned pigs, and then improve their fertility and increase the economic benefit of pig industry. SUMMARY
[0005] The application aims at providing a CRISPR / Cas9 system for pig INHA gene editing.
[0006] Another object of the application is to provide a target gRNA for INHA gene editing and an expression vector thereof.
[0007] Still another object of the application is to provide the CRISPR / Cas9 system and the gRNA expression vector.
[0008] The object of the application can be achieved by the following technical solutions.
[0009] The application provides a CRISPR / Cas9 system for pig INHA gene editing, comprising a Cas9 expression vector and a gRNA expression vector.
[0010] As a preferred embodiment of the application, the gRNA expression vector is a pKG-U6gRNA vector with a full sequence as shown in SEQ ID NO. 3.
[0011] As a further preferred embodiment of the application, the gRNA expression vector is a double-stranded DNA molecule with sticky ends obtained by annealing single-stranded DNA shown in SEQ ID NO. 23 and SEQ ID NO. 24 and cloned into a pKG-U6gRNA backbone vector.
[0012] As a further preferred embodiment of the application, the molar ratio of the gRNA expression vector and the Cas9 expression vector is 1-3:1, and further preferably 3:1.
[0013] The application provides a target gRNA for INHA gene editing, and the sequence is shown in SEQ ID NO. 19.
[0014] The application provides a gRNA expression vector for pig INHA gene, which is a pKG-U6gRNA vector with a full sequence as shown in SEQ ID NO. 3, and expresses a gRNA shown in SEQ ID NO. 31.
[0015] As a preferred embodiment of the application, the expression vector is a double-stranded DNA molecule with sticky ends obtained by annealing single-stranded DNA shown in SEQ ID NO. 23 and SEQ ID NO. 24 and cloned into a pKG-U6gRNA backbone vector.
[0016] The CRISPR / Cas9 system and the gRNA expression vector for the porcine INHA gene described in the present invention are used in constructing high-fertility cloned porcine nuclear donor cells.
[0017] A recombinant porcine fibroblast is obtained by co-transfecting primary porcine fibroblasts with the CRISPR / Cas9 system described in the present invention after verification.
[0018] The recombinant cells of the present invention are used in constructing INHA gene knockout cloned pigs; preferably in constructing INHA gene knockout cloned pigs with high fertility.
[0019] Compared with the prior art, the present invention has at least the following beneficial effects:
[0020] (1) The research object of the present invention (pig) has better applicability than other animals (rat, mouse, and primate).
[0021] Rodents such as mice and rats differ significantly from humans in terms of body shape, organ size, physiology, and pathology, making them unable to truly simulate normal human physiological and pathological conditions. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but their small size, late sexual maturity (mating begins at 6-7 years old), and single-birth primates make population expansion extremely slow and their breeding costs very high. Furthermore, primate cloning is inefficient, difficult, and costly.
[0022] Pigs, however, do not have these drawbacks as model animals. They are the closest relative to humans besides primates, with body shape, weight, and organ size similar to humans. Their anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis are highly similar to humans. Furthermore, pigs reach sexual maturity early (4-6 months), have high fertility, and can produce many offspring per litter, allowing them to form a large population within 2-3 years. Furthermore, pig cloning technology is highly mature, and the costs of cloning and rearing pigs are much lower than those of primates. Therefore, pigs are highly suitable as models for human diseases.
[0023] (2) The pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector in the application is verified by experiments, and compared with the pX330 vector before modification, the stronger promoter is replaced and the element for enhancing protein translation is added, so that the expression of Cas9 is improved, the number of nuclear localization signals is increased, the nuclear localization ability of Cas9 protein is improved, and the gene editing efficiency is higher. The application also adds a fluorescent marker and a resistance marker in the vector, so that it is more convenient to use in the screening and enrichment of vector positive transformed cells. The gRNA combined with the modified Cas9 high expression vector of the application is used for gene editing, and the editing efficiency is improved by more than 100% than that of the original vector.
[0024] (3) The application designs corresponding expression vectors for different target gRNAs of INHA genes, and obtains gRNAs with high editing efficiency and their expression vectors through screening. The application is combined with the modified Cas9 high expression vector for gene editing, and the genotype of the obtained cells can be analyzed through the sequencing results of the target gene PCR products, and the probability of obtaining the target gene mutation is as high as 75%, which is much higher than the probability of obtaining the mutation in the gene editing delivery method (i.e. fertilized egg injection of gene editing materials) using the embryo injection technology.
[0025] (4) The mutant single cell clone obtained by the application can directly obtain a cloned pig containing a target gene mutation through somatic cell nuclear transfer animal cloning, and the mutation can be stably inherited.
[0026] The application adopts the method of primary cell in vitro editing and screening of positive editing single cell clones, which has great technical difficulty and high challenge, and then the corresponding gene editing pig is directly obtained through somatic cell nuclear transfer animal cloning technology, so that the production cycle of gene editing pig can be greatly shortened, and manpower, material resources and financial resources can be saved. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 It is a structural schematic diagram of plasmid pX330.
[0028] Figure 2 It is a structural schematic diagram of plasmid pX330.
[0029] Figure 3 It is a structural schematic diagram of plasmid pX330.
[0030] Figure 4 It is a structural schematic diagram of plasmid pX330.
[0031] Figure 5 It is a structural schematic diagram of plasmid pX330.
[0032] Figure 6 A schematic diagram of the structure of plasmid pKG-U6gRNA.
[0033] Figure 7 A schematic diagram for inserting a DNA molecule of about 20 bp (a target sequence binding region for transcription to form a gRNA) into plasmid pKG-U6gRNA.
[0034] Figure 8 A sequencing peak chart for step 2.3.3 in Example 2.
[0035] Figure 9 A sequencing peak chart for step 2.4.3 in Example 2.
[0036] Figure 10 A sequencing peak chart for step 3.1 in Example 3 using
[0037] An electropherogram after PCR amplification using the primer pair consisting of INHA-E2-JDF178 / INHA-E2-JDR654.
[0038] Figure 11 A sequencing peak chart for step 3.4 in Example 3.
[0039] Figure 12 A sequencing peak chart for step 4.4.4 in Example 4 using
[0040] An electropherogram after PCR amplification using the primer pair consisting of INHA-E2-JDF178 / INHA-E2-JDR654.
[0041] Figure 13 A exemplary sequencing peak chart for determining that the target gene is a wild type in step 4.4.5 in Example 4.
[0042] Figure 14 A exemplary sequencing peak chart for determining that the target gene is a heterozygous mutant in step 4.4.5 in Example 4.
[0043] Figure 15 A exemplary sequencing peak chart for determining that the target gene is a homozygous mutant of double allelic identical variation in step 4.4.5 in Example 4.
[0044] Figure 16 A exemplary sequencing peak chart for determining that the target gene is a homozygous mutant of double allelic different variation in step 4.4.5 in Example 4. DETAILED DESCRIPTION
[0045] Example 1, Construction of Plasmid
[0046] 1.1 Construction of plasmid pU6gRNAeEF1a-mNLS-hSpCas9-EGFP-PURO (referred to as plasmid pKG-GE3)
[0047] The original plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (referred to as plasmid pX330) has a sequence as shown in SEQ ID NO: 1. The schematic diagram of the structure of plasmid pX330 is shown in Figure 1 . In SEQ ID NO: 1, nucleotides 440-725 constitute a CMV enhancer, nucleotides 727-1208 constitute a chicken β-actin promoter, nucleotides 1304-1324 encode an SV40 nuclear localization signal (NLS), nucleotides 1325-5449 encode a Cas9 protein, and nucleotides 5450-5497 encode a nucleoplasmin nuclear localization signal (NLS).
[0048] Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO Figure 5 ), referred to as plasmid pKG-GE3, has nucleotides as shown in SEQ ID NO: 2. Compared with plasmid pX330, plasmid pKG-GE3 has been mainly modified as follows: ① the residual gRNA backbone sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT) is removed to reduce interference; ② the original chicken β-actin promoter is modified into an EF1a promoter with higher expression activity to increase the protein expression capacity of the Cas9 gene; ③ the nuclear localization signal encoding gene (NLS) is added upstream and downstream of the Cas9 gene to increase the nuclear localization capacity of the Cas9 protein; ④ the original plasmid does not have any eukaryotic cell selection marker, which is not conducive to the screening and enrichment of positive transformed cells, and the P2A-EGFP-T2A-PURO encoding gene is inserted downstream of the Cas9 gene in turn to endow the vector with fluorescence and eukaryotic cell resistance selection capacity; ⑤ the WPRE element and the 3'LTR sequence element are inserted to enhance the protein translation capacity of the Cas9 gene.
[0049] The construction method of plasmid pKG-GE3 is as follows:
[0050] (1) Removal of redundant invalid sequences in the gRNA backbone
[0051] Plasmid pX330 is digested with BbsI and XbaI, and the vector fragment (about 8313 bp) is recovered. The insertion fragment 175 bp (SEQ ID NO: 4) is synthesized by using the multi-fragment recombination method, and the recovered vector fragment is recombined to obtain pU6gRNA Cas9 vector Figure 2 .
[0052] (2) Modification of the promoter and enhancer
[0053] The constructed pU6gRNA Cas9 vector was digested with XbaI and AgeI endonuclease to remove the promoter (chicken β-actin promoter) and enhancer sequence (CMV enhancer), and the linear vector sequence of about 7650 bp was recovered, and a sequence of 554 bp containing the CMV enhancer and EF1a promoter (SEQ ID NO: 5) was synthesized by a multi-fragment recombination method, and the pU6gRNA-eEF1a Cas9 vector was obtained by recombination with the enzyme-digested vector pU6gRNA Cas9. Figure 3 ).
[0054] (3) Addition of NLS sequence to the N terminus of Cas9 gene
[0055] The constructed vector pU6gRNA-eEF1a Cas9 was digested with AgeI and BglII, and the 7786 bp vector sequence was recovered, and the sequence with added NLS was supplemented to the enzyme digestion site, i.e., a fragment of 447 bp including two nuclear localization signals and a partially excised Cas9 coding sequence (SEQ ID NO: 6) was synthesized by a multi-fragment recombination method, and the pU6gRNA-eEF1a Cas9+nNLS vector was obtained by recombination. Figure 4 ).
[0056] (4) Addition of NLS, P2A-EGFP-T2A-PURO, WPRE-3'LTR-bGH polyA signal to the C terminus of Cas9 gene
[0057] The above constructed vector is named pU6gRNA-eEF1a Cas9+nNLS, which is digested with FseI and SbfI to recover the vector sequence of 7781 bp, and a fragment of 2727 bp including NLS-P2A-EGFP-T2A-PURO-WPRE-3'LTR-bGH polyA signal (SEQ ID NO: 7) is synthesized by a multi-fragment recombination method, and the vector pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO, abbreviated as pKG-GE3, is obtained by recombination with the vector fragment. The plasmid map is as shown in Figure 5 , and the nucleotide sequence (SEQ ID NO: 2).
[0058] In SEQ ID NO: 2, nucleotides 395-680 constitute a CMV enhancer, nucleotides 682-890 constitute an EFla promoter, nucleotides 986-1006 encode a nuclear localization signal (NLS), nucleotides 1016-1036 encode a nuclear localization signal (NLS), nucleotides 1037-5161 encode a Cas9 protein, nucleotides 5162-5209 encode a nuclear localization signal (NLS), nucleotides 5219-5266 encode a nuclear localization signal (NLS), nucleotides 5276-5332 encode a self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the cleavage position of the self-cleavage is between the first and second amino acid residues from the C-terminus), nucleotides 5333-6046 encode an EGFP protein, nucleotides 6056-6109 encode a self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP", and the cleavage position of the self-cleavage is between the first and second amino acid residues from the C-terminus), nucleotides 6110-6703 encode a Puromycin protein (referred to as Puro protein), nucleotides 6722-7310 constitute a WPRE sequence element, nucleotides 7382-7615 constitute a 3'LTR sequence element, and nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 2, nucleotides 911-6706 form a fusion gene, and express a fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein having the Cas9 protein, a protein having the EGFP protein, and a protein having the Puro protein.
[0059] 1.2 Construction of pKG-U6gRNA vector
[0060] The pKG-U6gRNA insert sequence (a DNA fragment containing a U6 promoter, a BbsI restriction site, and an sgRNA backbone sequence, the sequence of which is shown in SEQ ID NO: 8) was inserted into the pUC57 vector through the EcoRV restriction site in the reverse direction to obtain the full sequence of the pKG-U6gRNA vector (SEQ ID NO: 3). In SEQ ID NO: 3, nucleotides 2280-2539 constitute a hU6 promoter, and nucleotides 2558-2637 are used for transcription to form a gRNA backbone. When used, a DNA molecule of about 20 bp (a target sequence binding region for transcription to form a gRNA) Figure 7 ) is inserted into the plasmid pKG-U6gRNA Figure 6), the recombinant plasmid is formed, and the gRNA is transcribed in the cell.
[0061] Example 2 Optimization of plasmid ratio and comparison of effects of plasmid pX330 and plasmid pKG-GE3
[0062] 2.1 Target gRNA design and construction
[0063] 2.1.1 Use Benchling to design target gRNA for RAG1 gene
[0064] RAG1-g4: AGTTATGGCAGAACTCAGTG (SEQ ID NO. 9)
[0065] Synthesize the insertion sequence complementary DNA Oligo for the above-mentioned RAG1 gene target as follows:
[0066] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO. 10)
[0067] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO. 11)
[0068] RAG1-gRNA4S and RAG1-gRNA4A are both single-stranded DNA molecules.
[0069] 2.1.2 Design primers for amplification and detection of fragments containing RAG1 gRNA target sites
[0070] RAG1-nF126: CCCCCATCCAAAGTTTTTAAAGGA (SEQ ID NO. 12)
[0071] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG (SEQ ID NO. 13)
[0072] 2.1.3 Construction and cloning of gRNA recombinant vectors
[0073] 1) Digest 1 ug of pKG-U6gRNA plasmid with restriction enzyme BbsI;
[0074] 2) Run the digested pKG-U6gRNA plasmid on an agarose gel (agarose gel concentration 1%, i.e. 1 g of agarose gel is added to 100 mL of electrophoresis buffer) and isolate, purify and recover the enzyme digestion product with a gel recovery kit (Vazyme);
[0075] 3) Two complementary DNA oligos synthesized for the target site described in 2.1.1 were annealed to form double-stranded DNA complementary to the sticky ends of the pKG-U6gRNA vector Bbsl-cleaved, as shown in the following annealing program Figure 7 :
[0076] 95 °C, 5 min, then decrease to 25 °C at a rate of 5 °C / min;
[0077] 4) Initiate the ligation reaction according to the following system: room temperature reaction for 10 min
[0078]
[0079] 37 °C reaction for 60 min;
[0080] 5) Transformation
[0081] According to the instructions of the competent cells (Vazyme), the operation was performed.
[0082] 2.1.4 gRNA vector construction
[0083] 1) Mix and anneal the synthesized RAG1-gRNA4S and RAG1-gRNA4A to obtain double-stranded DNA molecules with sticky ends. Connect the double-stranded DNA molecules with sticky ends and the vector backbone to obtain plasmid pKG-U6gRNA(RAG1-gRNA4). The plasmid pKG-U6gRNA(RAG1-gRNA4) will express RAG1-gRNA4 as shown in SEQ ID NO. 14.
[0084] 2.1.5 gRNA vector identification
[0085] Single colonies were picked from LB plates and placed in LB culture solution with the corresponding antibiotics. After incubation at 37 °C in a constant temperature shaker for 12-16 h, the plasmid was extracted and sent to the general company for sequencing. After sequence alignment, it was confirmed that the RAG1-gRNA4 vector was successfully constructed.
[0086] 2.2 Preparation of porcine primary fibroblasts
[0087] 2.2.1 Take 0.5 g of ear tissue from a newborn Jiangxiang pig, remove the hair and bone tissue, and soak in 75% alcohol for 30-40 s;
[0088] 2.2.2 Wash 5 times with PBS containing 5% P / S (Gibco Penicillin-Streptomycin) and once with PBS without P / S;
[0089] The PBS formula of 5% P / S is: 5% P / S (Gibco Penicillin-Streptomycin) + 95% PBS, and 5% and 95% are volume percentages.
[0090] 2.2.3 The tissue was cut with scissors, 5 mL of 0.1% collagenase (Sigma) solution was added, and 37°C shaking table digestion was performed for 1 h;
[0091] 2.2.4 500g centrifugation for 5 min, the supernatant was removed, the precipitate was resuspended with 1 mL of complete medium, and was inoculated into a 10 cm cell culture dish containing 10 mL of complete medium and having been sealed with 0.2% gelatin (VWR).
[0092] The formula of the complete cell culture medium is: 15% fetal bovine serum (Gibco) + 83% DMEM medium
[0093] (Gibco) + 1% P / S (Gibco Penicillin-Streptomycin) + 1% HEPES (Solarbio), and 15%, 83%, 1%, and 1% are volume percentages.
[0094] 2.2.5 Incubation in a constant temperature incubator at 37°C, 5% CO2 (volume percentage), and 5% O2 (volume percentage);
[0095] 2.2.6 When the cells were cultured to about 60% of the bottom of the dish, the cells were digested with 0.25% (Gibco) trypsin, and then complete medium was added to terminate the digestion. The cell suspension was transferred into a 15 mL centrifuge tube, 400g centrifugation was performed for 4 min, the supernatant was removed, and the cell precipitate was obtained for the next cell transfection experiment
[0096] 2.3 Optimization of plasmid ratio
[0097] 2.3.1 Co-transfection grouping
[0098] The first group: co-transfecting plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is: about 200,000 porcine primary fibroblasts: 0.44 μg of plasmid pKG-U6gRNA (RAG1-gRNA4): 1.56 μg of plasmid pKG-GE3. That is, the molar ratio of plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 is 1:1.
[0099] The second group: the plasmid pKG-U6gRNA (RAG1-gRNA4) and the plasmid pKG-GE3 are co-transfected into the porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.72 μg of plasmid pKG-U6gRNA (RAG1-gRNA4): 1.28 μg of plasmid pKG-GE3. That is, the molar ratio of the plasmid pKG-U6gRNA (RAG1-gRNA4) and the plasmid pKG-GE3 is 2:1.
[0100] The third group: the plasmid pKG-U6gRNA (RAG1-gRNA4) and the plasmid pKG-GE3 are co-transfected into the porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (RAG1-gRNA4): 1.08 μg of plasmid pKG-GE3. That is, the molar ratio of the plasmid pKG-U6gRNA (RAG1-gRNA4) and the plasmid pKG-GE3 is 3:1.
[0101] The fourth group: the plasmid pKG-U6gRNA (RAG1-gRNA4) is transfected into the porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 1 μg of plasmid pKG-U6gRNA (RAG1-gRNA4).
[0102] 2.3.2 Co-transfection operation method
[0103] The transfection experiment is carried out using the mammalian fibroblast nucleic transfection kit (Neon kit) and the Neon TM transfection system electroporator.
[0104] 1) The electroporation DNA solution is prepared according to the above grouping, and attention is paid to avoid the generation of bubbles during the mixing process;
[0105] 2) The cell pellet prepared in 2.2.6 is washed with 1 ml of PBS phosphate buffer (Solarbio) and transferred to a 1.5 ml centrifuge tube, centrifuged at 600g for 6 min, the supernatant is discarded, and 11 μL of electroporation basic solution Opti-MEM is used to resuspend the cells, and bubbles are avoided during the resuspension process;
[0106] 3) 10 μL of cell suspension is taken and added to the electroporation DNA solution in step 1) for mixing, and attention is paid to avoid the generation of bubbles during the mixing process;
[0107] 4) The electroporation cup provided with the kit is placed in the cup slot of the Neon TM transfection system electroporator, and 3 mL of Buffer E is added;
[0108] 5) Take 10 μL of the mixture obtained in step 3) with the electrotransformation gun, insert into the click cup, select the electrotransformation program (1450V 10ms 3 pulse), and immediately after electrotransfection, transfer the mixture in the electrotransformation gun into a 6-well plate in the clean bench, containing 3 mL of complete culture solution (15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% P / S (Gibco Penicillin-Streptomycin) + 1% HEPES (Solarbio)) per well;
[0109] 6) After mixing, place in a constant temperature incubator at 37°C, 5% CO2, 5% O2, and culture;
[0110] 7) Change the liquid 12-18h after electrotransformation, and collect the cells in a 1.5 mL centrifuge tube by trypsinization with 0.25% (Gibco) 36-48h after electrotransformation.
[0111] 2.3.3 Analysis of gene editing efficiency
[0112] Extract the genomic DNA of the cells collected in 2.3.2, and perform PCR amplification with the primer pair composed of RAG1-nF126 and RAG1-nR525, and sequence the product. The sequencing results are analyzed using the web-based Synthego ICE tool to obtain the editing efficiencies of the first group, the second group, and the third group as 9%, 53%, and 66%, respectively. An exemplary peak graph of the sequencing results is shown in FIG. 2B. Figure 8 It is determined that the gene editing efficiency of the third group is the highest, i.e., the optimal amount of gRNA plasmid and Cas9 plasmid is a molar ratio of 3:1, and the actual amount of plasmid used is 0.92 μg: 1.08 μg.
[0113] 2.4 Comparison of the effects of plasmid pX330 and plasmid pKG-GE3
[0114] 2.4.1 Grouping for co-transfection
[0115] RAG1-330 group: co-transfect the plasmid pKG-U6gRNA (RAG1-gRNA4) and the plasmid pX330 into the porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (RAG1-gRNA4): 1.08 μg of plasmid pX330, wherein the molar ratio of pKG-U6gRNA (RAG1-gRNA4) to pX330 is 3:1.
[0116] RAG1-KG group: plasmid pKG-U6gRNA(RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(RAG1-gRNA4): 1.08 μg of plasmid pKG-GE3, wherein the molar ratio of pKG-U6gRNA(RAG1-gRNA4) to pKG-GE3 was 3:1.
[0117] RAG1-B group: plasmid pKG-U6gRNA(RAG1-gRNA4) was transfected into porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(RAG1-gRNA4).
[0118] 2.4.2 Co-transfection operation method
[0119] The same as 2.3.2 in this embodiment.
[0120] 2.4.3 Analysis of gene editing efficiency
[0121] The genomic DNA of the cells collected in 2.4.2 was extracted, and a primer pair composed of RAG1-nF126 and RAG1-nR525 was used for PCR amplification, and the product was sequenced. The sequencing results were analyzed by the web-based Synthego ICE tool to obtain the editing efficiency of the RAG1-330 group and the RAG1-KG group, which were 28% and 68%, respectively. The exemplary peak chart of the sequencing results is shown in Figure 9 The results show that compared with plasmid pX330, the use of plasmid pKG-GE3 significantly improves the efficiency of gene editing.
[0122] Example 3 Screening of efficient INHA gene gRNA target
[0123] Pig INHA gene information: encoding inhibin subunit alpha protein; located on pig chromosome 5; GeneID is 397386, Sus scrofa. The protein encoded by pig INHA gene is shown in GENBANK ACCESSION NO. XP_020930352.1 (linear CON 12-JAN-2018), and the amino acid sequence is shown in SEQ ID NO: 15. In the genomic DNA, the pig INHA gene has 2 exons, wherein the 2nd exon and the sequences of 100 bp upstream and downstream thereof are shown in SEQ ID NO: 16.
[0124] 3.1 Analysis of INHA gene knockout preset target and adjacent genomic sequence conservation
[0125] 18 newborn Jiangxiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, respectively) and 8 males (named A, B, C, D, E, F, G, and H, respectively).
[0126] Genomic DNA of the 18 pigs was used as a template for PCR amplification using primer pairs (the target sequence of the primer pair includes the 2nd exon of the pig INHA gene), followed by electrophoresis. The PCR amplification product was recovered and sequenced, and the sequencing results were compared with the INHA gene sequence in the public database. According to the comparison results, primers for detecting mutations were designed (the primers themselves avoid possible mutation sites). The designed primers for detecting mutations are: INHA-E2-JDF178 / INHA-E2-JDR654. The electrophoretogram of the PCR amplification of the genomic DNA of the 18 pigs using the primer pair consisting of INHA-E2-JDF178 / INHA-E2-JDR654 is shown in FIG. 2. Figure 10 .
[0127] INHA-E2-JDF178: 5'-CTGCGCTGTCCTCTCTGTTC-3' (SEQ ID NO: 17);
[0128] INHA-E2-JDR654: 5'-AGTGCTGGGTGAGAAGGTTG-3' (SEQ ID NO: 18).
[0129] 3.2 Target gRNA design and construction
[0130] Several target sites were initially screened by screening NGG (avoiding possible mutation sites), and 4 target sites were further screened from them through a pre-experiment.
[0131] The 4 target sites are as follows:
[0132] sgRNA INHA-E2-g1 Target: 5'-CCTCTGCAGCAGGCGCAGCG-3' (SEQ ID NO: 19);
[0133] sgRNA INHA-E2-g2 Target: 5'-CCTGCTGCAGAGGCCCCCGG-3' (SEQ ID NO: 20);
[0134] sgRNA INHA-E2-g3 Target: 5'-GTGGCAGTCGGCGTGCACAG-3' (SEQ ID NO: 21);
[0135] sgRNA INHA-E2-g4Target: 5'-AGATGTTGAGGGAAGCTCTG-3' (SEQ ID NO: 22).
[0136] The synthesized INHA gene 4-target point insertion sequence complementary DNA Oligo is as follows:
[0137] INHA-E2-gRNA1-S: 5'-caccgCCTCTGCAGCAGGCGCAGCG-3' (SEQ ID NO: 23);
[0138] INHA-E2-gRNA1-A: 5'-aaacCGCTGCGCCTGCTGCAGAGGc-3' (SEQ ID NO: 24);
[0139] INHA-E2-gRNA2-S: 5'-caccgCCTGCTGCAGAGGCCCCCGG-3' (SEQ ID NO: 25);
[0140] INHA-E2-gRNA2-A: 5'-aaacCCGGGGGCCTCTGCAGCAGGc-3' (SEQ ID NO: 26);
[0141] INHA-E2-gRNA3-S: 5'-caccGTGGCAGTCGGCGTGCACAG-3' (SEQ ID NO: 27);
[0142] INHA-E2-gRNA3-A: 5'-aaacCTGTGCACGCCGACTGCCAC-3' (SEQ ID NO: 28);
[0143] INHA-E2-gRNA4-S: 5'-caccgAGATGTTGAGGGAAGCTCTG-3' (SEQ ID NO: 29);
[0144] INHA-E2-gRNA4-A: 5'-aaacCAGAGCTTCCCTCAACATCTc-3' (SEQ ID NO: 30).
[0145] INHA-E2-gRNA1-S, INHA-E2-gRNA1-A, INHA-E2-gRNA2-S, INHA-E2-gRNA2-A, INHA-E2-gRNA3-S, INHA-E2-gRNA3-A, INHA-E2-gRNA4-S, INHA-E2-gRNA4-A are all single-stranded DNA molecules.
[0146] 3.3 Preparation of recombinant plasmid
[0147] The plasmid pKG-U6gRNA was digested with restriction enzyme Bbsl, and the vector backbone (a linear large fragment of about 3 kb) was recovered.
[0148] INHA-E2-gRNA1-S and INHA-E2-gRNA1-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector backbone were ligated to obtain the plasmid pKG-U6gRNA(INHA-E2-g1). The plasmid pKG-U6gRNA(INHA-E2-g1) expressed sgRNA represented by SEQ ID NO: 31 INHA-E2-g1 .
[0149] INHA-E2-gRNA2-S and INHA-E2-gRNA2-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector backbone were ligated to obtain the plasmid pKG-U6gRNA(INHA-E2-g2). The plasmid pKG-U6gRNA(INHA-E2-g2) expressed sgRNA represented by SEQ ID NO: 32 INHA-E2-g2 .
[0150] INHA-E2-gRNA3-S and INHA-E2-gRNA3-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector backbone were ligated to obtain the plasmid pKG-U6gRNA(INHA-E2-g3). The plasmid pKG-U6gRNA(INHA-E2-g3) expressed sgRNA represented by SEQ ID NO: 33 INHA-E2-g3 .
[0151] INHA-E2-gRNA4-S and INHA-E2-gRNA4-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector backbone were ligated to obtain the plasmid pKG-U6gRNA(INHA-E2-g4). The plasmid pKG-U6gRNA(INHA-E2-g4) expressed sgRNA represented by SEQ ID NO: 34 INHA-E2-g4 .
[0152] 3.4 Comparison of editing efficiency of gRNAs for different target sites of INHA gene
[0153] Porcine primary fibroblasts were prepared from the ear tissue of a newborn Jiangxiang pig (female, blood type AO).
[0154] 1. Co-transfection
[0155] First group: co-transfect plasmid pKG-U6gRNA (INHA-E2-g1) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (INHA-E2-g1): 1.08 μg of plasmid pKG-GE3. The molar ratio of pKG-U6gRNA (INHA-E2-g1) to pKG-GE3 is 3:1.
[0156] Second group: co-transfect plasmid pKG-U6gRNA (INHA-E2-g2) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (INHA-E2-g2): 1.08 μg of plasmid pKG-GE3. The molar ratio of pKG-U6gRNA (INHA-E2-g2) to pKG-GE3 is 3:1.
[0157] Third group: co-transfect plasmid pKG-U6gRNA (INHA-E2-g3) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (INHA-E2-g3): 1.08 μg of plasmid pKG-GE3. The molar ratio of pKG-U6gRNA (INHA-E2-g3) to pKG-GE3 is 3:1.
[0158] Fourth group: co-transfect plasmid pKG-U6gRNA (INHA-E2-g4) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (INHA-E2-g4): 1.08 μg of plasmid pKG-GE3. The molar ratio of pKG-U6gRNA (INHA-E2-g4) to pKG-GE3 is 3:1.
[0159] Fifth group: porcine primary fibroblasts, the same electric conversion parameters without plasmid for electric conversion operation.
[0160] Co-transfection adopts the way of electric shock transfection, adopts mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electric conversion instrument (parameter setting is: 1450V, 10ms, 3pulse).
[0161] 2. After step 1 is completed, use complete culture solution to culture for 16-18 hours, then replace new complete culture solution for culture. The total culture time is 48 hours.
[0162] 3. After step 2 is completed, use trypsin to digest and collect cells, then lyse cells and extract genomic DNA, use primer pair composed of INHA-E2-JDF178 and INHA-E2-JDR654 to perform PCR amplification, then perform 1% agarose gel electrophoresis. Recover the target fragment and perform sequencing, and the sequencing peak chart is shown in Figure 11 . Use Synthego ICE tool to analyze the sequencing peak chart to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first group to the fourth group is 68%, 5%, 8%, and 1% respectively. The fifth group does not occur gene editing. The results show that the first group has the highest editing efficiency, and the target point of sgRNA INHA-E2-g1 is the optimal target point.
[0163] Example 4 Construction of INHA gene knockout Congjiang pig single cell clone
[0164] 4.1 Preparation of porcine primary fibroblasts
[0165] Same as 2.2 in Example 2.
[0166] 4.2 Co-transfection of porcine primary fibroblasts with constructed pKG-U6gRNA(INHA-E2-g1) plasmid and pKG-GE3 plasmid
[0167] Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(INHA-E2-g1): 1.08 μg plasmid pKG-GE3. The molar ratio of pKG-U6gRNA(INHA-E2-g1) to pKG-GE3 is 3:1.
[0168] The co-transfection operation method is the same as 2.3.2 in Example 2, but does not use 0.25% (Gibco) trypsin to digest and collect cells in a 1.5 mL centrifuge tube.
[0169] 4.3 Screening of INHA gene knockout single cell clone strains
[0170] 4.3.1 The population cells obtained by step 4.2 for 48h are digested using trypsin, neutralized in complete culture medium, centrifuged at 500g for 5min, the supernatant is removed, the precipitate is resuspended with 200μL complete culture medium, and appropriately diluted, and a single cell is picked up with a mouth pipette and transferred to a 96-well plate containing 100μL complete culture medium in each well, and one cell is placed in each well;
[0171] 4.3.2 The cells were cultured in a constant temperature incubator with 5% CO2 and 5% O2, and the cell culture medium was changed every 2-3 days. The cell growth in each well was observed under a microscope to exclude wells without cells or non-single cell clones.
[0172] 4.3.3 When the cells in the wells of the 96-well plate grew to cover the bottom of the wells, the cells were digested with trypsin and collected. Two-thirds of the cells were inoculated into a 6-well plate containing complete culture medium, and the remaining one-third of the cells were collected in a 1.5 mL centrifuge tube for subsequent genotype determination.
[0173] 4.3.4 When the 6-well plate reached 80% confluence, the cells were digested with 0.25% trypsin (Gibco) and collected, and the cells were frozen using a cell freezing solution (90% complete culture medium + 10% DMSO, by volume).
[0174] 4.4 Identification of single cell clones with INHA gene knockout
[0175] 4.4.1 To the cells collected in the 1.5 mL centrifuge tube in step 4.3.3, add 10 μL of KAPA2G lysis solution to lyse the cells and obtain a cell lysate releasing genomic DNA.
[0176] The KAPA2G lysis solution is prepared as follows:
[0177] 10X extract Buffer 1 μL
[0178] Enzyme 0.2 μL
[0179] ddH2O 8.8 μL
[0180] 75°C for 15 min, 95°C for 5 min, and 4°C, and the cell lysate is stored at -20°C after the reaction is completed.
[0181] 4.4.2 The aforementioned primer pair for INHA gene E14 (INHA-E2-JDF178 / INHA-E2-JDR654) is used to amplify the target region of the INHA gene, and the above cell lysate is used as the DNA template. The mutation of the target gene in the single cell clone is detected, and the length of the target PCR product is 477 bp.
[0182] 4.4.3 The target region of the INHA gene is amplified using a conventional PCR reaction.
[0183] 4.4.4 The PCR reaction product is electrophoresed, and the electrophoresis results are as follows Figure 12 The lane numbers are consistent with the single cell clone numbers. The PCR amplification product is recovered and sequenced.
[0184] 4.4.5 Compare the sequencing results with the INHA target information, so as to determine whether the single cell clone is an INHA gene knockout.
[0185] The genotype of the single cell clones numbered 2, 4, 9, 12, 20 is homozygous mutant of double alleles with the same variation. The genotype of the single cell clones numbered 7, 8, 16 is homozygous mutant of double alleles with different variations. The genotype of the single cell clones numbered 3, 5, 11, 14, 15, 18, 19 is heterozygous mutant. The genotype of the single cell clones numbered 1, 6, 10, 13, 17 is wild type. The rate of obtaining INHA gene editing single cell clones is 75%, and the homozygous knockout rate is 40%.
[0186] An exemplary sequencing alignment result is as follows Figures 13 to 16 , wherein Figure 13 is the alignment result of the sequencing result of clone number INHA-1 with the wild type reference sequence, and is determined as wild type; Figure 14 is the alignment result of the sequencing result of clone number INHA-5 with the wild type reference sequence, and is determined as heterozygous mutant; Figure 15 is the alignment result of the sequencing result of clone number INHA-2 with the wild type reference sequence, and is determined as homozygous mutant of double alleles with the same variation; Figure 16 is the alignment result of the sequencing result of clone number INHA-7 with the wild type reference sequence, and is determined as homozygous mutant of double alleles with different variations.
[0187] Through analysis of specific sequences, the genotype of each single cell clone is as shown in Table 1:
[0188] Table 1: Genotype identification of INHA gene knockout single cell clones
[0189]
[0190]
[0191] The heterozygous mutant and homozygous mutant single cell clone strains described above can be used for the cloning production of gene edited pigs.
[0192] The present application has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims. SEQUENCE LISTING <110> Nanjing Qiuzhen Gene Engineering Co. Ltd. <120> CRISPR / cas system and its application in constructing INHA mutant high-fertility pig nuclear transfer donor cells <160> 34 <170> SIPOSequenceListing 1.0 <210> 1 <211> 8484 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300 gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360 agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420 aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480 aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480CCAACGACCCC CGCCCATTGA CGTCAATAGT AACGCCAAT A GGACTTTCA TTGACGTC 540 AATGGGTGGA GTATTTCGGT AAACCGCCCC ACTTGGCAGT ACATCAAGT GTATCATATG C 600 CAAGTACGCC CCCTATTGAC GTCAATGACG G TAAATGGCCC GCCTGGCAT TGTC CCA GT 660 ACATGACCTT ATGGGACTTT CCTACTTGGC AGTACATCTA CGTATTAGTC ATCGCTATTA 720 CCATGGTCGA GGTGAGCCCC ACGTTCTGCT TC ACTCTCCCC CATCTCCCCC CCTCCCCAC 780 CCCCAATTTT GTATTTCATT TATTTCCTTT ATTTCTTTGT GCAGCGATGG GGGCGGGGGG 840 GGGGGGGGCG GGGCGAGGGG C GGGCGGGGCG GAGGC GGA GAGGTGC GGC GGCAGCCAAT C 900 AGAGCGGC GC GCTCCGAAAG TTT CCTTTTAT GGC GAGGC GGC GGC GGC GGC CCTATA 960 AAAAGCGAAG CGCGCGGC GGC GGGAGTCG CTGC GCGCTGC CTT CGCCCCGT GCCCCGCT 1020 CCGCCGCCGC CTCGC GCCGCC CGCCCCGGC TCTGACTGAC CGC GTTACTCCCACAGGTGA 1080 GC GGGCGGGA CGGCCCTTCT CCTCCGGGCT GTAATTAGCT GAGCAAGAGG T AAGGGTTA 1140 AGGGATGGTT G GTTGGTGGG GTATTAATGT TT AATTACCT GGAGCACCTG CCTGAAATCA 1200 ttttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260 ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320 ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380 caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440 caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500 gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560 caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620 ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680 gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740 ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800 gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860 cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920 caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980 gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040 gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100 caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160 cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220 cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280 caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340 gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400 cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460 ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520 gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580 ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640 CCTGAAGGAC AACC GGGAAA AGATCGAGAAG ATCCTGACCTTCCG CATCCCCCTAC TACGT 2700 GGGCCCTCTG GCCAG GGGAA ACAGC AGATT C GCCTGGATG ACCAGAAAGA GC GAGGA AAC 2760 CATCACCCCC TGGAAC TTCG AGGAAGTG GTGGACAAGGGC GCTTCCGCCCA GAGCTTCAT 2820 CGAGCGGATG ACCA ACTTCG AT AAGAAGCCCG CCAACGAGAAGGTGCTGC CCAAGCACAG 2880 CCTGCTGTAC GAGTACTTCA CC GTGTATAAC GAGCTGACCAAAGTGAAATACGTGACC GA 2940 GGGAATGAGAAAGCCC GCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCT 3000 GTTCAAGACCAACC GGGAAAGTGACCGTGAA GCAGCTGAAAGAGGACTACTTCAAGAAAAT 3060 CGAGTGCTTCGACTCCGTGGAATCTCCGGC GTGGAA GATCGGTTCAACGCCTCCCTGGG 3120 CACATACCAC GATCTGCTGAA AATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAAA 3180 CGAGGACATTC GGAAGATATCGTGCTGACCCTGACACTGT TTGAGGACAGAGAGATGAT 3240 CGAGGAACGGCTGAAAACCTATGCCCACCTGTTCGACGACA AAGTGATGAAGCAGCTGAA 3300 GC GGC GGA GATACACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGA 3360 caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420 cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480 ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540 cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600 ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660 gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720 cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780 cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840 gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900 cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960 cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020 tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080 taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140 acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200 agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260 ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320 cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380 ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440 taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500 ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560 cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620 gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680 caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740 cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800 caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860 cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920 ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980 aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040 tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100 tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160 gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220 cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280 gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340 ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400 caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460 ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520 TCGACGTGACGGCAAAGCCGGAAAGAGTGGCCGGCTTCGGCTTCGGCTTCGGC 1200 TCCTTGACCC TGGAAGGTGC CACTCCCACT GTCCTTTCCT AATAAAATGA GGAAATTGCA 5640 TCGCATTGTC TGAGTAGGTG TCATTCTATT CTGGGGGGTG GGGTGGGGCA GGACAGCAAG 5700 GGGGAGGATT GGGAAGAGAA TAGCAGGCAT GCTGGGGAGC GGCCGCAGGA ACCCCTAGTG 5760 ATGGAGTTGG CCAC TCCCTC TCTGC GCGCTCGCTCGCTC ACTGAGGCCGGGC GACCAAAG 5820 GTCGCCCGAC GCCC GGGCTTTGCCC GGGCGGCCTC AGT GAGCGAGCGAGCGC GCAGCTGC 5880 CTGCAGGGGC GCCTGATGCG GTATT TTC TCTTACGCATC TGTGCGGTATTTCACACCGC 5940 ATACGTCAAAGCAACCATAGTACGC GCCCTG TAGCGGC GCATT AAGCGCGGC GG GTGTGG 6000 TG GTTACGC GCAGC GTGACCGCTACACTTGCCAGC GCCTTAGCGCCCGCTCCTTT CGCTT 6060 TCTTCCCTTCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGG GC 6120 TCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACC TCGACCCCAAAAAACTTGATTTGG 6180 GTGATGGTTACG TAGTGGGCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGG 6240 agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300 cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360 agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420 ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480 caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540 ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600 cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660 tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720 ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780 aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840 tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900 atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960 agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020 tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080 tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140 atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200 ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260 tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320 acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380 ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440 aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500 ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560 cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620 gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680 actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740 agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800 cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860 tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920 agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980 ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040 acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100 ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160 gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220 gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280 gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340 tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400 CAGGGGGGCG GAGCCTATGG AAAAACGCAG CAACGCGGCC TTTTTACGGT TCCTGGCCT 8460 TTTGCTGGCC TTTTGCTCAC ATGT 8484 <210> 2 <211> 10476 <212> DNA <213> Artificial Sequence <400> 2 GAGGGCCTAT TTCCCATGAT TCCTT CATAT TTG CATATA CGATA CAAGGCT GTTAGAGAG 60 ATAATTGGAA TTAATTTGAC TGTAACACA AAGATATTAG TACAAAATA CGTGACGTAGA 120 AAGTAATAAT TTCTTGGGTA GTTTGCAGTT TTA AAATTATGTTT TAAAATGGAC TATCAT 180 ATGCTTACCG TAAC TTAAGAAGT ATTT CGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGA 240 CGAAACACCG GGTCTTCGAG AAGACCTGTT TTAGAGCTAG AAATAGCAAG TTA AAAT AAG 300 GCTAGTCCGT TATCAACTTG AAAAAGTGGC ACCGAGTCGG TGCTTTTTTC TAGC GC GTGC 360 GCCAATTCTG CAGACAAATG GCTCTAGAGG TACCCGTTAC ATAAC TTA CGGTAATGGCC 420 CGCCTGGCTG ACCGCCCAAC GACCCCCGCC CATTGACGTC AATAGTAACG CCAATAGGGA 480 CTTTCCAT TGACGTCAAT GGGTGGAGTA TT TACGGTAAAC TGCCCAC T TGGCAGTACAT C 540 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600 ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660 tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720 ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780 gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840 cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900 cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960 caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020 gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080 cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140 cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200 cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260 GAGAAGAAGA GATACCCAGA CGGAAAGAAC CGGATCTGCT ATCTGCAAAG ATCTTCAGC AA 1320 CGAGATGGCC AAGGTGGAC GACAGCTTCT TCCACAGACT GGAAGAGTCC TTCCTGGGTGGA 1380 AGAGGATAAG AAGCACGAGC GGCACCCCAT CTTCGGCAAC ATCGTGGACG AGGTGGCCTA 1440 CCACGAGAAG TACCCCACTA TCTACCACCT GAGAAAGAAA CTGGTGGACA GCACCGACAA 1500 GGCCGACCTG CGGCTGATCT ATCTGGCCCT GGCCCACATG ATCAAGTTCC GGGGCCACTT 1560 CCTGATCGAG GGCACCTGAA CCCCGACAAC AGCGACGTGG ACAAGCTGTT CATCCAGCT 1620 Ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680 CAAGGCCATC CTGTCTGCAG ACTGAGCAAG AGCAGACGGC TGGAAAATC TGATCGCCCA 1740 GCTGCCCggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800 GACCCccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860 GGACACCTAC GACGACGACC TGGACAACCT GCTGGCCCAG ATCGGCgacc agtacgccga 1920 CCTGTttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980 GAACACCAGA ATACCCAAGG CCCCTCCTGA CGCCTCTATG ATCAAGAGAT ACGACGAGCA 2040 CCACCAGGAC CTGACCCTGC TGAAAGCTCT CGTGCGGCAG CAGCTGCCTG AGAAGTACAA 2100 AGAGATTTTC TTCGACCAGA GCAAGAACGG CTACGCCGGC TACATTGACG GCGGAGCCAG 2160 CCAGGAAGAG TTCTACAAGT TCATCAAGCC CATCCTGGAA AAGATGGACG GCACCGAGGA 2220 ACTGCTCGTG AAGCTGAACA GAGAGGACCT GCTGCGGAAG CAGCggACCT TCGACAACGG 2280 CAGCATCCCC CACCAGATCC ACCTGGGAGA GCTGCACGCC ATTCTGCGGC GGAGAAGAAG 2340 TTTTTACCAT TTCCTGAAGG ACAACCGGGA AAAGATCGAG AAGATCCTGA CCTTCCGCAT 2400 CCCCTACTAC GTGGGCCCTC TGGCCAGGGG AAACAGCAGA TTCGCCTGGA TGACCAGAAA 2460 GAGCGAGGAA ACCATCACCCC CTGGAACCTC GAGGAAGTGG TGGACAAGGG CGCTTCCGCG 2520 CCAGAGCTTC ATCGAGCGGA TGACCAACTT CGATAAGACC TGCCCAACGA GAAGGTGCT 2580 GCCC AAGCAC AGCCTGCTGT ACGAGTA CTCACC GTGTAT AACGAGCTG ACCAAAGTGA A 2640 ATACGTGACC GAGGGAATGA GAAAGCCCgc CTTCCTGAGC GGCgAGCAGA AAAAGGCCAT 2700 cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760 cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820 cgcctccctg ggcacatacc acgatctgct gaaaattatc areacaagg acttcctgga 2880 2940 cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000 gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060 cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120 cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180 ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240 cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300 gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360 gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420 caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaaccc agctgcagaa 3480 cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540 ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600 ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660 caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720 cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780 gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840 aaagcacgtg gcacagatcc tggactccg gatgaacact aagtacgacg agaatgacaa 3900 gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960 ggattccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020 cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080 cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140 aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200 cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260 aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320 catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380 gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440 taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500 agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560 catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620 agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680 cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740 gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800 ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860 GATCATCGAG CAGATCAGCG AGTTCTCCAA GAGAGTGATC CTGGCCGACG CTAATCTGGA 4920 CAAAGTGCTG TCCGCCTACA ACAAGCACCG GGATAAGCCC ATCAGAGAGC AGGCCGAGAA 4980 TATCATCCAC CTGTTTACCC TGACCAATCT GGGAGCCCCT GCCGCCTTCA AGTACTTTGA 5040 CACCACCATC GACCGGAGAG GTACACCAGC ACCAAAGAGG TGCTGGACGC CACCCTGAT 5100 CCACCAGAGC ATCACCGGCC TGTCGAGACA CGGATCGACC TGTCTCAGCT GGGAGGCAGA 5160 CAAAAGGCCG GCGGCCACGA AAAAGGCCGG CCAGGCAAAA AAGAAAAAGG CGGCTCCAA 5220 GCGGCCTGCC GCgACGAAGA AGCgGGACAG GccAAGAAAA AGAAAGGATC CgGCgCAAC 5280 AAACTTCTCT CTGCTGAAAC AAGCCGGAGA TGTcGAAGAG AATCCTGGAC CGGTGAGCAA 5340 GGGCgAGGAG CTGTTCACCG GGGTGgtGCC CATCCTGGTC GAGCTGGACG GCGACGTAAG 5400 CgGCcACAAG TTCAGCgTGT CCgGCgAGGG CGAGGGCGAT GCCACCCACG GCAAGCTGAC 5460 CCTGAAGTTC ATCTGCACCA CCgGCAAGCT GCCCgTGCCC TGGCCCACCC TCgTGACCAC 5520 CCTGACCTAC GGCGTGAGTG CTTcAGCCgC TACCCCGACc ACATGAAGC AGCACGACTT 5580 GAGAAGCGTA ATATTTCACA GATCGTTGCG GCGGCGGCGG 60 CGAGCTGAAG GGATCGACTT CAAGGAGGAC GGCAACATCC TGGGGCACAA GCTGGAGTA 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 CAGTTCGAGT TATTCACGCG GCGGCGGCGG 60 ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360 ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420 gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480 ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540 ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600 ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660 cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720 caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780 tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840 tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900 gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960 tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020 tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080 gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140 cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200 caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260 tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320 agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380 ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620 cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680 cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740 aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800 ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860 gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920 atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980 cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040 ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100 taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160 aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220 ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280 tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340 ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400 ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460 cccgacaccc gccaacaccc gctgacgcg cctgacgggc ttgtctgctc ccggcatccg 8520 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580 caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640 tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700 ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760 gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820 cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940 tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000 cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480 ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900 TGCCGGATCA AGAGCTACC AACTCTTTTT CCGAAGGTAA CTGGCTTCAG CAGAGCGAGA 9960 TACCAAATAC GTTCTTCTAG TGTA GCCGT AGTTAGGCACC ACTTCAAG AACTCTGTAG 10020 CACC GCCTAC ATACCTCGCT CTGCTAATCC GTTTACCAGT GGCTGCTGCC AGTGGCGATA 10080 AGTCGTGTCT TACC GGGTTGGACTCAAGAC GATAGTTACC GGATAAGGC GCAGCGGTCGG 10140 GCTGAACGGG GGGTTCGTGC ACACAGCCCAG CTTGGAGCGA ACGACCTAC ACCGAACTGA 10200 GATACCTACA GC GT AGCTAT GAGAAAGCG CCACGCTTCC C GAAGGGAGA AAGGC GGACA 10260 GGTATCCGGT AAGCGGCAGG GTCGGAACAG GAGAGCGACA GG GGAGCTT CCAGGGGGAA 10320 ACGCCTGGTA TCTTTATAGT CCTGTCGGGT TTCGCCACCT CTGACTTGAG CGT CGATTTT 10380 TGTGATGCTC GT CAGGGGGGC GGAGCCTAT GGA AAAACGC CAGCAACGC GGCCTTTTTA 10440 GGTT CCTGGCCTTTTGCTGGCCTTTTGCTCACATGT 10476 <210> 3 <211> 3120 <212> DNA <213> Artificial Sequence <400> 3 GCGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAG 60 CTTAGACGTC AGGTGGCACT TTTCGGGGAA ATGTGCGCGG AACCCCTATT TGTTTATTTT 120 TCTAAATACA TTCAAATATG TATCCGCTCA TGAGACAATA ACCCTGATAA ATGCTTCAAT 180 AATATTGAAA AAGGAAGAGT ATGAGTATTC AACATTCCTG TCGCCCTTAT TCCCTTTTC 240 TTGCGGCATT TTGCCTTCCT GTTTTTTGCT CACCCAGAAC GCTGGTGAAA GTAAG 300 CTGAAGATCA GTTGGGTGCA CGAGTGGGTT ACATCGAACT GGATCTCAAC AGC 360 TCCTTGAGAG TTTTCGCCCC GAAGAAGCCT TTCCAATGAT GAGC 420 TATGTGGCGC GGTATTATCC CGTATTGACG CCGGGCAAGA GCAACTCGGT CGCCGCATA 480 ACTATTCTCA GAATGACTTG GTTGAGTACT CACCAGTCAC AGAAAAGCAT CTTACGGATG 540 GCA 600 ACTTACTTCT GACAACGATC GGAGGACCGA AGGAGCTAAC CGCTTTTTTG CACAACATGG 660 GGGATCATGT AACTCGCCTT GATCGTTGGG AACC 720 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATATAATAT ATATATATAT ATAT 2'35 DNA SEQ ID NO. 19 ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940 gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000 cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060 tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120 <210> 4 <211> 175 <212> DNA <213> Artificial Sequence <400> 4 tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 60 gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 120 ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccgtta cataa 175 <210> 5 <211> 554 <212> DNA <213> Artificial Sequence <400> 5 tctgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat ggcccgcctg 60 gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata gggactttcc 120 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 180 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 240 gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 300 tcgctattac catgggggca gagcgcacat cgcccacagt ccccgagaag ttggggggag 360 gggtcggcaa ttgatccggt gcctagagaa ggtggcgcgg ggtaaactgg gaaagtgatg 420 tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata agtgcagtag 480 tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggtt ggaccggtgc 540 caccatggac tata 554 <210> 6 <211> 447 <212> DNA <213> Artificial Sequence <400> 6 ccagaacaca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 60 ggatcatgat attgattaca aagacgatga cgataagatg gcccccaaaa agaaacgaaa 120 ggtgggtggg tccccaaaga agaagcggaa ggtcggtatc cacggagtcc cagcagccga 180 caagaagtac agcatcggcc tggacatcgg caccaactct gtgggctggg ccgtgatcac 240 cgacgagtac aaggtgccca gcaagaaatt caaggtgctg ggcaacaccg accggcacag 300 catcaagaag aacctgatcg gagccctgct gttcgacagc ggcgaaacag ccgaggccac 360 ccggctgaag agaaccgcca gaagaagata caccagacgg aagaaccgga tctgctatct 420 gcaagagatc ttcagcaacg agatggc 447 <210> 7 <211> 2727 <212> DNA <213> Artificial Sequence <400> 7 cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa gggcggctcc aagcggcctg 60 ccgcgacgaa gaaagcggga caggccaaga aaaagaaagg atccggcgca acaaacttct 120 ctctgctgaa acaagccgga gatgtcgaag agaatcctgg accggtgagc aagggcgagg 180 agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 240 agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 300 tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 360 acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 420 ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 480 acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 540 agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 600 acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 660 agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 720 cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 780 ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 840 ccgccgggat cactctcggc atggacgagc tgtacaaggg ctccggcgag ggcaggggaa 900 gtcttctaac atgcggggac gtggaggaaa atcccggccc aaccgagtac aagcccacgg 960 tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg 1020 ccgactaccc cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg 1080 agctgcaaga actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg 1140 acgacggcgc cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt 1200 tcgccgagat cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac 1260 agatggaagg cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg 1320 tcggagtctc gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag 1380 tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc 1440 tccccttcta cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac 1500 cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaac gcgttaagtc gacaatcaac 1560 ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt gctcctttta 1620 cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc cgtatggctt 1680 tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag ttgtggcccg 1740 ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc actggttggg 1800 GCGTCGGCGGAACTCATCGCCGCCTGCCTTGCCC GCTGCTGGACAGGGGCTCGGCTGTTGGGCA 1800 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 CCTGGATTCTGC GCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG 2040 ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 2580 aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 2640 acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 2700 tggcctgcag gggcgcctga tgcggta 2727 <210> 8 <211> 410 <212> DNA <213> Artificial Sequence <400> 8 gataaacatg tgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 60 ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 120 cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 180 tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 240 tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 300 gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 360 ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccatag 410 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 agttatggca gaactcagtg 20 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 caccgagtta tggcagaact cagtg 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <400> 11 aaaccactga gttctgccat aactc 25 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <400> 12 ccccatccaa agtttttaaa gga 23 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <400> 13 tgtggcagat gtcacagttt agg 23 <210> 14 <211> 100 <212> RNA <213> Artificial Sequence <400> 14 aguuauggca gaacucagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 15 <211> 339 <212> PRT <213> 猪(Sus scrofa) <400> 15 Met Gly Arg Gly Asp Trp Gly Gly Pro Gly Gln Thr Leu Thr Glu Gly 1 5 10 15 Ala Gln Gly Trp Val Trp Val His Arg Trp Gln Gly Gln Val Ser Tyr 20 25 30 Val Ala Ser Ala Ala Pro Leu Ala Val Gly Pro Thr Glu Trp Ala Trp 35 40 45 Leu Pro Gly Pro Gly Ala Gly Pro Gly Ala Cys Pro Gly Gln Gly Ala 50 55 60 Arg Cys Gly Asp Glu Pro Ala Ala Gly Glu Leu Ala Arg Glu Ala Glu 65 70 75 80 Glu Gly Leu Phe Thr Tyr Val Phe Arg Pro Ser Gln His Thr Arg Ser 85 90 95 Arg Gln Val Thr Ser Ala Gln Leu Trp Phe His Thr Gly Leu Asp Arg 100 105 110 Gln Gly Met Ala Ala Ala Asn Ser Ser Gly Pro Leu Leu Asp Leu Leu 115 120 125 Ala Leu Ser Ser Arg Gly Pro Val Ala Val Pro Met Ser Leu Gly Gln 130 135 140 Ala Pro Pro Arg Trp Ala Val Leu His Leu Ala Ala Ser Ala Leu Pro 145 150 155 160 Leu Leu Thr His Pro Val Leu Val Leu Leu Leu Arg Cys Pro Leu Cys 165 170 175 Ser Cys Ser Ala Arg Pro Glu Ala Thr Pro Phe Leu Val Ala His Thr 180 185 190 Arg Ala Arg Pro Pro Ser Gly Gly Glu Arg Ala Arg Arg Ser Thr Ala 195 200 205 Pro Leu Pro Trp Pro Trp Ser Pro Ala Ala Leu Arg Leu Leu Gln Arg 210 215 220 Pro Pro Glu Glu Pro Ala Val His Ala Asp Cys His Arg Ala Ser Leu 225 230 235 240 Asn Ile Ser Phe Gln Glu Leu Gly Trp Asp Arg Trp Ile Val His Pro 245 250 255 Pro Ser Phe Ile Phe His Tyr Cys His Gly Gly Cys Gly Leu Pro Thr 260 265 270 Leu Pro Asn Leu Pro Leu Ser Val Pro Gly Ala Pro Pro Thr Pro Val 275 280 285 Gln Pro Leu Leu Leu Val Pro Gly Ala Gln Pro Cys Cys Ala Ala Leu 290 295 300 Pro Gly Thr Met Arg Ser Leu Arg Val Arg Thr Thr Ser Asp Gly Gly 305 310 315 320 Tyr Ser Phe Lys Tyr Glu Thr Val Pro Asn Leu Leu Thr Gln His Cys 325 330 335 Ala Cys Ile <210> 16 <211> 1034 <212> DNA <213> Pig (Sus scrofa) <400> 16 gcaggctcct gagtggcagc cagatcctgc ctgttgagga ggaggggtcc caggttctgc 60 cagtcagggc tgccctctcc cttccttctg cctcctgcag gtgcccgctg tggggacgag 120 ccagctgctg gagagctggc ccgggaggct gaggagggcc tcttcacata tgtattccgg 180 ccgtcccagc acacacgcag ccgccaggtg acttcagctc agctgtggtt ccacacggga 240 ctggacagac aggggatggc agccgccaat agctctgggc ccctgctgga cctgctggca 300 CTATCATCCA GGGGTCCTGT GGCTGTGCCC ATGTCACCGG CCAGGCACCC CCCTCGCTGG 360 GCTGTGCTGC CCTGGCCGCC TCTGCCCTCC CTTGTTGACC CCACCCAGTC CTGgtgctg 420 CTGCTGCgCT GTCCTCTCTG TTCCTGCTCA GCCCggcccg AGGCCCACCCC TTCCTGgtg 480 GCCCACACTC GGGCCAGGCC ACCCAGCGGA GGGGGAGAGG GCCCGACGCT CCACCgcccc 540 TCTGCCCTGG CCTTGGTCCC CCGCCGCgCT GCgcctgctg CAGAGGCCCC CGGAGGAACC 600 CGCTGTGCAC GCCGACTGCC ACAGAGCTTC CCTCAACATC TCCTTCCAGG AGCTGGGCTG 660 GGACCgGTGG ATCGTGCACC CTCCCAGTTT CATCTTCCAC TACTGTCACG GGGGCTGCgg 720 GCTGCCGACC CTGCCCAGCC CTGCCCCTGTC GTGTCCCTGG GGCCCCCTAC CCCTGTCCA 780 GCCCCTGTTC TTGgtgccag GGGCTCAGCC CTGCTGCgCT GCTCTCCCgg GACCATGAG 840 GTCCCTACGC GTTCGCACCA CCTCggatgg AGGTTACTCT TTCAAGTACG AGACAGTGCC 900 CAACCTTCTC ACCCAGCACC TGTGCCTGCA TCTAAGGgtG TCCCGCTGgt GGCCAAGCTC 960 CACAGGCACC AGCCTGGAGG AAGGCAGAGT TCCCACCTCC CCTTTCCTTC CGCCTCTCCG 1020 cctggaggct cccc 1034 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 ctgcgctgtc ctctctgttc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 agtgctgggt gagaaggttg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 cctctgcagc aggcgcagcg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <400> 20 cctgctgcag aggcccccgg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <400> 21 gtggcagtcg gcgtgcacag 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <400> 22 agatgttgag ggaagctctg 20 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <400> 23 caccgcctct gcagcaggcg cagcg 25 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <400> 24 aaaccgctgc gcctgctgca gaggc 25 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <400> 25 caccgcctgc tgcagaggcc cccgg 25 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <400> 26 aaacccgggg gcctctgcag caggc 25 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <400> 27 caccgtggca gtcggcgtgc acag 24 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <400> 28 aaacctgtgc acgccgactg ccac 24 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <400> 29 caccgagatg ttgagggaag ctctg 25 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <400> 30 aaaccagagc ttccctcaac atctc 25 <210> 31 <211> 100 <212> RNA <213> Artificial Sequence <400> 31 ccucugcagc aggcgcagcg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 32 <211> 100 <212> RNA <213> Artificial Sequence <400> 32 ccugcugcag aggcccccgg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 33 <211> 100 <212> RNA <213> Artificial Sequence <400> 33 guggcagucg gcgugcacag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 34 <211> 100 <212> RNA <213> Artificial Sequence <400> 34 agauguugag ggaagcucug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
Claims
1. A CRISPR / Cas9 system for pig INHA gene editing, characterized in that The invention comprises a Cas9 expression vector and a gRNA expression vector, wherein the molar ratio of the gRNA expression vector to the Cas9 expression vector is 3:1; the Cas9 expression vector is a pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector having a full plasmid sequence as shown in SEQ ID NO.2; the gRNA expression vector expresses a gRNA having a full sequence as shown in SEQ ID NO:31; the gRNA expression vector uses the pKG-U6gRNA having a full sequence as shown in SEQ ID NO.3 as a vector backbone; and the gRNA expression vector is obtained by cloning a double-stranded DNA molecule with sticky ends obtained by annealing the single-stranded DNAs shown in SEQ ID NO:23 and SEQ ID NO:24 into a pKG-U6gRNA backbone vector.
2. Use of the CRISPR / Cas9 system according to claim 1 in constructing INHA gene knockout cloned porcine nuclear donor cells.
3. A recombinant porcine fibroblast, characterized in that Obtained after verification of co-transfection of porcine primary fibroblasts by the CRISPR / Cas9 system according to claim 1.
4. Use of the recombinant porcine fibroblasts according to claim 3 in constructing INHA gene knockout cloned pigs.
Citation Information
Patent Citations
Interference vector for improving animal fertility
CN102409064A