3-(Benzenesulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives

Abstract

The present invention relates to a compound according to formula (I), wherein R1 and R5 are independently selected from H, halogen, hydroxyl, NO2, CN, C1-C6 alkyl optionally substituted by one or more R11, C1-C6 alkoxy optionally substituted by one or more R11, C3-C6 cycloalkyl optionally substituted by one or more R11, n Alkyl-N(R12)(R13), where n=0-3, -C n Alkyl-C(O)N(R12)(R13), wherein n=0-3, -SO2-N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, where n=0-3, -C n Alkyl-C(O)-OR16, where n=0-3, -O(C1-C3 alkyl-O) m -C1-C3 alkyl-OR10, where m=0-3, -C n Alkyl-OR16, where n=0-3, -NH-C n Alkyl-R18, where n=0-3; -O-C n alkyl-R18, wherein n=0-3; -OPO(OR10)2, -PO(OR10)2, and a heterocycle optionally substituted by one or more R17; R3 is selected from H, halogen, hydroxyl, NO2, CN, C1-C6 alkyl optionally substituted by one or more R11, C1-C6 alkoxy optionally substituted by one or more R11, C3-C6 cycloalkyl optionally substituted by one or more R11, -C n Alkyl-N(R12)(R13), where n=0-3, -C n Alkyl-C(O)N(R12)(R13), wherein n=0-3, -SO2-N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, where n=0-3, -C n Alkyl-C(O)-OR16, where n=0-3, -O(C1-C3 alkyl-O) m -C1-C3 alkyl-OR10, where m=0-3, -C n Alkyl-OR16, where n=0-3, -NH-C n Alkyl-R18, where n=0-3; -O-C nR18 is an alkyl group, wherein n=0-3; OPO(OR10)2, PO(OR10)2, and a heterocycle optionally substituted by one or more R17; R2 and R4 are independently selected from H, halogen, C1-C6 alkyl optionally substituted by one or more R11; R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO2, CN, C1-C6 alkyl optionally substituted by one or more R11, C1-C6 alkoxy optionally substituted by one or more R11, C3-C6 cycloalkyl optionally substituted by one or more R11, n Alkyl-N(R12)(R13), where n=0-3, -C n Alkyl-C(O)N(R12)(R13), wherein n=0-3, -SO2-N(R12)(R13), -SO2-N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, where n=0-3, -C n Alkyl-C(O)-OR16, where n=0-3, -O(C1-C3 alkyl-O) m -C1-C3 alkyl-OR10, where m=0-3, -C n Alkyl-OR16, where n=0-3, -NH-C n Alkyl-R18, where n=0-3; -O-C n wherein R12 and R13 are together with the nitrogen to which they are attached form a heterocycle optionally substituted by one or more R17; wherein the one or more R17 are independently selected from halogen, hydroxy, NO2, CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C nAlkyl-OR16, wherein n=0-3, C1-C6 alkyl optionally substituted by one or more R11, and C1-C6 alkoxy optionally substituted by one or more R11; R18 is selected from N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a heterocycle optionally substituted by one or more R17; and wherein at least one of R1, R2, R4, R5, R6, R7, R8 or R9 is not H; and pharmaceutically acceptable salts, stereoisomers, enantiomers, tautomers of the compound of formula (I) and pharmaceutical compositions thereof and their use in methods for reducing the virulence of bacteria expressing AgrA, in methods for preventing or treating diseases caused or exacerbated by bacteria, preferably Staphylococcus aureus (Staphylococcus aureus), such as skin or lung infections or atopic dermatitis.

Description

[0001] The present invention relates to 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives and pharmaceutical compositions thereof, as well as their use in methods for reducing the virulence of bacteria expressing accessory gene regulator A (AgrA) or an ortholog of AgrA, in methods for inhibiting quorum sensing in bacteria, preferably in Staphylococcus aureus, and in methods for preventing or treating a disease caused or aggravated by bacteria, preferably Staphylococcus aureus, in a subject (such as skin or lung infection, atopic dermatitis or psoriasis). Therefore, the present invention relates to compositions and methods for treating, ameliorating and / or preventing diseases caused or aggravated by bacteria, preferably Staphylococcus aureus, and more specifically to compositions and methods for reducing the virulence of bacteria expressing AgrA or an ortholog of AgrA, preferably AgrA. Background Art

[0002] Staphylococcus aureus is both a human comorbidity and a notorious opportunistic pathogen, causing serious community-acquired and hospital-acquired infections. Staphylococcus aureus can cause a variety of infections ranging from mild superficial skin infections to severe systemic life-threatening conditions such as endocarditis, pneumonia or sepsis (Lee AS et al. (2018) Nat Rev Dis Primers, Vol. 4, Article 18033 pp. 1-23 (doi: 10.1038 / nrdp.2018.33). In addition, Staphylococcus aureus has also been associated with allergic skin conditions such as atopic dermatitis (Geoghegan JA et al. (2018) Trends in Microbiology The success of S. aureus in causing multiple diseases is due to the development of a broad repertoire of virulence factors combined with resistance to β-lactams and, for most clones, resistance to other antibiotic classes. Antibiotic-associated resistance has developed to nearly every antibiotic that has been adopted clinically, while the discovery and development of new antibiotic classes has lagged behind, leading to the antibiotic resistance crisis we face today. Therefore, alternative strategies for treating or preventing S. aureus-mediated bacterial infections that are also effective against multidrug-resistant strains such as methicillin-resistant S. aureus (MRSA) are needed (Dickey SW et al. (2017) Nat Rev Drug Discov 16(7):457-471).

[0003] One of these strategies is the anti-virulence approach, which targets only features associated with virulence, rather than features associated with survival / health. Compared to common antibiotic therapy, anti-virulence drugs themselves are not bacteriostatic (inhibit bacterial growth) or bactericidal (kill bacteria). This approach focuses on ultimately interfering with bacterial pathogenicity mechanisms by blocking expression or neutralizing its virulence factors, and thus promoting the removal of pathogens by the host immune system, thereby disarming pathogenic bacteria. Because anti-virulence drugs do not interfere with the basic mechanisms of bacterial growth and survival, they are thought to reduce the pressure on pathogens to develop resistance. Another advantage is that specific anti-virulence drugs can protect healthy host microbiota, and can even eventually help resist microbial flora imbalance by reducing the invasiveness of pathogens (such as Staphylococcus aureus). . Importantly, the anti-virulence approach provides an increased reservoir of pharmacological targets and thus has the potential to generate alternative antimicrobial agents with novel modes of action (Mühlen S & Dersch P (2016) Curr Top Microbiol Immunol 398: 147-183).

[0004] How to regulate the virulence factors of Staphylococcus aureus: The agr operon is a bacterial quorum sensing system that controls the cell density-dependent expression of virulence factors of Staphylococcus aureus. It consists of two different promoters, P2 and P3, of which P2 is responsible for producing the components of the quorum sensing system, AgrB, D, C, and A, see Figure 1). The precursor peptide AgrD is processed by AgrB to form a mature autoinducing peptide (AIP), which is secreted on the bacterial cell membrane. AIP binds to the histidine kinase AgrC and activates the transcriptional regulator AgrA by driving the expression of P2 and P3 via phosphorylation. There are four allelic variants of agr (types I-IV), each encoding a different AIP that acts as a specific ligand for the AgrC of its own cell, but as an inhibitor of other AgrC variants. P3 produces the agr effector molecule RNAIII, which together with AgrA is responsible for the transcriptional control of approximately 200 genes, including a variety of virulence factors and metabolic pathways involved in stationary phase growth (Khan BA et al. (2015) Expert Opin Investig Drugs 24(5):689-704). Examples of virulence factors regulated by AgrA are cell surface associated proteins such as protein A (SpA) and fibronectin binding protein, secreted toxins such as α-hemolysin / α-toxin (Hla), δ-hemolysin (Hld), phenol-soluble regulatory protein (PSM), Panton-Valentine leukocidin (PVL), leukotoxin E and D (LukED), leukotoxin G and H (LukGH) or secreted proteases such as SspA or metalloproteinases. Taken together, the numerous and multifunctional virulence determinants make the pathogenesis of S. aureus particularly complex and provide the pathogen with a range of mechanisms to damage the host or circumvent and escape host immune defenses. It is important to note that most AgrA-regulated virulence factors are responsible for the pathogenicity of S. aureus in skin and soft tissue infections (SSTIs), lung infections, and have also been shown to contribute to chronic inflammatory skin diseases such as atopic dermatitis (Oliveira D et al. (2018) Toxins 10:252 (DOI: 10.3390 / toxins10060252); Geoghegan JA et al. (2018) Advances in Microbiology 26(6):484-497).

[0005] How we prevent virulence factor expression: Inhibition of central regulatory RNAIII expression and inhibition of PSMα production are thought to result in an effective overall reduction in virulence factor levels (see Figure 1 Current strategies for inhibiting RNAIII expression can be divided into different categories: (1) competitive inhibitors of the histidine kinase AgrC, (2) RNAIII transcription inhibitors (the precise mechanism is still uncertain), and (3) inhibition of the AgrA-P2 / P3 interaction. Targeting AgrA has the advantage of blocking the expression of AgrA-dependent virulence factors for all four agr groups (Gordon CP et al. (2013) J Med Chem 56(4):1389-404).

[0006] Recently, in the context of studies related to acute bacterial skin and soft tissue infections caused by Staphylococcus aureus, Sully and colleagues discovered an AgrA inhibitor called Savirin among 24'087 compounds selected for inhibition of agr induced by cyclic thiolactone pheromone (AIP) (Sully EK et al. (2014) PLoS Pathog 10(6):e1004174). Savirin was shown to be a potent regulator of AgrA-regulated toxin gene transcription in all four agr groups, such as hla, psmα and pvl, without affecting the viability of S. aureus. Savirin inhibited exotoxin-induced red blood cell (RBC) lysis. No resistance was developed after multiple passages with Savirin. The molecule was shown to interfere with AgrA-DNA interactions, thereby preventing virulence gene upregulation. It was observed that when Savirin was applied multiple times, abscess size and skin necrosis were significantly reduced in mice infected with the MRSAUSA300 strain.

[0007] Despite the recent findings, there remains a great need for methods of reducing the virulence of bacteria, preferably S. aureus, expressing AgrA and / or inhibiting quorum sensing in bacteria, preferably S. aureus, thereby preventing or treating bacterial infections and / or diseases caused or exacerbated by bacteria, preferably S. aureus, such as skin or lung infections, atopic dermatitis or psoriasis. Summary of the invention

[0008] Now, we have unexpectedly identified a series of novel compounds that can interact with AgrA and inhibit the expression of virulence factors regulated by AgrA. Specifically, it has been demonstrated by qRT-PCR that the compounds of the present invention can reduce the expression of RNAIII, which is the most central regulatory RNA that controls the expression of most virulence factors (such as α-hemolysin). By qRT-PCR, we have demonstrated that the expression of psmα is significantly reduced by the compounds of the present invention. The compounds of the present invention are more effective than saverin in reducing the expression of RNAIII and psmα. In addition, incubation of MRSA with the compounds of the present invention and AgrA inhibitors, respectively, leads to the prevention of damage to red blood cells (RBCs) monitored by hemolysis assays. The compounds of the present invention are more effective than saverin in preventing RBC lysis. The compounds of the present invention are typically not antibacterial and non-cytotoxic to mammalian cells, and therefore, the compounds of the present invention are classified as anti-virulence inhibitors, i.e., compounds that regulate the content of virulence factors of bacteria, preferably Staphylococcus aureus, but do not directly inhibit the growth of bacteria or kill bacteria.

[0009] In a first aspect, the present invention provides a pharmaceutical composition comprising at least one compound according to formula (I)

[0010]

[0011] in

[0012] R1 and R5 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0013] R3 is selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C nAlkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0014] R2 and R4 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 6 alkyl;

[0015] R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R12)(R13), -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0016] R10 is selected from H and C optionally substituted by one or more R11 1 -C 6 alkyl;

[0017] The one or more R11 are independently selected from Cl, F and hydroxyl;

[0018] R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -SO optionally substituted with one or more R11 2 -C 1 -C 6 Alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a heterocyclic ring optionally substituted with one or more R17;

[0019] The one or more R17 are independently selected from halogen, hydroxyl, NO 2 , CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C n Alkyl-OR16, wherein n=0-3, optionally substituted by one or more R11 1 -C 6 alkyl, and C optionally substituted by one or more R11 1 -C 6 Alkoxy;

[0020] R18 is selected from N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a heterocycle optionally substituted with one or more R17; and

[0021] wherein at least one of R1, R2, R4, R5, R6, R7, R8 or R9 is not H;

[0022] and pharmaceutically acceptable salts, stereoisomers, enantiomers, and tautomers of the compounds of formula (I).

[0023] In another aspect, the present invention provides a compound of formula (I)

[0024]

[0025] in

[0026] R1 and R5 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0027] R3 is selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0028] R2 and R4 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 6 alkyl;

[0029] R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R12)(R13), -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0030] R10 is selected from H and C optionally substituted by one or more R11 1 -C 6 alkyl;

[0031] The one or more R11 are independently selected from Cl, F and hydroxyl;

[0032] R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -SO optionally substituted with one or more R11 2 -C 1 -C 6 Alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a heterocyclic ring optionally substituted with one or more R17;

[0033] The one or more R17 are independently selected from halogen, hydroxyl, NO 2 , CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C n Alkyl-OR16, wherein n=0-3, optionally substituted by one or more R11 1 -C 6 alkyl, and C optionally substituted by one or more R11 1 -C 6 Alkoxy;

[0034] R18 is selected from N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a heterocycle optionally substituted with one or more R17; and

[0035] wherein at least one of R1, R2, R4, R5, R6, R7, R8 or R9 is not H; and

[0036] The condition is

[0037] If R3 is methyl and R1 is methyl, then at least one of R2, R4 to R9 is not H;

[0038] If R3 is methyl and R1 is methyl and R5 is methyl, then at least one of R2, R4, R6 to R9 is not H;

[0039] If R3 is methyl and R2 is methyl, then R7 is not Cl;

[0040] If R3 is methyl and R7 is Cl, then at least one of R1, R2, R4, R5, R6, R8, R9 is not H;

[0041] If R3 is methyl and R7 and R8 are both methoxy, then at least one of R1, R2, R4 to R6, R9 is not H;

[0042] If R3 is Cl and R7 and R8 are both methoxy, then at least one of R1, R2, R4 to R6, R9 is not H;

[0043] If R3 is F and R7 is methyl, then at least one of R1, R2, R4 to R6, R9 is not H;

[0044] If R3 is methyl and R2 is methyl, then at least one of R1, R4 to R9 is not H;

[0045] If R3 is ethyl and R7 is Cl, at least one of R1, R2, R4 to R6, R8 to R9 is not H;

[0046] If R3 is methoxy and R2 is methoxy, then at least one of R1, R4 to R9 is not H;

[0047] If R1 is Cl and R3 is Cl, then at least one of R2, R4 to R9 is not H;

[0048] and pharmaceutically acceptable salts, stereoisomers, enantiomers, and tautomers of the compounds of formula (I).

[0049] The present invention therefore provides di-, tri- or polysubstituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, preferably di- and tri-substituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, wherein, in addition to the 4-position or para-position (R3) of the benzene ring bonded to the sulfonyl group, at least one further substituent is present on the benzene ring or on the benzene ring of the quinazoline part and is not hydrogen.

[0050] In another aspect, the present invention provides a compound according to formula (I) for use in a method for reducing the virulence of a bacterium, preferably a bacterium expressing AgrA or an orthologue of AgrA, preferably AgrA, and further preferably a bacterium selected from the genera Staphylococcus, Streptococcus, Clostridium, more preferably Staphylococcus, and yet further preferably Staphylococcus aureus,

[0051]

[0052] in

[0053] R1 and R5 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0054] R3 is selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0055] R2 and R4 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 6 alkyl;

[0056] R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -Cn Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R12)(R13), -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0057] R10 is selected from H and C optionally substituted by one or more R11 1 -C 6 alkyl;

[0058] The one or more R11 are independently selected from Cl, F and hydroxyl;

[0059] R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -SO optionally substituted with one or more R11 2 -C 1 -C 6 Alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a heterocyclic ring optionally substituted with one or more R17;

[0060] The one or more R17 are independently selected from halogen, hydroxyl, NO 2 , CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C nAlkyl-OR16, wherein n=0-3, optionally substituted by one or more R11 1 -C 6 alkyl, and C optionally substituted by one or more R11 1 -C 6 Alkoxy;

[0061] R18 is selected from N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a heterocycle optionally substituted with one or more R17; and

[0062] wherein at least one of R1, R2, R4, R5, R6, R7, R8 or R9 is not H;

[0063] and pharmaceutically acceptable salts, stereoisomers, enantiomers, and tautomers of the compounds of formula (I).

[0064] In another aspect, the present invention provides a compound according to formula (I) for use in a method for preventing or treating a disease caused or exacerbated by bacteria, preferably an infection or an inflammatory disease, further preferably a bacterial infection or an inflammatory skin disease, wherein preferably the bacteria is selected from Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and further preferably wherein the bacteria is Staphylococcus aureus,

[0065]

[0066] in

[0067] R1 and R5 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0068] R3 is selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0069] R2 and R4 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 6 alkyl;

[0070] R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R12)(R13), -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0071] R10 is selected from H and C optionally substituted by one or more R11 1 -C 6 alkyl;

[0072] The one or more R11 are independently selected from Cl, F and hydroxyl;

[0073] R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -SO optionally substituted with one or more R11 2 -C 1 -C 6Alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a heterocyclic ring optionally substituted with one or more R17;

[0074] The one or more R17 are independently selected from halogen, hydroxyl, NO 2 , CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C n Alkyl-OR16, wherein n=0-3, optionally substituted by one or more R11 1 -C 6 alkyl, and C optionally substituted by one or more R11 1 -C 6 Alkoxy;

[0075] R18 is selected from N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a heterocycle optionally substituted with one or more R17; and

[0076] wherein at least one of R1, R2, R4, R5, R6, R7, R8 or R9 is not H;

[0077] and pharmaceutically acceptable salts, stereoisomers, enantiomers, and tautomers of the compounds of formula (I).

[0078] Further aspects and embodiments of the invention will become apparent as the description proceeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] Figure 1 Quorum sensing signaling is shown in staphylococci to control virulence factor production. The precursor peptide AgrD is processed by AgrB, and the mature autoinducing peptide (AIP) is secreted on the bacterial cell membrane. AIP binds to the histidine kinase AgrC on its own cells or other bacterial cells. Then, AgrC activates the response regulator AgrA by means of phosphorylation. Phospho-AgrA binds and activates the transcription of the promoter of agr P2 and P3 promoters and psm operons (independent of AgrA regulation of RNAIII). The classical targets of AgrA are controlled by RNAIII dependency, including several toxins and proteases that are upregulated, and several surface-bound proteins that are downregulated, such as protein A. Small molecule inhibitors that bind to the DNA-binding domain of AgrA prevent binding to the P2 and P3 promoters, thereby blocking the continuous production of AIP (P2 drive) and virulence factors (P3 drive), and also blocking the expression of AgrA regulation independent of RNAIII, such as the production of PSM.

[0080] Figure 2The chemical shift perturbations observed upon binding of the compounds to AgrAc are shown. Recorded in the absence (grey) or presence (black) of 1.6 mM of compound 34 of the invention 15 N-AgrAc (100 μM) 1 H, 15 N-HSQC spectrum. Addition of compound 34 resulted in perturbations in the chemical shifts of the backbone amides corresponding to several residues at the C-terminus of the protein. These perturbations clearly showed the interaction between compound 34 and AgrAc. DETAILED DESCRIPTION

[0081] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by ordinary technicians in the field to which the present invention belongs. The embodiments, preferred embodiments and very preferred embodiments described and disclosed herein should be applicable to all aspects and other embodiments, preferred embodiments and very preferred embodiments, regardless of being specifically mentioned again or avoiding repetition for brevity.

[0082] As used herein, the articles "a" and "an" refer to one or more than one (ie, at least one) of the grammatical objects of the article. Unless the context clearly indicates otherwise, the term "or" used herein should be understood to mean "and / or".

[0083] As used herein, “C 1 -C 6 "Alkyl" refers to a straight or branched chain C 1 -C 6 Alkyl, i.e. containing 1, 2, 3, 4, 5 or 6 carbon atoms, may be, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, straight-chain or branched pentyl, straight-chain or branched hexyl. 1 -C 6 Alkyl is C 1 -C 4 Alkyl, and further preferably C 1 -C 3 alkyl.

[0084] As used herein, “C n "alkyl" (depending on the value of n) refers to a bond if n=0, and to a straight or branched hydrocarbon chain if n is non-zero, and thus C n Alkyl refers to C 1 -C 6 Alkyl is defined as a straight chain or branched hydrocarbon.

[0085] As used herein, “C 1 -C 6"Alkoxy" refers to a "substituted hydroxy" group of the formula (-OR') wherein R' is an optionally substituted C 1 -C 6 The alkyl group is a C alkyl group, and the oxygen moiety is directly attached to the parent molecule, and thus as used herein, the term "C 1 -C 6 "Alkoxy" refers to a straight or branched chain C 1 -C 6 Alkoxy, which may be, for example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, straight-chain or branched pentyloxy, straight-chain or branched hexyloxy. Preferred C 1 -C 8 Alkoxy is C 1 -C 4 Alkoxy.

[0086] As used herein, "halogen" refers to fluorine (F, -F), chlorine (Cl, -Cl), bromine (Br, -Br) and iodine (I, -I). Preferably, it refers to fluorine, chlorine or bromine. Accordingly, this also applies to halogen in combination with other meanings (such as haloalkyl).

[0087] As used herein, “C 1 -C 6 "-haloalkyl" refers to a C group as defined above which is substituted by one or more halogen atoms (preferably one, two or three halogen atoms, preferably fluorine or chlorine atoms). 1 -C 6 Preferably, C 1 -C 8 -Haloalkyl is a C-substituted group substituted with one, two or three fluorine or chlorine atoms. 1 -C 4 Preferred examples include difluoromethyl, trifluoromethyl, chlorodifluoromethyl and 2,2,2-trifluoroethyl, most preferably trifluoromethyl.

[0088] As used herein, the term "cycloalkyl" refers to a monocyclic or bicyclic form, typically and preferably a monocyclic form, and preferably contains 3 to 8 carbon atoms, more preferably 3 to 6 carbon atoms. Specific and preferred examples of monocyclic cycloalkyl groups include cyclopropyl, cyclobutyl and cyclohexyl. Therefore, as used herein, the term "C 3 -C 6 "Cycloalkyl" refers to a monocyclic form containing 3 to 6 carbon atoms, and specifically refers to cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl.

[0089] As used herein, the term "aryl" refers to a C 6 -C 14 Monocyclic or polycyclic aromatic groups, such as phenyl or naphthyl, anthracenyl or phenanthryl, preferably C6 -C 14 Monocyclic aryl, and most preferably refers to phenyl.

[0090] As used herein, the term "heterocycle" refers to an aromatic partially saturated or fully saturated 4 to 14-membered ring system containing 1 to 4 heteroatoms selected from nitrogen, oxygen and sulfur, with the proviso that each ring system cannot contain more than 2 oxygen atoms and more than 2 sulfur atoms. As used herein, the heterocycle may be a single ring or two or more fused rings, at least one of which contains a heteroatom. Preferably, as used herein, the term "heterocycle" refers to an aromatic partially saturated or fully saturated 5 to 7-membered, preferably 4 to 6-membered monocyclic ring system containing 1 to 4 heteroatoms selected from nitrogen, oxygen and sulfur, with the proviso that each ring system cannot contain more than 2 oxygen atoms and more than 2 sulfur atoms. Typical and preferred examples of the monocyclic aromatic heterocycle of the present invention include pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, furanyl, oxadiazolyl, oxazolyl, imidazolyl, thiazolyl, thiadiazolyl, thienyl, pyran, pyrrolyl, pyridyl, triazolyl, tetrazolyl, imidazolidinyl and pyrazolyl. Typical and preferred examples of the monocyclic partially saturated or fully saturated heterocycle of the present invention include azetidine, oxetane, dioxolane, pyrrolidine, pyrrolidin-2-one, piperidine, morpholine, piperazine, homopiperazine, tetrahydropyran.

[0091] Where a group is said to be optionally substituted, preferably there are optionally 1-5 substituents, more preferably optionally 1-3 substituents, again more preferably optionally 1 or 2 substituents, and most preferably optionally 1 substituent. Where a group is said to be optionally substituted, and where there is more than one substituent for said optional substitution of said group, said more than one substituent may be the same or different.

[0092] As used herein, the term "ortholog" represents the well-known meaning of this term. In the art, orthologs are genes in different species that evolved from a common ancestral gene. Due to their separation after the speciation event, orthologs can diverge, but usually have similarities at the sequence and structural levels; In addition, orthologs usually have the same function. Orthologous homology is a type of homology. In this application, the term ortholog is used to include ortholog genes (DNA or RNA) or peptide / protein products of orthologs. Sometimes the peptide / protein product of an ortholog is referred to as "ortholog product" or simply "ortholog". The meaning is obvious from the context (e.g., an anti-toxic composition of the invention may include an anti-toxic agent capable of reducing the toxicity of a bacterium expressing a peptide or protein, which may be referred to as an ortholog of AgrA, i.e., the product of an ortholog gene of Staphylococcus aureus AgrA from another bacterium, such as Streptococcus pyogenes). In certain aspects, an ortholog of AgrA produces a protein / peptide that shares greater than about 70%, about 80%, or about 90% identity with the amino acid sequence of the gene product of AgrA.

[0093] The terms "reduce" and "inhibit" have their generally understood meanings of alleviating or decreasing.

[0094] As used herein, the expression "reducing the virulence of bacteria expressing AgrA" typically and preferably refers to inhibiting the synthesis of one or more virulence factors by the compound of formula (I) of the present invention or the composition of the present invention, preferably a pharmaceutical composition, comprising the compound of formula (I) of the present invention. Examples of virulence factors regulated by AgrA are cell surface-associated proteins such as protein A (SpA) and fibronectin binding protein, secreted toxins such as α-hemolysin / α-toxin (Hla), δ-hemolysin (Hld), phenol-soluble regulatory protein (PSM), Panton-Valentine leukocidin (PVL), leukotoxin E and D (LukED), leukotoxin G and H (LukGH) or secreted proteases such as SspA or metalloproteases. In preferred examples and embodiments of the present invention, the virulence of bacteria expressing AgrA is reduced by inhibiting the synthesis of one or more virulence factors selected from PSMα, RNAIII and its downstream targets. In preferred examples and embodiments of the present invention, the reduction of virulence of bacteria expressing AgrA is to inhibit the synthesis of PSMα. In preferred examples and embodiments of the present invention, the reduction of virulence of bacteria expressing AgrA is to inhibit the synthesis of RNAIII and / or its downstream targets, preferably RNAIII.

[0095] As used herein, the term "inhibiting the synthesis of one or more virulence factors" shall mean completely or partially inhibiting (preferably greater than 20%, further preferably greater than 30%, further preferably greater than 50%, further preferably greater than 90%, even more preferably greater than 95% or even greater than 99%) the synthesis of one or more virulence factors compared to the synthesis of one or more virulence factors by the bacteria in the absence of the compound of formula (I) of the present invention or the composition of the present invention, preferably the pharmaceutical composition, of the present invention, or compared to the method of the present invention in which such compound of formula (I) of the present invention or the composition of the present invention, preferably the pharmaceutical composition, is not applied or used.

[0096] Virulence factors as considered herein include any molecule expressed and secreted by bacteria to promote colonization and / or adhesion in a host subject, promote inflammation in host tissues, promote evasion of host immune responses, and obtain nutrition from a host subject. Virulence factors may also include exotoxins and endotoxins. As described herein, non-limiting examples of virulence factors inhibited by the compounds of formula (I) of the present invention or the compositions of the present invention comprising the compounds of formula (I) of the present invention, preferably the pharmaceutical compositions of the present invention, include one or more toxins (e.g., α, β, γ, γ-variants and δ hemolysins, PSMs (e.g., PSMα), Panton-Valentine leukocidin (PVL), leukotoxins E and D (LukED), leukotoxins G and H (LukGH), enterotoxins (e.g., enterotoxin B), exfoliative toxins), proteases (e.g., serine proteases, metalloproteases, and cysteine ​​proteases), nucleases, lipases, coagulase, hyaluronidase, fibronectin binding protein, agglutination factors, pyrogenic toxin superantigens (e.g., TSST-1). In a preferred embodiment, the virulence factor inhibited is RNAIII and / or its downstream targets or PSMα.

[0097] Anti-virulence drugs may be combined with therapeutic agents, such as antibiotics, which are typically and preferably used to prevent and treat infections caused by bacteria, such as Staphylococcus spp., primarily Staphylococcus aureus.

[0098] Anti-virulence drugs may be combined with therapeutic agents typically and preferably used to prevent and treat chronic inflammatory skin diseases (eg, atopic dermatitis) exacerbated by bacteria, such as Staphylococcus spp., primarily Staphylococcus aureus.

[0099] As used herein, the term "antibiotic" refers to an antimicrobial or anti-infective agent that kills bacteria (bactericidal antibiotics) or inhibits the growth and / or metabolism of bacteria (bacteriostatic antibiotics). Antibiotics are well known to those skilled in the art, and specific and preferred examples thereof include penicillins, cephalosporins, polymyxins, rifamycins, intercalary mycins, quinolones, sulfonamides, macrolides, oxazolidinones, lincosamides and tetracyclines.

[0100] As used herein, the terms "treating," "treatment," or "therapy" refer to means of obtaining a desired physiological effect. The effect may be therapeutic, in the sense of partially or completely curing a disease or condition and / or the symptoms attributable to the disease or condition. The term refers to inhibiting a disease or condition, i.e., preventing its development; or relieving a disease or condition, i.e., causing regression of the disease or condition.

[0101] As used herein, the term "prevent" or "preventing" means preventing or delaying the onset of a disease or condition and / or symptoms attributable to a disease or condition.

[0102] As described herein, the compounds of formula (I) of the present invention, the pharmaceutical compositions of the present invention comprising the compounds of formula (I) of the present invention can be used for the preventive and therapeutic treatment of diseases caused or exacerbated by bacteria, preferably infections or inflammatory diseases, further preferably bacterial infections or inflammatory skin diseases, wherein preferably the bacteria are selected from Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and further preferably wherein the bacteria is Staphylococcus aureus.

[0103] As used herein, the term "subject" or "animal" or "patient" or "mammal" refers to any subject for which diagnosis, prognosis, prevention or treatment is desired, particularly a mammalian subject, such as a human or a domesticated mammal (such as a dog, cat or horse) or a food animal (such as a cow, sheep or pig), preferably a human. Therefore, in a preferred embodiment of the present invention, the subject is a human.

[0104] The term "pharmaceutically acceptable" or "therapeutically acceptable" refers to a material that does not interfere with the effectiveness or biological activity of the active ingredients and is non-toxic to the host.

[0105] "Pharmaceutically acceptable salts" of compounds of formula (I) means salts that are pharmaceutically acceptable and have the desired pharmacological activity of the parent compound. For example, the salt may be an acid addition salt. An example of an acid addition salt is a hydrochloride. Pharmaceutically acceptable salts can be synthesized from a parent compound containing a basic or acidic moiety by conventional chemical methods. In general, such salts can be prepared by reacting the free acid or base form of these compounds with a stoichiometric amount of an appropriate base or acid in water or in an organic solvent or in a mixture of the two; in general, non-aqueous media (such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile) are preferred. A list of salts can be found in Remington's Pharmaceutical Sciences, 18th edition. (Mack Publishing Company, 1990).

[0106] As used herein, the term "for" as used in "a composition for treating or preventing a disease" shall also disclose the corresponding treatment or prevention method and the corresponding use for the manufacture of a preparation for treating or preventing a disease.

[0107] "Therapeutically effective amount" is the amount of a compound or pharmaceutical composition according to the invention that will cause a biological or medical response in a subject (preferably a human subject) sought by a researcher, veterinarian, physician or other clinician. As used herein, the term "therapeutic administration" shall refer to the administration of a therapeutically effective amount. Specifically, as used herein, the terms "effective", "effective amount" and "therapeutically effective amount" typically and preferably refer to the amount of a compound of formula (I) of the invention or a composition of the invention comprising a compound of formula (I) of the invention, preferably a pharmaceutical composition of the invention, the compound of formula (I) reducing the virulence of bacteria or causing symptom relief or prolonging the survival of a subject suffering from a bacterial-related disease or condition. The term "effective amount" is generally used herein to refer to the amount of a given compound, or in the case of a mixture, to refer to the combined amount of the components of the mixture that provide a measurable effect for the listed function. One of ordinary skill in the art will understand that for a given application, the effective amount can be determined by applying routine experiments without undue experimentation by methods described herein or known in the art. The term "effective amount" is generally used herein to refer to the amount of a given compound, or in the case of a mixture, or in the case of a mixture, to the combined amount of the components of the mixture that, when administered to an individual, including a human or non-human animal, provides a measurable therapeutic effect on the listed disease, disorder or condition to at least partially alleviate the symptoms of such disease, disorder or condition. The result of treatment can be partial or complete alleviation, inhibition, prevention, amelioration and / or relief of the disorder, condition or one or more symptoms thereof.

[0108] In a first aspect, the present invention provides a compound of formula (I)

[0109]

[0110] in

[0111] R1 and R5 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0112] R3 is selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C nAlkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0113] R2 and R4 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 6 alkyl;

[0114] R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R12)(R13), -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0115] R10 is selected from H and C optionally substituted by one or more R11 1 -C 6 alkyl;

[0116] The one or more R11 are independently selected from Cl, F and hydroxyl;

[0117] R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -SO optionally substituted with one or more R11 2 -C 1 -C 6 Alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a heterocyclic ring optionally substituted with one or more R17;

[0118] The one or more R17 are independently selected from halogen, hydroxyl, NO 2 , CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C n Alkyl-OR16, wherein n=0-3, optionally substituted by one or more R11 1 -C 6 alkyl, and C optionally substituted by one or more R11 1 -C 6 Alkoxy;

[0119] R18 is selected from N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a heterocycle optionally substituted with one or more R17; and

[0120] wherein at least one of R1, R2, R4, R5, R6, R7, R8 or R9 is not H;

[0121] and pharmaceutically acceptable salts, stereoisomers, enantiomers, and tautomers of the compounds of formula (I).

[0122] In one embodiment, if R3 is methyl and R1 is methyl, at least one of said R2, R4 to R9 is not H. In another embodiment, if R3 is methyl and R1 is methyl and R5 is methyl, at least one of said R2, R4, R6 to R9 is not H. In another embodiment, if R3 is methyl and R2 is methyl, then R7 is not Cl. In another embodiment, if R3 is methyl and R7 is Cl, at least one of R1, R2, R4, R5, R6, R8 to R9 is not H. In another embodiment, if R3 is methyl and R7 and R8 are both methoxy, then at least one of R1, R2, R4 to R6, R9 is not H. In another embodiment, if R3 is Cl and R7 and R8 are both methoxy, then at least one of R1, R2, R4 to R6, R9 is not H. In another embodiment, if R3 is F and R7 is methyl, then at least one of R1, R2, R4 to R6, R9 is not H. In another embodiment, if R3 is methyl and R2 is methyl, then at least one of R1, R4 to R9 is not H. In another embodiment, if R3 is ethyl and R7 is Cl, then at least one of R1, R2, R4 to R6, R8, R9 is not H. In another embodiment, if R3 is methoxy and R2 is methoxy, then at least one of R1, R4 to R9 is not H. In another embodiment, if R1 is Cl and R3 is Cl, then at least one of R2, R4 to R9 is not H.

[0123] The present invention therefore provides di-, tri- or polysubstituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, preferably di- and tri-substituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, wherein, in addition to the 4-position or para-position (R3) of the benzene ring bonded to the sulfonyl group, at least one further substituent is present on the benzene ring or on the benzene ring of the quinazoline part and is not hydrogen.

[0124] In another preferred embodiment, one, two, three, four or five of R1, R2 and R4 to R9 are independently not H, and wherein the other of R1, R2 and R4 to R9 are independently H. In another preferred embodiment, one, two, three or four of R1, R2 and R4 to R9 are independently not H, and wherein the other of R1, R2 and R4 to R9 are independently H. In another preferred embodiment, one, two or three of R1, R2 and R4 to R9 are independently not H, and wherein the other of R1, R2 and R4 to R9 are independently H. In a further preferred embodiment, one or two of R1, R2 and R4 to R9 are independently not H, and wherein the other of R1, R2 and R4 to R9 are independently H.

[0125] Therefore, in a preferred embodiment, the present invention provides di-, tri-, tetra- or penta-substituted 3-(benzenesulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives. In a preferred embodiment, the present invention provides di-, tri- or tetra-substituted 3-(benzenesulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives. In another preferred embodiment, the present invention provides di- and tri-substituted 3-(benzenesulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives. In another preferred embodiment, one, two, three or four of said R1, R2 and R4 to R9 are independently not H, and thus said di-, tri- or tetra-substitution is selected from (i) one of said R1, R2, R4 and R5 is independently not H; (ii) one of said R6, R7, R8 and R9 is independently not H; (iii) one of said R1, R2, R4 and R5 is independently not H, and one of said R6, R7, R8 and R9 is independently not H; (IV) two of said R6, R7, R8 and R9 are independently not H; (v) one of said R1, R2, R4 and R5 is independently not H, and two of said R6, R7, R8 and R9 are independently not H, and (vi) two of said R1, R2, R4 and R5 are independently not H, and two of said R6, R7, R8 and R9 are independently not H. In another preferred embodiment, one or two of said R1, R2 and R4 to R9 are independently not H, and thus said di- and said di- and tri-substitutions are selected from (i) one of said R1, R2, R4 and R5 is independently not H; (ii) one of said R6, R7 R8 and R9 is independently not H; (iii) one of said R1, R2, R4 and R5 is independently not H and one of said R6, R7, R8 and R9 is independently not H; (iv) one of said R1, R2, R4 and R5 is independently not H, and two of said R6, R7, R8 and R9 are independently not H, (v) two of said R6, R7, R8 and R9 are independently not H. In another preferred embodiment, one or two of said R1, R2 and R4 to R9 are independently not H, and thus said di- and said di- and tri-substitutions are selected from (i) one of said R1, R2, R4 and R5 is independently not H; (ii) one of said R6, R7, R8 and R9 is independently not H; (iii) one of said R1, R2, R4 and R5 is independently not H, and one of said R6, R7, R8 and R9 is independently not H; and (iv) two of said R6, R7, R8 and R9 are independently not H.

[0126] Thus, in a preferred embodiment, the present invention provides di-, tri-, tetra- or penta-substituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives wherein, in addition to the 4 or para position (R3) of the phenyl ring bonded to the sulfonyl group, one or two further substituents are present on the phenyl ring and / or none, and one or two substituents are present on the phenyl ring of the quinazoline moiety and are not H. In a preferred embodiment, the present invention provides di- and tri-substituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, wherein in addition to the 4 or para position (R3) of the benzene ring bonded to the sulfonyl group, there is one additional substituent on the benzene ring or on the benzene ring of the quinazoline portion and is not hydrogen, or there is one additional substituent on the benzene ring and on the benzene ring of the quinazoline portion, or there are two substituents on the benzene ring of the quinazoline portion and are not H.

[0127] In another preferred embodiment, said one or two of R1, R2 and R4 to R9 are independently not H, selected from (i) one of R1, R2, R4 and R5 is independently not H; (ii) one of R6, R7, R8 and R9 is independently not H; (iii) one of R1, R2, R4 and R5 is independently not H, and one of R6, R7, R8 and R9 is independently not H.

[0128] In another preferred embodiment, at least one of R1, R2, R4 and R5 is not H. In another very preferred embodiment, one or two of R1, R2, R4, R5 are not H, and the others of R1, R2, R4, R5 are H. In another very preferred embodiment, exactly one of R1, R2, R4, R5 is not H, and the others of R1, R2, R4, R5 are H.

[0129] Therefore, these preferred embodiments of the present invention provide di-, tri- or polysubstituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives in which at least two, preferably two or three, further preferably exactly two substituents are present on the phenyl ring bonded to the sulfonyl group and are not hydrogen.

[0130] In another preferred embodiment, said R1 or R5 is not H. In another preferred embodiment, one of said R1 and said R5 is H, wherein the other of said R1 and said R5 is not H. Thus, when R1 is H, then R5 is not H, and when R5 is H, then R1 is not H.

[0131] Therefore, these preferred embodiments of the present invention provide di-, tri- or polysubstituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, wherein in addition to the 4 or para position (R3) of the phenyl ring bonded to the sulfonyl group, there is at least one, preferably one, additional substituent on the phenyl ring that is not hydrogen and is located in the ortho position (R1 or R5). For these preferred embodiments, the two ortho positions (R1 and R5) are indistinguishable.

[0132] In another very preferred embodiment, one of said R1, R2, R4 and R5 is independently not H, and wherein the other of said R1, R2, R4 and R5 is H, and wherein said R6 to R9 are H. In another very preferred embodiment, one of said R1 and R5 is independently not H, and the other of said R1 and R5 is H, and wherein said R2, R4 and R6 to R9 are H. Thus, when R1 is H, then R5 is not H, and when R5 is H, then R1 is not H.

[0133] These preferred embodiments of the invention provide disubstituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, wherein in addition to the 4 or para position (R3) of the phenyl ring bonded to the sulfonyl group, there is one additional substituent on the phenyl ring and is not hydrogen, and the additional substitution is in the ortho position (R1 or R5), and wherein the phenyl ring of the quinazoline moiety is unsubstituted. For these preferred embodiments, the two ortho positions (R1 and R5) are indistinguishable.

[0134] In another very preferred embodiment, at least one of said R6 to R9 is not H. In another preferred embodiment, exactly one of said R6 to R9 is not H.

[0135] Thus, these preferred embodiments of the invention provide di-, tri- or polysubstituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, wherein in addition to the 4 or para position (R3) of the phenyl ring bonded to the sulfonyl group, at least one, preferably exactly one, further substituent is present on the phenyl ring of the quinazoline moiety and is not hydrogen. In another very preferred embodiment, one of said R6, R7, R8 and R9 is independently not H, and wherein the other of said R6, R7, R8 and R9 is H, and wherein said R1, R2, R4 and R5 are H.

[0136] In another very preferred embodiment, one of said R6, R7, R8 and R9 is not H, and the other of said R6, R7, R8 and R9 is H, and wherein at least one, preferably one or two, and further preferably exactly one of said R1, R2, R4 and R5 is not H. In another preferred embodiment, at least two of said R1, R2, R4, R5, R6, R7, R8 or R9 are not H. In another very preferred embodiment, exactly two of said R1, R2, R4, R5, R6, R7, R8 or R9 are not H. In another very preferred embodiment, at least one of said R1, R2, R4, R5 is not H, and at least one of said R6 to R9 is not H.

[0137] Therefore, these preferred embodiments of the present invention provide tri- or polysubstituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, preferably di- and tri-substituted 3-(phenylsulfonyl)-[1,2,3]triazolo[1,5a]quinazolin-5(4H)-one derivatives, wherein in addition to the 4 or para position (R3) of the phenyl ring bonded to the sulfonyl group, there are at least two, preferably exactly two substituents which are not hydrogen, and at least one further substituent is present on the phenyl ring or on the phenyl ring of the quinazoline moiety and is not hydrogen.

[0138] In another preferred embodiment, said R1 or R5 is not H, and at least one of said R6 to R9 is not H. In another very preferred embodiment, said R1 or R5 is not H, and exactly one of said R6 to R9 is not H. In another very preferred embodiment, exactly one of R1 and R5 is H, wherein the other of said R1 and R5 is not H. In another very preferred embodiment, exactly one of R1 and R5 is H, wherein the other of said R1 and R5 is not H, and wherein at least one of said R6 to R9 is not H. In yet another very preferred embodiment, said R2 and R4 are H, and wherein exactly one of R1 and R5 is H, wherein the other of said R1 and R5 is not H, and wherein at least one of said R6 to R9 is not H. In another very preferred embodiment, one of said R1 and R5 is independently not H, and wherein one of said R6, R7, R8 and R9 is independently not H, and wherein the other of said R1 and R5 is H, and wherein the other of said R6, R7, R8 and R9 is H.

[0139] In another very preferred embodiment, said R1 and said R5 are independently selected from H, C optionally substituted with one or more R11 1 -C 6 Alkyl, halogen or C 1 -C6 In another very preferred embodiment, said R1 and R5 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 3 alkyl, C optionally substituted by one or more R11 1 -C 3 In another very preferred embodiment, said R1 and said R5 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 3 Alkyl, or C 1 -C 3 Alkoxy.

[0140] In another very preferred embodiment, said R1 and said R5 are independently selected from H, halogen, C 1 -C 3 Alkyl, CF 3 or C 1 -C 3 In another very preferred embodiment, R1 and R5 are independently selected from H, halogen, methyl, ethyl, CF 3 , methoxy and isopropoxy.

[0141] In another very preferred embodiment, said R1 and said R5 are independently selected from H, methyl, ethyl, CF 3 In another very preferred embodiment, said R1 and said R5 are independently selected from H, methyl, ethyl, CF 3 In another very preferred embodiment, said R1 and said R5 are independently selected from H, methyl, ethyl, CF 3 In another very preferred embodiment, said R1 and said R5 are independently selected from methyl, ethyl, CF 3 , F, Cl or Br, wherein the other of said R1 and said R5 is H.

[0142] In another very preferred embodiment, said R1 or said R5 is independently hydrogen.

[0143] In another very preferred embodiment, said R1 or said R5 is independently methyl.

[0144] In another very preferred embodiment, said R1 or said R5 is independently ethyl.

[0145] In another very preferred embodiment, said R1 or said R5 is independently CF 3 .

[0146] In another very preferred embodiment, said R1 or said R5 is independently F.

[0147] In another very preferred embodiment, said R1 or said R5 is independently Cl.

[0148] In another very preferred embodiment, said R1 or said R5 is independently Br.

[0149] In another very preferred embodiment, said R1 or said R5 is independently methoxy.

[0150] In another very preferred embodiment, one of said R1 and R5 is independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 3 alkyl, C optionally substituted by one or more R11 1 -C 3 Alkoxy, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 3 Alkyl, or C 1 -C 3 Alkoxy, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is independently selected from H, halogen, C 1 -C 3 Alkyl, CF 3 or C 1 -C 3 Alkoxy, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is independently selected from H, halogen, methyl, ethyl, CF 3 , methoxy and isopropoxy, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is independently selected from H, methyl, ethyl, CF 3 , F, Cl, Br or methoxy, and wherein the other of R1 and R5 is H.

[0151] In another very preferred embodiment, said R1 or said R5 is independently hydrogen. In another very preferred embodiment, said R1 is hydrogen. In another very preferred embodiment, said R5 is hydrogen. In another very preferred embodiment, one of said R1 and R5 is independently methyl, and wherein the other of said R1 and R5 is H. In another very preferred embodiment, one of said R1 and R5 is independently ethyl, and wherein the other of said R1 and R5 is H. In another very preferred embodiment, one of said R1 and R5 is independently CF 3 , and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is independently F, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is independently Cl, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is independently Br, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is independently methoxy, and wherein the other of R1 and R5 is H.

[0152] In another very preferred embodiment, said R1 and said R5 are independently selected from H, halogen and C optionally substituted with one or more R11. 1 -C 2 In another very preferred embodiment, said R1 and said R5 are independently selected from H, Cl, Br and C optionally substituted by one or more R11 1 -C 2 In another very preferred embodiment, said R1 and said R5 are independently selected from H, Cl, Br and C optionally substituted by one or more halogens. 1 -C 2 In another very preferred embodiment, said R1 and said R5 are independently selected from H, Cl, Br and C optionally substituted with one or more F 1 -C 2 In another very preferred embodiment, said R1 and said R5 are independently selected from H, Cl, Br and CH 3 and CF 3 In another very preferred embodiment, one of said R1 and said R5 is independently selected from Cl, Br and CH 3 and CF 3 , and the other of said R1 and said R5 is H.

[0153] In another very preferred embodiment, one of said R1 or R5 is independently selected from C optionally substituted with one or more R11 1 -C 6 Alkyl, halogen or C 1 -C 6 alkoxy, and wherein the other of R1 or R5 is H, and wherein at least one of R6 to R9 is not H. In another very preferred embodiment, one of R1 or R5 is independently selected from C optionally substituted by one or more R11 1 -C 3 Alkyl, halogen or C 1 -C 3 Alkoxy, and wherein the other of R1 or R5 is H, and wherein at least one of R6 to R9 is not H. In another very preferred embodiment, R1 and R5 are independently selected from H, Cl, Br and C optionally substituted with one or more F. 1 -C 2 alkyl, and wherein at least one of said R6 to R9 is not H. In another very preferred embodiment, said R1 and said R5 are independently selected from H, Cl, Br and CH 3 and CF 3 , and wherein at least one of R6 to R9 is not H.

[0154] In another very preferred embodiment, one of said R1 or R5 is independently selected from C 1 -C 3 Alkyl, CF 3 , halogen or C 1 -C 2 Alkoxy, and wherein the other of R1 or R5 is H, and wherein at least one of R6 to R9 is not H. In another very preferred embodiment, R1 or R5 is selected from Cl, Br and C optionally substituted by one or more F 1 -C 2 alkyl, and the other of said R1 and R5 is H, and at least one of said R6 to R9 is not H. In another very preferred embodiment, said R1 and said R5 are independently selected from H, Cl, Br, CH 3 and CF 3 , and wherein at least one of R6 to R9 is not H. In another very preferred embodiment, one of R1 or R5 is selected from Cl, Br, CH 3 and CF 3 , and the other of said R1 and said R5 is H, and wherein at least one of said R6 to R9 is not H.

[0155] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 or R5 is independently selected from C optionally substituted with one or more R11 1 -C 6 Alkyl, halogen or C 1 -C 6 Alkoxy, and wherein the other of R1 or R5 is H, and wherein at least one, preferably exactly one, of R6 to R9 is not H.

[0156] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 or R5 is independently selected from C optionally substituted with one or more R11 1 -C 3 Alkyl, halogen or C 1 -C 3 Alkoxy, and wherein the other of R1 or R5 is H, and wherein at least one, preferably exactly one, of R6 to R9 is not H.

[0157] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 or R5 is independently selected from C 1 -C 3 Alkyl, CF 3 , halogen or C 1 -C 2 Alkoxy, and wherein the other of R1 or R5 is H, and wherein at least one, preferably exactly one, of R6 to R9 is not H.

[0158] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 or R5 is independently selected from methyl, ethyl, CF 3 , F, Cl, Br or methoxy, and wherein the other of R1 or R5 is H, and wherein at least one, preferably exactly one, of R6 to R9 is not H.

[0159] In another very preferred embodiment, said R2 and R4 are H, and wherein said R1 and said R5 are independently selected from H, Cl, Br and C optionally substituted with one or more F. 1 -C 2 alkyl, and wherein at least one of said R6 to R9 is not H. In another very preferred embodiment, said R2 and R4 are H, and wherein said R1 and said R5 are independently selected from H, Cl, Br and CH 3 and CF 3, and wherein at least one of said R6 to R9 is not H. In another very preferred embodiment, said R2 and R4 are H, and wherein said R1 or said R5 is selected from Cl, Br and C optionally substituted by one or more F 1 -C 2 alkyl, and the other of said R1 and R5 is H, and wherein at least one, preferably one or two, further preferably exactly one of said R6 to R9 is not H. In another very preferred embodiment, said R2 and R4 are H, and wherein said R1 and said R5 are independently selected from H, Cl, Br, CH 3 and CF 3 , and wherein at least one, preferably one or two, further preferably exactly one of R6 to R9 is not H. In another very preferred embodiment, R2 and R4 are H, and wherein one of R1 or R5 is selected from Cl, Br, CH 3 and CF 3 , and the other of said R1 and said R5 is H, and wherein at least one, preferably one or two, further preferably exactly one of said R6 to R9 is not H.

[0160] In another very preferred embodiment, one of said R1 or R5 is independently selected from C optionally substituted with one or more R11 1 -C 6 Alkyl, halogen or C 1 -C 6 Alkoxy, and wherein the other of R1 or R5 is H, and wherein exactly one of R6 to R9 is not H.

[0161] In another very preferred embodiment, one of said R1 or R5 is independently selected from C optionally substituted with one or more R11 1 -C 3 Alkyl, halogen or C 1 -C 3 Alkoxy, and wherein the other of R1 or R5 is H, and wherein exactly one of R6 to R9 is not H.

[0162] In another very preferred embodiment, one of said R1 or R5 is independently selected from C 1 -C 3 Alkyl, CF 3 , halogen or C 1 -C 2 Alkoxy, and wherein the other of R1 or R5 is H, and wherein exactly one of R6 to R9 is not H.

[0163] In another very preferred embodiment, one of said R1 or R5 is independently selected from methyl, ethyl, CF 3 , F, Cl, Br or methoxy, and wherein the other of R1 or R5 is H, and wherein one of R6 to R9 is not H.

[0164] In another very preferred embodiment, said R2 is H.

[0165] In another very preferred embodiment, said R4 is H.

[0166] In another very preferred embodiment, said R2 and said R4 are H.

[0167] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 or R5 is independently selected from C optionally substituted with one or more R11 1 -C 6 Alkyl, halogen or C 1 -C 6 Alkoxy, and wherein the other of R1 or R5 is H, and wherein exactly one of R6 to R9 is not H.

[0168] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 or R5 is independently selected from C optionally substituted with one or more R11 1 -C 3 Alkyl, halogen or C 1 -C 3 Alkoxy, and wherein the other of R1 or R5 is H, and wherein exactly one of R6 to R9 is not H.

[0169] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 or R5 is independently selected from C 1 -C 3 Alkyl, CF 3 , halogen or C 1 -C 2 Alkoxy, and wherein the other of R1 or R5 is H, and wherein exactly one of R6 to R9 is not H.

[0170] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 or R5 is independently selected from methyl, ethyl, CF 3 , F, Cl, Br or methoxy, and wherein the other of R1 or R5 is H, and wherein exactly one of R6 to R9 is not H.

[0171] In another very preferred embodiment, said R1, R2, R4 and R5 are H, and wherein at least one of said R6 to R9 is not H, and wherein preferably at least one of said R6 to R9 is not H.

[0172] In another very preferred embodiment, said R1, R2, R4 and R5 are H, and wherein exactly one of said R6 to R9 is not H.

[0173] In another preferred embodiment, said R3 is selected from halogen, CN, C optionally substituted by one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl-C(O)N(R12)(R13), wherein n=0-3, -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted by one or more R17, wherein preferably the heterocycle is aromatic, partially saturated or fully saturated, and contains 1 to 4 nitrogen heteroatoms and up to one oxygen atom.

[0174] In another preferred embodiment, R3 is selected from halogen, CN, C optionally substituted by one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, Cn Alkyl-C(O)N(R12)(R13), wherein n=0-3; -Cnalkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a 4 to 6 heterocyclic ring optionally substituted by one or more R17, wherein the heterocyclic ring is aromatic, partially saturated or fully saturated, and contains 1 to 4 nitrogen heteroatoms and up to one oxygen atom.

[0175] In another very preferred embodiment, said R3 is selected from halogen, CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C(O)N(R12)(R13); -N(R14)-C(O)-R15; -C(O)-OR16; -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a 4 to 6 membered heterocyclic ring optionally substituted with one or more R17, wherein the heterocyclic ring is aromatic and contains 1 to 4 nitrogen heteroatoms and up to one oxygen atom.

[0176] In another very preferred embodiment, said R3 is selected from halogen, CN, C optionally substituted with one or more R11 1 -C 3 alkyl, C optionally substituted by one or more R11 1 -C 3 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C(O)N(R12)(R13); -N(R14)-C(O)-R15; -C(O)-OR16; -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl -OR10, where m = 0-3, -OR16; -NH-C n Alkyl-R18 wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a 4 to 6 membered heterocyclic ring optionally substituted with one or more R17, wherein the heterocyclic ring is aromatic and contains 1 to 4 nitrogen heteroatoms and up to one oxygen atom.

[0177] In another very preferred embodiment, said R3 is selected from halogen, CN, C optionally substituted with one or more R11 1 -C 3 alkyl, C optionally substituted by one or more R11 1 -C 3 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C(O)N(R12)(R13); -N(R14)-C(O)-R15; -C(O)-OR16; -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl -OR10, where m = 0-3, -OR16, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2, and a 4 to 6 membered heterocyclic ring optionally substituted by one or more R17, wherein the heterocyclic ring is aromatic and contains 1 to 4 nitrogen heteroatoms and up to one oxygen atom, and wherein the R10 is H or methyl.

[0178] In another very preferred embodiment, said R3 is selected from F, Cl, Br, CN, C optionally substituted with one or more F or hydroxyl groups. 1 -C 3 alkyl, C optionally substituted with one or more F 1 -C 3 Alkoxy, C 3 -C 6 Cycloalkyl, -C(O)N(R12)(R13), -N(R14)-C(O)-R15, -C(O)-OR16, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl -OR10, where m = 0-3, -OR16, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a 4 to 6 membered heterocyclic ring optionally substituted by one or more R17, wherein the heterocyclic ring is aromatic and contains 1 to 4 nitrogen heteroatoms and up to one oxygen atom, and wherein preferably the R10 is H or methyl.

[0179] In another very preferred embodiment, said R3 is selected from F, Cl, Br, CN, C optionally substituted with one or more F or hydroxyl groups. 1 -C 3 alkyl, C optionally substituted with one or more F 1 -C 3 Alkoxy, C 3 -C 6 Cycloalkyl, -C(O)N(R12)(R13), -N(R14)-C(O)-R15, -C(O)-OR16, and a 4- to 6-membered heterocycle optionally substituted with one or more R17, wherein the heterocycle is aromatic and contains 1 to 4 nitrogen heteroatoms and up to one oxygen atom.

[0180] In another very preferred embodiment, said R3 is selected from F, Cl, Br, CN, C optionally substituted with one or more F or hydroxyl groups. 1 -C 3 alkyl, C optionally substituted with one or more F 1-C 3 Alkoxy, C 3 -C 5 Cycloalkyl, -C(O)N(R12)(R13), -N(R14)-C(O)-R15, and a 5- to 6-membered heterocyclic ring optionally substituted with one or more R17, wherein the heterocyclic ring is aromatic and contains 1 to 4 nitrogen heteroatoms.

[0181] In another very preferred embodiment, R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, OCF 3 , cyclopropyl, -C(O)NH 2 、-NHCOCH 3 、-C(O)OC 2 H 5 , 5-methyltriazolyl, triazolyl and tetrazolyl.

[0182] In another very preferred embodiment, R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, -NHCOCH 3 and cyclopropyl.

[0183] In another very preferred embodiment, R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy and cyclopropyl.

[0184] In another very preferred embodiment, said R3 is selected from methyl, ethyl, isopropyl, C optionally substituted with one or more R11 3 -C 5 In another very preferred embodiment, R3 is selected from methyl, ethyl, isopropyl, C 3 -C 5 In another very preferred embodiment, said R3 is selected from methyl, ethyl, isopropyl and cyclopropyl. In another very preferred embodiment, said R3 is selected from methyl, ethyl and cyclopropyl.

[0185] In another very preferred embodiment, said R3 is F.

[0186] In another very preferred embodiment, said R3 is Cl.

[0187] In another very preferred embodiment, said R3 is Br.

[0188] In another very preferred embodiment, said R3 is CN.

[0189] In another very preferred embodiment, said R3 is methyl.

[0190] In another very preferred embodiment, said R3 is ethyl.

[0191] In another very preferred embodiment, said R3 is isopropyl.

[0192] In another very preferred embodiment, said R3 is CF 3 .

[0193] In another very preferred embodiment, said R3 is methoxy.

[0194] In another very preferred embodiment, said R3 is isopropoxy.

[0195] In another very preferred embodiment, R3 is OCF 3 .

[0196] In another very preferred embodiment, said R3 is cyclopropyl.

[0197] In another very preferred embodiment, said R3 is -C(O)NH 2 .

[0198] In another very preferred embodiment, said R3 is -NHCOCH 3 .

[0199] In another very preferred embodiment, said R3 is -C(O)OC 2 H 5 .

[0200] In another very preferred embodiment, said R3 is triazolyl.

[0201] In another very preferred embodiment, said R3 is 5-methyltriazolyl.

[0202] In another very preferred embodiment, said R3 is tetrazolyl.

[0203] In another very preferred embodiment, said R1 and said R5 are independently selected from H, C optionally substituted with one or more R11 1 -C 3 Alkyl, halogen or C 1 -C 3 Alkoxy, and said R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, OCF 3 , cyclopropyl, -C(O)NH 2 、-NHCOCH 3 、C(O)OC2 H 5 , 5-methyltriazolyl, triazolyl and tetrazolyl.

[0204] In another very preferred embodiment, said R1 and said R5 are independently selected from H, C 1 -C 3 Alkyl, CF 3 , halogen or C 1 -C 2 Alkoxy, and said R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, -NHCOCH 3 and cyclopropyl.

[0205] In another very preferred embodiment, said R1 and said R5 are independently selected from H, methyl, ethyl, CF 3 , F, Cl, Br or methoxy, and R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy and cyclopropyl.

[0206] In another very preferred embodiment, said R1 or said R5 is selected from Cl, Br and C optionally substituted with one or more F. 1 -C 2 wherein the other of R1 and R5 is H, and wherein R3 is selected from methyl, ethyl, isopropyl, C optionally substituted with one or more R11 3 -C 5 In another very preferred embodiment, said R1 and said R5 are independently selected from H, Cl, Br, CH 3 and CF 3 , and wherein R3 is selected from methyl, ethyl, isopropyl, C 3 -C 5 In another very preferred embodiment, one of said R1 or said R5 is selected from Cl, Br, CH 3 and CF 3 , and wherein the other of said R1 and said R5 is H, and wherein said R3 is selected from methyl, ethyl, isopropyl and cyclopropyl, and wherein preferably said R3 is selected from methyl, ethyl and cyclopropyl.

[0207] In another very preferred embodiment, said R1 and said R5 are independently selected from H, C optionally substituted with one or more R11 1 -C 3 Alkyl, halogen or C 1 -C 3Alkoxy, wherein R2 and R4 are H, and wherein R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, OCF 3 , cyclopropyl, -C(O)NH 2 、-NHCOCH 3 、C(O)OC 2 H 5 , triazolyl and tetrazolyl.

[0208] In another very preferred embodiment, said R1 and said R5 are independently selected from H, C 1 -C 3 Alkyl, CF 3 , halogen or C 1 -C 2 Alkoxy, wherein R2 and R4 are H, and wherein R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, -NHCOCH 3 and cyclopropyl.

[0209] In another very preferred embodiment, said R1 and said R5 are independently selected from H, methyl, ethyl, CF 3 , F, Cl, Br or methoxy, said R2 and R4 are H, and said R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy and cyclopropyl.

[0210] In another very preferred embodiment, said R1 or said R5 is selected from Cl, Br and C optionally substituted with one or more F. 1 -C 2 alkyl, and wherein the other of R1 and R5 is H, said R2 and R4 are H, and wherein said R3 is selected from methyl, ethyl, isopropyl, C optionally substituted with one or more R11 3 -C 5 In another very preferred embodiment, said R1 and said R5 are independently selected from H, Cl, Br, CH 3 and CF 3 , and said R2 and R4 are H, and wherein said R3 is selected from methyl, ethyl, isopropyl, C 3 -C 5 In another very preferred embodiment, one of said R1 or said R5 is selected from Cl, Br, CH 3 and CF 3, and wherein the other of said R1 and said R5 is H, and said R2 and R4 are H, and wherein said R3 is selected from methyl, ethyl, isopropyl and cyclopropyl, and wherein preferably said R3 is selected from methyl, ethyl and cyclopropyl.

[0211] In another very preferred embodiment, said R10 is H or methyl.

[0212] In another very preferred embodiment, said R11 is independently selected from F and hydroxyl. In another very preferred embodiment, said R11 is independently Cl. In another very preferred embodiment, said R11 is independently F. In another very preferred embodiment, said R11 is independently hydroxyl.

[0213] In another preferred embodiment, R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted by one or more R11 1 -C 3 alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a 4-6 membered heterocyclic ring optionally substituted by one or more R17. In another very preferred embodiment, said R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted by one or more F and hydroxyl. 1 -C 3 alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a 4-6 membered heterocyclic ring optionally substituted by one or more R17. In another highly preferred embodiment, said R12 is independently selected from H, C optionally substituted by one or more F and hydroxyl. 1 -C 3 alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a 4-6 membered heterocyclic ring optionally substituted by one or more R17. In another highly preferred embodiment, said R13 is independently selected from H, C optionally substituted by one or more F and hydroxyl. 1 -C 3 alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a 4-6 membered heterocyclic ring optionally substituted by one or more R17. In another highly preferred embodiment, said R14 is independently selected from H, C optionally substituted by one or more F and hydroxyl. 1 -C 3 In another very preferred embodiment, said R15 is independently selected from H, C optionally substituted with one or more F and hydroxyl. 1 -C 3 In another very preferred embodiment, said R16 is independently selected from H, C optionally substituted with one or more F and hydroxyl. 1 -C 3alkyl.

[0214] In another preferred embodiment, the one or more R17 are independently selected from halogen, CN, N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C n Alkyl-OR16, wherein n=0-3, optionally substituted by one or more R11 1 -C 3 alkyl, and C optionally substituted by one or more R11 1 -C 3 In another very preferred embodiment, the one or more R17 are independently selected from C optionally substituted by one or more R11 1 -C 3 alkyl, and C optionally substituted by one or more R11 1 -C 3 In another very preferred embodiment, the one or more R17 are independently selected from C optionally substituted with one or more F 1 -C 3 Alkyl, and C 1 -C 3 In another very preferred embodiment, the one or more R17 are independently selected from C 1 -C 3 Alkyl and C 1 -C 3 Alkoxy.

[0215] In another preferred embodiment, the R18 is selected from -N(R12)(R13), -OR10 and a 4-6 membered heterocycle optionally substituted by one or more R17.

[0216] In another very preferred embodiment, R1, R2, R4 and R5 are H, and wherein R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, OCF 3 , cyclopropyl, -C(O)NH 2 、-NHCOCH 3 、-C(O)OC 2 H 5 and triazolyl and tetrazolyl, and wherein at least one of R6 to R9 is not H.

[0217] In another very preferred embodiment, R1, R2, R4 and R5 are H, and wherein R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, OCF 3, cyclopropyl, -C(O)NH 2 、-NHCOCH 3 、-C(O)OC 2 H 5 and triazolyl and, and wherein exactly one of said R6 to R9 is not H.

[0218] In another very preferred embodiment, R1, R2, R4 and R5 are H, and wherein R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, -NHCOCH 3 and cyclopropyl, and wherein at least one of said R6 to R9 is not H.

[0219] In another very preferred embodiment, R1, R2, R4 and R5 are H, and wherein R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy, -NHCOCH 3 and cyclopropyl, and wherein exactly one of said R6 to R9 is not H.

[0220] In another very preferred embodiment, R1, R2, R4 and R5 are H, and wherein R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy and cyclopropyl, and wherein at least one of R6 to R9 is not H.

[0221] In another very preferred embodiment, R1, R2, R4 and R5 are H, and wherein R3 is selected from F, Cl, Br, CN, methyl, ethyl, isopropyl, CF 3 , methoxy, isopropoxy and cyclopropyl, and wherein exactly one of said R6 to R9 is not H.

[0222] In another very preferred embodiment, said R1, R2, R4 and R5 are H, and wherein R3 is cyclopropyl, and wherein at least one of said R6 to R9 is not H.

[0223] In another very preferred embodiment, said R1, R2, R4 and R5 are H, and wherein R3 is cyclopropyl, and wherein exactly one of said R6 to R9 is not H.

[0224] In another very preferred embodiment, said R1, R2, R4 and R5 are H, and wherein R3 is isopropyl, and wherein at least one of said R6 to R9 is not H.

[0225] In another very preferred embodiment, said R1, R2, R4 and R5 are H, and wherein R3 is isopropyl, and wherein exactly one of said R6 to R9 is not H.

[0226] In another very preferred embodiment, said R6, R7, R8 and R9 are independently selected from H, halogen, CN, C optionally substituted with one or more F or hydroxyl. 1 -C 3 alkyl, C optionally substituted with one or more F 1 -C 3 Alkoxy, C 3 -C 6 Cycloalkyl, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl -OR10, where m = 0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, where n=0-3, -OC n Alkyl-R18, wherein n=0-3.

[0227] In another very preferred embodiment, R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R12)(R13), -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C nAlkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted by one or more R17.

[0228] In another very preferred embodiment, said R6, R7, R8 and R9 are independently selected from H, halogen, CN, C optionally substituted with one or more F 1 -C 3 alkyl, C optionally substituted with one or more F 1 -C 3 Alkoxy, C 3 -C 6 Cycloalkyl.

[0229] In another very preferred embodiment, said R6, R7, R8 and R9 are independently selected from H, halogen, CN, C optionally substituted with one or more F 1 -C 3 Alkoxy.

[0230] In another very preferred embodiment, R6, R7, R8 and R9 are independently selected from H, halogen, CN, C 1 -C 3 Alkoxy.

[0231] In another very preferred embodiment, said R6, R7, R8 and R9 are independently selected from H, F, Cl, Br, CN, methoxy and ethoxy.

[0232] In another very preferred embodiment, said R6, R7, R8 and R9 are independently H. In another very preferred embodiment, said R6, R7, R8 and R9 are independently halogen. In another very preferred embodiment, said R6, R7, R8 and R9 are independently CN. In another very preferred embodiment, said R6, R7, R8 and R9 are independently C optionally substituted with one or more F or hydroxyl. 1 -C 3 In another very preferred embodiment, said R6, R7, R8 and R9 are independently hydroxy. In another very preferred embodiment, said R6, R7, R8 and R9 are independently C optionally substituted with one or more F 1 -C 3 In another preferred embodiment, R6, R7, R8 and R9 are independently C optionally substituted by one or more F 1 -C 3In another very preferred embodiment, R6, R7, R8 and R9 are independently CF 3 In another very preferred embodiment, R6, R7, R8 and R9 are independently C 3 -C 6 Cycloalkyl.

[0233] In another very preferred embodiment, said R6, R7, R8 and R9 are independently -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, wherein m=0-3, wherein preferably m=1 or 2. In another very preferred embodiment, said R6, R7, R8 and R9 are independently -O(C 2 Alkyl-O) m -C 1 -C 3 Alkyl-OR10 wherein m=0-3, wherein preferably m=1 or 2. In another very preferred embodiment, said R6, R7, R8 and R9 are independently -O(C 2 Alkyl-O) m -C 2 Alkyl-OR10, wherein m=0-3, wherein preferably m=1 or 2.

[0234] In another very preferred embodiment, R6, R7, R8 and R9 are independently C 1 -C 3 Alkyl-OC 1 -C 3 alkyl.

[0235] In another very preferred embodiment, said R6, R7, R8 and R9 are independently -NH-C n Alkyl-R18, wherein n=0-3, wherein preferably n=1 or 2. In another very preferred embodiment, said R6, R7, R8 and R9 are independently -NH-C n Alkyl-R18, wherein n=0-3, wherein preferably n=0, 1 or 2, and wherein said R18 is a heterocycle optionally substituted by one or more R17. Preferably said heterocycle is a fully saturated 5- or 6-membered, preferably 6-membered monocyclic ring system containing one or two heteroatoms selected from nitrogen, oxygen and sulfur. Further preferably, said heterocycle is selected from piperidine, morpholine and tetrahydropyran optionally substituted by one or two R17, wherein preferably said R17 is C 1 -C 2 alkyl.

[0236] In another very preferred embodiment, R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=0-3, wherein preferably n=1, 2 or 3. In another very preferred embodiment, said R18 is selected from -OR10, -C(O)-R16, -C(O)-OR16, CN and a heterocycle optionally substituted by one or more R17, wherein preferably said R10 is selected from H or CH 3 , and wherein preferably R16 is selected from H or CH 3 , and wherein preferably the heterocycle is a fully saturated 5- or 6-membered, preferably 6-membered monocyclic ring system containing one or two heteroatoms selected from nitrogen, oxygen and sulfur, and further preferably, the heterocycle is a dioxolane optionally substituted by one or two R17, wherein preferably R17 is CH 3 In another very preferred embodiment, R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=0-3, wherein preferably n=1, 2 or 3. In another very preferred embodiment, said R18 is selected from -OR10, -C(O)-OR16, CN and a heterocycle optionally substituted by one or more R17, wherein preferably said R10 is selected from H or CH3, and wherein preferably R16 is selected from H or CH 3 , and wherein preferably the heterocycle is a fully saturated 5- or 6-membered, preferably 6-membered, monocyclic ring system containing one or two heteroatoms selected from nitrogen and oxygen.

[0237] In another very preferred embodiment, R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, wherein preferably said R10 is selected from H or CH 3 In another very preferred embodiment, R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -C(O)-OR16, wherein preferably said R16 is selected from H or CH 3 In another very preferred embodiment, R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is CN. In another very preferred embodiment, said R6, R7, R8 and R9 are independently -OC nAlkyl-R18, wherein n=1 or 2, and wherein said R18 is a heterocycle optionally substituted by one or more R17, wherein said heterocycle is a fully saturated 5- or 6-membered, preferably 6-membered monocyclic ring system containing one or two heteroatoms selected from nitrogen and oxygen, and wherein further preferably, said heterocycle is a dioxolane optionally substituted by one or two R17, preferably two R17, wherein said R17 is preferably CH 3 .

[0238] In another very preferred embodiment, said R6, R7, R8 and R9 are independently a heterocycle optionally substituted by one or more R17, wherein preferably said heterocycle is a fully saturated 4-6 membered monocyclic ring system containing one or two heteroatoms selected from nitrogen and oxygen. In another very preferred embodiment, said R6, R7, R8 and R9 are independently a heterocycle optionally substituted by one or more R17, wherein preferably said heterocycle is azetidine.

[0239] In another very preferred embodiment, R6, R7, R8 and R9 are independently C 1 -C 3 In another highly preferred embodiment, said R6, R7, R8 and R9 are independently F. In another highly preferred embodiment, said R6, R7, R8 and R9 are independently Cl. In another highly preferred embodiment, said R6, R7, R8 and R9 are independently Br. In another highly preferred embodiment, said R6, R7, R8 and R9 are independently I. In another highly preferred embodiment, said R6, R7, R8 and R9 are independently CN. In another highly preferred embodiment, said R6, R7, R8 and R9 are independently methoxy. In another highly preferred embodiment, said R6, R7, R8 and R9 are independently ethoxy.

[0240] In another very preferred embodiment, one or two of said R6, R7, R8 and R9 are independently selected from halogen, CN, C optionally substituted with one or more F or hydroxyl. 1 -C 3 alkyl, C optionally substituted with one or more F 1 -C 3 Alkoxy, C 3 -C 6 Cycloalkyl, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, wherein m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C nAlkyl-R18, where n=0-3, -OC n Alkyl-R18, wherein n=0-3, and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently selected from halogen, CN, C optionally substituted with one or more F or hydroxyl. 1 -C 3 alkyl, C optionally substituted with one or more F 1 -C 3 Alkoxy, C 3 -C 6 Cycloalkyl, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR11, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, where n=0-3, -OC n Alkyl-R18, wherein n=0-3, and wherein the others of R6, R7, R8 and R9 are H.

[0241] In another very preferred embodiment, one or two of R6, R7, R8 and R9 are independently selected from halogen, CN, C optionally substituted with one or more F 1 -C 3 alkyl, C optionally substituted with one or more F 1 -C 3 Alkoxy, C 3 -C 6 cycloalkyl, and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently selected from halogen, CN, C optionally substituted with one or more F 1 -C 3 alkyl, C optionally substituted with one or more F 1 -C 3 Alkoxy, C 3 -C 6 Cycloalkyl, and wherein the other of R6, R7, R8 and R9 is H.

[0242] In another very preferred embodiment, one or two of R6, R7, R8 and R9 are independently selected from halogen, CN, C optionally substituted with one or more F 1 -C 3alkoxy, and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently selected from halogen, CN, C optionally substituted with one or more F 1 -C 3 Alkoxy, and wherein the other of R6, R7, R8 and R9 is H.

[0243] In another very preferred embodiment, one or two of R6, R7, R8 and R9 are independently selected from halogen, CN, C 1 -C 3 Alkoxy, and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently selected from halogen, CN, C 1 -C 3 Alkoxy, and wherein the other of R6, R7, R8 and R9 is H.

[0244] In another very preferred embodiment, one or two of said R6, R7, R8 and R9 are independently selected from F, Cl, Br, CN, methoxy and ethoxy, and wherein the others of said R6, R7, R8 and R9 are H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently selected from F, Cl, Br, CN, methoxy and ethoxy, and wherein the others of said R6, R7, R8 and R9 are H.

[0245] In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently selected from halogen, CN, C optionally substituted with one or more R11. 1 -C 3 alkoxy, and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently selected from F, Cl, CN, methoxy and ethoxy, and wherein the other of said R6, R7, R8 and R9 is H.

[0246] In another very preferred embodiment, one or two of R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=0-3, wherein preferably n=1, 2 or 3, and wherein the other of said R6, R7, R8 and R9 is H. Preferably, said R18 is selected from -OR10, -C(O)-OR16, CN and a heterocycle optionally substituted by one or more R17, wherein preferably said R10 is selected from H or CH 3 , and wherein preferably R16 is selected from H or CH3 , and wherein preferably the heterocycle is a fully saturated 5- or 6-membered, preferably 6-membered, monocyclic ring system containing one or two heteroatoms selected from nitrogen and oxygen.

[0247] In another very preferred embodiment, one or two of R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, wherein preferably said R10 is selected from H or CH 3 , and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, one or two of said R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -C(O)-OR16, wherein preferably said R16 is selected from H or CH 3 , and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, one or two of said R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is CN, and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, one or two of said R6, R7, R8 and R9 are independently -OC n Alkyl-R18, wherein n=1 or 2, and wherein said R18 is a heterocycle optionally substituted by one or more R17, wherein said heterocycle is a fully saturated 5- or 6-membered, preferably 6-membered monocyclic ring system containing one or two heteroatoms selected from nitrogen and oxygen, and wherein further preferably, said heterocycle is a dioxolane optionally substituted by one or two R17, preferably two R17, wherein said R17 is preferably CH 3 , and wherein the others of R6, R7, R8 and R9 are H.

[0248] In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, wherein preferably said R10 is selected from H or CH 3 , and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -C(O)-OR16, wherein preferably said R16 is selected from H or CH 3, and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is CN, and wherein the other of said R6, R7, R8 and R9 is H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently -OC n Alkyl-R18, wherein n=1 or 2, and wherein said R18 is a heterocycle optionally substituted by one or more R17, wherein said heterocycle is a fully saturated 5- or 6-membered, preferably 6-membered monocyclic ring system containing one or two heteroatoms selected from nitrogen and oxygen, and wherein further preferably, said heterocycle is a dioxolane optionally substituted by one or two R17, preferably two R17, wherein said R17 is preferably CH 3 , and wherein the others of R6, R7, R8 and R9 are H.

[0249] In another very preferred embodiment, one or two of R6, R7, R8 and R9 are independently halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=1, 2 or 3, and wherein said R18 is -OR10, -C(O)-OR16 or CN, wherein preferably said R10 is selected from H or CH 3 , wherein preferably said R16 is selected from H or CH 3 , and wherein preferably at least two of said R6, R7, R8 and R9 are H, and wherein further preferably, the others of said R6, R7, R8 and R9 are H. In another very preferred embodiment, exactly one of said R6, R7, R8 and R9 is independently halogen, hydroxyl, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=1, 2 or 3, and wherein said R18 is -OR10, -C(O)-OR16 or CN, wherein preferably said R10 is selected from H or CH 3 , wherein preferably said R16 is selected from H or CH 3 , and wherein preferably at least two of said R6, R7, R8 and R9 are H, and wherein further preferably, the others of said R6, R7, R8 and R9 are H.

[0250] In another very preferred embodiment, R6 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=1, 2 or 3, and wherein said R18 is -OR10, -C(O)-OR16 or CN, wherein preferably said R10 is selected from H or CH3 , wherein preferably said R16 is selected from H or CH 3 , and wherein preferably at least two of said R7, R8 and R9 are H, and wherein further preferably, R7, R8 and R9 are H.

[0251] In another very preferred embodiment, R7 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=1, 2 or 3, and wherein said R18 is -OR10, -C(O)-OR16 or CN, wherein preferably said R10 is selected from H or CH 3 , wherein preferably said R16 is selected from H or CH 3 , and wherein preferably at least two of said R6, R8 and R9 are H, and wherein further preferably, R6, R8 and R9 are H.

[0252] In another very preferred embodiment, R8 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=1, 2 or 3, and wherein said R18 is -OR10, -C(O)-OR16 or CN, wherein preferably said R10 is selected from H or CH 3 , wherein preferably said R16 is selected from H or CH 3 , and wherein preferably at least two of said R6, R7 and R9 are H, and wherein further preferably, R6, R7 and R9 are H.

[0253] In another very preferred embodiment, R9 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=1, 2 or 3, and wherein said R18 is -OR10, -C(O)-OR16 or CN, wherein preferably said R10 is selected from H or CH 3 , wherein preferably said R16 is selected from H or CH 3 , and wherein preferably at least two of said R6, R7 and R8 are H, and wherein further preferably, R6, R7 and R8 are H.

[0254] In another very preferred embodiment, R6 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, wherein preferably said R10 is selected from H or CH 3 , and wherein at least two of said R7, R8 and R9 are H, and wherein preferably said R7, R8 and R9 are H. In another very preferred embodiment, said R6 is halogen, hydroxy, methoxy, ethoxy, -OCn Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -C(O)-OR16, wherein preferably said R16 is selected from H or CH 3 , and wherein at least two of said R7, R8 and R9 are H, and wherein preferably said R7, R8 and R9 are H. In another very preferred embodiment, said R6 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is CN, and wherein at least two of said R7, R8 and R9 are H, and wherein preferably said R7, R8 and R9 are H.

[0255] In another very preferred embodiment, R7 is halogen, hydroxyl, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, wherein preferably said R10 is H, and wherein at least two of said R6, R8 and R9 are H, and wherein preferably said R6, R8 and R9 are H. In another very preferred embodiment, said R7 is halogen, hydroxyl, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -C(O)-OR16, wherein preferably said R16 is H, and wherein at least two of said R6, R8 and R9 are H, and wherein preferably said R6, R8 and R9 are H. In another very preferred embodiment, said R7 is halogen, hydroxyl, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is CN, and wherein at least two of said R6, R8 and R9 are H, and wherein preferably said R6, R8 and R9 are H.

[0256] In another very preferred embodiment, R8 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, wherein preferably said R10 is selected from H or CH 3 , and wherein at least two of said R6, R7 and R9 are H, and wherein preferably said R6, R7 and R9 are H. In another very preferred embodiment, said R8 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -C(O)-OR16, wherein preferably said R16 is selected from H or CH 3, and wherein at least two of said R6, R7 and R9 are H, and wherein preferably said R6, R7 and R9 are H. In another very preferred embodiment, said R8 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is CN, and wherein at least two of said R7, R8 and R9 are H, and wherein preferably said R6, R7 and R9 are H.

[0257] In another very preferred embodiment, R9 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, wherein preferably said R10 is selected from H or CH 3 , and wherein at least two of said R6, R7 and R8 are H, and wherein preferably said R6, R7 and R8 are H. In another very preferred embodiment, said R9 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -C(O)-OR16, wherein preferably said R16 is selected from H or CH 3 , and wherein at least two of said R6, R7 and R8 are H, and wherein preferably said R6, R7 and R8 are H. In another very preferred embodiment, said R9 is halogen, hydroxy, methoxy, ethoxy, -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is CN, and wherein at least two of said R6, R7 and R8 are H, and wherein preferably said R6, R7 and R8 are H.

[0258] In another very preferred embodiment, R8 is selected from Cl, F, CN and methoxy, and wherein R6, R7 and R9 are H. In another very preferred embodiment, R8 is methoxy, and wherein R6, R7 and R9 are H. In another very preferred embodiment, R8 is Cl, F, methoxy, hydroxyl or -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, -C(O)-OR16 or CN, wherein preferably said R10 is selected from H or CH 3 , wherein preferably said R16 is selected from H or CH 3 , and wherein preferably at least two of said R6, R7 and R9 are H, and wherein further preferably, said R6, R7 and R9 are H.

[0259] In another very preferred embodiment, said R6 is Cl, and wherein R7, R8 and R9 are H. In another very preferred embodiment, said R6 is Cl, OH or methoxy, and wherein two of said R7, R8 and R9 are H. In another very preferred embodiment, said R6 is Cl, OH or methoxy, and wherein R7, R8 and R9 are H.

[0260] In another very preferred embodiment, R7 is Cl or methoxy, and wherein R6, R8 and R9 are H. In another very preferred embodiment, R7 is Cl, F, hydroxyl or -OC n Alkyl-R18, wherein n=2 or 3, and wherein said R18 is -OR10, -C(O)-OR16 or CN, wherein preferably said R10 is selected from H, wherein preferably said R16 is H, and wherein preferably at least two of said R6, R8 and R9 are H, and wherein further preferably said R6, R8 and R9 are H.

[0261] In another very preferred embodiment, said R9 is Cl, OH or methoxy, and wherein two of said R6, R7 and R8 are H. In another very preferred embodiment, said R6 is Cl, OH or methoxy, and wherein R6, R7 and R8 are H.

[0262] In another preferred embodiment, said R6 to R9 are H, wherein at least one of said R1, R2, R4 and R5 is not H. In another very preferred embodiment, said R6 to R9 are H, and wherein exactly one of said R1, R2, R4 and R5 is not H. In another very preferred embodiment, said R6 to R9 are H, and wherein R1 or R5 is C optionally substituted with one or more R11 1 -C 6 alkyl, and wherein R2 and R4 are H. In another very preferred embodiment, said R6 to R9 are H, and wherein R1 or R5 is C optionally substituted by one or more R11 1 -C 3 alkyl, and wherein R2 and R4 are H. In another very preferred embodiment, said R6 to R9 are H, and wherein R1 or R5 is C 1 -C 3 alkyl, and wherein R2 and R4 are H. In another very preferred embodiment, said R6 to R9 are H, and wherein R1 or R5 are methyl, ethyl, cyclopropyl or isopropyl, and wherein R2 and R4 are H.

[0263] In another very preferred embodiment, said R6 to R9 are H, and wherein R3 is C optionally substituted with one or more R111 -C 6 alkyl, and wherein R1 or R5 is C optionally substituted by one or more R11 1 -C 6 alkyl, and wherein R2 and R4 are H. In another very preferred embodiment, said R6 to R9 are H, and wherein R3 is C optionally substituted by one or more R11 1 -C 3 alkyl, and wherein R1 or R5 is C optionally substituted by one or more R11 1 -C 3 alkyl, and wherein R2 and R4 are H. In another very preferred embodiment, said R6 to R9 are H, and wherein R3 is C 1 -C 3 alkyl, and wherein R1 or R5 is C 1 -C 3 alkyl, and wherein R2 and R4 are H. In another very preferred embodiment, said R6 to R9 are H, and wherein R3 is methyl, ethyl or isopropyl, and wherein R1 or R5 is methyl, ethyl, cyclopropyl or isopropyl, and wherein R2 and R4 are H.

[0264] In another very preferred embodiment, one of said R1 and R5 is selected from halogen, C optionally substituted by one or more R11 1 -C 3 alkyl, C optionally substituted by one or more R11 1 -C 3 alkoxy, and wherein the other of said R1 and R5 is H. In another very preferred embodiment, one of said R1 and R5 is selected from halogen, C optionally substituted by one or more R11 1 -C 3 Alkyl, C 1 -C 3 alkoxy, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is selected from halogen, methyl, ethyl, trifluoromethyl, methoxy and ethoxy, and wherein the other of R1 and R5 is H. In another very preferred embodiment, one of R1 and R5 is selected from F, Cl, Br, methyl, ethyl, trifluoromethyl and methoxy, and wherein the other of R1 and R5 is H.

[0265] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 and R5 is selected from halogen, C optionally substituted with one or more R11 1 -C 3 alkyl, C optionally substituted by one or more R111 -C 3 alkoxy, and wherein the other of R1 and R5 is H. In another very preferred embodiment, R2 and R4 are H, and wherein one of R1 and R5 is selected from halogen, C optionally substituted by one or more R11 1 -C 3 Alkyl, C 1 -C 3 Alkoxy, and wherein the other of R1 and R5 is H. In another very preferred embodiment, R2 and R4 are H, and wherein one of R1 and R5 is selected from halogen, methyl, ethyl, trifluoromethyl, methoxy and isopropoxy, and wherein the other of R1 and R5 is H.

[0266] In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 and R5 is selected from F, Cl, Br, methyl, ethyltrifluoromethyl and methoxy, and wherein the other of said R1 and R5 is H. In another very preferred embodiment, said R2 and R4 are H, and wherein one of said R1 and R5 is selected from F, Cl, Br, methyl, trifluoromethyl and methoxy, and wherein the other of said R1 and R5 is H.

[0267] In another very preferred embodiment, said R3 is selected from halogen, CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl-C(O)N(R12)(R13), wherein n=0-3, -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC nAlkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted by one or more R17, and a 4- to 6-membered heterocycle optionally substituted by one or more R17, said heterocycle may be aromatic, partially saturated or fully saturated, and contain 1 to 4 heteroatoms selected from nitrogen, oxygen, with the proviso that each ring system cannot contain more than 2 oxygen atoms, and wherein preferably said heterocycle contains at least one nitrogen as a heteroatom.

[0268] In another very preferred embodiment, said R3 is selected from halogen, CN, C optionally substituted with one or more R11 1 -C 3 alkyl, C optionally substituted by one or more R11 1 -C 3 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl-C(O)N(R12)(R13), wherein n=0-3, -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted by one or more R17, and a 4- to 6-membered heterocycle optionally substituted by one or more R17, said heterocycle may be aromatic, partially saturated or fully saturated, and contain 1 to 4 heteroatoms selected from nitrogen, oxygen, with the proviso that each ring system cannot contain more than 2 oxygen atoms, and wherein preferably said heterocycle contains at least one nitrogen as a heteroatom.

[0269] In another very preferred embodiment, said R3 is selected from halogen, CN, C optionally substituted with one or more R11 1 -C 3alkyl, C optionally substituted by one or more R11 1 -C 3 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C(O)N(R12)(R13); -N(R14)-C(O)-R15; -C(O)-OR16; -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a 4 to 6 membered heterocycle optionally substituted by one or more R17, wherein the heterocycle is selected from tetrazole, pyrazole, pyrrole, oxazole, thiazole, imidazole, triazole, pyrrolidine, pyrrolidin-2-one, piperidine and morpholine. In another highly preferred embodiment, the R3 is selected from halogen, CN, C optionally substituted by one or more R11. 1 -C 3 alkyl, C optionally substituted by one or more R11 1 -C 3 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C(O)N(R12)(R13); -N(R14)-C(O)-R15; -C(O)-OR16; -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl -OR10, where m = 0-3, -OR16; -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a 4- to 6-membered heterocyclic ring optionally substituted with one or more R17, wherein the heterocyclic ring is selected from tetrazole, pyrazole, pyrrole, oxazole, thiazole, imidazole, triazole, pyrrolidine, pyrrolidin-2-one, piperidine and morpholine.

[0270] In another very preferred embodiment, R3 is selected from F, Cl, Br, CN, C 1 -C 2 Alkyl-OC 1 -C 2 Alkyl, C 1 -C 3 Alkyl, trifluoromethyl, C 1 -C 2 Alkoxy, N(R14)-C(O)-R15, -C(O)-OR16, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl -OR11, where m = 0-3, -OPO(OR10) 2 、-PO(OR10) 2 , and a 4- to 6-membered heterocyclic ring optionally substituted with one or more R17, wherein the heterocyclic ring is selected from triazole and tetrazole.

[0271] In another very preferred embodiment, R3 is selected from F, Cl, Br, CN, CH 2 -O-CH 3 , methyl, ethyl isopropyl, trifluoromethyl, methoxy, -N(R14)-C(O)-R15, -C(O)-OR16, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl -OR11, where m = 0-3, -OPO(OR10) 2 、-PO(OR10) 2 , and a 4- to 6-membered heterocyclic ring optionally substituted with one or more R17, wherein the heterocyclic ring is selected from triazole and tetrazole.

[0272] In another very preferred embodiment, R1, R2 and R4 are H; R3 is selected from methylethyl, cyclopropyl and isopropyl; R5 is selected from H, Cl, Br, CF 3 and methyl; and at least one of said R6 to R9 is not H.

[0273] In another very preferred embodiment, R3 is isopropyl; and at least one of R6, R7, R8 or R9 is not H.

[0274] In another highly preferred embodiment, R1, R2, R4 and R5 are H; R3 is isopropyl; and at least one of R6, R7, R8 or R9 is not H.

[0275] In another very preferred embodiment, R1 is methyl; R2, R4 and R5 are H; and R3 is methyl; and at least one of R6, R7, R8 or R9 is not H.

[0276] In another very preferred embodiment, the compound of formula (I) is selected from

[0277]

[0278]

[0279]

[0280] And wherein preferably, the compound is selected from

[0281]

[0282] In another very preferred embodiment, the compound is selected from

[0283]

[0284]

[0285] In another very preferred embodiment, the compound is selected from

[0286] 7-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0287] 6-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0288] 8-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0289] 9-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0290] 3-(2,4-Dimethylphenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0291] 3-(2,4-Dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazoline-8-carbonitrile;

[0292] 3-(2,4-Dimethylphenyl)sulfonyl-8-fluoro-4H-triazolo[1,5-a]quinazolin-5-one;

[0293] 6-Chloro-3-(4-isopropylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0294] 9-Chloro-3-(4-isopropylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0295] 8-methoxy-3-(2-methoxy-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0296] 3-(4-isopropoxy-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0297] 3-(2-Chloro-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0298] 3-(4-Bromo-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0299] 3-(2-Fluoro-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0300] 8-methoxy-3-(4-methoxy-2-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0301] N-[4-[(8-methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-phenyl]acetamide;

[0302] 3-(4-Fluoro-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0303] 3-(2-Bromo-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0304] 8-methoxy-3-[2-methyl-4-(trifluoromethoxy)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0305] 3-(4-chloro-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0306] 3-(4-Cyclopropylphenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one:

[0307] 4-[(8-methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzonitrile;

[0308] 4-[(8-Methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzoic acid;

[0309] 4-[(8-Methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzoic acid ethyl ester;

[0310] 8-methoxy-3-[4-(trifluoromethyl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0311] 8-methoxy-3-[4-methyl-2-(trifluoromethyl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0312] 3-(4-cyclopropyl-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0313] 3-(4-ethyl-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0314] 4-[(8-methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]benzonitrile;

[0315] 3-(2,4-Dimethylphenyl)sulfonyl-7-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0316] 8-methoxy-3-[2-methyl-4-(2H-tetrazol-5-yl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0317] 4-[(8-methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzamide;

[0318] 8-methoxy-3-[2-methyl-4-(5-methyl-4H-1,2,4-triazol-3-yl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0319] 3-(2-Chloro-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0320] 3-(2,4-dimethylphenyl)sulfonyl-8-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0321] 3-(2-Bromo-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0322] 8-bromo-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; and

[0323] 3-(2,4-Dimethylphenyl)sulfonyl-6-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0324] 3-(2,4-dimethylphenyl)sulfonyl-8-(3-methoxypropoxy)-4H-triazolo[1,5-a]quinazolin-5-one;

[0325] 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butyronitrile;

[0326] 3-(2,4-Dimethylphenyl)sulfonyl-8-iodo-4H-triazolo[1,5-a]quinazolin-5-one;

[0327] 3-(2,4-dimethylphenyl)sulfonyl-8-(2-methoxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one;

[0328] 3-(2-Bromo-4,5-dimethyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0329] 8-(azetidin-1-yl)-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0330] 3-(2,4-Dimethylphenyl)sulfonyl-7-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0331] 3-(2,4-Dimethylphenyl)sulfonyl-9-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0332] 3-(2,4-dimethylphenyl)sulfonyl-8-(2-morpholinoethylamino)-4H-triazolo[1,5-a]quinazolin-5-one;

[0333] 3-(2,4-dimethylphenyl)sulfonyl-8-(tetrahydropyran-4-ylamino)-4H-triazolo[1,5-a]quinazolin-5-one;

[0334] 3-(2,4-Dimethylphenyl)sulfonyl-9-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0335] 3-(2-Chloro-4,6-dimethyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0336] 3-(2-Bromo-4,6-dimethyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0337] 3-(2,4-dimethylphenyl)sulfonyl-8-(2-hydroxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one;

[0338] 2-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]acetonitrile;

[0339] 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butanoic acid methyl ester;

[0340] 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butanamide;

[0341] 3-(2,4-dimethylphenyl)sulfonyl-8-hydroxy-7-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0342] 3-(2,4-dimethylphenyl)sulfonyl-7-hydroxy-8-(2-methoxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one;

[0343] 3-(2,4-dimethylphenyl)sulfonyl-8-[2-[2-(2-methoxyethoxy)ethoxy]ethoxy]-4H-triazolo[1,5-a]quinazolin-5-one;

[0344] 8-[(2,2-dimethyl-1,3-dioxolan-4-yl)methoxy]-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; and

[0345] 3-(2,4-Dimethylphenyl)sulfonyl-7-hydroxy-8-(2-hydroxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one.

[0346] In another very preferred embodiment, the compound is selected from

[0347] 7-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0348] 6-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0349] 8-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0350] 9-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0351] 3-(2,4-Dimethylphenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0352] 6-Chloro-3-(4-isopropylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0353] 9-Chloro-3-(4-isopropylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0354] 3-(2-Chloro-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0355] 3-(2-Bromo-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0356] 8-methoxy-3-[4-methyl-2-(trifluoromethyl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0357] 3-(2-Chloro-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0358] 3-(2,4-dimethylphenyl)sulfonyl-8-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0359] 3-(2-Bromo-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0360] 8-Bromo-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one;

[0361] 3-(2,4-Dimethylphenyl)sulfonyl-6-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0362] 3-(2,4-dimethylphenyl)sulfonyl-8-(3-methoxypropoxy)-4H-triazolo[1,5-a]quinazolin-5-one;

[0363] 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butyronitrile;

[0364] 3-(2,4-dimethylphenyl)sulfonyl-8-(2-methoxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one;

[0365] 3-(2,4-Dimethylphenyl)sulfonyl-7-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0366] 3-(2,4-Dimethylphenyl)sulfonyl-9-methoxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0367] 3-(2,4-dimethylphenyl)sulfonyl-8-(tetrahydropyran-4-ylamino)-4H-triazolo[1,5-a]quinazolin-5-one;

[0368] 3-(2,4-Dimethylphenyl)sulfonyl-9-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one;

[0369] 3-(2,4-dimethylphenyl)sulfonyl-8-(2-hydroxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one;

[0370] 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butanoic acid methyl ester;

[0371] 3-(2,4-dimethylphenyl)sulfonyl-7-hydroxy-8-(2-methoxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one; and

[0372] 8-[(2,2-dimethyl-1,3-dioxolan-4-yl)methoxy]-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one.

[0373] In another very preferred embodiment, the compound is 7-chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 6-chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 8-chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 9-chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 6-chloro-3-(4-isopropylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 9-chloro-3-(4-isopropylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2-chloro-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2-bromo-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 8-methoxy-3-[4-methyl-2-(trifluoromethyl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound used is 3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2-chloro-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-8-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2-bromo-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 8-bromo-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-6-methoxy-4H-triazolo[1,5-a]quinazolin-5-one.In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-8-(3-methoxypropoxy)-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butyronitrile. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-8-(2-methoxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-7-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-9-methoxy-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-8-(tetrahydropyran-4-ylamino)-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-9-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-8-(2-hydroxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is methyl 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butyrate. In another very preferred embodiment, the compound is 3-(2,4-dimethylphenyl)sulfonyl-7-hydroxy-8-(2-methoxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one. In another very preferred embodiment, the compound is 8-[(2,2-dimethyl-1,3-dioxolan-4-yl)methoxy]-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one.

[0374] In another aspect, the present invention provides compounds according to formula (I) and pharmaceutically acceptable salts, stereoisomers, enantiomers, tautomers of compounds of formula (I), as disclosed herein, for use in a method of reducing the virulence of a bacterium, preferably a bacterium expressing AgrA or an ortholog of AgrA, preferably AgrA, and further preferably selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and yet further preferably Staphylococcus aureus. In another very preferred embodiment, the bacterium expresses AgrA or an ortholog of AgrA. In another very preferred embodiment, the bacterium expresses AgrA. In another very preferred embodiment, the bacterium is selected from the genus Staphylococcus, Streptococcus or Clostridium. In another very preferred embodiment, the bacterium is Staphylococcus. In another very preferred embodiment, the bacterium is Staphylococcus. In another very preferred embodiment, the bacterium is Staphylococcus. The embodiments, preferred embodiments and very preferred embodiments of the compounds of formula (I) described and disclosed herein shall apply to the method of the present invention, regardless of whether they are specifically mentioned again or their repetition is avoided for the sake of brevity.

[0375] In another aspect, the present invention provides compounds according to formula (I) and pharmaceutically acceptable salts, stereoisomers, enantiomers, tautomers of compounds of formula (I), as disclosed herein, for use in a method of preventing or treating a disease caused or aggravated by bacteria, preferably an infection or inflammatory disease, further preferably a bacterial infection or an inflammatory skin disease, wherein preferably the bacteria is selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and still further preferably wherein the bacteria is Staphylococcus aureus. In another very preferred embodiment, the disease is an infection or an inflammatory disease. In another very preferred embodiment, the disease is an infection. In another very preferred embodiment, the disease is a bacterial infection or an inflammatory skin disease caused or aggravated by bacteria. In another very preferred embodiment, the disease is a bacterial infection, wherein the bacteria is selected from the genus Staphylococcus, Streptococcus or Clostridium. In another very preferred embodiment, the disease is a bacterial infection or an inflammatory skin disease caused or aggravated by bacteria. In another very preferred embodiment, the disease is a bacterial infection, wherein the bacteria is selected from the genus Staphylococcus, Streptococcus or Clostridium. In another very preferred embodiment, the disease is aggravated by a bacterium selected from the genus Staphylococcus, preferably Staphylococcus aureus. In another very preferred embodiment, the disease is an infection caused or aggravated by a bacterium selected from the genus Staphylococcus. In another very preferred embodiment, the disease is an infection caused or aggravated by Staphylococcus aureus. In another very preferred embodiment, the disease is an inflammatory skin disease, preferably atopic dermatitis. In another very preferred embodiment, the disease is an inflammatory skin disease aggravated by Staphylococcus aureus, preferably atopic dermatitis. The embodiments, preferred embodiments and very preferred embodiments of the compounds of formula I described and disclosed herein shall apply to the method of the present invention, regardless of whether they are specifically mentioned again or their repetition is avoided for the sake of brevity.

[0376] In another aspect, the present invention provides a compound according to formula (I) for use in a method of inhibiting quorum sensing, preferably AgrA quorum sensing, in bacteria, preferably selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably in Staphylococcus, and still further preferably in Staphylococcus aureus,

[0377]

[0378] in

[0379] R1 and R5 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0380] R3 is selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R113 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0381] R2 and R4 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 6 alkyl;

[0382] R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R12)(R13), -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C nAlkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0383] R10 is selected from H and C optionally substituted by one or more R11 1 -C 6 alkyl;

[0384] The one or more R11 are independently selected from Cl, F and hydroxyl;

[0385] R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -SO optionally substituted with one or more R11 2 -C 1 -C 6 Alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a heterocyclic ring optionally substituted with one or more R17;

[0386] The one or more R17 are independently selected from halogen, hydroxyl, NO 2 , CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C n Alkyl-OR16, wherein n=0-3, optionally substituted by one or more R11 1 -C 6 alkyl, and C optionally substituted by one or more R11 1 -C 6 Alkoxy;

[0387] R18 is selected from -N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a heterocycle optionally substituted with one or more R17; and wherein at least one of R1, R2, R4, R5, R6, R7, R8 or R9 is not H;

[0388] and pharmaceutically acceptable salts, stereoisomers, enantiomers, tautomers of the compound of formula (I). In another preferred embodiment, the bacterium is selected from Streptococcus pyogenes, Clostridium difficile or Staphylococcus aureus, preferably the bacterium is Staphylococcus aureus. In a very preferred embodiment, the bacterium is Staphylococcus aureus.

[0389] In another aspect, the present invention provides a pharmaceutical composition comprising at least one compound according to formula (I)

[0390]

[0391] in

[0392] R1 and R5 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC nAlkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0393] R3 is selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0394] R2 and R4 are independently selected from H, halogen, C optionally substituted with one or more R11 1 -C 6 alkyl;

[0395] R6, R7, R8 and R9 are independently selected from H, halogen, hydroxyl, NO 2 , CN, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 1 -C 6 Alkoxy, C optionally substituted by one or more R113 -C 6 Cycloalkyl, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl -C(O)N(R12)(R13), where n=0-3, -SO 2 -N(R12)(R13), -SO 2 -N(R14)-C(O)-R15; -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C 1 -C 3 Alkyl-O) m -C 1 -C 3 Alkyl-OR10, where m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3; -OPO(OR10) 2 、-PO(OR10) 2 , and a heterocycle optionally substituted with one or more R17;

[0396] R10 is selected from H and C optionally substituted by one or more R11 1 -C 6 alkyl;

[0397] The one or more R11 are independently selected from Cl, F and hydroxyl;

[0398] R12, R13, R14, R15 and R16 are independently selected from H, C optionally substituted with one or more R11 1 -C 6 alkyl, C optionally substituted by one or more R11 3 -C 6 Cycloalkyl, -SO optionally substituted with one or more R11 2 -C 1 -C 6 Alkyl, or wherein said R12 and R13 together with the nitrogen to which they are attached form a heterocyclic ring optionally substituted with one or more R17;

[0399] The one or more R17 are independently selected from halogen, hydroxyl, NO 2 , CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -Cn Alkyl-OR16, wherein n=0-3, optionally substituted by one or more R11 1 -C 6 alkyl, and C optionally substituted by one or more R11 1 -C 6 Alkoxy;

[0400] R18 is selected from N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a heterocycle optionally substituted with one or more R17; and

[0401] wherein at least one of R1, R2, R4, R5, R6, R7, R8 or R9 is not H;

[0402] and pharmaceutically acceptable salts, stereoisomers, enantiomers, tautomers and pharmaceutically acceptable excipients of the compound of formula (I).

[0403] In another preferred embodiment, the bacterium is selected from Streptococcus pyogenes, Clostridium difficile or Staphylococcus aureus, preferably the bacterium is Staphylococcus aureus.

[0404] In a preferred embodiment, the pharmaceutical composition further comprises at least one antibiotic active against bacteria, preferably selected from the group consisting of Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and still more preferably Staphylococcus aureus. In a very preferred embodiment, the pharmaceutical composition further comprises at least one antibiotic active against Staphylococcus aureus.

[0405] Therefore, the compositions and compounds of the present invention represent anti-virulence therapies that can be used as stand-alone therapies to enhance the self-defense and self-healing capabilities of the infected host by reducing tissue damage, reducing inflammation, reducing disease transmission, complete immune response, and reducing relapse rates. In cases where the disarmed pathogen may not be able to be fully cleared by the host, combination therapy with traditional antibiotics (for infections caused by S. aureus) or with anti-inflammatory agents (for diseases exacerbated by S. aureus) may be considered, ultimately optimizing the timeliness and / or dosage of therapy (Dickey SW et al. (2017) Nature Reviews Drug Discovery 16(7):457-471).

[0406] In a preferred embodiment, the pharmaceutical composition further comprises at least one anti-inflammatory agent, preferably at least one anti-inflammatory agent for treating chronic inflammatory skin diseases.

[0407] In another aspect, the present invention provides a combination product containing at least one compound according to formula (I) and at least one antibiotic, said antibiotic being active against bacteria, preferably against bacteria selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably against Staphylococcus, and even more preferably against Staphylococcus aureus. Therefore, in other embodiments, the compounds of formula (I) of the present invention can be administered in combination with antibiotics. Exemplary antibiotics include, but are not limited to, colloidal silver, penicillins (including penicillin G, ampicillin, amoxicillin, methicillin, oxacillin, dicloxacillin, flucloxacillin, amoxicillin / clavulanic acid, ampicillin / sulbactam), carbapenems (including imipenem, meropenem, ertapenem, doripenem, imipenem-cilastatin), cephalosporins (including cephalothin, cefazolin, cephalexin, cephradine, cefamandole, cefoxitin and third generation cephalosporins), glycopeptides (including vancomycin, teicoplanin, oritavancin, telavancin, dalbavancin), oxazolidinones (including linezolid, tedizolid) lipopeptides (including daptomycin, ramoplanin), Lincosamides (including clindamycin and lincomycin), macrolides (including erythromycin, spiramycin, roxithromycin, clarithromycin, azithromycin), aminoglycosides (including streptomycin, gentamicin, amikacin, kanamycin, neomycin, tobramycin), ketolides (including telithromycin, solithromycin), bacitracin, annulomycins (including rifampicin), tetracyclines (including doxycycline, minocycline), glycinecyclines (including tylosin), quinolones (including ciprofloxacin, moxifloxacin, levofloxacin, ofloxacin), streptomycins (including quinupristin / dalfopristin), trimethoprim-sulfamethoxazole (TMP-SMX), topical mupirocin.

[0408] In another aspect, the present invention provides a composition containing at least one compound according to formula (I) and at least one agent typically and preferably used for the treatment of inflammatory diseases, preferably chronic inflammatory skin diseases, preferably an anti-inflammatory agent, said disease being exacerbated by bacteria selected from the genus Staphylococcus, preferably Staphylococcus aureus.

[0409] As described herein, combination therapy may involve co-administration or sequential administration of a compound of formula (I) of the present invention and at least one antibiotic or at least one agent typically and preferably used to treat inflammatory diseases, preferably an anti-inflammatory agent. In the methods and / or compositions or combinations of the present invention, the combination of a compound of formula (I) of the present invention and at least one antibiotic or at least one anti-inflammatory agent can reduce the amount of the drug compound required as a therapeutically effective dose, and thus reduce any adverse side effects of the antibiotic or the agent that can be induced in vivo. In addition, in the methods and / or compositions or combinations of the present invention, the combination of a compound of formula (I) of the present invention and at least one antibiotic or at least one anti-inflammatory agent can reduce the time of in vivo therapy. In addition, in the methods and / or compositions or combinations of the present invention, the combination of a compound of formula (I) of the present invention and at least one antibiotic can reduce the effective dose or reduce the time required for successful treatment with an antibiotic, which in turn reduces the chance of resistance of the microorganism to a specific antibiotic.

[0410] The compounds of formula (I) of the present invention, pharmaceutical compositions or combination products as described herein can be administered to any subject that can experience the beneficial effects of the compounds, compositions or products of the present invention. Preferably, the subject is human. The compounds, compositions or products of the present invention as described herein can be administered by any means to achieve their intended purpose. For example, administration can be delivered parenterally, topically, regionally, subcutaneously, orally, intravenously, intraarticularly, intrathecally, intramuscularly, intraperitoneally or intradermally, or by transdermal, buccal, oral mucosal ocular routes or via inhalation. In a preferred embodiment, administration to the subject is systemic. In other embodiments, administration to the subject is regional, such as in a topical solution, a topical ointment or a topical cream. Preferably, the subject is human.

[0411] In another aspect, the present invention provides the use of a compound of formula (I), a pharmaceutical composition or a combination product for use in the manufacture of a medicament according to the invention for reducing the virulence of a bacterium, preferably a bacterium expressing AgrA or an orthologue of AgrA, preferably AgrA, and further preferably selected from a bacterium of the genus Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and still further preferably Staphylococcus aureus. In another very preferred embodiment, the bacterium expresses AgrA. In another very preferred embodiment, the bacterium is selected from the genus Staphylococcus, Streptococcus or Clostridium. In another very preferred embodiment, the bacterium is Staphylococcus. In another very preferred embodiment, the bacterium is Staphylococcus. In another very preferred embodiment, the bacterium is Staphylococcus.

[0412] In another aspect, the present invention provides the use of a compound of formula (I), a pharmaceutical composition or a combination product for use in the manufacture of a medicament for preventing or treating a disease caused or aggravated by bacteria, preferably an infection or inflammatory disease, further preferably a bacterial infection or inflammatory skin disease, wherein preferably the bacteria are selected from Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and further preferably wherein the bacteria are Staphylococcus aureus. In another very preferred embodiment, the disease is an infection caused or aggravated by a bacterium selected from Staphylococcus, Streptococcus or Clostridium. In another very preferred embodiment, the disease is an infection caused or aggravated by a bacterium selected from Staphylococcus. In another very preferred embodiment, the disease is an infection caused or aggravated by a bacterium selected from Staphylococcus. In another very preferred embodiment, the disease is an infection caused or aggravated by Staphylococcus.

[0413] In another aspect, the present invention provides the use of a compound of formula (I), a pharmaceutical composition or a combination product for use in the manufacture of an agent according to the present invention that effectively inhibits quorum sensing, preferably AgrA quorum sensing, in bacteria, preferably selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably in Staphylococcus, and further preferably in Staphylococcus aureus. In another aspect, the present invention provides the use of a pharmaceutical composition according to the present invention for use in the manufacture of an agent that inhibits quorum sensing, preferably AgrA quorum sensing, in bacteria, preferably selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably in Staphylococcus, and further preferably in Staphylococcus aureus.

[0414] In another aspect, the present invention provides a method for reducing the virulence of a bacterium, preferably a bacterium expressing AgrA or an ortholog of AgrA, preferably AgrA, and further preferably Staphylococcus aureus, the method comprising administering to a subject an amount of a compound of formula (I), a pharmaceutical composition or a combination product, preferably a compound of formula (I), which according to the present invention effectively inhibits the synthesis of one or more virulence factors by the bacterium. In another very preferred embodiment, the bacterium expresses AgrA. In another very preferred embodiment, the bacterium is selected from the genus Staphylococcus, Streptococcus and Clostridium. In another very preferred embodiment, the bacterium is Staphylococcus. In another very preferred embodiment, the bacterium is Staphylococcus. In another very preferred embodiment, the bacterium is Staphylococcus. The embodiments, preferred embodiments and very preferred embodiments of the compounds of formula I described and disclosed herein should apply to the method of the present invention, regardless of whether they are specifically mentioned again or their repetition is avoided for the sake of brevity.

[0415] In another preferred embodiment of the method of the present invention, the compound of formula (I) inhibits the synthesis of one or more virulence factors by bacteria, wherein the one or more virulence factors are selected from the group consisting of: one or more toxins (e.g., α, β, γ, γ-variants, and δ-hemolysin, PSM (e.g., PSMα), Panton-Valentine leukocidin (PVL), leukotoxin E and D (LukED), leukotoxin G and H (LukGH), enterotoxins (e.g., enterotoxin B), exfoliating toxins), proteases (e.g., serine proteases, metalloproteases, and cysteine ​​proteases), nucleases, lipases, coagulase, hyaluronidase, agglutination factors, pyrogenic toxin superantigens (e.g., TSST-1), and combinations thereof. Therefore, in another preferred embodiment of the method of the present invention, the one toxin is selected from α, β, γ, γ-variants, and δ-hemolysin. In another preferred embodiment of the method of the present invention, the PSM is PSMα. In another preferred embodiment of the method of the present invention, the enterotoxin is enterotoxin B or an exfoliating toxin. In another preferred embodiment of the method of the present invention, the protease is selected from serine proteases, metalloproteases and cysteine ​​proteases. In another preferred embodiment of the method of the present invention, the pyrogenic toxin superantigen is TSST-1. In another preferred embodiment of the method of the present invention, the compound of formula (I) inhibits the synthesis of one or more virulence factors by the bacteria, wherein the one or more virulence factors are selected from the group consisting of: α, β, γ, γ-variants, and δ-hemolysin, PSMα, Panton-Valentine leukocidin (PVL), leukotoxin E and D (LukED), leukotoxin G and H (LukGH), enterotoxin B, exfoliative toxins, serine proteases, metalloproteases, cysteine ​​proteases, nucleases, lipases, coagulase, hyaluronidase, coagulation factors, TSST-1, and any combination of one or more of any specific virulence factors or a general group of virulence factors thereof. In another very preferred embodiment of the method of the present invention, the compound of formula (I) inhibits the expression of any one of PSMα, RNAIII and / or its downstream targets. In another very preferred embodiment of the method of the present invention, the compound of formula (I) inhibits the expression of PSMα. In another very preferred embodiment of the method of the present invention, the compound of formula (I) inhibits the expression of RNAIII. In another very preferred embodiment of the method of the present invention, the compound of formula (I) inhibits the expression of downstream targets of RNAIII. In another very preferred embodiment, the method further comprises administering an antibiotic or an anti-inflammatory agent to the subject, preferably to the human. In another very preferred embodiment, the method further comprises administering an antibiotic to the subject, preferably to the human. In another very preferred embodiment, the method further comprises administering an anti-inflammatory agent, preferably to the human.

[0416] In another aspect, the present invention provides a method for preventing or treating a disease caused or aggravated by bacteria in a subject, preferably an infection or inflammatory disease, further preferably a bacterial infection or inflammatory skin disease, wherein preferably the bacteria is selected from Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and further preferably wherein the bacteria is Staphylococcus aureus, the method comprising administering to a subject in need of such prevention or treatment an effective amount of a compound of formula (I), a pharmaceutical composition or a combination product, preferably a compound of formula (I). In another very preferred embodiment, the disease is an infection or inflammatory disease. In another very preferred embodiment, the disease is an infection. In another very preferred embodiment, the disease is a bacterial infection. In another very preferred embodiment, the disease is an inflammatory skin disease caused or aggravated by bacteria. Preferably the infection, preferably the bacterial infection is caused by a bacterium selected from Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and further preferably Staphylococcus aureus. In another very preferred embodiment, said infection, preferably said bacterial infection comprises an antibiotic resistant Staphylococcus infection, preferably said antibiotic resistant Staphylococcus infection comprises a methicillin resistant Staphylococcus aureus infection.

[0417] Thus, as described herein, the compounds of formula (I) of the present invention or the compositions of the present invention comprising the compounds of formula (I) of the present invention, preferably the pharmaceutical compositions of the present invention, can be administered to a subject to inhibit the activity of AgrA, thereby preventing the production of virulence factors that contribute to bacterial infection or disease conditions or disorders associated with bacterial infection. Examples of diseases and disorders associated with bacterial infection that respond to treatment with the compounds and / or compositions of the present invention may include, but are not limited to, skin and soft tissue infections, lung infections, or chronic inflammatory skin diseases, such as atopic dermatitis.

[0418] In another aspect, the present invention provides a method for inhibiting quorum sensing, preferably AgrA quorum sensing, in bacteria, preferably selected from Staphylococcus, Streptococcus or Clostridium, more preferably in Staphylococcus, and still further preferably in Staphylococcus aureus, wherein the method comprises administering to a subject an effective amount of a compound of formula (I), a pharmaceutical composition or a combination product, preferably according to formula (I).

[0419] In another preferred embodiment of the present invention, the compound of formula (I) is provided in a topical composition with a pharmaceutically acceptable carrier and is topically administered to a subject, wherein preferably the subject suffers from a disease or condition associated with a bacterial infection, wherein the bacterial infection is an infection caused or aggravated by bacteria, preferably Staphylococcus aureus. In another preferred embodiment, the infection caused or aggravated by bacteria is SSTI or atopic dermatitis. In another preferred embodiment, the bacterial infection is SSTI or atopic dermatitis.

[0420] Thus, as described herein, the compounds of formula (I) of the present invention or the compositions of the present invention comprising the compounds of formula (I) of the present invention or the combination products of the present invention, preferably the compounds of formula (I) of the present invention, the pharmaceutical compositions of the present invention can be used to prevent or treat infection of a subject by any bacterial species that utilizes quorum sensing AgrA response regulators and produces virulence factors. The compounds and compositions of the present invention are typically and preferably administered to a subject suffering from or at risk of suffering from an infection, preferably a bacterial infection, such as a Staphylococcus and / or Streptococcus infection. For example, as described herein, a subject that may benefit from treatment with the compounds or compositions of the present invention may be a hospitalized patient at risk of developing a nosocomial infection or a subject known to be infected or exposed to antibiotic-resistant bacteria such as methicillin-resistant Staphylococcus aureus, vancomycin-sensitive Staphylococcus aureus, and vancomycin-resistant Staphylococcus aureus. Methods for detecting the presence of Staphylococcus bacterial infection are well known, for example by culturing a sample from a subject, for example, blood culture may be used.

[0421] In another aspect, the present invention provides a method for treating a subject suffering from an infection or inflammatory disease, preferably a bacterial infection or an inflammatory skin disease, caused by a bacterium selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and still further preferably Staphylococcus aureus, the method comprising administering to the subject a compound of formula (I) according to the present invention and at least one antibiotic active against bacteria, preferably against bacteria selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably against Staphylococcus, and still further preferably against Staphylococcus aureus.

[0422] In another aspect, the present invention provides a method for preventing or treating a bacterial infection in a subject, comprising the step of administering to the subject in need of such prevention or treatment an effective amount of a compound of formula (I) according to the present invention. Preferably, the bacterial infection is caused by a bacterium selected from the genus Staphylococcus, Streptococcus or Clostridium, more preferably Staphylococcus, and still more preferably Staphylococcus aureus.

[0423] In another aspect, the present invention provides a method for preventing or treating a disease caused or exacerbated by Gram-positive quorum sensing bacteria, the method comprising administering to a subject in need of such prevention or treatment an effective amount of a compound of formula (I) according to the present invention.

[0424] Compound preparation

[0425] The compounds of the present invention can be prepared by a variety of methods, including standard chemical methods. Unless otherwise indicated, any previously defined substituents will continue to have the meanings previously defined. Illustrative general synthetic methods are set forth in the following schemes and can be easily adapted to prepare other compounds of the present invention. Specific preferred compounds of the present invention can be prepared according to the experimental procedures disclosed in the Examples section.

[0426] General procedures for the synthesis of compounds of formula (I) are described below in Reaction Schemes 1-3 and illustrated in the Examples section.

[0427] Preparation of compounds of formula (I)

[0428] The compounds of formula (I) of the present invention, wherein R1 to R9 are as defined above, can be prepared according to Scheme 1. 1 Appropriately substituted anthranilates (III) can be readily converted to the corresponding 2-azidobenzoates (II) by substitution with trimethylsilyl azide or trimethylsilyl azide (Barral, K. et al., Organic Letters (Org. Lett.) 2007, 9(9), 1809-1811). Treatment of (II) with substituted arylsulfonyl lactone nitrile (IV) in the presence of a base affords the desired triazoloquinazolinone of formula (I) (Lee, K. et al., Bioorganic Med. Chem. Lett. 2010, 20(5), 1767-1770; Jones, P. et al., Tetrahedron 2002, 58(50), 9973-9981).

[0429]

[0430] Solution 1

[0431] Preparation of intermediates

[0432] Intermediates of formula (IV) can be prepared according to Scheme 2 by reacting the corresponding commercially available arylsulfonyl chloride of formula (V) with chloroacetonitrile in the presence of sodium sulfite.

[0433]

[0434] Solution 2

[0435] Alternatively, the intermediate of formula (IV) can be prepared according to Scheme 3 by oxidation of the sulfide of formula (VI) in the presence of mCPBA (Anderson, MO et al. J. Med. Chem. 2012, 55(12), 5942-5950) or hydrogen peroxide (Tsui, GC et al. Org. Express 2011, 13(2), 208-211). The intermediate of formula (VI) can be prepared by alkylation of commercially available aryl thiols of formula (VII) with bromoacetonitrile in the presence of potassium carbonate (Anderson, MO et al. J. Med. Chem. 2012, 55(12), 5942-5950). Alternatively, the compound of formula (VI) can be prepared from commercially available anilines of formula (VIII) and bromoacetonitrile by copper-catalyzed S-transfer reaction (Li, Y. et al. Org. Express 2014, 16(10), 2692-2695).

[0436]

[0437] Solution 3

[0438] Highly preferred compounds of formula (I) according to the invention are listed in Table 1 by providing compound number, chemical structure and name.

[0439] Table 1: Highly preferred compounds of formula (I)

[0440]

[0441]

[0442]

[0443]

[0444]

[0445]

[0446]

[0447]

[0448] The synthesis and physical data characterization of particularly preferred compounds are described in the Examples section.Compound 34 was purchased from AK Scientific.

[0449] Examples

[0450] The present invention will now be described by means of the following non-limiting examples. Although specific embodiments of the present invention are described below, it will be appreciated by the skilled person that various changes and modifications may be made. Reference to preparations prepared in a manner similar to other preparations or by the general methods of other preparations may encompass variations in conventional parameters, such as time, temperature, processing conditions, subtle changes in reagent amounts, etc.

[0451] abbreviation

[0452] The following table provides definitions of certain abbreviations and symbols as used herein. It should be understood that the list is not exhaustive, but the meanings of those abbreviations and symbols not defined herein below will be apparent to one skilled in the art. In describing the present invention, chemical elements are identified according to the periodic table.

[0453]

[0454]

[0455] Proton NMR spectra were recorded on a Bruker DPX 300 MHz equipped with a 5 mm BBI probe, a Bruker AV400 MHz equipped with a 5 mm PABBO probe, a Bruker DRX 500 MHz equipped with a 5 mm PABBI probe, or a Bruker Avance III 600 spectrometer equipped with a 5 mm rt BBI probe. 1 H NMR) spectroscopy. Unless otherwise stated, DMSO-d 6 , C 5 D 5 N.CD 2 Cl 2 , Pyr-d5 or CDCl 3 The samples were recorded at 25°C as solvent.

[0456] The 2D spectra were acquired at 298 K on a Bruker Avance IIIHD 600 MHz NMR spectrometer (Bruker, Karlsruhe, Germany) equipped with a cryogenic triple resonance probe. 1 H, 15N HSQC spectra. Proton chemical shifts were referenced to the methyl signal of sodium 3-trimethylsilyl-[2,2,3,3-d4]-propionate at 0 ppm. Spectra were processed with Bruker TopSpin software package 3.5 and analyzed with Sparky software. The assignment of AgrAc was derived from the Biological Magnetic Resonance Library (BMRB) entry 18598. Chemical shifts are reported in parts per million (δ) into the low field from the internal standard tetramethylsilane (TMS). The abbreviations for NMR data are as follows: s = singlet, d = doublet, t = triplet, q = quartet, sep = septet, m = multiplet, app = apparent, br = broad. Mass spectra were obtained using electrospray (ES) ionization techniques. All temperatures are reported in degrees Celsius. Microwave heating was performed by a Biotage Initiator with Robot Sixty TM conduct.

[0457] Intermediate VI

[0458] Intermediate VI-1: 2-[2-methyl-4-(trifluoromethoxy)phenyl]sulfanylacetonitrile

[0459]

[0460] A mixture of sodium thiosulfate pentahydrate (Fluorochem, 1818 mg, 7.3 mmol), 2-bromoacetonitrile (Fluorochem, 878.5 mg, 7.3 mmol), copper (II) sulfate pentahydrate (Kemika, 26.12 mg, 0.105 mmol) and 2,2'-bipyridine (Fluorochem, 16.34 mg, 0.105 mmol) was stirred in MeOH / H 2 DCM (30mL) was added to 4- (trifluoromethoxy) phenylamine (ArkPharm, 200mg, 1.05mmol) and tert-butyl nitrite (Fluorochem, 186.7μL, 1.57mmol) in 0 (10mL / 20mL) and stirred at 80°C for 2 hours. The reaction mixture was concentrated under reduced pressure and DCM (30mL) was added. The organic phase was extracted and evaporated in vacuo to produce 150mg of brown oily residue, which was purified by flash chromatography (eluent cHex: EtOAc 7: 3) to obtain the title compound (97mg, 37.5%) as a light yellow oil. 1 HNMR (300MHz, CDCl 3 )δppm:7.57(d,J=8.6Hz,1H),7.17-7.06(m,2H),3.52(s,2H),2.51(s,3H).

[0461] Intermediates VI-2 to VI-8 were prepared analogously as described for VI-1, substituting those indicated in the table below for 2-methyl-4-(trifluoromethoxy)aniline. Modifications in the scheme and purification steps are also indicated.

[0462]

[0463]

[0464] 1 Purify by flash chromatography (eluent chex:EtOAc 9:1)

[0465] Intermediate IV

[0466] Intermediate IV-1: 2-(2,4-dimethylphenyl)sulfonylacetonitrile

[0467]

[0468] 2-Bromoacetonitrile (Alfa Aesar, 174 μL, 2.50 mmol) was dissolved in DMF (0.4 M), stirred in an ice bath, and then treated with 2,4-dimethylbenzenethiol (Enamine, 321 μL, 2.38 mmol) and K 2 CO 3 (691 mg, 5.00 mmol) and allowed to stir at 0 °C for 2 h. The reaction mixture was dissolved in excess H 2 O, and with Et 2 O and extracted 3 times. The combined organic extracts were washed twice with water and NaCl (saturated aqueous solution) and then concentrated in vacuo to produce 2-(2,4-dimethylphenyl)sulfanylacetonitrile with a yield of approximately 90%. 2-(2,4-dimethylphenyl)sulfanylacetonitrile (380 mg, 2.14 mmol) was then dissolved in DCM (0.4 M) and treated in batches with mCPBA (77.0%, 961 mg, 4.29 mmol) at 0°C. The reaction was stirred at room temperature under argon for 3 days. The reaction mixture was quenched with excess sodium sulfite solution and extracted twice with DCM. The organic layer was washed with saturated NaHCO 3 Aqueous solution, brine, MgSO 4 Dry and concentrate in vacuo to give the title compound (300 mg, 67%). 1 H NMR (300MHz, CD 2 Cl 2)δppm:7.95(d,J=8.0Hz,1H),8.32-8.25(m,2H),4.15(s,2H),2.69(s,3H),2.45(s,3H). [ES-MS]m / z 208(MH-).

[0469] Intermediate IV-2: 2-(4-chloro-2-methyl-phenyl)sulfonylacetonitrile

[0470]

[0471] 2-Bromoacetonitrile (Aldrich, 159 mg, 1.33 mmol) was dissolved in DMF (0.4 M), stirred in an ice bath, and then treated with 4-chloro-2-methylbenzenethiol (Fluorochem, 200 mg, 1.26 mmol) and K 2 CO 3 (348 mg, 2.52 mmol) and allowed to stir at 0 °C for 1 hour. The reaction mixture was dissolved in excess H 2 0 and use Et 2 The combined organic extracts were washed twice with water and NaCl (saturated aqueous solution), and then filtered through MgSO 4 Dry, filter and then concentrate in vacuo to give 2-(4-chloro-2-methylphenyl)sulfanylacetonitrile in 23% yield. 2-(4-chloro-2-methylphenyl)sulfanylacetonitrile was dissolved in glacial acetic acid (5 mL) and 30% H2O in water was added. 2 O 2 (413 μL). The solution was heated at 110°C for 1.5 hours. The reaction mixture was cooled to room temperature and evaporated under vacuum. Water was added and the residue was extracted with DCM. The organic layer was washed with saturated NaHCO 3 Wash with aqueous solution and MgSO 4 Dry, filter and concentrate in vacuo to give the title compound (107 mg, 92%). 1 H NMR (300MHz, DMSO-d6) δppm: 7.94 (d, J = 8.47Hz, 1H), 7.70 (d, J = 2.16Hz, 1H), 7.63 (dd, J = 8.44, 2.07Hz, 1H), 5.22 (s, 2H), 2.64 (s, 3H). [ES-MS]m / z 227(MH-).

[0472] Intermediate IV-3: 2-(2-methoxy-4-methylphenyl)sulfonylacetonitrile

[0473]

[0474] A mixture of 2-methoxy-4-methyl-benzenesulfonyl chloride (Santa Cruz, 200 mg, 0.906 mmol), sodium sulfite (183 mg, 1.45 mmol) and sodium bicarbonate (122 mg, 1.45 mmol) was suspended in a mixture of water (2.0 mL) and i-PrOH (0.5 mL). The resulting suspension was heated at 120 °C for 30 minutes by microwave irradiation. 2-Chloroacetonitrile (Aldrich, 2.72 mmol, 172 μL) was added to the reaction mixture, which was then heated at 120 °C for 20 minutes by microwave irradiation. NH 4 Cl (saturated aqueous solution, 15 mL), and the resulting suspension was extracted with EtOAc (3×10 mL). The organic layer was purified by MgSO 4 Dried, filtered and evaporated in vacuo.The crude product was purified by flash chromatography (cHex:EtOAc 4:1) to give the title compound as a colorless oil (177 mg, 87%). 1 H NMR (300MHz, DMSO-d6) δppm: 7.71 (d, J = 8.1Hz, 1H), 7.20 (s, 1H), 7.05-7.60 (m, 1H), 5.08 (s, 2H), 3.94 (s, 3H), 2.42 (s, 3H). [ES-MS]m / z224(MH-).

[0475] Intermediates IV-4 to IV-14 were prepared similarly as described for IV-3, substituting those indicated as starting materials in the table below for 2-methoxy-4-methyl-benzenesulfonyl chloride. Modifications in the purification steps are also indicated.

[0476]

[0477]

[0478] 1 (cHex:EtOAc 7:3)

[0479] 2 (cHex:EtOAc 1:1)

[0480] Intermediate IV-15: 2-[2-methyl-4-(trifluoromethoxy)phenyl]sulfonylacetonitrile

[0481]

[0482] Intermediate VI-1 (93 mg, 0.38 mmol) was dissolved in DCM (5 mL) and mCPBA (Apollo Scientific, 204 mg, 1.18 mmol) was added in portions at 0 °C. The mixture was stirred at room temperature overnight. mCPBA (Apollo Scientific, 102 mg, 1 eq) was added and stirring was continued at room temperature for 72 hours. Saturated Na 2 SO 3 Aqueous solution (10 mL) was added to the reaction mixture. The aqueous layer was extracted with DCM (10 mL x 2). The combined organic layers were washed with saturated NaHCO 3 The aqueous solution was washed with water and then brine, and the mixture was washed with MgSO 4 Dry, filter and concentrate in vacuo to give the title compound (84 mg, 80%) as a light yellow solid. 1 H NMR (300MHz, DMSO-d6) δppm: 8.07 (d, J = 8.8Hz, 1H), 7.63-7.51 (m, 2H), 5.26 (s, 2H), 2.69 (s, 3H). [ES-MS]m / z 278(MH-).

[0483] Intermediates IV-16 to IV-17 were prepared similarly as described for IV-15, substituting those indicated as starting materials in the table below for Intermediate VI-1, 2-[2-methyl-4-(trifluoromethoxy)phenyl]sulfanylacetonitrile. Modifications in the scheme and purification steps are also indicated.

[0484]

[0485]

[0486] 1 There was no second addition of mCPBA and the reaction mixture was stirred at room temperature for 96 hours.

[0487] 2 The compound was purified by flash chromatography, eluent cHex:EtOAc 10:0 to 5:5

[0488] Intermediate IV-18: 2-[4-methyl-2-(trifluoromethyl)phenyl]sulfonylacetonitrile

[0489]

[0490] Intermediate VI-4 (167 mg, 0.63 mmol) was dissolved in glacial acetic acid (5 mL) and 30% H 2 O 2(513 μL, 5 mmol). The solution was heated at 110°C for 5 hours. The reaction mixture was cooled to room temperature and evaporated under vacuum. Water was added and the residue was extracted with DCM. The organic layer was washed with saturated NaHCO 3 Wash with aqueous solution and MgSO 4 Dry, filter and concentrate in vacuo.The residue was purified by flash chromatography (eluent cHex:EtOAc 8:2) to give the title compound (98 mg, 54%). 1 H NMR (300 MHz, DMSO-d6) δ ppm: 8.15 (d, J = 8.2 Hz, 1H), 7.97 (s, 1H), 7.85 (d, J = 8.3 Hz, 1H), 5.21 (s, 2H), 2.52 (s, 3H, under solvent). [ES-MS] m / z 262 (MH-).

[0491] Intermediates IV-19 to IV-22 were prepared similarly as described for IV-18, substituting those indicated as starting materials in the table below for intermediate VI-4. Modifications in schemes and purification steps are also indicated.

[0492]

[0493] 1 The solution was heated at 110°C for 1.5 hours. No purification was performed. The residue was used as such in the next step.

[0494] 2 The solution was heated at 110° C. for 2 h. The residue was purified by flash chromatography (eluent cHex:EtOAc 6:4).

[0495] Intermediate II

[0496] Intermediate II-1: 2-azido-5-chlorobenzoic acid methyl ester

[0497]

[0498] 2-Amino-5-chloro-benzoic acid methyl ester (Enamine, 400 mg, 2.16 mmol) was dissolved in anhydrous ACN (2 mL) and cooled to 0°C. Tert-butyl nitrite (Sigma-Aldrich, 388 μL, 3.23 mmol) was added and the reaction mixture was stirred for 5 minutes. Azido (trimethyl) silane (Acros, 343 μL, 2.59 mmol) was added dropwise and the reaction mixture was stirred at room temperature for 2 hours. NaHCO was added. 3 The organic layer was washed with NaHCO 3The mixture was washed with saturated aqueous solution and brine, and then with MgSO 4 Dried and evaporated in vacuo to give the title compound as an orange solid (391 mg, 86%) which was used in the next step without further purification. 1 H NMR (300MHz, DMSO-d6) δppm: 7.77 (d, J = 2.5 Hz, 1H), 7.69 (dd, J = 8.6 & 2.6 Hz, 1H), 7.44 (d, J = 8.6 Hz, 1H), 3.82 (s, 3H).

[0499] Intermediates II-2 to II-4 were prepared by methods analogous to those described for II-1, substituting those indicated in the table below for 2-amino-5-chloro-benzoic acid methyl ester.

[0500]

[0501] Intermediate II-5: 2-azido-4-methoxy-benzoic acid methyl ester

[0502]

[0503] In N 2 To an ice-cold suspension of methyl 2-amino-4-methoxybenzoate (1 g, 5.4 mmol) in HCl (aqueous solution, 6 M, 27 mL) was added a solution of sodium nitrite (564 mg, 8.2 mmol) in water (7.0 mL) under N atmosphere. The resulting yellow solution was stirred at 0° C. for 20 minutes. 2 The resulting solution was added dropwise to an ice-cold solution of sodium azide (703 mg, 11 mmol) and sodium acetate (4437 mg, 54 mmol) in water (30 mL) under an atmosphere. The resulting solution was stirred at 0° C. for 15 minutes and then allowed to spontaneously reach room temperature for 2 hours. The mixture was heated to room temperature with Et 2 O (3 × 80 mL). The combined organic layers were washed with NaHCO 3 (saturated aqueous solution, 2 × 100 mL), washed with MgSO 4 Dry, filter and evaporate in vacuo to give the title product as a yellow oil (1.1 g, 94%). 1 H NMR (300MHz, DMSO-d6) δppm: 7.83-7.58(m,1H), 6.89-6.80(m,2H), 3.85(s,3H), 3.78(s,3H).

[0504] Intermediate II-6: 2-azido-benzoic acid methyl ester

[0505]

[0506] In N 2 To an ice-cold suspension of methyl 2-aminobenzoate (0.5 g, 3.3 mmol) in HCl (aq., 6 M, 17 mL) was added a solution of sodium nitrite (345 mg, 5 mmol) in water (4.0 mL) under N atmosphere. 2 The resulting yellow solution was stirred at 0°C for 20 minutes under an atmosphere and added dropwise to an ice-chilled solution of sodium azide (430 mg, 6.6 mmol) and sodium acetate (2713 mg, 33 mmol) in water (18 mL). The resulting solution was stirred at 0°C for 30 minutes and then allowed to stand to spontaneously reach room temperature for 1.5 hours. The mixture was heated to room temperature with Et 2 O (3 × 50 mL). The combined organic layers were washed with NaHCO 3 (saturated aqueous solution, 3×50 mL), washed with Na 2 SO 4 Dry, filter and evaporate in vacuo to give the title product as a yellow oil (413 mg, 70%). 1 H NMR (300MHz, DMSO-d6) δppm: 7.76 (d, J = 7.8 Hz, 1H), 7.63 (t, J = 7.6 Hz, 1H), 7.40 (d, J = 8.4 Hz, 1H) 7.28 (t, J = 7.6 Hz, 1H), 3.81 (s, 3H).

[0507] Intermediate II-7: 2-azido-4-bromo-benzoic acid methyl ester

[0508]

[0509] In N 2 To an ice-cold suspension of 2-amino-4-bromo-benzoic acid methyl ester (0.5 g, 2.2 mmol) in HCl (aq., 6 M, 17 mL) was added a solution of sodium nitrite (226 mg, 3.3 mmol) in water (3.0 mL) under N atmosphere. 2 The resulting yellow solution was stirred at 0°C for 20 minutes under an atmosphere and added dropwise to an ice-cold solution of sodium azide (212 mg, 3.3 mmol) and sodium acetate (3.57 g, 43 mmol) in water (22 mL). The resulting solution was stirred at 0°C for 20 minutes and then allowed to spontaneously reach room temperature for 2 hours. 2 O (3 × 50 mL). The combined organic layers were washed with NaHCO 3 (saturated aqueous solution, 3×50 mL), washed with Na 2 SO 4Dry, filter and evaporate in vacuo to give the title product as a yellow oil (410 mg, 74%).

[0510] Intermediate II-8: 2-Azido-6-methoxy-benzoic acid methyl ester

[0511]

[0512] In N 2 To an ice-cold suspension of 2-amino-6-methoxy-benzoic acid methyl ester (0.25 g, 1.4 mmol) in HCl (aq., 6 M, 8 mL) was added a solution of sodium nitrite (144 mg, 2.1 mmol) in water (1.5 mL) under N atmosphere. 2 The resulting yellow solution was stirred at 0°C for 20 minutes under an atmosphere and added dropwise to an ice-chilled solution of sodium azide (135 mg, 2.1 mmol) and sodium acetate (2.26 g, 28 mmol) in water (10 mL). The resulting solution was stirred at 0°C for 20 minutes and then allowed to stand to spontaneously reach room temperature for 1 hour. The mixture was heated to 40°C with Et 2 O (3 × 50 mL). The combined organic layers were washed with NaHCO 3 (saturated aqueous solution, 3×50 mL), washed with Na 2 SO 4 Dry, filter and evaporate under vacuum to give the title product as a yellow oil (260 mg, 91%) which was used in the next step without further purification.

[0513] Intermediates II-9 to II-12 were prepared by procedures analogous to those described for II-8, substituting those indicated in the table below for 2-amino-6-methoxy-benzoic acid methyl ester.

[0514]

[0515]

[0516] Intermediate II-13: 2-azido-5-methoxy-4-(2-methoxyethoxy)benzoic acid methyl ester

[0517]

[0518] To a solution of intermediate II-11 (130 mg, 0.58 mmol) in DMF (2 mL) were added 1-bromo-2-methoxy-ethane (82.1 μL, 0.87 mmol) and K 2 CO 3(242 mg, 1.75 mmol), and the reaction mixture was stirred at room temperature for 4 days. The reaction mixture was diluted with EtOAc (75 mL) and washed with saturated NH 4 Cl solution and brine, and washed with Na 2 SO 4 Dry, filter and evaporate in vacuo to give the title product (170 mg, 100%).

[0519] Intermediate II-14: methyl 2-azido-4-[2-[2-(2-methoxyethoxy)ethoxy]ethoxy]benzoate

[0520]

[0521] To a solution of intermediate II-12 (75 mg, 0.39 mmol) in DMF (1 mL) were added 1-[2-(2-bromoethoxy)ethoxy]-2-methoxyethane (135 μL, 0.78 mmol) and K 2 CO 3 (215 mg, 1.55 mmol), and the reaction mixture was stirred at room temperature overnight. The reaction mixture was diluted with EtOAc (150 mL) and washed with saturated NH 4 Cl solution and brine, and washed with Na 2 SO 4 Dry, filter and evaporate in vacuo to give the title product (130 mg, 98%).

[0522] Intermediate II-15: methyl 2-azido-4-[(2,2-dimethyl-1,3-dioxolan-4-yl)methoxy]benzoate

[0523]

[0524] To a solution of intermediate II-12 (75 mg, 0.39 mmol) in DMF (1 mL) were added 4-(bromomethyl)-2,2-dimethyl-1,3-dioxolane (66 μL, 0.47 mmol) and K 2 CO 3 (215 mg, 1.55 mmol), and the reaction mixture was stirred at 50°C for 4 days. The reaction mixture was diluted with EtOAc (150 mL) and washed with saturated NH 4 Cl solution and brine, and washed with Na 2 SO 4 Dry, filter and evaporate in vacuo to give the title product (85 mg, 71%).

[0525] Intermediate II-16: 2-azido-4-(2-hydroxyethoxy)-5-methoxy-benzoic acid methyl ester

[0526]

[0527] To a solution of intermediate II-11 (120 mg, 0.54 mmol) in DMF (2 mL) were added 2-bromoethanol (153 μL, 2.1 mmol) and K 2 CO 3 (594 mg, 4.3 mmol), and the reaction mixture was stirred at room temperature for 6 days. The reaction mixture was diluted with EtOAc (75 mL) and washed with saturated NH 4 Cl solution and brine, and washed with Na 2 SO 4 Dry, filter and evaporate in vacuo to give the title product (144 mg, 100%).

[0528] Compound of formula (I):

[0529] Compound 1: 7-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one

[0530]

[0531] A sodium methoxide solution was carefully prepared in situ by dissolving sodium (27.2 mg, 1.18 mmol) in anhydrous MeOH (0.1 M) under argon. To this solution was added intermediate IV-1 (112 mg, 0.536 mmol), and the solution was stirred at room temperature for 20 minutes. Intermediate II-1 (100 mg, 0.47 mmol) was added in portions, and the resulting orange solution was stirred at room temperature overnight. After concentration under reduced pressure, the residue was suspended in H 2 O and acidified to pH 2 with 1 N HCl. The precipitate was filtered and washed with water. The yellow solid was heated in EtOH and filtered to give the title compound (80.0 mg, 43.5%) as a white solid. 1 H NMR(300MHz,DMSO-d6)δppm:12.63(br s,1H),8.32(d,J=8.7Hz,1H),8.19(d,J=8.2Hz,1H),8.14(d,J=1.9Hz,1H),8 .1-7.9(m,1H),7.28(d,J=8.2Hz,1H),7.22(s,1H),2.59(s,3H),2.33(s,3H). [ES+MS]m / z 389(MH + ).

[0532] Compounds 2 to 30 of formula (I) of the present invention were prepared by a process analogous to that described for compound 1, replacing intermediates IV-1 and II-1 with the corresponding intermediates IV and II as indicated in the table below. Modifications in schemes and purification steps are also indicated.

[0533]

[0534]

[0535]

[0536]

[0537]

[0538] 1 The compound was triturated, filtered and washed with ACN

[0539] 2 The compound was recrystallized in EtOH

[0540] 3 The compound was purified by flash chromatography eluent DCM:MeOH (10:0.05)

[0541] 4 The mixture was washed with water, cold i-PrOH and cold Et 2 OWashing

[0542] 5 The reaction was stirred at 50 °C for 1 h and then at room temperature overnight.

[0543] 6 The reaction was stirred at room temperature overnight.

[0544] 7 Purification by preparative HPLC (ACN / NH 4 HCO 3 (10 mM), pH 10, 3 / 97 to 80 / 20, 10 min)

[0545] 8 Purification by preparative HPLC (ACN / NH 4 HCO 3 (10 mM), pH 10, 3 / 97 to 50 / 50, 10 min)

[0546] Compound 31: 8-methoxy-3-[2-methyl-4-(2H-tetrazol-5-yl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one

[0547]

[0548] Compound 31 can be prepared by [3+2] cycloaddition of compound 22 using sodium azide and copper(II) sulfate similarly as described below (Akhlaghinia, B. et al., J. Braz. Chem. Soc., 2012, 23(12), 2197-2203).

[0549] A mixture of compound 22 (0.0910 mmol, 40.0 mg), copper (II) sulfate pentahydrate (Kemika, 0.0018 mmol, 0.5 mg), sodium azide (Sigma-Aldrich, 0.091 mmol, 5.9 mg) in DMSO (0.4 mL) was stirred and heated at 140 °C for 1 hour. The reaction mixture was poured into HCl (aqueous solution 4 M), and the resulting suspension was extracted with EtOAc (3×30 mL). The aqueous layer was washed with NaHCO 3 (saturated aqueous solution) and extracted again with DCM / i-PrOH (7:2). The combined organic layers were washed with Na 2 SO 4 Drying, filtration and evaporation under vacuum gave the crude product, which was submitted to preparative HPLC purification (high pH, ​​method B) to afford the title compound (6.3 mg, 15.5%) as a white solid. 1 H NMR (500 MHz, Pyr-d5) δppm: 8.58-8.48 (m, 2H), 8.48-8.42 (m, 2H), 7.83 (d, J = 2.2 Hz, 1H), 7.20-7.15 (m, 1H, under solvent), 3.78 (s, 3H), 2.94 (s, 3H). [ES+MS] m / z 439 (MH + ).

[0550] Compound 32: 4-[(8-methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzamide

[0551]

[0552] Compound 32 can be prepared by hydrolysis of compound 22 using acetamide and palladium (II) chloride similarly as described below Maffioli, S. et al. Organic Letters 2005, 7, (13), 5237-5239.

[0553] To a solution of compound 22 (0.06 mmol, 25.0 mg) in a mixture of water / THF 1:3 (1.3 mL) were added acetamide (15 mg, 0.25 mmol) and PdCl2 To the 4-thiazolinyl esters (2.2mg, 0.012mmol), the mixture was stirred at room temperature for 5 hours. 1N NaOH solution (0.1mL) was added, and the reaction mixture was stirred at room temperature for 3 days. The reaction mixture was evaporated in a vacuum. Water was added to the residue, and the pH was adjusted to pH 2, to produce a brown precipitate. The precipitate was purified by flash chromatography (eluent DCM: MeOH 10: 0.05), to produce the title compound (6.39mg, 24%) as a beige solid. 1 H NMR(500MHz,Pyr-d5)δppm:9.07(br s.,1H),8.66(br s.,1H),8.54-8.50(m,1H),8.45-8.20(m,1H),8.25-8.20(m,2H),7.84(d,J=2.1Hz,1H),3.80(s,3H),2.92(s,3H). [ES+MS]m / z414(MH+).

[0554] Compound 33: 8-methoxy-3-[2-methyl-4-(5-methyl-4H-1,2,4-triazol-3-yl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one

[0555]

[0556] Compound 33 can be prepared by copper-catalyzed oxidative cyclization of compound 22 using acetamidine and copper(I) bromide similarly as described below Ueda, S. et al. J. Am. Chem. Soc. 2009 131(42), 15080-15081.

[0557] To a mixture of compound 22 (0.601 mmol, 25.0 mg), copper (I) bromide (0.003 mmol, 0.43 mg), cesium carbonate (0.180 mmol, 58.7 mg) and acetamidine hydrochloride (0.0901 mmol, 8.52 mg) was added DMSO (0.19 mL). The resulting mixture was stirred and heated at 120 ° C for 6 hours. The reaction mixture was cooled to room temperature and washed with EtOAc (5 mL) and NaHCO 3 The mixture was diluted with saturated aqueous solution (10 mL). The resulting suspension was extracted with EtOAc (3×10 mL). The combined organic layers were purified by MgSO 4 Dry, filter and evaporate in vacuo. 4 HCO 3 The residue was purified by HPLC (aq.sol. / MeCN 8:2) to give the title compound (5.5 mg, 19.5%) as a white solid.1 H NMR (500 MHz, Pyr-d5) δ ppm: 8.58-8.53 (m, 1H), 8.49-8.39 (m, 3H), 7.83 (d, J=1.95 Hz, 1H), 7.24-7.17 (m, 1H, under solvent), 3.79 (s, 3H), 2.99 (s, 3H), 2.49 (s, 3H). [ES+MS] m / z 452 (MH+).

[0558] Compound 35: 3-(2-chloro-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one

[0559]

[0560] In a nitrogen atmosphere, A 20% solution of sodium ethoxide (0.655 mL, 1.69 mmol) diluted in anhydrous EtOH (2 mL) with 100 molecular sieves and stirred for 2 hours under nitrogen atmosphere was added to a solution of intermediate IV-5 (194.5 mg, 0.85 mmol) in anhydrous EtOH (3 mL) and Molecular sieve suspension. The resulting mixture was stirred at room temperature for 15 minutes. Then a solution of intermediate II-6 (100 mg, 0.56 mmol) in anhydrous EtOH was slowly added, and the resulting light yellow solution was stirred at room temperature overnight. After filtering and concentrating under reduced pressure, the residue was purified by flash chromatography (DCM to 1% MeOH in DCM). The residue was dissolved in MeOH and washed with Et 2 O was precipitated. The residue was dried to give the title compound (8 mg, 4%) as a white solid. 1 H NMR (500 MHz, CDCl 3 )δppm:9.58(bs,1H),8.46-8.60(m,2H),8.34(d,J=8.3Hz,1H),7.97(t,J=8.0H z, 1H), 7.72 (t, J = 7.8Hz, 1H), 7.35 (d, J = 8.6Hz, 1H), 7.31 (s, 1H), 2.43 (s, 3H). [ES+MS]m / z 375(MH+).

[0561] Compound 36: 3-(2,4-Dimethylphenyl)sulfonyl-8-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one

[0562]

[0563] Compound 36 can be prepared by demethylation of the methoxy group of compound 5 using sodium hydroxide and 1-dodecanethiol similarly as described below. Chae, J. Arch. Pharm. R Res. 2008, 31(3), 305-309.

[0564] Compound 5 (40 mg, 0.102 mmol) and NaOH (12.2 mg, 0.306 mmol) were dissolved in NMP (0.4 mL), and 1-dodecanethiol (37 μL, 0.153 mmol) was added to the solution. The reaction mixture was stirred at 130 ° C for 15 minutes. Ethyl acetate (30 mL) was added to the reaction mixture and washed with 3×30 mL of water. The organic layer was purified by MgSO 4 Dried, filtered and evaporated to dryness.The residue was purified by flash chromatography (DCM to DCM:MeOH:NH3 (90:9:1.5) 10%-100%) to give the title compound (8 mg, 21%) as a white solid. 1 H NMR (500MHz, DMSO-d6) δppm: 12.13 (bs, 1H), 11.27 (s, 1H), 8.18 (d, J = 8.0Hz, 1H), 8.04 (d, J = 8.5Hz, 1H), 7.54 (d,J=2.8Hz,1H),7.27(d,J=8.2Hz,1H),7.07(dd,J=8.8,2.3Hz,1H),7.31(s,1H),2.57(s,3H),2.32(s,3H). [ES+MS]m / z 371(MH+).

[0565] Compounds of formula (I) 46 and 50 of the present invention were prepared by a procedure analogous to that described for compound 36, using those indicated in the table below as starting materials in place of compound 5. Modifications in schemes and purification steps are also indicated.

[0566]

[0567] 1 The reaction was stirred at 130 °C for 3 hours.

[0568] 2 The reaction was stirred at 130 °C for 2 hours.

[0569] Compound 37: 3-(2-Bromo-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one

[0570]

[0571] By dissolving sodium (13mg, 0.56mmol) in anhydrous EtOH (2mL) under nitrogen, carefully prepare sodium ethoxide solution in situ. Add intermediate IV-10 (61.3mg, 0.22mmol) to this solution, and stir the solution for 15 minutes. Add intermediate II-6 (33mg, 0.19mmol) dissolved in anhydrous EtOH (0.5mL), and the light yellow solution of gained is stirred at room temperature overnight. After concentrating under reduced pressure, by flash chromatography (DCM to DCM: MeOH: NH 3 The residue was purified by HPLC (ACN / HCOOH (1% v / v in water), 30 / 70 to 80 / 20, 14 min) to give the title compound (1.1 mg, 1.4%) as an orange solid. 1 H NMR (500 MHz, CDCl 3 )δppm: 9.60 (bs, 1H), 8.48-8.36 (m, 3H), 7.98 (t, J = 7.5Hz, 1H), 7.73 (t, J = 8.2Hz, 1H), 7.53 (s, 1H), 7.41 (d, J = 8.4Hz, 1H), 7.43 (s, 3H). [ES+MS]m / z 419,421(MH + ).

[0572] Compound 38: 3-(2-Bromo-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one

[0573]

[0574] To a solution of intermediate IV-1 (20.4 mg, 0.1 mmol) in anhydrous EtOH (0.5 mL) was added a 20% solution of NaOEt in EtOH (75.5 μL, 0.2 mmol), and the resulting solution was stirred at room temperature for 20 minutes. Then a solution of intermediate II-7 (25 mg, 0.1 mmol) in anhydrous EtOH (0.5 mL) was added, and the resulting light yellow solution was stirred at room temperature for 1 hour. Ethanol was evaporated, the residue was dissolved in water (3 ml), and the pH was adjusted to ~2, followed by extraction with EtOAc (~100 ml). The organic layer was purified by Na 2 SO 4 The mixture was dried and evaporated to dryness. The residue was purified by flash chromatography (DCM to DCM:MeOH:NH 3 The residue was purified by HPLC-MS / MS (90:9:1.5) 0-100%) to give the title compound (13 mg, 31%) as a white solid. 1 H NMR (400 MHz, CDCl3 )δppm:9.51(br.s,1H),8.54(d,J=1.6Hz,1H),8.22(d,J=8.8Hz,1H),8.06(d,J=8.4Hz,1H ),7.79(dd,J=8.4,1.6Hz,1H),7.19(d,J=8Hz,1H),7.12(s,1H),2.68(s,3H),2.36(s,3H). [ES+MS]m / z 433,435(MH + ).

[0575] Compound 39: 3-(2,4-dimethylphenyl)sulfonyl-6-methoxy-4H-triazolo[1,5-a]quinazolin-5-one

[0576]

[0577] To a solution of intermediate IV-1 (150 mg, 0.7 mmol) in anhydrous EtOH (2.5 mL) was added a 20% solution of NaOEt in EtOH (543 μL, 1.4 mmol), and the resulting solution was stirred at room temperature for 20 minutes. Then a solution of intermediate II-8 (174.6 mg, 0.84 mmol) in anhydrous EtOH (2 mL) was added, and the resulting light yellow solution was stirred at room temperature overnight. Ethanol was evaporated, the residue was dissolved in water (6 mL), and the pH was adjusted to ~2, followed by extraction with EtOAc (~100 ml). The organic layer was purified by Na 2 SO 4 The mixture was dried and evaporated to dryness. The residue was purified by flash chromatography (DCM to DCM:MeOH:NH 4 The residue was purified by 4% paraformaldehyde (CHCl3 0-100%) to give the title compound (60 mg, 22%) as a white solid. 1 H NMR (400 MHz, CDCl 3 )δppm:9.25(br.s,1H),8.06(d,J=8.4Hz,1H),7.96(d,J=8.4Hz,1H),7.81(t,J=8.4H z, 1H), 7.18 (d, J = 8Hz, 1H), 7.09-7.12 (m, 2H), 4.05 (s, 3H), 2.68 (s, 3H), 2.35 (s, 3H). [ES+MS]m / z 385(MH + ).

[0578] Compounds of formula (I) 42, 44, 47, 51, 52, 57, 59 and 60 of the present invention were prepared by a method similar to that described for compound 39, replacing intermediates IV-1 and II-8 with the corresponding intermediates IV and II as indicated in the table below. Modifications in schemes and purification steps are also indicated.

[0579]

[0580]

[0581] Compound 40: 3-(2,4-dimethylphenyl)sulfonyl-6-methoxy-4H-triazolo[1,5-a]quinazolin-5-one

[0582]

[0583] 1- bromo-3-methoxypropane (12 μL, 0.1mmol) and potassium carbonate (43.7mg, 0.3mmol) were added to a solution of compound 36 (50mg, 0.1mmol) in DMF (1mL), and the resulting solution was stirred at room temperature overnight. The starting material was not completely consumed, so 1- bromo-3-methoxypropane (12 μL, 0.1mmol) and potassium carbonate (43.7mg, 0.3mmol) were added, and the resulting solution was stirred at room temperature overnight. The reaction mixture was diluted in EtOAc (100mL) and washed with water (3×30mL). The aqueous layer was extracted with EtOAc (3×50mL). The organic layer was collected and purified by Na 2 SO 4 Dry and evaporate to dryness. Flash chromatography (DCM to DCM:MeOH:NH 4 The residue was purified by 4% paraformaldehyde (CHCl3 0-100%) to give the title compound (20 mg, 40%) as a white solid. 1 H NMR (400 MHz, CDCl 3 )δppm:9.59(bs,1H),8.38(d,J=8.88Hz,1H),8.21(d,J=7.99Hz,1H),7.89(s,1H),7.35-7.21(m,3H),4. 38(t,J=6.22Hz,2H),3.69(t,J=5.86Hz,2H),3.48(s,3H),2.81(s,3H),2.49(s,3H),2.31-2.18(m,2H). [ES+MS]m / z 443(MH + ).

[0584] Compounds of formula (I) 41, 43, 54 and 55 of the invention were prepared by a procedure analogous to that described for compound 40, substituting those indicated as starting materials in the table below for 1-bromo-3-methoxypropane. Modifications in schemes and purification steps are also indicated.

[0585]

[0586]

[0587] Compound 45: 8-(azetidin-1-yl)-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one

[0588]

[0589] To a solution of compound 42 (40 mg, 0.08 mmol) in dioxane (1.5 mL), azetidine (8.25 μL, 0.12 mmol), sodium tert-butoxide (11.8 mg, 0.12 mmol), chloro(2-dicyclohexylphosphino-2', 6'-di-isopropoxy-1,1'-biphenyl)[2-(2-aminoethylphenyl)]palladium(II), methyl tert-butyl ether adduct (RuPhos precatalyst, 6.6 mg, 0.008 mmol), and 2-dicyclohexylphosphino-2', 6'-diisopropoxy-1,1'-biphenyl (RuPhos, 3.8 mg, 0.008 mmol). The reaction mixture was heated at 120 ° C for 3 hours. The solvent was evaporated and the product was purified by flash chromatography (DCM to DCM: MeOH: NH 4 The residue was purified by 4% CO 2 OH (90:9:1.5) 0-100%) to give the title compound (20 mg, 59%) as a white powder. 1 H NMR (300 MHz, CDCl 3 )δppm:9.18(br.s,1H),8.07(d,J=8.7Hz,2H),7.17(d,J=8.1Hz,1H),7.09(s,1H),7.00(d,J=2.4Hz, 1H), 6.50 (dd, J = 8.7, 2.4Hz, 1H), 4.12 (t, J = 7.5Hz, 4H), 2.66 (s, 3H), 2.45-2.55 (m, 2H), 2.35 (s, 3H). [ES+MS]m / z 410(MH+).

[0590] Compounds of formula (I) 48 and 49 of the invention were prepared by a procedure analogous to that described for compound 45, substituting those indicated as starting materials in the table below for azetidine. Modifications in schemes and purification steps are also indicated.

[0591]

[0592] Compound 53: 3-(2,4-dimethylphenyl)sulfonyl-8-(2-hydroxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one

[0593]

[0594] 2-bromoethyl acetate (100 mg, 0.6 mmol) and potassium carbonate (222 mg, 1.6 mmol) were added to a solution of compound 36 (150 mg, 0.4 mmol) in DMF (1 mL), and the resulting solution was stirred at room temperature overnight. The starting material was not completely consumed, so 2-bromoethyl acetate (33.5 mg, 0.2 mmol) and potassium carbonate (55 mg, 0.4 mmol) were added, and the resulting solution was stirred at room temperature overnight. The reaction mixture was diluted in EtOAc (150 mL) and washed with water (2 × 10 mL). The organic layer was purified by Na 2 SO 4 The residue was dried and evaporated to dryness. The residue was purified by flash chromatography (DCM to DCM:MeOH:NH4OH (90:9:1.5) 0-100%). The residue was washed with Et 2 O and dried under vacuum. Then, it was suspended in water, acidified to pH ~ 2, extracted with DCM, dried over sodium sulfate, evaporated to dryness and washed with diethyl ether to give 2-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]ethyl acetate (86 mg, 46%). [ES+MS] m / z 457 (MH + ).

[0595] To a solution of 2-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]ethyl acetate (20 mg, 0.043 mmol) in MeOH:water (2 mL, 1:1) was added lithium hydroxide (10.3 mg, 0.43 mmol). The reaction mixture was stirred at room temperature for 2 hours. MeOH was evaporated in vacuo, and the aqueous layer was extracted with EtOAc (2×30 mL). The organic layer was purified by Na 2 SO 4 The mixture was dried and evaporated to dryness. The residue was purified by flash chromatography (DCM to DCM:MeOH:NH 4 The residue was purified by 4% CO 2 + / - 4-(4-(4-(4-piperidin-2-yl)-4-ol)-0.4% CO 2 0.5% 4-(4-piperidin-2-yl)-4-ol (90:9:1.5) 0-100%) to give the title compound (17 mg, 92%) as a white powder. 1H NMR (300MHz, DMSO-d6) δppm: 12.27 (bs, 1H), 8.14 (d, J = 8.21Hz, 1H), 8.08 (d, J = 8.86Hz, 1H), 7.66 (d, J = 2.38Hz, 1H ),7.29-7.15(m,3H),4.97(t,J=5.50Hz,1H),4.21(t,J=4.35Hz,2H),3.81-3.71(m,2H),2.55(s,3H),2.32(s,3H). [ES+MS]m / z 415(MH + ).

[0596] Compound 56: 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butyramide

[0597]

[0598] To compound 55 (150mg, 0.3mmol) solution in MeOH (20mL) add LiOH (27mg, 0.64mmol), and the resulting solution is stirred at room temperature overnight.Evaporated solvent, and the residue is dissolved in water (2.5mL), and acidified with HCl 2N solution.Filter precipitate and vacuum dry, to obtain 4- [[3- (2,4- dimethylphenyl) sulfonyl -5- oxygen subunit -4H- triazolo [1,5-a] quinazoline -8- bases] epoxide] butyric acid (40mg, 28%). 1 H NMR (300MHz, DMSO-d6) δppm: 12.26 (br.s, 1H), 12.18 (br.s, 1H), 8.18 (d, J=7.8Hz, 1H), 8.10 (d, J=8.1Hz, 1H), 7.68 (d, J= 2.4Hz,1H),7.21-7.29(n,3H),4.23(t,J=6.0Hz,2H),2.72(s,3H),2.41(t,J=7.2Hz,2H),2.33(s,3H),1.95-2.05(m,2H).

[0599] A solution of methyl 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butanoic acid (20 mg, 0.044 mmol), HOBt (10.1 mg, 0.066 mmol), DIPEA (30.5 μL, 0.175 mmol) and HATU (25 mg, 0.066 mmol) in DMF (1 mL) was stirred at room temperature for 5 minutes. Ammonium chloride (47 mg, 0.088 mmol) was then added, and the mixture was stirred at room temperature overnight. The reaction mixture was diluted with EtOAc (100 mL) and washed with saturated NH 4 Cl solution and brine, and washed with Na 2 SO 4 The mixture was dried and evaporated to dryness. The residue was purified by flash chromatography (DCM to DCM:MeOH:NH 4 The residue was purified by 4% paraformaldehyde (CHCl3 0-100%) to give the title compound (12 mg, 60%) as a white powder. 1 HNMR(300MHz,DMSO-d6)δppm:8.15(d,J=8.1Hz,1H),8.09(d,J=8.7Hz,1H),7.65(d,J=2.4Hz,1H),7.20-7.34( m,4H),6.79(s,1H),4.19(t,J=6.3Hz,2H),2.56(s,3H),2.32(s,3H),2.25(t,J=7.4Hz,2H),1.94-2.03(m,2H). [ES+MS]m / z 456(MH + ).

[0600] Compound 61: 3-(2,4-dimethylphenyl)sulfonyl-7-hydroxy-8-(2-hydroxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one

[0601]

[0602] To a solution of intermediate IV-1 (100 mg, 0.47 mmol) in anhydrous EtOH (1 mL) was added a 20% solution of NaOEt in EtOH (362 μL, 0.94 mmol), and the resulting solution was stirred at room temperature for 20 minutes. Then a solution of intermediate II-16 (199 mg, 0.47 mmol) in anhydrous EtOH (2 mL) was added, and the resulting light yellow solution was stirred at room temperature overnight. Ethanol was evaporated, the residue was dissolved in water (6 mL), and the pH was adjusted to ~2, followed by extraction with EtOAc (~250 ml). The organic layer was purified by Na 2 SO 4The mixture was dried and evaporated to dryness. The residue was purified by flash chromatography (DCM to DCM:MeOH:NH 4 The residue was purified by 4% paraformaldehyde (5% paraformaldehyde) (90:9:1.5) 0-100%) to give 3-(2,4-dimethylphenyl)sulfonyl-8-(2-hydroxyethoxy)-7-methoxy-4H-triazolo[1,5-a]quinazolin-5-one (75 mg, 36%) as a white solid. 1 H NMR (300MHz, DMSO-d6) δppm: 12.38 (br.s, 1H), 8.20, (d, J = 8.4Hz), 7.75 (s, 1H), 7.55 (s, 1H), 7.27 (d, J = 8.7Hz, 1H),7.21(s,1H),4.98(br.s,1H),4.22-4.26(m,2H),3.92(s,3H),3.78-3.80(m,2H),2.57(s,3H),2.33(s,3H). [ES+MS]m / z 445(MH + ).

[0603] 3-(2,4-dimethylphenyl)sulfonyl-8-(2-hydroxyethoxy)-7-methoxy-4H-triazolo[1,5-a]quinazolin-5-one (50 mg, 0.11 mmol) and NaOH (13.5 mg, 0.34 mmol) were dissolved in NMP (1.5 mL), and 1-dodecanethiol (40.4 μL, 0.17 mmol) was added to the solution. The reaction mixture was stirred at 130 ° C for 3 hours. The reaction mixture was cooled to room temperature. Ethyl acetate (300 mL) was added to the reaction mixture and washed with 3×50 mL of water. The organic layer was purified by MgSO 4 Dried, filtered and evaporated to dryness.The residue was purified by flash chromatography (DCM to DCM:MeOH:NH3 (90:9:1.5) 10%-100%) to give the title compound (7 mg, 14%) as a white solid. 1 H NMR (500MHz, DMSO-d6) δppm: 12.22 (br.s, 1H), 10.08 (s, 1H), 8.19, (d, J = 8.5Hz), 7.72 (s, 1H), 7.49 (s, 1H), 7.28 (d, J=9.0Hz,1H),7.22(s,1H),4.96(t,J=6Hz,1H),4.24(t,J=4.5Hz,2H),3.78-3.81(m,2H),2.57(s,3H),2.33(s,3H). [ES+MS]m / z 431(MH+).

[0604] 1 H, 15N HSQC NMR spectrum:

[0605] 2D 1 H, 15 N HSQC spectra (96 scans) were typically acquired on 100 μM or 200 μM 15N-AgrAc samples, respectively. 1 H and 15 There are 3072 and 180 points in the N dimension. All spectra were acquired in the presence of 3% DMSO-d6.

[0606] For each sample tested, 400 μL of 15N-AgrAc at 100 μM in [50 mM NaPi pH 6.3; 100 mM NaCl 3 mM THP; 5% D2O; + TMSP] was mixed with 13 μL of a stock solution of the compound (dissolved in DMSO-d6). 13 μL of DMSO-d6 was added for control experiments. In each NMR sample, the final DMSO-d6 concentration was 3%. After a centrifugation step (a few minutes at ~7000×g), the supernatant was transferred to a shigemi NMR tube. The samples were analyzed on a 600 MHz spectrometer using a sample changer. For each tube, a 1D 1 H spectroscopy and 2D 1 H, 15 N-HSQC.

[0607] Figure 2 Compound 34 and AgrA C The chemical shift perturbations observed upon binding showed that these inhibitors indeed bound to the C-terminal domain of AgrA.

[0608] MIC:

[0609] According to CLSI guidelines, the minimum inhibitory concentration (MIC) was determined in cation-adjusted Mueller-Hinton (CA-MHB) broth by the broth microdilution method. From overnight culture plates, cells were resuspended in 0.9% (w / v) saline solution and bacterial inoculum was prepared at 5×10^5 CFU / ml in CA-MHB. Compounds were serially diluted two-fold in CA-MHB and 10 μL of this 10× concentrated sample was added to a 96-well plate. Finally, 90 μL of bacterial suspension was added to the compound. Cover the plate and incubate at 35°C without shaking for 18 hours. Each experiment contained antibiotics as quality control. The MIC was determined visually as the lowest concentration of the compound that prevented visible growth of bacteria and the data of the plate was scanned.

[0610] Lethal dose 50% (LD 50 ):

[0611] Human hepatocellular carcinoma cells (HepG2) engineered to stably express human secreted embryonic alkaline phosphatase (hSEAP) were used for LD50 determination. Cells were cultured in 10 cm petri dishes in EMEM (EBSS) + 2 mM glutamine + 1% non-essential amino acids (NEAA) + 10% fetal bovine serum (FBS) + 1% penicillin / streptomycin (PS) (Sigma) at 37°C in 5% CO 2 For LD50 determination, 20.000 cells per well were seeded into clear 96-well tissue culture plates and incubated at 37°C in 5% CO. 2 Incubate overnight at 37°C for cell attachment. The next morning, the medium was replaced with fresh medium containing two-fold serial dilutions of compound or DMSO (solvent control) in the range of 0.8-100 μM. Plates were incubated at 37°C, 5% CO 2 For SEAP quantification, culture supernatants were collected and heat-inactivated at 65°C for 15 min, followed by 10 μL of heat-inactivated supernatant, 70 μL of MilliQ and 100 μL of 2× SEAP buffer (20 mM homoarginine, 1 mM MgCl 2 , 21% diethanolamine, adjusted to pH 9.8 with HCl) were mixed in a fresh 96-well flat-bottom plate (Greiner). Enzyme activity was measured for 25 minutes by determining the absorbance at 405 nm using a microplate reader, and the specific SEAP activity was calculated using the Lambert-Beer rule within the linear range of absorbance. LD 50 Compounds >100 μM were considered non-cytotoxic.

[0612] Table 2: MIC and LD of highly preferred compounds of formula (I) 50 Biological data.

[0613]

[0614]

[0615] Hemolysis assay:

[0616] The hemolytic assay is a phenotypic assay to measure lysis of red blood cells (RBC) mediated by exotoxin collected from supernatants (SN) of S. aureus cultures. The assay was developed to evaluate the efficacy of compounds in reducing exotoxin expression by inhibiting AgrA.

[0617] Two hemolytic assays were performed. In the first hemolytic assay (hemolytic assay I), an overnight culture of MRSA (USA300 isolate) was grown at OD 600The cells were inoculated at 0.1 into tubes containing 1 mL of fresh TSB and 10 μM compound (preliminary test, fixed concentration) or 30 / 10 / 3.3 / 1.1 and 0.37 μM compound (IC50 determination). The cultures were incubated at 37°C at 220 rpm for 8 hours, after which the cell density was measured and the OD was calculated by diluting with fresh medium. 600 Adjust to 6.0. The culture was passed through a 0.2-μm filter and used immediately for hemolysis assay. The filtrate with toxin was diluted serially in PBS, and dilutions from 1:2 to 1:256 were tested. Hemolytic activity was assessed using a modification of the process described by Sully et al. Briefly, defibrinated rabbit blood (10% washed pooled cells, Rockland) was diluted 1:5 in PBS to a cell concentration of 2%. The diluted filtrate including toxin was mixed with red blood cells (100uL each) 1:1. Blood cells treated with PBS or 0.4% TX-100 were used to determine the baseline of no lysis and complete lysis, respectively. The reaction was mixed by gently pipetting and incubated at 37°C for 1 hour. After incubation, the plate was centrifuged at room temperature at 1000×g for 5 minutes. A 30-μL aliquot of the supernatant was transferred to a 96-well U-shaped plate, and the absorbance at 405nm was measured. The values ​​of the PBS control were subtracted from the experimental data and the difference was normalized to the absorbance value of the TX-100 lysate control. These values ​​were plotted against the concentration of the extract to generate activity curves, which were fitted to a four-parameter logistic model (EC 50 Compounds were further analyzed in the presence of 30 / 10 / 3.3 / 1.1 / 0.37 μM compound. For IC 50 Determine, using the OD of all 5 concentrations 600 The lower the value, the more active the compound. Compounds 12, 18 and 26 are at IC 50 The most effective compounds were at approximately 1 μM.

[0618] In the second hemolytic assay (hemolytic assay II), compounds were serially diluted from 32 μg / ml to 0.0156 μg / ml using a 2-fold dilution in cation-adjusted Mueller Hinton broth (CA-MHB). DMSO (0.9%, N=6) and BV2985 (16 μg / ml, n=6) were used to determine the baselines of no inhibition and complete inhibition of lysis, respectively. 250 μl of the prepared compound dilutions and controls were transferred to a 96-deep well plate. Scrape the Staphylococcus aureus MRSA strain (USA300 isolate) from a fresh directional agar plate and suspend it in a saline solution in which the turbidity was adjusted to an OD610 of 0.1 (equivalent to a 0.5 McFarland scale). The bacterial suspension was subsequently diluted 100× in CA-MHB and mixed 1:1 with the compound dilution, resulting in a 2-fold dilution of the latter. The plates were incubated at 37°C, 600 rpm for 18 hours, after which the cultures were filter sterilized using 96-well, 0.2 μm filter plates (Corning) by centrifugation at 4500 rpm for 2 minutes at room temperature on top of a stacked receiver plate. Hemolytic activity was assessed using a modification of the procedure described by Sully et al. Briefly, defibrinated rabbit blood (10% washed pooled cells, Rockland) was diluted 1:5 in PBS to a cell concentration of 2%. The diluted filtrate including the toxin was mixed 1:1 with red blood cells (100 μl each). The reaction was mixed by gentle pipetting and incubated at 37°C for 1 hour. After incubation, the plates were centrifuged at 1000 × g for 5 minutes at room temperature. A 30 μL aliquot of the supernatant was transferred to a 96-well U-shaped plate, and the absorbance at 405 nm was measured. The value of the complete inhibition control (HTS007753) was subtracted from the experimental data, and the difference was then normalized to the value of the non-inhibition control (DMSO). These values ​​were plotted against the concentration of the test compound to generate inhibition concentration response curves, which were fitted to a four-parameter logistic model (IC50; IC95) using GraphPad. The minimum effective concentration (MEC) was determined directly from the raw data as the compound concentration that resulted in an absorbance <2× the mean of the complete inhibition control. The lower the value, the more active the compound.

[0619] Table 3: Biological data obtained by hemolytic assay for very preferred compounds of formula (I).

[0620]

[0621] Quantitative RT-PCR analysis of psma and RNAIII:

[0622] An overnight culture of MRSA (USA300 isolate) was inoculated into a plate containing a starting OD 6000.05 in 25 mL of fresh TSB in a 100 mL Erlenmeyer flask. Grow the culture at 37 °C at 220 rpm until it reaches an OD of 600 The culture medium of one milliliter is transferred to each well of 12-well plate, and 10 μM compound or 1% v / v DMSO is added. The culture is grown for two hours at 37 ℃ under 300rpm shaking. Cells are collected by centrifugation, cell metabolism and RNA degradation are stopped by adding 500 μL RNAlater, and total RNA is extracted using PureLink RNA minikit (Ambion) according to the manufacturer's advice. Residual DNA contaminants are removed using a kit (Ambion) without Turbo DNA. Quantitative reverse transcription PCR (qRT-PCR) is carried out on CFX96 real-time PCR detection system (BioRad) using GoTaq 1 step RT-qPCR system kit (Promega). Extracted RNA (25 ng) was mixed with 10 μL of GoTaq master mix, 1 μL of 8 μM primers, 0.4 μL of GoScript RT mix, and 0.3 μL of carboxy-X-rhodamine (CXR) standard dye in a total volume of 20 μL. As a housekeeping gene, RNA polymerase sigma factor D (rpoD) was quantified, and psmα and RNAIII expression were normalized to rpoD using the comparative ΔΔCT (where CT is the threshold cycle) method.

[0623] Sequence information (5'-3') of the probe used for transcription detection in qRT-PCR:

[0624] psmα-fw TATCAAAAGCTTAATCGAACAATTC (SEQ ID NO: 1);

[0625] psmα-rev CCCCTTCAAATAAGATGTTCATATC (SEQ ID NO: 2);

[0626] RNAIII-fw TTCACTGTGTCGATAATCCA (SEQ ID NO:3);

[0627] RNAIII-revTGATTTCAATGGCACAAGAT(SEQ ID NO:4);

[0628] rpoD-fw GAGGATCAGGAAGCACAAAGTC (SEQ ID NO: 5);

[0629] rpoD-rev GCCGTCATCAAGACCAAATC (SEQ ID NO: 6).

[0630] Table 4: Biological data on the expression of the AgrA target gene in the presence of highly preferred compounds of formula (I).

[0631] Compound Downregulation of PSMα expression at 10 μM Downregulation of RNAIII expression at 10 μM Shavlin + 0 3 ++ ++ 5 ++ + 12 ++ ++ 18 ++ ++ 26 ++ ++ 34 ++ ++

[0632] The major effector of AgrA is RNAIII under the control of the P3 promoter (see Figure 1 ). RNAIII itself is then responsible for the regulation of multiple virulence genes including α-hemolysin. In contrast, psmα is directly regulated by AgrA. In the presence of a strong AgrA inhibitor, expression of both genes was significantly reduced. Legend: 0 = down-regulation between 0 and 10-fold, + down-regulation > 10-fold (1log 10 ), ++ down-regulated >100-fold (2log 10 ). All compounds tested were significantly more effective than salaverin in downregulating psmα and RNAIII.

[0633] Expression and purification of AgrAc:

[0634] To produce 15 N-labeled AgrA C-terminal domain (AgrAc), E. coli BL21(DE3) cells were grown in M9-based semi-rich medium: M9 medium supplemented with [ 15 N]-NH 4 Cl (1.5 g / L), unlabeled D-glucose (4 g / L) Isogro- 15 N powder growth medium (1 g / L, 10%; Sigma-Aldrich). When the optical density at 600 nm reached a value of ∼0.8-1.0, the temperature was lowered to 18°C ​​and protein production was induced with 0.4 mM isopropyl β-D-1-thiogalactopyranoside. Cells were harvested by centrifugation 20 hours after induction and resuspended in lysis buffer [50 mM Na 2 HPO 4 / NaH 2 PO 4 (NaPi) pH7.8, 500 mM NaCl, protease inhibitor cocktail (complete EDTA-free, Roche) and lysed using a homogenizer (20000 psi). After removing cell debris by centrifugation (30,000 × g), the resulting supernatant was submitted to Ni equilibrated in [50 mM NaPi pH7.8, 500 mM NaCl] 2+Affinity chromatography (HisTrap column, 5 ml; GE Healthcare Europe). AgrAc elution was performed with a steep gradient of imidazole (0-400 mM) and fractions were analyzed by SDS-PAGE (4-20%). 15 The N-AgrAc fraction was dialyzed against 50 mM NaPi, pH 6.8, 100 mM NaCl, 4 mM DTT. The protein was concentrated to 200 μM using a Vivaspin Turbo 4 concentrator (5 kDa cutoff, Sartorius Stedim Biotech, Aubagne, France), filtered at 0.2 μm, flash frozen in liquid nitrogen, and then stored at -80 ° C. Protein concentration was estimated based on its UV absorbance at 280 nm.

Claims

1. A compound of formula (I), in R1 is independently selected from halogen, C1-C3 alkyl optionally substituted with one or more R11, or C1-C3 alkoxy; R5 is H; R3 is selected from halogen, CN, C1-C6 alkyl optionally substituted by one or more R11, C1-C6 alkoxy optionally substituted by one or more R11, C3-C6 cycloalkyl optionally substituted by one or more R11, -N(R12)(R13), -C(O)N(R12)(R13), -N(R14)-C(O)-R15, -C(O)-OR16, and a 5- to 6-membered aromatic heterocycle containing 1 to 4 nitrogen heteroatoms optionally substituted by one or more R17; R2 and R4 are independently selected from H, halogen, C1-C6 alkyl optionally substituted with one or more R11; R6 and R9 are independently selected from H, halogen, hydroxy, C1-C3 alkyl optionally substituted with one or more F, C1-C3 alkoxy optionally substituted with one or more F; R7 and R8 are independently selected from H, halogen, hydroxy, NO2, CN, C1-C6 alkyl optionally substituted by one or more R11, C1-C6 alkoxy optionally substituted by one or more R11, C3-C6 cycloalkyl optionally substituted by one or more R11, -C n Alkyl-N(R12)(R13), wherein n=0-3, -C n Alkyl-C(O)N(R12)(R13), wherein n=0-3, -C n Alkyl-N(R14)-C(O)-R15, wherein n=0-3, -C n Alkyl-C(O)-OR16, wherein n=0-3, -O(C1-C3 alkyl-O) m -C1-C3 alkyl-OR10, wherein m=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, where n=0-3, -OC n Alkyl-R18, wherein n=0-3, and a 4- to 6-membered saturated, partially saturated or aromatic heterocyclic ring containing 1 to 4 oxygen or nitrogen heteroatoms, optionally substituted by one or more R17; R10 is selected from H and C1-C6 alkyl optionally substituted with one or more R11; The one or more R11 are independently selected from Cl, F and hydroxyl; R12, R13, R14, R15 and R16 are independently selected from H, C1-C6 alkyl optionally substituted by one or more R11, C3-C6 cycloalkyl optionally substituted by one or more R11, -SO2-C1-C6 alkyl optionally substituted by one or more R11, or wherein said R12 and R13 together with the nitrogen to which they are attached form a 4 to 6 membered saturated, partially saturated or aromatic heterocyclic ring containing 1 to 4 oxygen or nitrogen heteroatoms optionally substituted by one or more R17; The one or more R17 are independently selected from halogen, hydroxyl, NO2, CN, -N(R12)(R13), -C(O)-R16, -C(O)-OR16, -C n Alkyl-OR16, wherein n=0-3, C1-C6 alkyl optionally substituted by one or more R11, and C1-C6 alkoxy optionally substituted by one or more R11; R18 is selected from N(R12)(R13), -OR10, -C(O)-R16, -C(O)-OR16, -C(O)-N(R12)(R13), CN, and a 4- to 6-membered saturated, partially saturated or aromatic heterocyclic ring containing 1 to 4 oxygen or nitrogen heteroatoms optionally substituted with one or more R17; and Pharmaceutically acceptable salts and tautomers of the compounds of formula (I).

2. The compound according to claim 1, wherein R2 and R4 are H.

3. A compound according to any one of the preceding claims, wherein one or two of R6, R7, R8 and R9 are independently not H.

4. The compound according to claim 1, wherein said R1 is independently selected from H, C1-C3 alkyl, halogen or C1-C3 alkoxy.

5. The compound according to claim 1, wherein said R1 is independently selected from H, C1-C2 alkyl, CF3 and halogen.

6. The compound according to claim 1, wherein the R3 is selected from halogen, C1-C3 alkyl optionally substituted by one or more R11, C1-C3 alkoxy optionally substituted by one or more R11, and C3-C6 cycloalkyl optionally substituted by one or more R11.

7. The compound according to claim 1, wherein the R3 is selected from C1-C3 alkyl or C3-C5 cycloalkyl optionally substituted with one to three R11.

8. The compound according to claim 1, wherein the R7 and R8 are independently selected from H, halogen, CN, hydroxyl, C1-C3 alkyl optionally substituted with one or more F or hydroxyl, C1-C3 alkoxy optionally substituted with one or more F, C3-C6 cycloalkyl, -O(C1-C3 alkyl-O) n -C1-C3 alkyl-OR10, wherein n=0-3, -C n Alkyl-OR16, wherein n=0-3, -NH-C n Alkyl-R18, wherein n=0-3; -OC n Alkyl-R18, wherein n=0-3, and a 4- to 6-membered saturated, partially saturated or aromatic heterocyclic ring containing 1 to 4 oxygen or nitrogen heteroatoms, optionally substituted by one or more R17.

9. A compound, wherein the compound is selected from 7-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 6-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 8-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 9-Chloro-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-5-oxyde-4H-triazolo[1,5-a]quinazoline-8-carbonitrile; 3-(2,4-dimethylphenyl)sulfonyl-8-fluoro-4H-triazolo[1,5-a]quinazoline-5-one; 8-methoxy-3-(2-methoxy-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(4-isopropoxy-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2-Chloro-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(4-bromo-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2-fluoro-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 8-methoxy-3-(4-methoxy-2-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; N-[4-[(8-methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-phenyl]acetamide; 3-(4-Fluoro-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2-bromo-4-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 8-methoxy-3-[2-methyl-4-(trifluoromethoxy)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(4-Chloro-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 4-[(8-methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzonitrile; 4-[(8-Methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzoic acid; 4-[(8-Methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzoic acid ethyl ester; 8-methoxy-3-[4-methyl-2-(trifluoromethyl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(4-cyclopropyl-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(4-ethyl-2-methyl-phenyl)sulfonyl-8-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-7-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 8-methoxy-3-[2-methyl-4-(2H-tetrazol-5-yl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 4-[(8-methoxy-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-3-yl)sulfonyl]-3-methyl-benzamide; 8-methoxy-3-[2-methyl-4-(5-methyl-4H-1,2,4-triazol-3-yl)phenyl]sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2-Chloro-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-Dimethylphenyl)sulfonyl-8-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2-Bromo-4-methyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 8-Bromo-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-6-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-8-(3-methoxypropoxy)-4H-triazolo[1,5-a]quinazolin-5-one; 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butyronitrile; 3-(2,4-Dimethylphenyl)sulfonyl-8-iodo-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-8-(2-methoxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2-Bromo-4,5-dimethyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 8-(azetidin-1-yl)-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-Dimethylphenyl)sulfonyl-7-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-9-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-8-(2-morpholinoethylamino)-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-8-(tetrahydropyran-4-ylamino)-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-9-hydroxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2-Chloro-4,6-dimethyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2-Bromo-4,6-dimethyl-phenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-8-(2-hydroxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one; 2-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]acetonitrile; 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butanoic acid methyl ester; 4-[[3-(2,4-dimethylphenyl)sulfonyl-5-oxyylidene-4H-triazolo[1,5-a]quinazolin-8-yl]oxy]butanamide; 3-(2,4-dimethylphenyl)sulfonyl-8-hydroxy-7-methoxy-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-7-hydroxy-8-(2-methoxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one; 3-(2,4-dimethylphenyl)sulfonyl-8-[2-[2-(2-methoxyethoxy)ethoxy]ethoxy]-4H-triazolo[1,5-a]quinazolin-5-one; 8-[(2,2-dimethyl-1,3-dioxolan-4-yl)methoxy]-3-(2,4-dimethylphenyl)sulfonyl-4H-triazolo[1,5-a]quinazolin-5-one; and 3-(2,4-Dimethylphenyl)sulfonyl-7-hydroxy-8-(2-hydroxyethoxy)-4H-triazolo[1,5-a]quinazolin-5-one.

10. Use of the compound according to any one of claims 1 to 9, or a pharmaceutically acceptable salt and tautomer thereof, in the preparation of a medicament for reducing the virulence of bacteria, wherein the bacteria is Staphylococcus aureus.

11. The use according to claim 10, wherein the compound inhibits the synthesis of one or more virulence factors by the bacterium, wherein the one or more virulence factors are selected from PSMα and RNAIII.

12. Use of a compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt and tautomer thereof in the preparation of a medicament for preventing or treating a disease in a subject, wherein the disease is an infection or inflammatory disease caused or aggravated by bacteria, wherein the bacteria is Staphylococcus aureus.

13. The use according to claim 12, wherein the Staphylococcus aureus is antibiotic-resistant Staphylococcus aureus.

14. The use according to claim 13, wherein the antibiotic-resistant Staphylococcus aureus is methicillin-resistant Staphylococcus aureus.

15. A pharmaceutical composition comprising at least one compound according to any one of claims 1 to 9, or a pharmaceutically acceptable salt and tautomer thereof, and a pharmaceutically acceptable excipient.

16. The pharmaceutical composition according to claim 15, further comprising at least one antibiotic or anti-inflammatory agent active against bacteria.

17. The pharmaceutical composition according to claim 16, wherein the pharmaceutical composition comprises at least one antibiotic active against bacteria.

18. The pharmaceutical composition according to claim 17, wherein the bacterium is a bacterium selected from the genus Staphylococcus, Streptococcus or Clostridium.

19. The pharmaceutical composition according to claim 18, wherein the bacterium is of the genus Staphylococcus.

20. The pharmaceutical composition according to claim 19, wherein the bacterium is Staphylococcus aureus.

Images