Condensed tetracyclic compounds and their application in medicine

Abstract

The present invention relates to a fused tetracyclic compound and its application in medicine, especially its application as a medicine for treating and / or preventing hepatitis B. Specifically, the present invention relates to a compound represented by general formula (I) or its stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs, and their use as medicine, especially their use as medicine for treating and / or preventing hepatitis B. The variables are as defined in the specification.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and relates to a fused tetracyclic compound and its use as a medicine, especially as a medicine for treating and / or preventing hepatitis B. The present invention also relates to a composition composed of these fused tetracyclic compounds and other antiviral agents, and its use in treating and / or preventing hepatitis B virus (HBV) infection. Background Art

[0002] Hepatitis B virus belongs to the family of Hepatoviridae. It can cause acute and / or progressive chronic diseases. Hepatitis B virus can also cause many other clinical manifestations in pathological morphology - especially chronic inflammation of the liver, cirrhosis and carcinogenesis of liver cells. According to the World Health Organization, 2 billion people have been infected with HBV, about 350 million are chronically infected, and about 1 million people die each year from liver failure, cirrhosis and primary hepatocellular carcinoma (HCC) caused by HBV infection.

[0003] Currently, the main treatment for chronic hepatitis B (CHB) is antiviral therapy. Interferon α (IFN-α) and pegylated IFN-α and five nucleoside (acid) analogs (lamivudine, adefovir dipivoxil, entecavir, telbivudine and tenofovir dipivoxil) have been approved by the US Food and Drug Administration (FDA) for clinical treatment. Interferon is the first anti-HBV drug approved by the FDA. It mainly eliminates the virus through direct antiviral effects and inducing the body's immune response. However, its application is subject to many restrictions due to its low response rate, multiple side effects, high price and limited treatment targets. The common point of nucleoside (acid) drugs against HBV is that they specifically act on viral DNA polymerase and have a strong effect of inhibiting viral replication. Patients have better tolerance to drugs than interferon. However, the widespread and long-term use of nucleoside (acid) drugs can induce DNA polymerase mutations to form drug resistance, leading to the continuous emergence of drug-resistant strains, making the treatment far from achieving the ideal therapeutic effect.

[0004] Therefore, there is still a clinical need for new compounds that can be effectively used as drugs for treating and / or preventing hepatitis B. Summary of the invention

[0005] The present invention relates to a novel fused tetracyclic compound and its use in preparing a drug for treating and preventing HBV infection. The inventors have found that the novel fused tetracyclic compound of the present invention has the advantages of good pharmacokinetic properties, good solubility, low toxicity, good liver microsome stability, and good inhibitory activity on the generation or secretion of HBsAg and the replication of HBV DNA, and has a good application prospect in anti-HBV. In particular, the compounds involved in the present invention and the pharmaceutically acceptable compositions thereof can also effectively inhibit HBV infection.

[0006] In one aspect, the present invention relates to a compound as represented by formula (I) or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of the compound as represented by formula (I),

[0007]

[0008] Among them, R 1 For R 1a O- or R a R b N-;

[0009] X is CR 7 or N;

[0010] Ring A is the following structure:

[0011] wherein the formula (I-1), formula (I-2), formula (I-3), formula (I-4), formula (I-5), formula (I-6), formula (I-7) and formula (I-8) are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 2 replaced by;

[0012] X1 is -O-, -S- or -NR d -; X2 is -CH2-, -S-, -S(=O)-, -S(=O)2- or -NR d -; each X3 and X6 are independently -O-, -S-, -CH2-, -S(=O)-, -S(=O)2- or -NR d -; each X4 and X5 are independently -O-, -S-, -CH2-, -S(=O)-, -S(=O)2- or -NR d -;

[0013] Or ring A is At the same time, X is N, wherein the formula (I-10) and the formula (I-11) are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 2 replaced by;

[0014] Each R 2 Deuterium, F, Cl, Br, =O, C 1-6 Alkyl, C 1-6 Alkylamino, C 1-6 Alkoxy, C 2-6 Alkynyl, C 2-6 Alkenyl, C 3-7 Cycloalkyl, phenyl or a heterocyclic group consisting of 3 to 6 ring atoms, wherein the C 1-6 Alkyl, C 1-6 Alkylamino, C 1-6 Alkoxy, C 2-6 Alkynyl, C 2-6 Alkenyl, C 3-7 Cycloalkyl, phenyl and heterocyclic groups consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0015] or two R attached to the same carbon atom 2 Together with the carbon atom to which it is attached, it forms C 3-6 Cycloalkyl or -(C=O)-, wherein the C 3-6 The cycloalkyl group is unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0016] Each R d are independently H or C 1-6 Alkyl, wherein the C 1-6 The alkyl group is unsubstituted or substituted by 1, 2 or 3 groups selected from F, Cl, Br, CN, HO-, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 substituted by an alkylamino substituent;

[0017] R 3 For hydrogen, deuterium, F, Cl, Br, hydroxyl, cyano, C 1-6 Alkyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10 Aryl, heteroaryl consisting of 5-10 ring atoms or R 10 -C 0-4 Alkylene-O-, wherein the C 1-6 Alkyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10 Aryl, heteroaryl consisting of 5-10 ring atoms and R 10 -C 0-4-C in alkylene-O- 0-4 Alkylene - each independently unsubstituted or substituted with 1, 2, 3 or 4 R g replaced by;

[0018] R 10 for hydrogen, deuterium, R 11 O-、C 1-6 Alkyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, C 6-10 Aryl or heteroaryl consisting of 5 to 10 ring atoms, wherein the C 1-6 Alkyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, C 6-10 The aryl group and the heteroaryl group consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R j replaced by;

[0019] Each R j and R g are independently deuterium, F, Cl, Br, CN, =O, HO-, HOOC-, R 11 O-、R 12 -S(=O)2-、R 13 -(C=O)-, R 14 -S(=O)2-O-、R 15 -S(=O)2-N(R c )-、R 16 -N(R c )-S(=O)2-、R 17 -(C=O)-N(R c )-S(=O)2-, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl consisting of 5 to 10 ring atoms, wherein the C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10The aryl group and the heteroaryl group consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0020] Each R 11 , R 12 , R 12a , R 13 , R 13a , R 14 , R 15 , R 16 and R 17 are independently hydrogen, deuterium, R a R b N-、C 1-6 Alkyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, C 6-10 Aryl, C 6-10 Aryl C 1-3 Alkylene or heteroaryl composed of 5-10 ring atoms, wherein the C 1-6 Alkyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, C 6-10 Aryl, C 6-10 Aryl C 1-3 The alkylene group and the heteroaryl group consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, =O, HOOC-, R a R b NS(=O)2-, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Haloalkoxy, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-7 Cycloalkyl, heteroaryl composed of 5-6 ring atoms, heterocyclic group composed of 3-6 ring atoms, C 1-6 Alkoxy C 1-4 Alkylene or C 1-4 Alkylamino C 1-4 substituted by an alkylene substituent;

[0021] Each R w are independently deuterium, F, Cl, Br, HO-, HOOC-, =O, amino, C 1-6 Alkyl, C 1-6 Alkoxy, C1-6 Alkylthio, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, tert-butyloxycarbonyl, C 1-6 Alkyl-S(=O)2-, C 3-6 Cycloalkyl-S(=O)2- or C 3-7 Cycloalkyl, wherein the C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, tert-butyloxycarbonyl, C 1-6 Alkyl-S(=O)2-, C 3-6 Cycloalkyl-S(=O)2- and C 3-7 The cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, OH, =O, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Haloalkoxy or C 1-6 substituted by an alkylamino substituent;

[0022] Each R 4 , R 5 , R 6 , R 7 , R 8 and R 9 are independently hydrogen, deuterium, F, Cl, Br, R 12a -S(=O)2-、R 13a -(C=O)-, C 1-6 Alkyl, C 1-6 Alkylamino, C 1-6 Alkoxy, C 2-6 Alkynyl, C 2-6 Alkenyl, C 3-7 Cycloalkyl, phenyl, heteroaryl composed of 5-6 ring atoms or heterocyclic group composed of 3-10 ring atoms, wherein the C 1-6 Alkyl, C 1-6 Alkylamino, C 1-6 Alkoxy, C 2-6 Alkynyl, C 2-6 Alkenyl, C 3-7 Cycloalkyl, phenyl, heteroaryl consisting of 5-6 ring atoms and heterocyclyl consisting of 3-10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0023] or R 6 , R 4 and together with the atoms to which they are attached, form a carbocyclic group consisting of 5-6 ring atoms or a heterocyclic group consisting of 5-6 ring atoms, wherein the carbocyclic group consisting of 5-6 ring atoms and the heterocyclic group consisting of 5-6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0024] Each R 1a , R a , R b and R c H, deuterium, C 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 6-10 aryl, a heterocyclic group consisting of 3 to 6 ring atoms, or a heteroaryl group consisting of 5 to 10 ring atoms, wherein the C 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 6-10 The aryl group, the heterocyclic group consisting of 3-6 ring atoms and the heteroaryl group consisting of 5-10 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 The amino group is substituted with an alkylamino group.

[0025] In some embodiments, the ring A of the present invention is the structure shown below:

[0026] Wherein, the formula (II-1), formula (II-2), formula (II-3), formula (II-4), formula (II-5), formula (II-6), formula (II-7), formula (II-8), formula (II-9), formula (II-10), formula (II-11), formula (II-12), formula (II-13), formula (II-14), formula (II-15), formula (II-16), formula (II-17), formula (I-5), formula (I-6) and formula (I-7) are each independently unsubstituted or substituted by 1, 2, 3 or 4 R 2 replaced by;

[0027] Or ring A is At the same time, X is N, wherein the formula (I-10) and the formula (I-11) are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 2 replaced by;

[0028] Each R d is independently H, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl or tert-butyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl are each independently unsubstituted or substituted by 1, 2 or 3 groups selected from F, Cl, Br, CN, HO-, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy or C 1-4 substituted by an alkylamino substituent;

[0029] Among them, each R 2 Has the meaning described in the present invention.

[0030] In some embodiments, the R 3 For hydrogen, deuterium, F, Cl, Br, hydroxyl, cyano, C 1-4 Alkyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms, heteroaryl consisting of 6 ring atoms, or R 10 -C 0-3 Alkylene-O-, wherein the C 1-4 Alkyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms, heteroaryl consisting of 6 ring atoms, and R 10 -C 0-3 -C in alkylene-O- 0-3 Alkylene - each independently unsubstituted or substituted with 1, 2, 3 or 4 R g replaced by;

[0031] R 10 for hydrogen, deuterium, R 11 O-、C 1-4 Alkyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein the C 1-4 Alkyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R j replaced by;

[0032] Among them, each R 11 , R g and R j Has the meaning described in the present invention.

[0033] In some embodiments, the R 3 R is hydrogen, deuterium, F, Cl, Br, hydroxyl, cyano, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, ethynyl, propargyl, propynyl, 1-butylynyl, 2-butylynyl, 3-butylynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, R 10 -O-、R 10 -CH2-O-, R 10 -(CH2)2-O- or R 10 -(CH2)3-O-, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, R 10 -CH2-, R in -CH2-O- 10 -(CH2)2- and R in -(CH2)2- 10 The -(CH2)3- in -(CH2)3-O- is each independently unsubstituted or substituted with 1, 2, 3 or 4 R g replaced by;

[0034] R 10 for hydrogen, deuterium, R 11O-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl R, 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), j replaced by;

[0035] Among them, each R 11 , R g and R j Has the meaning described in the present invention.

[0036] In some embodiments, each R described in the present invention j and R g are independently deuterium, F, Cl, Br, CN, =O, HO-, HOOC-, R 11 O-、R 12 -S(=O)2-、R 13 -(C=O)-, R 14 -S(=O)2-O-、R 15 -S(=O)2-N(R c )-、R 16 -N(R c )-S(=O)2-、R 17 -(C=O)-N(R c )-S(=O)2-, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, C 3-6Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein the C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0037] Each R 11 , R 12 , R 12a , R 13 , R 13a , R 14 , R 15 , R 16 and R 17 are independently hydrogen, deuterium, R a R b N-、C 1-4 Alkyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, phenyl C 1-2 an alkylene group, a heteroaryl group consisting of 5 ring atoms, or a heteroaryl group consisting of 6 ring atoms, wherein the C 1-4 Alkyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, phenyl C 1-2 The alkylene, the heteroaryl consisting of 5 ring atoms and the heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, =O, HOOC-, R a R b NS(=O)2-, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Haloalkoxy, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, phenyl, C 3-6 Cycloalkyl, heteroaryl composed of 5 ring atoms, heteroaryl composed of 6 ring atoms, heterocyclic group composed of 3-6 ring atoms, C 1-4Alkoxy C 1-3 Alkylene or C 1-4 Alkylamino C 1-3 substituted by an alkylene substituent;

[0038] Among them, each R 12a , R 13a , R a , R b , R c and R w Has the meaning described in the present invention.

[0039] In some embodiments, each R described in the present invention j and R g are independently deuterium, F, Cl, Br, CN, =O, HO-, HOOC-, R 11 O-、R 12 -S(=O)2-、R 13 -(C=O)-, R 14 -S(=O)2-O-、R 15 -S(=O)2-N(R c )-、R 16 -N(R c )-S(=O)2-、R 17 -(C=O)-N(R c )-S(=O)2-, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-1-propoxy, 2-butoxy, C 1-3 Alkylthio, C 1-3 Alkylamino, C 2-4 Alkenyl, C 2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl , sec-butyl, tert-butyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-l-propoxy, 2-butoxy, C 1-3 Alkylthio, C 1-3 Alkylamino, C 2-4 Alkenyl, C 2-4 alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0040] Each R 11 , R 12 , R 12a , R 13 , R 13a , R 14 , R 15 , R 16 and R 17 are independently hydrogen, deuterium, R a R b N-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, phenyl C 1-2 Alkylene, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, phenyl C 1-2 The alkylene, furanyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, =O, HOOC-, R a R b NS(=O)2-, amino, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Alkoxy, C 1-3 Alkylthio, C 1-3 Haloalkoxy, C 1-3 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, phenyl, C 3-6 Cycloalkyl, heteroaryl composed of 5 ring atoms, heteroaryl composed of 6 ring atoms, heterocyclic group composed of 3-6 ring atoms, C 1-3 Alkoxy C 1-2 Alkylene or C 1-3 Alkylamino C 1-2 substituted by an alkylene substituent;

[0041] Among them, each R 12a , R 13a , R a , R b , R c and R w Has the meaning described in the present invention.

[0042] In some embodiments, each R described in the present invention ware independently deuterium, F, Cl, Br, HO-, HOOC-, =O, amino, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, tert-butyloxycarbonyl, C 1-4 Alkyl-S(=O)2-, cyclopropyl-S(=O)2-, cyclopentyl-S(=O)2-, cyclohexyl-S(=O)2- or C 3-6 Cycloalkyl, wherein the C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, tert-butyloxycarbonyl, C 1-4 Alkyl-S(=O)2-, cyclopropyl-S(=O)2-, cyclopentyl-S(=O)2-, cyclohexyl-S(=O)2- and C 3-6 The cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, OH, =O, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Haloalkoxy or C 1-4 substituted by an alkylamino substituent;

[0043] Each R 4 , R 5 , R 6 , R 7 , R 8 and R 9 are independently hydrogen, deuterium, F, Cl, Br, R 12a -S(=O)2-、R 13a -(C=O)-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, C 2-4 Alkynyl, C 2-4 alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furanyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl or a heterocyclic group consisting of 3 to 6 ring atoms, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4Alkylamino, C 1-4 Alkoxy, C 2-4 Alkynyl, C 2-4 Alkenyl, C 3-6 Cycloalkyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl and heterocyclic radicals of 3 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0044] or R 6 , R 4 and together with the atoms to which they are attached form a cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein the cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0045] Among them, each R 12a and R 13a Has the meaning described in the present invention.

[0046] In some embodiments, each R described in the present invention w are independently deuterium, F, Cl, Br, HO-, HOOC-, =O, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 alkenyl, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, tert-butyloxycarbonyl ((CH3)3C-OC(=O)-), C 1-4 alkyl-S(=O)2-, cyclopropyl-S(=O)2-, cyclopentyl-S(=O)2-, cyclohexyl-S(=O)2-, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 alkenyl, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, tert-butyloxycarbonyl ((CH3)3C-OC(=O)-), C 1-4Alkyl-S(=O)2-, cyclopropyl-S(=O)2-, cyclopentyl-S(=O)2-, cyclohexyl-S(=O)2-, cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, OH, =O, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Haloalkoxy or C 1-4 substituted by an alkylamino substituent;

[0047] Each R 4 , R 5 , R 6 , R 7 , R 8 and R 9 are independently hydrogen, deuterium, F, Cl, Br, R 12a -S(=O)2-、R 13a -(C=O)-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, C 2-4 alkyl, cyclohexyl, phenyl, furanyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, C 2-4 substituted with 1, 2, 3 or 4 Rw replaced by;

[0048] or R 6 , R 4 and together with the atoms to which they are attached form a cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein the cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0049] Among them, each R 12a and R 13a Has the meaning described in the present invention.

[0050] In some embodiments, the compounds described herein, wherein each of the R 2 are independently deuterium, F, Cl, Br, =O, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, C 2-4 Alkynyl, C 2-4 Alkenyl, C 3-6 Cycloalkyl, phenyl or a heterocyclic group consisting of 3-6 ring atoms, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, C 2-4 Alkynyl, C 2-4 Alkenyl, C 3-6 Cycloalkyl, phenyl and heterocyclic groups consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0051] or two R attached to the same carbon atom 2 The carbon atom to which it is attached forms a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or -C(=O)-, wherein the cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0052] Each R 1a , R a , R b and R c are independently H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkoxy, C 2-4 Alkenyl, C 2-4 Alkynyl, C3-6 Cycloalkyl, phenyl, a heterocyclic group consisting of 3-6 ring atoms, a heteroaryl group consisting of 5 ring atoms, or a heteroaryl group consisting of 6 ring atoms, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkoxy, C 2-4 Alkenyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, phenyl, heterocyclic group consisting of 3-6 ring atoms, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy or C 1-4 substituted by an alkylamino substituent;

[0053] Among them, each R w Has the meaning described in the present invention.

[0054] On the other hand, the present invention also provides a pharmaceutical composition comprising the compound of the present invention, optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient or a combination of the excipients.

[0055] In some embodiments, the pharmaceutical composition of the present invention further comprises other anti-HBV drugs.

[0056] In some embodiments, in the pharmaceutical composition described herein, the other anti-HBV drug is a HBV polymerase inhibitor, an immunomodulator or an interferon.

[0057] In some embodiments, the pharmaceutical composition described in the present invention, wherein the other anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simu-leukin, clavudine, emtricitabine, famciclovir, interferon, Baoganling CP, Intefen, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mivotilide, nitazoxanide, polyethylene glycol interferon α-2a, ribavirin, rointerferon-A, sizoran, Euforavac, Ampligen, Phosphazid, Heplisav, interferon α-2b, levamisole or propagermanium.

[0058] On the other hand, the present invention also provides the use of the compound or the pharmaceutical composition in the preparation of a drug for preventing, treating or alleviating viral diseases in patients.

[0059] In some embodiments, in the use described in the present invention, the viral disease refers to hepatitis B virus infection or a disease caused by hepatitis B virus infection.

[0060] In other embodiments, the use described in the present invention, wherein the disease caused by hepatitis B virus infection refers to cirrhosis or hepatocellular carcinoma.

[0061] On the other hand, the present invention also provides the use of the compound or the pharmaceutical composition in the preparation of a drug for inhibiting the production or secretion of HBsAg and / or for inhibiting the production of HBV DNA.

[0062] On the other hand, the present invention relates to the use of the compound or pharmaceutical composition in the preparation of a drug for preventing, treating or alleviating hepatitis B disease in a patient.

[0063] Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV symptoms in a patient, the method comprising administering to the patient a pharmaceutically acceptable effective dose of a compound of the present invention.

[0064] Another aspect of the present invention relates to a method for preventing, treating or alleviating HBV symptoms in a patient, the method comprising administering to the patient a pharmaceutical composition containing a compound of the present invention in a pharmaceutically acceptable effective dose.

[0065] Another aspect of the present invention relates to the use of a compound of the present invention in the preparation of a medicament for preventing, treating or curing HBV disease in a patient and reducing its severity.

[0066] Another aspect of the present invention relates to the use of a pharmaceutical composition comprising the compound of the present invention in the preparation of a medicament for preventing or treating HBV disease in a patient and reducing its severity.

[0067] Another aspect of the present invention relates to a method for inhibiting HBV infection, which comprises contacting cells with a compound or composition of the present invention at a dose effective to inhibit HBV. In some other embodiments, the method further comprises contacting cells with other anti-HBV agents.

[0068] Another aspect of the present invention relates to a method for treating HBV disease in a patient, the method comprising administering to the patient an effective therapeutic amount of a compound of the present invention or a composition thereof. In some other embodiments, the method further comprises administering other HBV treatments.

[0069] Another aspect of the present invention relates to a method for inhibiting HBV infection in a patient, the method comprising administering to the patient an effective therapeutic amount of a compound of the present invention or a composition thereof. In some other embodiments, the method further comprises administering other anti-HBV treatments.

[0070] Another aspect of the present invention relates to methods for preparing, isolating and purifying the compounds encompassed by formula (I).

[0071] The foregoing description only summarizes certain aspects of the present invention, but is not limited to these aspects. These aspects and other aspects will be described in more detail and complete below.

[0072] Detailed description of the invention

[0073] Definitions and general terms

[0074] The present invention will list the literature corresponding to the determined specific content in detail, and the embodiments are accompanied by diagrams of structural formulas and chemical formulas. The present invention is expected to cover all options, variants and equivalents, which may be included in the existing invention field as defined in the claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which can be applied to the practice of the present invention. The present invention is by no means limited to the description of methods and materials. There are many documents and similar materials that are different from or conflict with the present application, including but not limited to the definition of terms, the usage of terms, the technology described, or the scope controlled by the present application.

[0075] The following definitions shall apply to the present invention unless otherwise indicated. For the purposes of the present invention, the chemical elements are those according to the Periodic Table of the Elements, CAS version and the Handbook of Chemicals, 75, th Ed, 1994. In addition, the general principles of organic chemistry are defined in "Organic Chemistry," Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry," by Michael B. Smith and Jerry March, John Wiley & Sons, New York: 2007, and all contents are incorporated by reference.

[0076] As described in the present invention, the compounds of the present invention are substituted with one or more substituents, such as the general formula compounds above, or as the specific examples in the embodiments, subclasses, and classes of compounds included in the present invention. In general, the term "substituted" means that one or more hydrogen atoms in a given structure are replaced by a specific substituent. Unless otherwise indicated, a substituted group may have a substituent substituted at each substitutable position of the group. When more than one position in the given structural formula can be substituted by one or more substituents selected from a specific group, the substituents may be substituted at each position in the same or different manner. In various parts of this specification, the substituents of the compounds disclosed in the present invention are disclosed according to group types or ranges. It is particularly noted that the present invention includes each independent secondary combination of each member of these group types and ranges. For example, the term "C 1-6 "Alkyl" specifically refers to methyl, ethyl, C3 alkyl, C4 alkyl, C5 alkyl and C6 alkyl as disclosed independently.

[0077] In addition, it should be noted that, unless explicitly stated otherwise, the description methods used in the present invention, "each... is independently" and "... are each independently" and "... are independently" can be interchanged and should be understood in a broad sense, which can mean that in different groups, the specific options expressed by the same symbols do not affect each other, or that in the same group, the specific options expressed by the same symbols do not affect each other.

[0078] The term "alkyl" used in the present invention includes saturated straight or branched monovalent hydrocarbon groups of 1 to 20 carbon atoms, wherein the alkyl group may be independently and optionally substituted by one or more substituents described in the present invention. In some embodiments, the alkyl group contains 1 to 12 carbon atoms, in other embodiments, the alkyl group contains 1 to 8 carbon atoms, in other embodiments, the alkyl group contains 1 to 6 carbon atoms, in other embodiments, the alkyl group contains 1 to 4 carbon atoms, and in other embodiments, the alkyl group contains 1 to 3 carbon atoms. Further examples of alkyl groups include, but are not limited to, methyl (Me, -CH3), ethyl (Et, -CH2CH3), n-propyl (n-Pr, -CH2CH2CH3), isopropyl (i-Pr, -CH(CH3)2), n-butyl (n-Bu, -CH2CH2CH2CH3), 2-methylpropyl or isobutyl (i-Bu, -CH2CH(CH3)2), 1-methylpropyl or sec-butyl (s-Bu, -CH(CH3)CH2CH3), tert-butyl (s-Bu, -CH(CH3)CH2CH3), Butyl (t-Bu, -C(CH3)3), n-pentyl (-CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3)CH2CH2CH3), 3-pentyl (-CH(CH2CH3)2), 2-methyl-2-butyl (-C(CH3)2CH2CH3), 3-methyl-2-butyl (-CH(CH3)CH(CH3)2), 3-methyl-1-butyl (-CH2CH2CH(CH3)2), 2-methyl-1-butyl (- 2-Hexyl (-CH(CH3)CH2CH2CH3), 3-Hexyl (-CH(CH2CH3)(CH2CH2CH3)), 2-methyl-2-pentyl (-C(CH3)2CH2CH2CH3), 3-methyl-2-pentyl (-CH(CH3)CH(CH3)CH2CH3), 4-methyl-2-pentyl (-CH( CH3)CH2CH(CH3)2), 3-methyl-3-pentyl (-C(CH3)(CH2CH3)2), 2-methyl-3-pentyl (-CH(CH2CH3)CH(CH3)2), 2,3-dimethyl-2-butyl (-C(CH3)2CH(CH3)2), 3,3-dimethyl-2-butyl (-CH(CH3)C(CH3)3), 3,3-dimethyl-butyl (-CH2CH2C(CH3)3), n-heptyl, n-octyl, and the like.

[0079] The term "haloalkyl" means an alkyl group substituted with one or more halogen atoms, wherein alkyl has the meaning as described herein. In some embodiments, the haloalkyl group contains 1-12 carbon atoms; in other embodiments, the haloalkyl group contains 1-10 carbon atoms; in other embodiments, the haloalkyl group contains 1-8 carbon atoms; in other embodiments, the haloalkyl group contains 1-6 carbon atoms; in other embodiments, the haloalkyl group contains 1-4 carbon atoms; in other embodiments, the haloalkyl group contains 1-3 carbon atoms. Such examples include, but are not limited to, -CF3, -CH2CF3, etc.

[0080] The term "carbonyl", whether used alone or in combination with other terms (such as "aminocarbonyl" or "acyloxy"), refers to -(C=O)-.

[0081] The terms "alkylamino" and "alkylamino" are used interchangeably and include "N-alkylamino" and "N,N-dialkylamino" wherein the amino group is independently substituted by one or two C 1-12 In some embodiments, the alkylamino group is one or two C 1-12 The alkyl group is a lower alkylamino group attached to the nitrogen atom. In some embodiments, the alkylamino group is C 1-6 In some embodiments, the alkylamino group is C 1-4 Suitable alkylamino groups can be monoalkylamino or dialkylamino, such examples include, but are not limited to, N-methylamino, N-ethylamino, N,N-dimethylamino, N,N-diethylamino, N-propylamino, N,N-dipropylamino, and the like, wherein the alkylamino groups can be independently unsubstituted or substituted with one or more substituents described herein.

[0082] The term "alkylene" refers to a saturated divalent hydrocarbon group obtained by removing two hydrogen atoms from a straight or branched saturated hydrocarbon group. Unless otherwise specified, the alkylene group contains 1-12 carbon atoms, in some other embodiments, the alkylene group contains 1-6 carbon atoms, in some other embodiments, the alkylene group contains 1-4 carbon atoms, in some other embodiments, the alkylene group contains 1-3 carbon atoms. In some other embodiments, the alkylene group contains 1-2 carbon atoms. Such examples include methylene (-CH2-), ethylene (-CH2CH2-), propylene (-CH2CH2CH2-), isopropylene (-CH(CH3)CH2-), butylene (-CH2CH2CH2CH2-), pentylene (-CH2CH2CH2CH2CH2-), hexylene (-CH2CH2CH2CH2CH2CH2-), heptylene (-CH2CH2CH2CH2CH2CH2CH2-), octylene (-CH2CH2CH2CH2CH2CH2CH2CH2-), and the like, wherein the alkylene groups independently may be unsubstituted or substituted with one or more substituents described herein.

[0083] The term "alkenyl" refers to a straight or branched monovalent hydrocarbon radical containing 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein at least one position of CC is sp 2 Double bond, wherein the alkenyl group may be independently unsubstituted or substituted with one or more substituents described in the present invention, including "cis", "trans" or "Z", "E" isomers, specific examples of which include, but are not limited to, vinyl (-CH=CH2), propenyl (-CH=CHCH3), allyl (-CH2CH=CH2) and the like.

[0084] The term "alkynyl" refers to a straight or branched monovalent hydrocarbon group containing 2-12 carbon atoms, or 2-8 carbon atoms, or 2-6 carbon atoms, or 2-4 carbon atoms, wherein at least one position of CC is an sp triple bond, wherein the alkynyl group may be independently unsubstituted or substituted with one or more substituents described in the present invention, specific examples include, but are not limited to, ethynyl (-C≡CH), propargyl (-CH2C≡CH), propynyl (-C≡C-CH3), 1-ynylbutyl (-CH2CH2C≡CH), 2-ynylbutyl (-CH2C≡CCH3), 3-ynylbutyl (-C≡CCH2CH3) and the like.

[0085] The term "alkoxy" means an alkyl group attached to the rest of the molecule via an oxygen atom, wherein the alkyl group has the meaning as described herein. Unless otherwise specified, the alkoxy group contains 1-20 carbon atoms, in some embodiments, the alkoxy group contains 1-12 carbon atoms, in other embodiments, the alkoxy group contains 1-8 carbon atoms, in other embodiments, the alkoxy group contains 1-6 carbon atoms, in other embodiments, the alkoxy group contains 1-4 carbon atoms, and in other embodiments, the alkoxy group contains 1-3 carbon atoms.

[0086] Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH3), ethoxy (EtO, -OCH2CH3), 1-propoxy (n-PrO, n-propoxy, -OCH2CH2CH3), 2-propoxy (i-PrO, i-propoxy, -OCH(CH3)2), 1-butoxy (n-BuO, n-butoxy, -OCH2CH2CH2CH3), 2-methyl-1-propoxy (i-BuO, i-butoxy, -OCH2CH(CH3)2), 2-butoxy (s-BuO, s-butoxy, -OCH(CH3)CH2CH3), 2-methyl-2-propoxy (t-BuO, t-butoxy, -OC( CH3)3), 1-pentyloxy (n-pentyloxy, -OCH2CH2CH2CH2CH3), 2-pentyloxy (-OCH(CH3)CH2CH2CH3), 3-pentyloxy (-OCH(CH2CH3)2), 2-methyl-2-butoxy (-OC(CH3)2CH2CH3), 3-methyl-2-butoxy (-OCH(CH3)CH(CH3)2), 3-methyl-l-butoxy (-OCH2CH2CH(CH3)2), 2-methyl-l-butoxy (-OCH2CH(CH3)CH2CH3), and the like, wherein the alkoxy groups may independently be unsubstituted or substituted with one or more substituents described herein.

[0087] The term "haloalkoxy" means an alkoxy group substituted with one or more halogen atoms, wherein alkoxy has the meaning as described herein. In some embodiments, the haloalkoxy group contains 1-12 carbon atoms; in other embodiments, the haloalkoxy group contains 1-10 carbon atoms; in other embodiments, the haloalkoxy group contains 1-8 carbon atoms; in other embodiments, the haloalkoxy group contains 1-6 carbon atoms; in other embodiments, the haloalkoxy group contains 1-4 carbon atoms; in other embodiments, the haloalkoxy group contains 1-3 carbon atoms. Such examples include, but are not limited to, trifluoromethoxy and the like.

[0088] The term "cycloalkyl" refers to a saturated, monocyclic, bicyclic or tricyclic ring system having 3-12 ring carbon atoms and having one or more points of attachment to the rest of the molecule. In some embodiments, the cycloalkyl group has 3-10 ring carbon atoms; in other embodiments, the cycloalkyl group has 3-8 ring carbon atoms; in other embodiments, the cycloalkyl group has 3-7 ring carbon atoms; in other embodiments, the cycloalkyl group has 5-8 ring carbon atoms; in other embodiments, the cycloalkyl group has 3-6 ring carbon atoms; in other embodiments, the cycloalkyl group has 5-6 ring carbon atoms; Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc., and the cycloalkyl groups may be independently unsubstituted or substituted with one or more substituents described herein.

[0089] The terms "heterocyclyl" and "heterocycle" are used interchangeably herein and both refer to a saturated or partially unsaturated, non-aromatic monocyclic, bicyclic or tricyclic ring system containing 3-12 ring atoms, wherein at least one ring atom is selected from nitrogen, sulfur and oxygen atoms, and the ring system has one or more points of attachment to the rest of the molecule. The term "heterocyclyl" includes monocyclic, bicyclic or polycyclic fused, spiro or bridged heterocyclic ring systems, and also includes polycyclic ring systems in which the heterocyclic ring may be fused to one or more non-aromatic carbocyclic or heterocyclic rings or one or more aromatic rings or combinations thereof, wherein the radical or point of attachment is on the heterocyclic ring. Bicyclic heterocyclyls include bridged bicyclic heterocyclyls, fused bicyclic heterocyclyls and spiro bicyclic heterocyclyls. Unless otherwise specified, the -CH2- group of the heterocyclyl group may be optionally replaced by -C(=O)-. The sulfur atom of the ring may be optionally oxidized to an S-oxide. The nitrogen atom of the ring may be optionally oxidized to an N-oxide. In some embodiments, heterocyclyl is a ring system consisting of 3-12 ring atoms; in some embodiments, heterocyclyl is a ring system consisting of 3-10 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 3-8 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 3-6 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 5-7 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 5-8 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 6-8 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 5-6 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 3 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 4 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 5 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 6 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 7 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 8 ring atoms.

[0090] Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thioxanyl, piperazinyl, homopiperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxirane, azepanyl, oxepanyl, thiepanyl, oxazepinyl, diazepinyl, thiazepinyl, 2-pyrrolinyl, 3- Pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl, 1,3-dioxolane, pyrazolinyl, dithianyl, dithiolanyl, dihydrothiophenyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 1,2,3,4-tetrahydroisoquinolinyl, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, azabicyclo[2.2.2]hexyl, 3H-indolylquinolizinyl and N-pyridylurea. Examples of heterocyclic groups also include 1,1-dioxothiomorpholinyl; examples of ring carbon atoms substituted by oxo (=O) groups include, but are not limited to, pyrimidinedione, 1,2,4-thiadiazole-5(4H)-one, 1,2,4-oxadiazole-5(4H)-one, 1H-1,2,4-triazole-5(4H)-one, etc.; examples of ring carbon atoms substituted by =S groups include, but are not limited to, 1,2,4-oxadiazole-5(4H)-thione, 1,3,4-oxadiazole-2(3H)-thione, etc. The heterocyclic group may be optionally substituted by one or more substituents described in the present invention.

[0091] The term "M-M1 ring atoms" means that the cyclic group is composed of M-M1 ring atoms, and the ring atoms include carbon atoms and / or heteroatoms such as O, N, S, and P. For example, "6-10 ring atoms composed of heteroaryl" means that it includes 6, 7, 8, 9 or 10 ring atoms.

[0092] The term "heteroatom" means one or more O, S, N, P and Si, including N, S and P in any oxidation state; in the form of primary, secondary, tertiary amines and quaternary ammonium salts; or in the form of a nitrogen atom in a heterocyclic ring in which the hydrogen is substituted, for example, N (such as N in 3,4-dihydro-2H-pyrrolyl), NH (such as NH in pyrrolidinyl) or NR (such as NR in N-substituted pyrrolidinyl, R represents a substituent described in the present invention).

[0093] The term "halogen" or "halogen atom" refers to F, Cl, Br or I.

[0094] As used herein, the term "unsaturated" means that the moiety contains one or more degrees of unsaturation.

[0095] The term "aryl" may be used alone or as a part of "aralkyl", "aralkyloxy" or "aryloxyalkyl" to refer to monocyclic, bicyclic, and tricyclic carbon ring systems containing 6-14 carbon atoms, or 6-12 carbon atoms, or 6-10 carbon atoms, wherein at least one of the ring systems is aromatic, wherein each ring system contains 3-7 carbon atoms and has one or more points of attachment to the rest of the molecule. The term "aryl" may be used interchangeably with the term "aromatic ring" or "aromatic ring", such as aryl may include phenyl, naphthyl and anthracenyl. The aryl groups may be independently unsubstituted or substituted with one or more substituents described herein.

[0096] The term "heteroaryl" may be used alone or as a large part of "heteroarylalkyl" or "heteroarylalkoxy" to refer to a monocyclic, bicyclic or tricyclic ring system containing 5-16 ring atoms, wherein at least one of the ring systems is aromatic and at least one of the ring systems contains one or more heteroatoms, wherein each ring system contains 5-7 ring atoms and has one or more points of attachment to the rest of the molecule. The term "heteroaryl" may be used interchangeably with the terms "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is a heteroaryl consisting of 5-14 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-12 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-10 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-8 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-7 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-6 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 6 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N.

[0097] In other embodiments, heteroaryl includes the following monocyclic groups, but is not limited to these monocyclic groups: 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, pyridazinyl (such as 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (such as 5H-tetrazolyl, 2H-tetrazolyl), triazolyl (such as 2-triazolyl, 5-triazolyl, 4H-1,2,4-triazolyl, 1H-1,2,4-triazolyl, 1,2,3-triazolyl), 2-thienyl, 3-thienyl, pyrazolyl (e.g., 2-pyrazolyl and 3-pyrazolyl), isothiazolyl, 1,2,3-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, 1,2,3-thiodiazolyl, 1,3,4-thiodiazolyl, 1,2,5-thiodiazolyl, pyrazinyl, 1,3,5-triazinyl; also includes The following bicyclic or tricyclic groups, but in no way limited to these groups: benzimidazolyl, benzofuranyl, benzothienyl, indolyl (such as 2-indolyl), purinyl, quinolyl (such as 2-quinolyl, 3-quinolyl, 4-quinolyl), isoquinolyl (such as 1-isoquinolyl, 3-isoquinolyl or 4-isoquinolyl), phenoxathiol, dibenzimidazolyl, dibenzofuranyl or dibenzothienyl, etc. The heteroaryl group is optionally substituted with one or more substituents described in the present invention.

[0098] Unless otherwise indicated, the structural formulas described in the present invention include all isomeric forms (such as enantiomers, diastereomers, and geometric isomers (or conformers)): for example, R, S configurations containing asymmetric centers, (Z), (E) isomers of double bonds, and (Z), (E) conformers. Therefore, single stereochemical isomers (such as enantiomers, diastereomers), or mixtures of geometric isomers (or conformers) of the compounds of the present invention are within the scope of the present invention.

[0099] As used herein, "nitrogen oxide" means that when a compound contains several amine functional groups, one or more nitrogen atoms can be oxidized to form an N-oxide. Specific examples of N-oxides are N-oxides of tertiary amines or N-oxides of nitrogen atoms of nitrogen-containing heterocyclic rings. The corresponding amines can be treated with oxidants such as hydrogen peroxide or peracids (e.g., peroxycarboxylic acids) to form N-oxides (see Advanced Organic Chemistry, Wiley Interscience, 4th edition, Jerry March, pages). In particular, N-oxides can be prepared by the method of LW Deady (Syn. Comm. 1977, 7, 509-514), wherein, for example, in an inert solvent (e.g., dichloromethane), an amine compound is reacted with meta-chloroperoxybenzoic acid (MCPBA).

[0100] The term "prodrug" as used in the present invention refers to a compound that is converted into a compound of formula (I) in vivo. Such conversion is affected by the hydrolysis of the prodrug in the blood or by the conversion of the prodrug into the parent structure by enzymes in the blood or tissues. The prodrug compounds of the present invention may be esters. In the prior invention, esters that can be used as prodrugs include phenyl esters, aliphatic (C 1-24 ) esters, acyloxymethyl esters, carbonates, carbamates and amino acid esters. For example, a compound of the present invention contains a hydroxyl group, which can be acylated to obtain a prodrug form of the compound. Other prodrug forms include phosphates, such as these phosphate compounds obtained by phosphorylation of the hydroxyl group on the parent. For a complete discussion of prodrugs, please refer to the following literature: T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems, Vol. 14 of the ACSSymposium Series, Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987, J. Rautio et al, Prodrugs: Design and Clinical Applications, Nature Review Drug Discovery, 2008, 7, 255-270, and SJ Hecker et al, Prodrugs of Phosphates and Phosphonates, Journal of Medicinal Chemistry, 2008, 51, 2328-2345.

[0101] Unless otherwise indicated, all tautomeric forms of the compounds of the present invention are included within the scope of the present invention. In addition, unless otherwise indicated, the structural formulas of the compounds described in the present invention include enriched isotopes of one or more different atoms.

[0102] "Metabolite" refers to a product obtained by the metabolism of a specific compound or salt thereof in vivo. Metabolites of a compound can be identified by techniques known in the art, and their activity can be characterized by assays as described herein. Such products can be obtained by administering a compound through oxidation, reduction, hydrolysis, amidation, deamidation, esterification, defatting, enzymatic cleavage, and the like. Accordingly, the present invention includes metabolites of a compound, including metabolites produced by contacting a compound of the present invention with a mammal for a period of time.

[0103] The definitions and conventions of stereochemistry used in this invention are generally based on the following references: SP Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., "Stereochemistry of Organic Compounds", John Wiley & Sons, Inc., New York, 1994. The compounds of the present invention may contain asymmetric centers or chiral centers and therefore exist in different stereoisomers. All stereoisomeric forms of the compounds of the present invention, including but not limited to diastereomers, enantiomers, atropisomers, and mixtures thereof, such as racemic mixtures, constitute a part of the present invention. Many organic compounds exist in optically active forms, that is, they have the ability to rotate the plane of plane polarized light. When describing optically active compounds, the prefixes D, L or R, S are used to indicate the absolute configuration of the chiral center of the molecule. The prefixes d, l or (+), (-) are used to name the sign of rotation of plane polarized light of a compound. (-) or l means that the compound is levorotatory, and the prefix (+) or d means that the compound is dextrorotatory. The chemical structures of these stereoisomers are identical, but their stereostructures are different. Specific stereoisomers can be enantiomers, and a mixture of enantiomers is often called an enantiomeric mixture. A 50:50 mixture of enantiomers is called a racemic mixture or racemate, which may result in no stereoselectivity or stereospecificity during chemical reactions. The terms "racemic mixture" and "racemate" refer to an equimolar mixture of two enantiomers that lacks optical activity.

[0104] The term "tautomer" or "tautomeric form" refers to structural isomers of different energies that can be interconverted via a low energy barrier. For example, proton tautomers (i.e., prototropic tautomers) include interconversions via proton migration, such as keto-enol and imine-enamine isomerizations. Valence tautomers include interconversions by reorganization of bonding electrons.

[0105] The "pharmaceutically acceptable salt" used in the present invention refers to organic salts and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as described in the literature: SM Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19, 1977. Pharmaceutically acceptable salts formed by non-toxic acids include, but are not limited to, inorganic acid salts formed by reaction with amino groups, such as hydrochlorides, hydrobromides, phosphates, sulfates, perchlorates, and organic acid salts such as acetates, oxalates, maleates, tartrates, citrates, succinates, malonates, or other methods described in books and literature, such as ion exchange methods, to obtain these salts. Other pharmaceutically acceptable salts include adipate, malate, 2-hydroxypropionate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, cyclopentylpropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, stearate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. If the compound of the invention is acidic, the desired salt can be prepared by a suitable method, for example, using an inorganic base or an organic base, such as ammonia (primary, secondary, tertiary amines), an alkali metal hydroxide, ammonium, N + (R 14a )4 salts and alkaline earth metal hydroxides, etc. Suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, amines, such as primary, secondary and tertiary amines, N + (R 14a )4 salts, such as R 14a It is H, C 1-4 Alkyl, C 6-10 Aryl, C6-10 Aryl C 1-4 alkyl, etc., and cyclic amines such as piperidine, morpholine and piperazine, etc., and inorganic salts obtained from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium. Also included are appropriate, non-toxic ammonium, quaternary ammonium salts and amine cations that counteract the formation of counterions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C 1-8 Sulfonates and aromatic sulfonates.

[0106] The "solvate" of the present invention refers to an association formed by one or more solvent molecules and the compound of the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, aminoethanol. The term "hydrate" refers to an association formed by the solvent molecule being water.

[0107] The term "protecting group" or "Pg" refers to a substituent that reacts with another functional group, usually to block or protect a specific functionality. For example, an "amino protecting group" refers to a substituent attached to an amino group to block or protect the functionality of the amino group in the compound. Suitable amino protecting groups include acetyl, trifluoroacetyl, tert-butyloxycarbonyl (BOC), benzyloxycarbonyl (CBZ) and 9-fluorenylmethyleneoxycarbonyl (Fmoc). Similarly, a "hydroxy protecting group" refers to a hydroxy substituent used to block or protect the functionality of the hydroxy group. Suitable protecting groups include acetyl and silyl. A "carboxyl protecting group" refers to a carboxyl substituent used to block or protect the functionality of the carboxyl group. Typical carboxyl protecting groups include -CH2CH2SO2Ph, cyanoethyl, 2-(trimethylsilyl)ethyl, 2-(trimethylsilyl)ethoxymethyl, 2-(p-toluenesulfonyl)ethyl, 2-(p-nitrobenzenesulfonyl)ethyl, 2-(diphenylphosphino)ethyl, nitroethyl, and the like. For a general description of protecting groups, reference may be made to: T W. Greene, Protective Groups in Organic Synthesis, John Wiley & Sons, New York, 1991; and P J Kocienski, Protecting Groups, Thieme, Stuttgart, 2005.

[0108] Description of the compounds of the present invention

[0109] The compounds involved in the present invention and their pharmaceutically acceptable compositions can effectively inhibit HBV infection.

[0110] In one aspect, the present invention relates to a compound as represented by formula (I) or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of the compound as represented by formula (I),

[0111]

[0112] Among them, R 1 For R 1a O- or R a R b N-;

[0113] X is CR 7 or N;

[0114] Ring A is the following structure:

[0115] wherein the formula (I-1), formula (I-2), formula (I-3), formula (I-4), formula (I-5), formula (I-6), formula (I-7) and formula (I-8) are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 2 replaced by;

[0116] X1 is -O-, -S- or -NR d -; X2 is -CH2-, -S-, -S(=O)-, -S(=O)2- or -NR d -; each X3 and X6 are independently -O-, -S-, -CH2-, -S(=O)-, -S(=O)2- or -NR d -; each X4 and X5 are independently -O-, -S-, -CH2-, -S(=O)-, -S(=O)2- or -NR d -;

[0117] Or ring A is At the same time, X is N, wherein the formula (I-10) and the formula (I-11) are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 2 replaced by;

[0118] Each R 2 Deuterium, F, Cl, Br, =O, C 1-6 Alkyl, C 1-6 Alkylamino, C 1-6 Alkoxy, C 2-6 Alkynyl, C 2-6 Alkenyl, C 3-7 Cycloalkyl, phenyl or a heterocyclic group consisting of 3 to 6 ring atoms, wherein the C 1-6 Alkyl, C 1-6 Alkylamino, C 1-6 Alkoxy, C2-6 Alkynyl, C 2-6 Alkenyl, C 3-7 Cycloalkyl, phenyl and heterocyclic groups consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0119] or two R attached to the same carbon atom 2 Together with the carbon atom to which it is attached, it forms C 3-6 Cycloalkyl or -(C=O)-, wherein the C 3-6 The cycloalkyl group is unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0120] Each R d are independently H or C 1-6 Alkyl, wherein the C 1-6 The alkyl group is unsubstituted or substituted by 1, 2 or 3 groups selected from F, Cl, Br, CN, HO-, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 substituted by an alkylamino substituent;

[0121] R 3 For hydrogen, deuterium, F, Cl, Br, hydroxyl, cyano, C 1-6 Alkyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10 Aryl, heteroaryl consisting of 5-10 ring atoms or R 10 -C 0-4 Alkylene-O-, wherein the C 1-6 Alkyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10 Aryl, heteroaryl consisting of 5-10 ring atoms and R 10 -C 0-4 -C in alkylene-O- 0-4 Alkylene - each independently unsubstituted or substituted with 1, 2, 3 or 4 R g replaced by;

[0122] R 10 for hydrogen, deuterium, R 11 O-、C 1-6 Alkyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, C 6-10 Aryl or heteroaryl consisting of 5 to 10 ring atoms, wherein the C 1-6Alkyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, C 6-10 The aryl group and the heteroaryl group consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R j replaced by;

[0123] Each R j and R g are independently deuterium, F, Cl, Br, CN, =O, HO-, HOOC-, R 11 O-、R 12 -S(=O)2-、R 13 -(C=O)-, R 14 -S(=O)2-O-、R 15 -S(=O)2-N(R c )-、R 16 -N(R c )-S(=O)2-、R 17 -(C=O)-N(R c )-S(=O)2-, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl consisting of 5 to 10 ring atoms, wherein the C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10 The aryl group and the heteroaryl group consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0124] Each R 11 , R 12 , R 12a , R 13 , R 13a , R 14 , R 15 , R 16 and R 17 are independently hydrogen, deuterium, Ra R b N-、C 1-6 Alkyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, C 6-10 Aryl, C 6-10 Aryl C 1-3 Alkylene or heteroaryl composed of 5-10 ring atoms, wherein the C 1-6 Alkyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, C 6-10 Aryl, C 6-10 Aryl C 1-3 The alkylene group and the heteroaryl group consisting of 5 to 10 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, =O, HOOC-, R a R b NS(=O)2-, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Haloalkoxy, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-7 Cycloalkyl, heteroaryl composed of 5-6 ring atoms, heterocyclic group composed of 3-6 ring atoms, C 1-6 Alkoxy C 1-4 Alkylene or C 1-4 Alkylamino C 1-4 substituted by an alkylene substituent;

[0125] Each R w are independently deuterium, F, Cl, Br, HO-, HOOC-, =O, amino, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Alkylamino, C 2-6 Alkenyl, C 2-6 Alkynyl, tert-butyloxycarbonyl, C 1-6 Alkyl-S(=O)2-, C 3-6 Cycloalkyl-S(=O)2- or C 3-7 Cycloalkyl, wherein the C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Alkylamino, C2-6 Alkenyl, C 2-6 Alkynyl, tert-butyloxycarbonyl, C 1-6 Alkyl-S(=O)2-, C 3-6 Cycloalkyl-S(=O)2- and C 3-7 The cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, OH, =O, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Haloalkoxy or C 1-6 substituted by an alkylamino substituent;

[0126] Each R 4 , R 5 , R 6 , R 7 , R 8 and R 9 are independently hydrogen, deuterium, F, Cl, Br, R 12a -S(=O)2-、R 13a -(C=O)-, C 1-6 Alkyl, C 1-6 Alkylamino, C 1-6 Alkoxy, C 2-6 Alkynyl, C 2-6 Alkenyl, C 3-7 Cycloalkyl, phenyl, heteroaryl composed of 5-6 ring atoms or heterocyclic group composed of 3-10 ring atoms, wherein the C 1-6 Alkyl, C 1-6 Alkylamino, C 1-6 Alkoxy, C 2-6 Alkynyl, C 2-6 Alkenyl, C 3-7 Cycloalkyl, phenyl, heteroaryl consisting of 5-6 ring atoms and heterocyclyl consisting of 3-10 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0127] or R 6 , R 4 and together with the atoms to which they are attached, form a carbocyclic group consisting of 5-6 ring atoms or a heterocyclic group consisting of 5-6 ring atoms, wherein the carbocyclic group consisting of 5-6 ring atoms and the heterocyclic group consisting of 5-6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0128] Each R 1a , R a , R b and Rc H, deuterium, C 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 6-10 aryl, a heterocyclic group consisting of 3 to 6 ring atoms, or a heteroaryl group consisting of 5 to 10 ring atoms, wherein the C 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 6-10 The aryl group, the heterocyclic group consisting of 3-6 ring atoms and the heteroaryl group consisting of 5-10 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, amino, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy or C 1-6 The amino group is substituted with an alkylamino group.

[0129] In some embodiments, the ring A of the present invention is the structure shown below:

[0130] Wherein, the formula (II-1), formula (II-2), formula (II-3), formula (II-4), formula (II-5), formula (II-6), formula (II-7), formula (II-8), formula (II-9), formula (II-10), formula (II-11), formula (II-12), formula (II-13), formula (II-14), formula (II-15), formula (II-16), formula (II-17), formula (I-5), formula (I-6) and formula (I-7) are each independently unsubstituted or substituted by 1, 2, 3 or 4 R 2 replaced by;

[0131] Or ring A is At the same time, X is N, wherein the formula (I-10) and the formula (I-11) are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 2 replaced by;

[0132] Each R d is independently H, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl or tert-butyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl are each independently unsubstituted or substituted by 1, 2 or 3 groups selected from F, Cl, Br, CN, HO-, amino, C 1-4 Alkyl, C 1-4Haloalkyl, C 1-4 Alkoxy or C 1-4 substituted by an alkylamino substituent;

[0133] Among them, each R 2 Has the meaning described in the present invention.

[0134] In some embodiments, the R 3 For hydrogen, deuterium, F, Cl, Br, hydroxyl, cyano, C 1-4 Alkyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms, heteroaryl consisting of 6 ring atoms, or R 10 -C 0-3 Alkylene-O-, wherein the C 1-4 Alkyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms, heteroaryl consisting of 6 ring atoms, and R 10 -C 0-3 -C in alkylene-O- 0-3 Alkylene - each independently unsubstituted or substituted with 1, 2, 3 or 4 R g replaced by;

[0135] R 10 for hydrogen, deuterium, R 11 O-、C 1-4 Alkyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein the C 1-4 Alkyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R j replaced by;

[0136] Among them, each R 11 , R g and R j Has the meaning described in the present invention.

[0137] In some embodiments, the R 3R is hydrogen, deuterium, F, Cl, Br, hydroxyl, cyano, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, ethynyl, propargyl, propynyl, 1-butylynyl, 2-butylynyl, 3-butylynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, R 10 -O-、R 10 -CH2-O-, R 10 -(CH2)2-O- or R 10 -(CH2)3-O-, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, R 10 -CH2-, R in -CH2-O- 10 -(CH2)2- and R in -(CH2)2- 10 The -(CH2)3- in -(CH2)3-O- is each independently unsubstituted or substituted with 1, 2, 3 or 4 R g replaced by;

[0138] R 10 for hydrogen, deuterium, R 11O-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl R, 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), 4-(4-nitro-2-yl), j replaced by;

[0139] Among them, each R 11 , R g and R j Has the meaning described in the present invention.

[0140] In some embodiments, each R described in the present invention j and R g are independently deuterium, F, Cl, Br, CN, =O, HO-, HOOC-, R 11 O-、R 12 -S(=O)2-、R 13 -(C=O)-, R 14 -S(=O)2-O-、R 15 -S(=O)2-N(R c )-、R 16 -N(R c )-S(=O)2-、R 17 -(C=O)-N(R c )-S(=O)2-, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, C 3-6Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms or heteroaryl consisting of 6 ring atoms, wherein the C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0141] Each R 11 , R 12 , R 12a , R 13 , R 13a , R 14 , R 15 , R 16 and R 17 are independently hydrogen, deuterium, R a R b N-、C 1-4 Alkyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, phenyl C 1-2 an alkylene group, a heteroaryl group consisting of 5 ring atoms, or a heteroaryl group consisting of 6 ring atoms, wherein the C 1-4 Alkyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 ring atoms, phenyl, phenyl C 1-2 The alkylene, the heteroaryl consisting of 5 ring atoms and the heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, =O, HOOC-, R a R b NS(=O)2-, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Haloalkoxy, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, phenyl, C 3-6 Cycloalkyl, heteroaryl composed of 5 ring atoms, heteroaryl composed of 6 ring atoms, heterocyclic group composed of 3-6 ring atoms, C 1-4Alkoxy C 1-3 Alkylene or C 1-4 Alkylamino C 1-3 substituted by an alkylene substituent;

[0142] Among them, each R 12a , R 13a , R a , R b , R c and R w Has the meaning described in the present invention.

[0143] In some embodiments, each R described in the present invention j and R g are independently deuterium, F, Cl, Br, CN, =O, HO-, HOOC-, R 11 O-、R 12 -S(=O)2-、R 13 -(C=O)-, R 14 -S(=O)2-O-、R 15 -S(=O)2-N(R c )-、R 16 -N(R c )-S(=O)2-、R 17 -(C=O)-N(R c )-S(=O)2-, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, 2-methyl-1-propoxy, 2-butoxy, C 1-3 Alkylthio, C 1-3 Alkylamino, C 2-4 Alkenyl, C 2-4alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl, 1-butyl 1-3 Alkylthio, C 1-3 Alkylamino, C 2-4 Alkenyl, C 2-4 alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0144] Each R 11 , R 12 , R 12a , R 13 , R 13a , R 14 , R 15 , R 16 and R 17 are independently hydrogen, deuterium, R a R b N-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 2-4Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, phenyl C 1-2 Alkylene, furyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 2-4 Alkynyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, phenyl C 1-2 The alkylene, furanyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, =O, HOOC-, R a R b NS(=O)2-, amino, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Alkoxy, C 1-3 Alkylthio, C 1-3 Haloalkoxy, C 1-3 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, phenyl, C 3-6 Cycloalkyl, heteroaryl composed of 5 ring atoms, heteroaryl composed of 6 ring atoms, heterocyclic group composed of 3-6 ring atoms, C 1-3 Alkoxy C 1-2 Alkylene or C 1-3 Alkylamino C 1-2 substituted by an alkylene substituent;

[0145] Among them, each R 12a , R 13a , R a , R b , R c and R w Has the meaning described in the present invention.

[0146] In some embodiments, each R described in the present invention ware independently deuterium, F, Cl, Br, HO-, HOOC-, =O, amino, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, tert-butyloxycarbonyl, C 1-4 Alkyl-S(=O)2-, cyclopropyl-S(=O)2-, cyclopentyl-S(=O)2-, cyclohexyl-S(=O)2- or C 3-6 Cycloalkyl, wherein the C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 Alkenyl, C 2-4 Alkynyl, tert-butyloxycarbonyl, C 1-4 Alkyl-S(=O)2-, cyclopropyl-S(=O)2-, cyclopentyl-S(=O)2-, cyclohexyl-S(=O)2- and C 3-6 The cycloalkyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, OH, =O, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Haloalkoxy or C 1-4 substituted by an alkylamino substituent;

[0147] Each R 4 , R 5 , R 6 , R 7 , R 8 and R 9 are independently hydrogen, deuterium, F, Cl, Br, R 12a -S(=O)2-、R 13a -(C=O)-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, C 2-4 Alkynyl, C 2-4 alkenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furanyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl or a heterocyclic group consisting of 3 to 6 ring atoms, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4Alkylamino, C 1-4 Alkoxy, C 2-4 Alkynyl, C 2-4 Alkenyl, C 3-6 Cycloalkyl, phenyl, furanyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl and heterocyclic radicals of 3 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0148] or R 6 , R 4 and together with the atoms to which they are attached form a cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein the cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0149] Among them, each R 12a and R 13a Has the meaning described in the present invention.

[0150] In some embodiments, each R described in the present invention w are independently deuterium, F, Cl, Br, HO-, HOOC-, =O, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 alkenyl, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, tert-butyloxycarbonyl ((CH3)3C-OC(=O)-), C 1-4 alkyl-S(=O)2-, cyclopropyl-S(=O)2-, cyclopentyl-S(=O)2-, cyclohexyl-S(=O)2-, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Alkylamino, C 2-4 alkenyl, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, tert-butyloxycarbonyl ((CH3)3C-OC(=O)-), C 1-4Alkyl-S(=O)2-, cyclopropyl-S(=O)2-, cyclopentyl-S(=O)2-, cyclohexyl-S(=O)2-, cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, OH, =O, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Haloalkoxy or C 1-4 substituted by an alkylamino substituent;

[0151] Each R 4 , R 5 , R 6 , R 7 , R 8 and R 9 are independently hydrogen, deuterium, F, Cl, Br, R 12a -S(=O)2-、R 13a -(C=O)-, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, C 2-4 alkyl, cyclohexyl, phenyl, furanyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidinyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, ethynyl, propargyl, propynyl, 1-butylene, 2-butylene, 3-butylene, C 2-4 substituted with 1, 2, 3 or 4 Rw replaced by;

[0152] or R 6 , R 4 and together with the atoms to which they are attached form a cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, wherein the cyclopentyl, cyclohexyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, piperidinyl, morpholinyl, thiomorpholinyl and piperazinyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0153] Among them, each R 12a and R 13a Has the meaning described in the present invention.

[0154] In some embodiments, the compounds described herein, wherein each of the R 2 are independently deuterium, F, Cl, Br, =O, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, C 2-4 Alkynyl, C 2-4 Alkenyl, C 3-6 Cycloalkyl, phenyl or a heterocyclic group consisting of 3-6 ring atoms, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkylamino, C 1-4 Alkoxy, C 2-4 Alkynyl, C 2-4 Alkenyl, C 3-6 Cycloalkyl, phenyl and heterocyclic groups consisting of 3 to 6 ring atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0155] or two R attached to the same carbon atom 2 The carbon atom to which it is attached forms a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or -C(=O)-, wherein the cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R w replaced by;

[0156] Each R 1a , R a , R b and R c are independently H, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkoxy, C 2-4 Alkenyl, C 2-4 Alkynyl, C3-6 Cycloalkyl, phenyl, a heterocyclic group consisting of 3-6 ring atoms, a heteroaryl group consisting of 5 ring atoms, or a heteroaryl group consisting of 6 ring atoms, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 1-4 Alkoxy, C 2-4 Alkenyl, C 2-4 Alkynyl, C 3-6 Cycloalkyl, phenyl, heterocyclic group consisting of 3-6 ring atoms, heteroaryl consisting of 5 ring atoms and heteroaryl consisting of 6 ring atoms are each independently unsubstituted or substituted by 1, 2, 3 or 4 groups selected from F, Cl, Br, CN, HO-, amino, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy or C 1-4 substituted by an alkylamino substituent;

[0157] Among them, each R w Has the meaning described in the present invention.

[0158] In some embodiments, the present invention relates to one of the following compounds or their stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof, but is in no way limited to these compounds:

[0159]

[0160]

[0161]

[0162]

[0163]

[0164] Unless otherwise indicated, stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof of the compound represented by formula (I) are all included in the scope of the present invention.

[0165] On the other hand, the present invention also provides a pharmaceutical composition comprising the compound of the present invention, optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient or a combination of the excipients.

[0166] In some embodiments, the pharmaceutical composition of the present invention further comprises other anti-HBV drugs.

[0167] In other embodiments, the pharmaceutical composition of the present invention, wherein the anti-HBV drug is a HBV polymerase inhibitor, an immunomodulator or an interferon.

[0168] Also in some embodiments, the pharmaceutical composition of the present invention, wherein the anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simu-leukin, clavudine, emtricitabine, famciclovir, interferon, Baoganling CP, Intefen, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mivotilide, nitazoxanide, pegylated interferon α-2a, ribavirin, rointerferon-A, sizoran, Euforavac, Ampligen, Phosphazid, Heplisav, interferon α-2b, levamisole or propagermanium.

[0169] On the other hand, the present invention also provides the use of the compound or the pharmaceutical composition in the preparation of a drug for preventing, treating or alleviating viral diseases in patients.

[0170] In some embodiments, the use described in the present invention, wherein the viral disease refers to hepatitis B virus infection or a disease caused by hepatitis B virus infection.

[0171] In other embodiments, the use described in the present invention, wherein the disease caused by hepatitis B virus infection refers to cirrhosis or hepatocellular carcinoma.

[0172] On the other hand, the present invention also provides the use of the compound or the pharmaceutical composition in the preparation of a drug for inhibiting the production or secretion of HBsAg and / or for inhibiting the production or replication of HBV DNA.

[0173] On the other hand, the present invention relates to the use of the compound or pharmaceutical composition in the preparation of a drug for preventing, treating or alleviating hepatitis B disease in a patient.

[0174] Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV symptoms in a patient, the method comprising administering to the patient a pharmaceutically acceptable effective dose of a compound of the present invention.

[0175] Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV symptoms in a patient, the method comprising administering to the patient a pharmaceutically acceptable effective dose of a pharmaceutical composition containing a compound of the present invention.

[0176] Another aspect of the present invention relates to the use of a compound of the present invention in the preparation of a medicament for preventing, managing or treating HBV disease in a patient and reducing its severity.

[0177] Another aspect of the present invention relates to the use of a pharmaceutical composition comprising the compound of the present invention in the preparation of a medicament for preventing or treating HBV disease in a patient and reducing its severity.

[0178] Another aspect of the present invention relates to a method for inhibiting HBV infection, which comprises contacting cells with a dose of the compound or composition of the present invention that is effective in inhibiting HBV. In some other embodiments, the method further comprises contacting cells with other anti-HBV agents.

[0179] Another aspect of the present invention relates to a method for treating HBV disease in a patient, the method comprising administering to the patient an effective therapeutic amount of a compound of the present invention or a composition thereof. In some other embodiments, the method further comprises administering other HBV treatments.

[0180] Another aspect of the present invention relates to a method for inhibiting HBV infection in a patient, the method comprising administering to the patient an effective therapeutic amount of a compound of the present invention or a composition thereof. In some other embodiments, the method further comprises administering other HBV treatments.

[0181] Another aspect of the present invention relates to methods for preparing, isolating and purifying the compounds encompassed by formula (I).

[0182] The present invention also includes the use of the compounds of the present invention and their pharmaceutically acceptable salts for producing pharmaceutical products that effectively inhibit HBV infection, including those described in the present invention: the use of the compounds of the present invention in producing drugs that effectively inhibit HBV infection. The compounds of the present invention are also used to produce a pharmaceutical product for alleviating, preventing, controlling or treating symptoms of hepatitis B in patients. The present invention includes a pharmaceutical composition comprising a compound of formula (I) in combination with at least one pharmaceutically acceptable excipient in an effective therapeutic amount.

[0183] The present invention also includes a method for effectively inhibiting HBV-infected diseases, or diseases sensitive to such diseases, which comprises treating a patient with a therapeutically effective amount of a compound represented by formula (I).

[0184] Unless otherwise indicated, all stereoisomers, tautomers, N-oxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof of the compounds of the present invention are within the scope of the present invention.

[0185] In particular, the salts are pharmaceutically acceptable salts. The term "pharmaceutically acceptable" includes that the substance or composition must be suitable chemically and toxicologically with the other ingredients that make up the formulation and with the mammal to be treated.

[0186] The salts of the compounds of the present invention also include salts of intermediates or isomers thereof used for preparing or purifying the compounds represented by formula (I), but they are not necessarily pharmaceutically acceptable salts.

[0187] The term "pharmaceutically acceptable" refers to materials that are acceptable for pharmaceutical use from a toxicological point of view and do not adversely interact with the active ingredients.

[0188] If the compound of the present invention is basic, the desired salt can be prepared by any suitable method provided in the literature, for example, using inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid and phosphoric acid, etc.; or using organic acids such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, malic acid, 2-hydroxypropionic acid, citric acid, oxalic acid, glycolic acid and salicylic acid; pyranose acids such as glucuronic acid and galacturonic acid; α-hydroxy acids such as citric acid and tartaric acid; amino acids such as aspartic acid and glutamic acid; aromatic acids such as benzoic acid and cinnamic acid; sulfonic acids such as p-toluenesulfonic acid, benzenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, trifluoromethanesulfonic acid, etc. or combinations thereof.

[0189] If the compound of the present invention is acidic, the desired salt can be prepared by a suitable method, an inorganic base, such as lithium salt, sodium salt, potassium salt, calcium salt, magnesium salt, aluminum salt, iron salt, ferrous salt, manganese salt, manganous salt, copper salt, zinc salt and ammonium salt of the compound represented by formula (I); an organic base, such as a compound represented by formula (I) and methylamine, dimethylamine, trimethylamine, ethylamine, diethylamine, triethylamine, tromethamine, diethylaminoethanol, isopropylamine, 2-ethylaminoethanol, pyridine, Salts formed by methylpyridine, ethanolamine, diethanolamine, ammonium, dimethylethanolamine, tetramethylammonium, tetraethylammonium, triethanolamine, piperidine, piperazine, morpholine, imidazole salts, lysine, arginine, L-arginine, histidine, N-methylglucamine, dimethylglucamine, ethylglucamine, dicyclohexylamine, 1,6-hexanediamine, ethylenediamine, glucosamine, sarcosine, serinol, aminopropylene glycol, 1-amino-2,3,4-butanetriol, L-lysine and ornithine.

[0190] Pharmaceutical compositions, formulations, administration and uses of the compounds and pharmaceutical compositions of the present invention

[0191] The pharmaceutical composition of the present invention comprises a compound represented by formula (I) or a compound represented by an embodiment, or a stereoisomer, a tautomer, a nitrogen oxide, a solvate, a metabolite, and a pharmaceutically acceptable salt or prodrug thereof, and a pharmaceutically acceptable excipient. Chronic viral diseases caused by HBV may lead to a serious morbidity. Chronic hepatitis B virus infection may lead to cirrhosis and / or hepatocellular carcinoma in many cases. The compound in the composition of the present invention can effectively inhibit hepatitis B virus and is suitable for the treatment of viral diseases, especially acute and chronic persistent HBV infection.

[0192] The compounds of the present invention are particularly suitable for treating chronic hepatitis B virus infection and acute hepatitis B virus infection.

[0193] The present invention includes pharmaceutical preparations which contain, in addition to non-toxic, inert pharmaceutically suitable excipients, one or more compounds or compositions of formula (I) of the present invention.

[0194] The above-mentioned pharmaceutical preparation may also contain other pharmaceutically active ingredients besides the compound represented by formula (I).

[0195] The compounds of the present invention exist in free form, or are suitable as pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adducts or derivatives that can be directly or indirectly administered according to the needs of patients, compounds described in other aspects of the present invention, their metabolites or their residues.

[0196] As described in the present invention, the pharmaceutical composition of the present invention comprises any compound represented by formula (I) of the present invention, and further comprises pharmaceutically acceptable excipients, such as those used in the present invention, including any solvent, solid excipient, diluent, binder, disintegrant, other liquid excipient, dispersant, flavoring agent or suspending agent, surfactant, isotonic agent, thickener, emulsifier, preservative, solid binder or lubricant, etc., suitable for a specific target dosage form. As described in the following documents: In Remington: The Science and Practice of Pharmacy, 21st edition, 2005, ed. DB Troy, Lippincott Williams & Wilkins, Philadelphia, and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and JC Boylan, 1988-1999, Marcel Dekker, New York, the contents of the documents herein are summarized, indicating that different excipients can be applied to the preparation of pharmaceutically acceptable compositions and their known preparation methods. Except insofar as any conventional excipients are incompatible with the compounds of the present invention, for example by producing any undesirable biological effect or interacting in a deleterious manner with any other component of the pharmaceutically acceptable composition, their use is contemplated by the present invention.

[0197] Substances that can be used as pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum albumin; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; partial glyceride mixtures of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silicon; magnesium trisilicate; polyvinyl pyrrolidone; polyacrylates; waxes; polyethylene-polyoxypropylene-blocking polymers; lanolin; sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as carboxymethyl cellulose sodium cellulose, ethylcellulose and cellulose acetate; gum powder; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycol compounds such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; phosphate buffer solution; and other non-toxic suitable lubricants such as sodium lauryl sulfate and magnesium stearate; colorants; release agents; coatings; sweeteners; flavorings; fragrances; preservatives and antioxidants.

[0198] The pharmaceutical composition of the compound of the present invention can be administered in any of the following ways: oral administration, topical administration, rectal administration, nasal administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrapulmonary, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or medication via an explanted reservoir. The preferred mode is oral administration, intramuscular injection, intraperitoneal administration or intravenous injection.

[0199] The compounds of the present invention or pharmaceutically acceptable compositions thereof may be administered in a unit dosage form. The dosage form may be a liquid dosage form or a solid dosage form. The liquid dosage form may be a true solution, a colloid, a microparticle dosage form, or a suspension dosage form. Other dosage forms include tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, suppositories, freeze-dried powder injections, inclusion compounds, implants, patches, liniments, etc.

[0200] Tablets and capsules for oral administration may contain excipients such as binders, for example, syrup, gum arabic, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example, lactose, sucrose, corn starch, calcium phosphate, sorbitol, aminoacetic acid; lubricants, for example, magnesium stearate, talc, polyethylene glycol, silica; disintegrants, for example, potato starch; or acceptable wetting agents, for example, sodium lauryl sulfate. Tablets may be coated by methods known in the pharmaceutical industry.

[0201] Oral liquid can be made into water and oil suspension, solution, emulsion, syrup or elixir, or it can be made into dry product, and water or other suitable medium is added before use. Such liquid preparations can contain conventional additives, such as suspending agents, sorbitol, methyl cellulose, glucose syrup, gel, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gel, hydrogenated edible oils and fats; emulsifiers, such as lecithin, sorbitan monooleate, gum arabic; or non-aqueous excipients (which may contain edible oils), such as almond oil; oils such as glycerol, ethylene glycol or ethanol; preservatives, such as methyl or propyl paraben, sorbic acid. Flavoring agents or colorants can be added as needed.

[0202] Suppositories may contain conventional suppository bases such as cocoa butter or other glycerides.

[0203] For extragastric administration, liquid dosage forms are usually made of the compound and a sterile excipient. The excipient is preferably water. Depending on the selected excipient and the drug concentration, the compound can be dissolved in the excipient or made into a suspension solution. When making an injection solution, the compound is first dissolved in water, filtered and sterilized, and then filled into a sealed bottle or ampoule.

[0204] When applied topically to the skin, the compounds of the present invention can be made into the form of suitable ointments, lotions, or creams, in which the active ingredient is suspended or dissolved in one or more excipients, wherein the excipients that can be used for ointment preparations include but are not limited to: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; the excipients that can be used for lotions and creams include but are not limited to: mineral oil, sorbitan monostearate, Tween 60, hexadecyl esters wax, hexadecene aromatic alcohol, 2-octyldodecanol, benzyl alcohol and water.

[0205] In general, it has proven to be advantageous that the total amount of the active compound of the invention administered per 24 hours is about 0.01-500 mg / kg body weight, preferably 0.01-100 mg / kg body weight, if appropriate, in a plurality of single doses to achieve the desired effect, both in human and veterinary medicine. The amount of active compound contained in a single dose is preferably about 1-80 mg / kg body weight, more preferably 1-50 mg / kg body weight, but it may not be in accordance with the above dosage, i.e., it depends on the type and body weight of the treated subject, the nature and severity of the disease, the type of preparation and the mode of administration of the drug, as well as the administration cycle or time interval.

[0206] The pharmaceutical composition provided by the present invention also contains anti-HBV drugs, wherein the anti-HBV drugs are HBV polymerase inhibitors, immunomodulators, interferons or other novel anti-HBV agents such as HBV RNA replication inhibitors, HBsAg secretion inhibitors, HBV capsid inhibitors, antisense oligomers, siRNA, HBV therapeutic vaccines, HBV preventive vaccines, HBV antibody therapy (monoclonal or polyclonal) and agonists for treating or preventing HBV.

[0207] Anti-HBV drugs include lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simu-leukin, clavudine, emtricitabine, famciclovir, interferon, Baoganling CP, Intefen, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mivotilide, nitazoxanide, peginterferon α-2a, ribavirin, roentgen-A, sirox, Euforavac, Ampligen, Phosphazid, Heplisav, interferon α-2b, levamisole or propagermanium, etc.

[0208] In one aspect, the compounds or pharmaceutical compositions of the present invention are used in the preparation of a drug for preventing, treating, curing or alleviating hepatitis B disease in a patient. Hepatitis B disease refers to hepatitis B virus infection or liver disease caused by hepatitis B virus infection, including acute hepatitis, chronic hepatitis, cirrhosis and liver cancer. Acute hepatitis B virus infection can be asymptomatic or manifest as symptoms of acute hepatitis. Chronic viral infection patients suffer from active disease and can develop cirrhosis and liver cancer.

[0209] The uses of the compound or pharmaceutical composition of the present invention include inhibiting the generation or secretion of HBsAg, and also include administering a pharmaceutically acceptable effective dose of the compound or pharmaceutical composition of the present invention to a patient.

[0210] The uses of the compound or pharmaceutical composition of the present invention include inhibiting the generation of HBV DNA, and also include administering a pharmaceutically acceptable effective dose of the compound or pharmaceutical composition of the present invention to a patient.

[0211] In one aspect, the use of the compound or pharmaceutical composition of the present invention in inhibiting HBV gene expression comprises administering a pharmaceutically acceptable effective dose of the compound or pharmaceutical composition of the present invention to a patient.

[0212] Other anti-HBV drugs can be administered separately from the composition comprising the compounds of the invention as part of a multiple administration regimen. Alternatively, those drugs can be part of a single dosage form, mixed with the compounds of the invention to form a single composition. If administered as part of a multiple administration regimen, the two active agents can be delivered to each other simultaneously, continuously or over a period of time, so as to obtain the desired agent activity.

[0213] The amount of compounds and compositions that may be combined with auxiliary materials to produce a single dosage form (those comprising a composition such as described herein) will vary depending upon the indication and the particular mode of administration.

[0214] The compounds of the present invention show strong antiviral effects. Such compounds have unexpected antiviral activity against HBV and are therefore suitable for treating various diseases caused by the virus, especially diseases caused by acute and chronic persistent HBV infection. Chronic viral diseases caused by HBV can lead to various complex symptoms of varying severity. It is well known that chronic hepatitis B virus infection can lead to cirrhosis and / or liver cancer.

[0215] Examples of indications that can be treated with the compounds of the present invention are: treatment of acute and chronic viral infections that can lead to infectious hepatitis, such as hepatitis B virus infection, with the treatment of chronic hepatitis B virus infection and the treatment of acute hepatitis B virus infection being particularly preferred.

[0216] The present invention also relates to the use of the compounds and compositions of the present invention in preparing drugs for treating and preventing viral diseases, especially hepatitis B.

[0217] General Synthesis Methods

[0218] To describe the present invention, the following examples are listed. However, it should be understood that the present invention is not limited to these examples, which are only provided to provide methods for practicing the present invention.

[0219] Generally, the compounds of the present invention can be prepared by the methods described herein, unless otherwise specified, wherein the substituents are defined as shown in formula (I). The following synthetic schemes and examples are provided to further illustrate the present invention.

[0220] Those skilled in the art will recognize that the chemical reactions described herein can be used to appropriately prepare many other compounds of the invention, and other methods for preparing the compounds of the invention are considered to be within the scope of the invention. For example, the synthesis of non-exemplified compounds according to the invention can be successfully accomplished by those skilled in the art through modification methods, such as appropriate protection of interfering groups, by utilizing other known reagents in addition to those described herein, or by making some conventional modifications to the reaction conditions. In addition, the reactions disclosed herein or known reaction conditions are also recognized to be applicable to the preparation of other compounds of the invention.

[0221] In the examples described below, all temperatures are in degrees Celsius (°C) unless otherwise indicated. Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, Arco Chemical Company and Alfa Chemical Company and were used without further purification unless otherwise indicated. Common reagents were purchased from Shantou Xilong Chemical Factory, Guangdong Guanghua Chemical Reagent Factory, Guangzhou Chemical Reagent Factory, Tianjin Haoyuyu Chemical Co., Ltd., Qingdao Tenglong Chemical Reagent Co., Ltd., and Qingdao Ocean Chemical Factory.

[0222] The NMR spectral data were measured by a Bruker Avance 400 NMR spectrometer or a Bruker Avance IIIHD 600 NMR spectrometer using CDCl3, DMSO-d6, CD3OD or d6-acetone as solvents (reported in ppm) and TMS (0 ppm) or chloroform (7.26 ppm) as reference standards. When multiple peaks appear, the following abbreviations are used: s (singlet), s,s (singlet, singlet, singlet), d (doublet), t (triplet), m (multiplet), br (broadened), dd (doublet of doublets), ddd (doublet of doublet of doublets), dt (doublet of triplets), ddt (doublet of doublet of triplets), td (triplet of doublets), br.s (broadened singlet). The coupling constant J is expressed in Hertz (Hz).

[0223] Low-resolution mass spectrometry (MS) data were measured by an Agilent 6320 series LC-MS spectrometer equipped with a G1312A binary pump and a G1316A TCC (column temperature was maintained at 30 °C). A G1329A autosampler and a G1315B DAD detector were used for analysis, and an ESI source was applied to the LC-MS spectrometer.

[0224] Low-resolution mass spectrometry (MS) data were determined by an Agilent 6120 series LC-MS spectrometer equipped with a G1311A quaternary pump and a G1316A TCC (column temperature was maintained at 30 °C), a G1329A autosampler and a G1315D DAD detector were used for analysis, and an ESI source was applied to the LC-MS spectrometer.

[0225] Both spectrometers were equipped with an Agilent Zorbax SB-C18 column with a size of 2.1×30 mm, 5 μm. The injection volume was determined by the sample concentration; the flow rate was 0.6 mL / min; the HPLC peak was recorded and read at UV-Vis wavelengths at 210 nm and 254 nm. The mobile phase was 0.1% formic acid acetonitrile solution (phase A) and 0.1% formic acid ultrapure water solution (phase B). The gradient elution conditions are shown in Table A:

[0226] Table A: Gradient elution conditions

[0227] Time (min) <![CDATA[A(CH3CN,0.1%HCOOH)]]> <![CDATA[B(H2O,0.1%HCOOH)]]> 0-3 5-100 95-0 3-6 100 0 6-6.1 100-5 0-95 6.1-8 5 95

[0228] The following abbreviations are used throughout this invention:

[0229]

[0230]

[0231] Synthesis method

[0232] The following synthesis scheme lists the synthetic steps for preparing the compounds disclosed in the present invention. 4 , R 5 , R 6 , R 8 , R 9 , R 1a and R 10 has the meaning as described in the present invention, L is 1, 2, 3 or 4; each of Y1, Y2 and Y3 is independently Cl, Br and I. . R 3a C 1-6 Alkyl, C 2-6 Alkynyl, C 3-7 Cycloalkyl, heterocyclic group consisting of 3-10 ring atoms, C 6-10 Aryl or heteroaryl consisting of 5 to 10 ring atoms.

[0233] Synthesis Scheme 1

[0234]

[0235]

[0236] Mode (a-14) The compounds shown can be prepared by the method described in Synthesis Scheme 1. First, compound (a-1) Under the action of silver sulfate, it undergoes a substitution reaction with iodine to generate a compound (a-2) Compound (a-2) Under alkaline conditions (such as potassium hydroxide, etc.), a substitution reaction occurs to generate compounds (a-3) Compound (a-3) Under alkaline conditions (such as K2CO3, etc.), the benzyl group is protected to obtain the compound (a-4) Compound (a-4) With compound (a-5) A coupling reaction occurs in a suitable solvent (such as THF, toluene, etc.) under the action of a palladium catalyst (such as Pd(dba)2, Pd2(dba)3, etc.), a ligand (such as Xantphos, etc.) and a suitable base (such as sodium tert-butoxide, etc.) to generate a compound (a-6) Compound (a-6)With NH4OAc in the presence of a reducing agent (such as NaBH3CN, etc.) in a suitable solvent (such as methanol, etc.), a reductive amination reaction occurs to generate a compound (a-7) Compound (a-7) Reacts with formic acid or ethyl formate to form compounds (a-8) Then, the compound (a-8) With phosphorus oxychloride, in a suitable solvent (such as DCM, etc.), a cyclization reaction occurs to generate a compound (a-9) Compound (a-9) With compound (a-10) or compound (a-11) A cyclization reaction occurs in a suitable solvent (such as water, isopropanol, ethanol or DMSO) to generate a compound (a- 12) Compound (a-12) With tetrachlorobenzoquinone, dehydrogenation reaction occurs in a suitable solvent (such as DME, etc.) to generate compounds (a- 13) Finally, the compound (a-13) Under the action of trifluoroacetic acid or palladium / carbon catalyst, the benzyl protecting group is removed to obtain the compound (a-14) .

[0237] Synthesis Scheme 2

[0238]

[0239] Compound (b-1) and 2,3-dichloro-5,6-dicyano-1,4-benzoquinone in a suitable solvent (such as 1,4-dioxane) to obtain (b-2) The compounds shown.

[0240] Synthesis Scheme 3

[0241]

[0242] Mode (c-8) The compounds shown can be prepared by the method described in Synthesis Scheme 3. First, compound (a-4) Under the conditions of isopropylmagnesium bromide and n-butyllithium, the compound (c-1) Compound (c-1) After halogen substitution, the compound (c-2) Compound (c-2) Under the condition of sodium borohydride, a reduction reaction occurs to generate compound (c- 3) Compound (c-3) Reaction with thionyl chloride to obtain compound (c-4) Compound (c-4) With compound (c-5) (Compound (c-5)The synthesis method of (a-4) in the synthesis scheme 1 disclosed in patent application CN 110862390 can be obtained by reacting under alkaline conditions (such as potassium carbonate, sodium carbonate, etc.) and in a suitable solvent (such as acetonitrile, etc.) to obtain compound (c-6) Compound (c- 6) In the presence of a Pd catalyst (such as palladium bromide, etc.), a base (such as potassium acetate, etc.) and a suitable solvent (such as DMF, etc.), an intermolecular coupling reaction occurs to obtain a compound (c-7) ; Finally, the compound (c-7) Remove the benzyl protecting group to obtain the compound (c-8) .

[0243] Synthesis Scheme 4

[0244]

[0245] Mode (d-5) The compounds shown can be prepared by the method described in Synthesis Scheme 4. First, compound (d-1) With compound (d-2) or compound (d-3) Under alkaline conditions (such as potassium carbonate, etc.) and in a suitable solvent (such as DMF, etc.), the compound is generated. (d-4) Finally, the compound (d-4) Hydrolysis reaction occurs in a base (such as lithium hydroxide, etc.) and a suitable solvent (such as methanol, etc.) to obtain a compound (d-5) .

[0246] Synthesis Scheme 5

[0247]

[0248] Mode (e-6) The compounds shown can be prepared by the method described in Synthesis Scheme 5. First, compound (d-1) React with N-phenylbis(trifluoromethanesulfonyl)imide under alkaline conditions (such as triethylamine, etc.) and a suitable solvent (such as dichloromethane, etc.) to generate a compound (e-1) , then, the compound (e-1) With compound (e-3) or compound (e-4) A coupling reaction occurs in the presence of a palladium catalyst (such as tetrakistriphenylphosphine palladium, etc.), a suitable solvent (such as 1,4-dioxane, etc.) and a suitable base (such as sodium carbonate, potassium phosphate, potassium carbonate, etc.) to generate a compound (e-5) ; Finally, the compound (a-5) Hydrolysis reaction occurs in a base (such as LiOH·H2O, lithium hydroxide, etc.) and a suitable solvent (such as methanol, water, etc.) to obtain a compound (e-6) . DETAILED DESCRIPTION

[0249] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0250] Preparation Example

[0251] In the following preparation examples, the inventors describe in detail the preparation process of the compounds of the present invention by taking some of the compounds of the present invention as examples.

[0252] Example 1: 4-(2-cyclopropylethoxy)-7-isopropyl-11-oxo-7,11-dihydro-6H-furo[2,3-h]pyrido[2,1-a]isoquinoline-10-carboxylic acid

[0253] Step 1: 5-Bromo-2,3-dihydrobenzofuran

[0254]

[0255] 2,3-Dihydrobenzofuran (15.26 g, 127.00 mmol) was dissolved in DCM (300 mL), and the resulting solution was added with pyridinium tribromide (45.13 g, 127.00 mmol) at 0°C, and stirred for 10 min, then heated to room temperature and stirred for 60 min. Saturated sodium bisulfite solution was added to the reaction solution to quench the reaction, and the liquid was separated, the organic phase was collected, the aqueous phase was extracted with dichloromethane (100 mL × 1), the organic phases were combined, and the combined organic phases were washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the solvent was removed by distillation under reduced pressure to obtain the title compound as a light yellow solid (22.8 g, 90%). 1 H NMR (400MHz, CDCl3) δ (ppm) 7.28 (s, 1H), 7.20 (d, J = 8.4Hz, 1H), 6.66 (d, J = 8.4Hz, 1H), 4.57 (t, J = 8.7Hz, 2H), 3.20 (t, J = 8.7Hz, 2H).

[0256] Step 2: 5-Bromo-7-iodo-2,3-dihydrobenzofuran

[0257]

[0258] 5-Bromo-2,3-dihydrobenzofuran (20.9 g, 105 mmol) was dissolved in methanol (300 mL), and silver sulfate (16.5 g, 52.7 mmol) and iodine (29.3 g, 115 mmol) were added. The mixture was stirred at room temperature for 3 h, and then sodium bisulfite solid was added to quench the reaction. The solid was removed by filtration through diatomaceous earth, and the filter cake was washed with ethyl acetate (100 mL × 2). The filtrate was collected, and the solvent was removed by distillation under reduced pressure. The residue was diluted with ethyl acetate (200 mL) and saturated sodium bisulfite aqueous solution (200 mL), and the liquids were separated. The upper organic phase was collected, the organic phase was washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the solvent was removed by distillation under reduced pressure to obtain the title compound as a yellow solid (30.23 g, 93.03 mmol, 88.6%). 1 H NMR (400MHz, CDCl3) δ (ppm) 7.55 (s, 1H), 7.23 (s, 1H), 4.65 (t, J = 8.8 Hz, 2H), 3.33 (t, J = 8.8 Hz, 2H).

[0259] Step 3: 5-Bromo-2,3-dihydrobenzofuran-7-ol

[0260]

[0261] Add 5-bromo-7-iodo-2,3-dihydrobenzofuran (9.65 g, 29.7 mmol), N,N'-bis(4-hydroxy-2,6-dimethylphenyl)oxalamide (585 mg, 1.78 mmol), copper acetylacetonate (467 mg, 1.78 mmol), dimethyl sulfoxide (24 mL) and potassium hydroxide (5 g, 89.11 mmol) in water (6 mL) to a dry reaction bottle. The reaction mixture was replaced with nitrogen three times, and the temperature was raised to 60 ° C under nitrogen protection, and the reaction was stirred for 5 hours. After the reaction, the reaction mixture was filtered through diatomaceous earth to remove the solid, and the filter cake was washed with sodium hydroxide aqueous solution (100 mL) and methyl tert-butyl ether (100 mL) at pH 10 in sequence. Collect the filtrate, separate the liquids, collect the lower aqueous phase, and wash with methyl tert-butyl ether (50 mL×2). The pH of the aqueous phase was adjusted to about 4 with 1M hydrochloric acid, ethyl acetate (100 mL) was added, the liquids were separated, the upper organic phase was collected, the aqueous phase was extracted with ethyl acetate (50 mL × 2), and the organic phases were combined. The combined organic phases were washed three times with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the solvent was removed by distillation under reduced pressure to obtain the title compound as a brown-black solid product (6.12 g, 28.5 mmol, 95.8%). 1H NMR (400MHz, CDCl3) δ (ppm) 6.97–6.62 (m, 2H), 5.07 (s, 1H), 4.62 (t, J = 8.7Hz, 2H), 3.23 (t, J = 8.7Hz, 2H).

[0262] Step 4: 7-(Benzyloxy)-5-bromo-2,3-dihydrobenzofuran

[0263]

[0264] 5-Bromo-2,3-dihydrobenzofuran-7-ol (4.562 g, 21.21 mmol) was dissolved in acetonitrile (100 mL), and then K2CO3 (8.8 g, 63.65 mmol) and benzyl bromide (2.77 mL, 23.3 mmol) were added, and the reaction mixture was heated to 80°C and stirred for 5 h. The insoluble solid was removed by filtration, and the filtrate was dried by spin drying. The residue was purified by silica gel column chromatography (PE / EA (V / V) = 5 / 1) to obtain the title compound as a white solid (6.3 g, 21 mmol, 97%). 1 H NMR (400MHz, CDCl3) δ (ppm) 7.36 (ddd, J = 22.6, 16.0, 7.1Hz, 5H), 6.96 (s, 1H), 6.90 (s, 1H), 5.11 (s, 2H), 4.63 (t, J = 8.8Hz, 2H), 3.21 (t, J = 8.8Hz, 2H).

[0265] Step 5: 1-(7-(Benzyloxy)-2,3-dihydrobenzofuran-5-yl)-3-methylbutan-2-one

[0266]

[0267] 7-(Benzyloxy)-5-bromo-2,3-dihydrobenzofuran (1 g, 3.277 mmol), Xantphos (0.189 g, 0.327 mmol), sodium tert-butoxide (0.629 g, 6.54 mmol), Pd2(dba)3 (0.15 g, 0.16 mmol) and THF (15 mL) were added to the reaction flask in sequence, and methyl propyl ketone (1.05 mL, 9.79 mmol) was added under ice bath. After the addition, the reaction mixture was replaced with nitrogen three times for air, and then heated to 60 ° C for 7 h. The reaction was stopped, the reaction mixture was cooled to room temperature, and then concentrated under reduced pressure. The residue was diluted with ethyl acetate (50 mL) and water (50 mL), the organic phase was separated, and the residue was dried by spin drying. The residue was purified by silica gel column chromatography (PE / EA (V / V) = 20 / 1) to obtain the title compound as a white solid (0.68 g, 2.2 mmol, 67%). MS(ESI,pos.ion)m / z:311.1[M+H] + .

[0268] Step 5: 1-(7-(Benzyloxy)-2,3-dihydrobenzofuran-5-yl)-3-methylbutan-2-amine

[0269]

[0270] 1-(7-(Benzyloxy)-2,3-dihydrobenzofuran-5-yl)-3-methylbutan-2-one (0.68 g, 2.2 mmol) was dissolved in MeOH (6.8 mL, 170 mmol), and then ammonium acetate (1.2 g, 16 mmol) was added. The mixture was stirred at room temperature for 30 min, and then cooled to 0 ° C. Sodium cyanoborohydride (0.28 g, 4.4 mmol) was added. After the addition was completed, the reaction mixture was heated to room temperature and stirred for 12 h. After the reaction was completed, the reaction mixture was decompressed to remove methanol, and then saturated sodium bicarbonate solution (20 mL) was added to quench the reaction, and then extracted with ethyl acetate (20 mL × 2). The combined organic phase was washed with saturated sodium chloride solution (20 mL × 1), then dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the title compound as a yellow oily liquid, which was directly used in the next step. MS (ESI, pos.ion) m / z: 312.5 [M+H] + .

[0271] Step 6: N-(1-(7-(Benzyloxy)-2,3-dihydrobenzofuran-5-yl)-3-methylbutan-2-yl)formamide

[0272]

[0273] Add 1-(7-(benzyloxy)-2,3-dihydrobenzofuran-5-yl)-3-methylbutan-2-amine (0.68 g, 2.2 mmol), dichloromethane (6.8 mL), EDCI (0.63 g, 3.3 mmol) and DIPEA (0.42 g, 3.2 mmol) to the reaction bottle, cool to 0 ° C, add formic acid (0.17 mL, 4.4 mmol), and then warm to room temperature and stir to react for 3 hours. After the reaction is completed, add 1M hydrochloric acid (5 mL) and stir, separate the liquids, dry the organic phase with anhydrous sodium sulfate, filter, and spin dry the filtrate. The residue is purified by silica gel column chromatography (DCM / MeOH (V / V) = 20 / 1) to obtain the title compound as a white solid (0.503 g, 1.48 mmol, 68%). MS (ESI, pos.ion) m / z: 340.5 [M+H] + .

[0274] Step 7: N-(1-(7-(Benzyloxy)benzofuran-5-yl)-3-methylbutan-2-yl)formamide

[0275]

[0276] N-(1-(7-(benzyloxy)-2,3-dihydrobenzofuran-5-yl)-3-methylbutan-2-yl)formamide (204 mg, 0.60 mmol) and 1,4-dioxane (5 mL) were added to the dried reaction bottle in sequence. The reaction mixture was stirred until dissolved, and 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (143 mg, 0.60 mmol) was added. The temperature was raised to 100°C and stirred for 3 hours, and then 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (72 mg, 0.30 mmol) was added and continued to stir for 16 hours. After the reaction was completed, the reaction mixture was distilled under reduced pressure to remove the solvent, and the residue was purified by silica gel column chromatography (PE / EA (V / V) = 4 / 1) to obtain the title compound as a brown oily product (109 mg, 0.32 mmol, 53.75%). MS (ESI, pos.ion) m / z: 338.1 [M+H] + .

[0277] Step 8: 6-(Benzyloxy)-3-isopropyl-3,4-dihydrofuro[2,3-h]isoquinoline

[0278]

[0279] Add N-(1-(7-(benzyloxy)benzofuran-5-yl)-3-methylbutane-2-yl)formamide (109 mg, 0.32 mmol) and dichloromethane (5 mL) to a dry reaction bottle, stir until dissolved, and then add phosphorus oxychloride (0.1 mL, 1 mmol) in an ice-water bath. The reaction mixture was moved to room temperature and stirred for 3 h. After the reaction, the solvent was removed by distillation under reduced pressure, transferred to an ice-water bath, and diluted with water (10 mL) and ethyl acetate (10 mL), and adjusted to pH = 8 with 1M sodium hydroxide solution. Separate the liquids, collect the upper organic phase, extract the aqueous phase with ethyl acetate (10 mL), and wash with saturated sodium chloride solution. The solvent was spin-dried, and the residue was purified by silica gel column chromatography (PE / EA (V / V) = 3 / 1) to obtain the title compound as a brown-red solid product (43 mg, 41.67%). MS (ESI, pos.ion) m / z: 320.0 [M+H] + .

[0280] Step 9: 4-(Benzyloxy)-7-isopropyl-11-oxo-7,11,12,12a-tetrahydro-6H-furo[2,3-h]pyrrolidone Ethyl 10-pizo[2,1-a]isoquinolinecarboxylate

[0281]

[0282] Add 6-(benzyloxy)-3-isopropyl-3,4-dihydrofurano[2,3-h]isoquinoline (551 mg, 1.73 mmol), water (3.5 mL), sodium chloride (551 mg), ethyl 2-(ethoxymethylene)-3-oxobutanoate (803 mg, 4.31 mmol) and 2-methyltetrahydrofuran (0.5 mL) to a dry reaction bottle. After the reaction mixture was heated to 70°C and stirred for 13 hours, it was extracted with dichloromethane (50 mL×2) and the organic phases were combined. The organic phase was washed with saturated sodium chloride solution (20 mL) and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA (V / V) = 2 / 1-0 / 1) to obtain the title compound as a brown solid (632 mg, 79.73%). MS (ESI, pos.ion) m / z: 460.2 [M+H] + .

[0283] Step 10: 4-(Benzyloxy)-7-isopropyl-11-oxo-7,11-dihydro-6H-furo[2,3-h]pyridinol [2,1-a]Isoquinoline-10-carboxylic acid ethyl ester

[0284] Add 4-(benzyloxy)-7-isopropyl-11-oxo-7,11,12,12a-tetrahydro-6H-furo[2,3-h]pyrido[2,1-a]isoquinoline-10-carboxylic acid ethyl ester (632 mg, 1.38 mmol), ethylene glycol dimethyl ether (10 mL) and tetrachlorobenzoquinone (376 mg, 1.51 mmol) to a dry reaction bottle. The reaction mixture was heated to 70°C and stirred for 3 hours, then concentrated under reduced pressure. The residue was purified by silica gel column chromatography (DCM / MeOH (V / V) = 20 / 1) to give the title compound as a brown-black solid (485 mg, 77.08%). MS (ESI, pos.ion) m / z: 458.1 [M+H] + .

[0285] Step 11: 4-Hydroxy-7-isopropyl-11-oxo-7,11-dihydro-6H-furo[2,3-h]pyrido[2,1- a]Ethyl isoquinoline-10-carboxylate

[0286] Add 4-(benzyloxy)-7-isopropyl-11-oxo-7,11-dihydro-6H-furano[2,3-h]pyrido[2,1-a]isoquinoline-10-carboxylic acid ethyl ester (485 mg, 1.06 mmol) and trifluoroacetic acid (10 mL) to a dry reaction bottle, heat the reaction mixture to 75°C and stir for 3.5 hours, then concentrate under reduced pressure, and the residue is directly fed to the next step. MS (ESI, pos.ion) m / z: 368.0 [M+H] + .

[0287] Step 12: 4-(2-cyclopropylethoxy)-7-isopropyl-11-oxo-7,11-dihydro-6H-furo[2,3-h] Ethyl pyrido[2,1-a]isoquinoline-10-carboxylate

[0288]

[0289] Mix 4-hydroxy-7-isopropyl-11-oxo-7,11-dihydro-6H-furo[2,3-h]pyrido[2,1-a]isoquinoline-10-carboxylic acid ethyl ester (389 mg, 1.06 mmol), N,N-dimethylformamide (5 mL), potassium carbonate (522 mg, 5.27 mmol) and methanesulfonic acid (2-cyclopropyl) ethyl ester (346 mg, 2.11 mmol). The reaction mixture was heated to 90°C and stirred for 2 h, then concentrated under reduced pressure. The residue was purified by silica gel column chromatography (DCM / MeOH (V / V) = 30 / 1) to give the title compound as a brown solid product (308 mg, 66.80%). MS (ESI, pos.ion) m / z: 436.2 [M+H] + .

[0290] Step 13: 4-(2-cyclopropylethoxy)-7-isopropyl-11-oxo-7,11-dihydro-6H-furo[2,3-h] Pyrido[2,1-a]isoquinoline-10-carboxylic acid

[0291] Dissolve 4-(2-cyclopropylethoxy)-7-isopropyl-11-oxo-7,11-dihydro-6H-furo[2,3-h]pyrido[2,1-a]isoquinoline-10-carboxylic acid ethyl ester (7,308 mg, 0.71 mmol) in methanol (10 mL), then add lithium hydroxide monohydrate (148 mg, 3.53 mmol) and water (2 mL), stir the reaction mixture for 2 h, then adjust the pH of the solution to about 4 with 1M hydrochloric acid, spin dry the solvent, and purify the residue by silica gel column chromatography (DCM / MeOH (V / V) = 20 / 1) to obtain the title compound as an off-white solid (108 mg, 0.265 mmol, 37.47%). MS (ESI, pos.ion) m / z: 408.1 [M+H] + ; 1 HNMR (400MHz, DMSO-d6) δ (ppm) 8.82 (s, 1H), 8.18 (d, J = 2.0 Hz, 1H), 7.36 (d, J =2.1Hz,1H),7.14(d,J=7.8Hz,2H),4.46(dd,J=9.5,3.9Hz,1H),4.38–4.26( m,2H),3.32(t,J=16.2Hz,2H),1.73(q,J=6.7Hz,2H),1.66–1.51(m,1H),0.9 5–0.82(m,4H),0.74(d,J=6.7Hz,3H),0.51–0.40(m,2H),0.20–0.13(m,2H).

[0292] Example 2: 5-(2-cyclopropylethoxy ) -8-Isopropyl-12-oxo-2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylic acid

[0293] Step 1: N-(1-(8-(Benzyloxy)chroman-6-yl)-3-methylbutan-2-yl)formamide

[0294]

[0295] Using chroman as the raw material, the title compound was obtained as a white solid by referring to the synthesis method of steps 1 to 6 of Example 1. MS (ESI, pos.ion) m / z: 354.2 [M+H] + .

[0296] Step 2: 5-Hydroxy-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2, 1-a] Ethyl isoquinoline-11-carboxylate

[0297] Using N-(1-(8-(benzyloxy)chroman-6-yl)-3-methylbutan-2-yl)formamide and phosphorus oxychloride as raw materials, refer to steps 8 to 11 of Example 1 to obtain the title compound as a gray solid. MS (ESI, pos.ion) m / z: 384.2 [M+H] + .

[0298] Step 3: 5-(2-cyclopropylethoxy ) -8-isopropyl-12-oxo-2,3,7,8,12-hexahydropyrano[2,3- h]pyrido[2,1-a]isoquinoline-11-carboxylic acid

[0299] Using 5-hydroxy-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylic acid ethyl ester and methanesulfonic acid (2-cyclopropyl) ethyl ester as raw materials, refer to steps 12 to 13 of Example 1 to obtain the title compound as a gray solid. MS (ESI, pos.ion) m / z: 424.2 [M+H] + ; 1H NMR (400MHz, CDCl3) δ (ppm) 16.04 (s, 1H), 8.47 (s, 1H), 6.92 (s, 1H), 6.67 (s, 1H), 4.57 (d, J = 9.9Hz ,1H),4.21–4.05(m,3H),3.78(d,J=6.0Hz,1H),3.24(dd,J=15.9,4.5Hz,1H),3.17–3.04(m,1H),2 .94(dd,J=35.2,16.1Hz,2H),2.12(d,J=10.8Hz,1H),1.92–1.82(m,1H),1.78(dd,J=13.9,6.9Hz, 2H),1.72–1.65(m,1H),0.89(dd,J=11.1,6.7Hz,7H),0.51(q,J=5.2Hz,2H),0.15(t,J=4.7Hz,2H).

[0300] Example 3: 8-isopropyl-5-(3-methoxypropoxy)-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylic acid

[0301] Using 5-hydroxy-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylic acid ethyl ester and 1-bromo-3-methoxypropane as raw materials, refer to steps 12 to 13 of Example 1 to obtain the title compound as a gray solid. MS (ESI, pos.ion) m / z: 428.5 [M+H] + ; 1 H NMR (400MHz, CDCl3) δ (ppm) 16.08 (s, 1H), 8.48 (s, 1H), 6.92 (s, 1H), 6.68 (s, 1H), 4.56 (d,J=9.1Hz,1H),4.13(dd,J=23.4,9.0Hz,3H),3.81(s,1H),3.57(s,2H),3.35(s,3H) ,3.22(s,1H),3.08(d,J=11.4Hz,1H),2.98(d,J=11.8Hz,1H),2.89(d,J=15.2Hz,1H), 2.19–2.05(m,3H),1.85(d,J=10.9Hz,1H),1.66(s,1H),0.88(dd,J=11.9,5.9Hz,6H).

[0302] Example 4: 8-isopropyl-5-(3-methoxypropoxy)-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]phthalazine-11-carboxylic acid

[0303] Step 1: 6-Bromo-8-(benzyloxy)chroman

[0304]

[0305] Using chroman as the starting material, refer to steps 1 to 4 of the synthesis method in Example 1 to obtain the title compound as a white solid.

[0306] Step 2: 8-(Benzyloxy)chroman-6-carbaldehyde

[0307]

[0308] Dissolve 6-bromo-8-(benzyloxy)benzodihydropyran (10 g, 31.33 mmol) in THF (80 mL), replace with nitrogen three times, place at -10 ° C, and add isopropylmagnesium bromide in THF (7.8 mL, 16 mmol, 2.0 mol / L). Keep the reaction mixture at a temperature below 5 ° C and stir for 10 min, then add n-butyllithium in n-hexane (13 mL, 33 mmol, 2.5 mol / L), continue to stir for 1 h, then add DMF (4.4 mL), continue to stir and react for 2 h. Post-treatment: At 0 ° C, slowly pour the reaction system into dilute hydrochloric acid (180 mL, 1 M) to quench the reaction, then continue to stir for 30 min, remove THF by vacuum distillation, extract with EA (50×2 mL), and collect the organic phase. The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate and spin-dried. The residue was purified by silica gel column chromatography (PE / EA (V / V) = 10 / 1) to give the title compound as a yellow-green solid (5.0 g, 19 mmol, 59%).

[0309] Step 3: 8-(Benzyloxy)-5-iodobenzodihydrofuran-6-carbaldehyde

[0310]

[0311] 8-(Benzyloxy)benzodihydropyran-6-carboxaldehyde (5g, 18.64mmol), DCM (50mL) and TFA (5mL, 65.076mmol) were added to a single-necked flask, and NIS (5.619g, 24.23mmol) was slowly added under ice bath. After the addition was completed, the mixture was stirred at room temperature for 15h. After the reaction was completed, the solvent was concentrated to remove the residual trifluoroacetic acid, and ethanol (35mL) was added under ice bath, stirred overnight, and filtered to obtain the title compound as a pink solid (6.9g, 18mmol 94%).

[0312] Step 4: (8-(Benzyloxy)-5-iodochroman-6-yl)methanol

[0313]

[0314] Dissolve 8-(Benzyloxy)-5-iodobenzodihydrofuran-6-carboxaldehyde (7.2g, 18mmol) in THF (58mL) and MeOH (5.8mL), stir at room temperature until completely dissolved, cool to 0℃ and slowly add sodium borohydride (0.61g, 15mmol). After addition, heat to room temperature and stir for 1h, and concentrate the solvent under reduced pressure. Dilute the residue with 10% NaOH aqueous solution (20mL), extract with EA (30mL×2), and combine the organic phases. The organic phase is concentrated under reduced pressure to obtain the title compound as a white solid (5.46g, 13.8mmol, 75%). MS (ESI, pos.ion) m / z: 379.0 [M-18] + .

[0315] Step 5: 8-(Benzyloxy)-6-(chloromethyl)-5-iodochroman

[0316]

[0317] Add (8-(Benzyloxy)-5-iodochroman-6-yl)methanol (5.2 g, 13 mmol) and DCM (26 mL) to a single-necked flask, slowly add dichlorothionyl (1.9 mL, 27 mmol) dropwise under ice bath, move to room temperature and stir to react for 2 h. Concentrate under reduced pressure to obtain the title compound as a white solid (5.0 g, 12 mmol, 92%).

[0318] Step 5: 4-Oxo-4H-pyran-3-carboxylic acid ethyl ester

[0319]

[0320] Add 2-(dimethylaminomethylene)-3-oxo-butyric acid ethyl ester (70g, 377.93mmol), THF (700mL) and ethyl formate (62.3mL, 756mmol) to the reaction flask, add sodium tert-butyl alcohol (74.88g, 755.8mmol) under ice bath, warm to room temperature and stir to react for 1.5h, then add dilute hydrochloric acid (472.41mL, 1889.6mmol, 4mol / L) at 0℃, stir to react, add dichloromethane (400mL), separate, extract the aqueous phase with dichloromethane (250mL×2), combine the organic phases, wash the organic phase once with saturated brine, dry over anhydrous sodium sulfate, filter, and concentrate under vacuum to obtain the title compound as a reddish brown oily compound (64g, 380.61mmol, 100%).

[0321] Step 6: 1-(Isopropylamino)-4-oxo-1,4-dihydropyridine-3-carboxylic acid ethyl ester

[0322]

[0323] Dissolve isopropylhydrazine hydrochloride (36.17 g, 327.1 mmol) and ethyl 4-oxo-4H-pyran-3-carboxylate (50 g, 297.35 mmol) in EtOH (250 mL), stir and reflux at 80 ° C for 2 h, and then concentrate under reduced pressure. Add TBME (200 mL) and water (200 mL) to the residue, then stir at room temperature, collect the lower aqueous phase, and wash the aqueous phase with TBME (100 mL × 2). Add dichloromethane (200 mL) and 20% saturated sodium bicarbonate solution (300 mL) to the aqueous phase, separate the liquids, extract the aqueous phase with dichloromethane (100 mL × 2), and combine the organic phases. The combined organic phases are dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain the title compound as a reddish brown solid compound (15 g, 66.89 mmol, 22.494%).

[0324] Step 7: 1-(((8-(Benzyloxy)-5-iodochroman-6-yl)methyl)(isopropyl)amino)-4-oxo Ethyl 1,4-dihydropyridine-3-carboxylate

[0325] In a single-mouth bottle, add 1-(isopropylamino)-4-oxo-1,4-dihydropyridine-3-carboxylic acid ethyl ester (2.0 g, 8.9 mmol), 8-(benzyloxy)-6-(chloromethyl)-5-iodobenzodihydropyran (5.5 g, 13 mmol), potassium iodide (0.15 g, 0.90 mmol) and potassium carbonate (2.5 g, 18 mmol) and dissolve in MeCN (20 mL), stir and reflux at 90°C for reaction. Filter through celite, wash the filter cake with dichloromethane (100 mL), concentrate the filtrate, and purify the obtained residue by silica gel column chromatography (DCM / MeOH (V / V) = 10 / 1) to obtain the title compound as a yellow foamy solid (3.45 g, 5.73 mmol, 64%). MS (ESI, pos.ion) m / z: 603.1 [M+H] + .

[0326] Step 8: 5-(Benzyloxy)-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido [2,1-a]Phthaloazine-11-carboxylic acid ethyl ester

[0327] In a single-necked flask, 1-(((8-(benzyloxy)-5-iodobenzodihydropyran-6-yl)methyl)(isopropyl)amino)-4-oxo-1,4-dihydropyridine-3-carboxylic acid ethyl ester (3.5 g, 5.8 mmol), potassium acetate (1.1 g, 11 mmol), DMF (18 mL) and palladium bromide (0.24 g, 0.86 mmol) were added. The atmosphere was replaced with nitrogen three times, and the reaction mixture was stirred at 60°C for 8 h, then cooled to room temperature, ethyl acetate (50 mL) and water (50 mL) were added to extract the liquid, and the aqueous phase was extracted with dichloromethane (50 mL×3), and the organic phases were combined. The combined organic phases were washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain the title compound as a dark brown solid (2.6 g, 5.5 mmol, 94%). MS (ESI, pos.ion) m / z: 475.2 [M+H] + .

[0328] Step 8: 5-(Hydroxy)-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2, 1-a] Phthaloazine-11-carboxylic acid ethyl ester

[0329]

[0330] Dissolve 5-(Benzyloxy)-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyran[2,3-h]pyrido[2,1-a]phthalazine-11-carboxylic acid ethyl ester (2.6 g, 5.5 mmol) in TFA (7.8 mL, 85 mmol), heat to 75°C and reflux for 1 h, turn off the heating, and concentrate the solvent under reduced pressure to obtain the title compound as a dark brown oily compound, which is directly reacted in the next step. MS (ESI, pos.ion) m / z: 385.2 [M+H] + .

[0331] Step 9: 8-isopropyl-5-(3-methoxypropoxy)-12-oxo-1,2,3,7,8,12-hexahydropyrano[2, 3-h]Pyrido[2,1-a]phthalazine-11-carboxylic acid ethyl ester

[0332] Add 5-(Hydroxy)-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]phthalazine-11-carboxylic acid ethyl ester (2.1 g, 5.5 mmol) and DMF (21 mL) to a single flask, stir and dissolve in an 80°C oil bath, then add potassium carbonate (3.1 g, 22 mmol) and 1-bromo-3-methoxy-propane (1.7 g, 11 mmol), stir and react for 3 h, cool to room temperature, add EA (40 mL) and water (40 mL) to dilute, separate the layers, extract the aqueous phase with EA (40 mL × 2), combine the organic phases, wash the organic phase three times with saturated brine, then dry over anhydrous sodium sulfate, filter, and concentrate under reduced pressure to obtain the title compound as a reddish brown solid (2.5 g, 5.5 mmol, 100%).

[0333] Step 10: 8-isopropyl-5-(3-methoxypropoxy)-12-oxo-1,2,3,7,8,12-hexahydropyrano[2, 3-h]Pyrido[2,1-a]phthalazine-11-carboxylic acid

[0334] 8-isopropyl-5-(3-methoxypropoxy)-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]phthalazine-11-carboxylic acid ethyl ester (2.5 g, 5.5 mmol), methanol (25 mL, 618 mmol), H2O (5.0 mL) and LiOH·H2O (1.1 g, 26 mmol) were added to a single-necked flask. The mixture was stirred at room temperature for 1 hour. The solvent was concentrated. 1M hydrochloric acid was added to the residue to adjust the pH to 4, and then DCM was added to dilute the residue. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (DCM / MeOH (V / V) = 10 / 1) to obtain the title compound as a white solid compound (1.15 g, 2.68 mmol, 49%). MS (ESI, pos.ion) m / z: 429.2 [M+H] + ; 1 H NMR (400MHz, CDCl3) δ (ppm) 15.89 (s, 1H), 8.59 (s, 1H), 6.92 (s, 1H), 6.67 (s, 1H), 4.57 (s, 1H), 4.37–4.03(m,5H),3.64–3.28(m,6H),3.17–2.77(m,3H),2.12(s,3H),0.98(d,J=26.6Hz,6H).

[0335] Example 5: 5-(1-(difluoromethyl)-1H-pyrazol-4-yl)-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylic acid

[0336]

[0337] Step 1: 8-isopropyl-12-oxo-5-(((trifluoromethyl)sulfonyl)oxy)-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyridin[2,1-a]isoquinoline-11-carboxylic acid ethyl ester

[0338]

[0339] Dissolve 5-hydroxy-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylic acid ethyl ester (0.420 g, 1.10 mmol) in DCM (10 mL), cool to 0°C, add DBU (0.263 g, 1.64 mmol), stir for 30 min, add PhN(OTf)2 (0.618 g, 1.64 mmol) in batches, then slowly warm to room temperature and stir overnight. Concentrate the solvent, and purify the residue by silica gel column chromatography (DCM / MeOH (V / V) = 15 / 1) to obtain the product title compound as a yellow solid (0.565 g, 1.10 mmol, 98%). MS (ESI, pos.ion) m / z: 516.5 [M+H] + .

[0340] Step 2: 5-(1-difluoromethyl)-1H-pyrazol-4-yl)-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylic acid ethyl ester

[0341]

[0342] To the reaction flask was added ethyl 8-isopropyl-12-oxo-5-(((trifluoromethyl)sulfonyl)oxy)-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyridin[2,1-a]isoquinoline-11-carboxylate (0.565 g, 1.10 mmol), 1-(difluoromethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (0.535 g, 2.19 mmol), sodium carbonate (0.291 g, 3.29 mmol), PdCl2(dppf) (0.141 g, 0.164 mmol), 1,2-dimethoxyethane (14.1 mL) and H2O (2.83 mL). The mixture was replaced with nitrogen three times, then reacted at 100°C for 8 hours, and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography (DCM / MeOH (V / V) = 10 / 1) to obtain the title compound as a dark brown solid (0.482 g, 0.997 mmol, 91.0%). MS (ESI, pos.ion) m / z: 484.3 [M+H] + .

[0343] Step 3: 5-(1-(difluoromethyl)-1H-pyrazol-4-yl)-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylic acid

[0344]

[0345] In a single-necked flask were added ethyl 5-(1-difluoromethyl)-1H-pyrazol-4-yl)-8-isopropyl-12-oxo-1,2,3,7,8,12-hexahydropyrano[2,3-h]pyrido[2,1-a]isoquinoline-11-carboxylate (0.482 g, 0.997 mmol), methanol (4.82 mL, 119 mmol), H2O (0.964 mL) and LiOH·H2O (0.209 g, 4.98 mmol). The reaction mixture was stirred at room temperature for 2 h, and then the solvent was concentrated under reduced pressure. 1 M hydrochloric acid was added to adjust the pH to 4, and DCM was added to dilute the mixture. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (DCM / MeOH (V / V) = 10 / 1) to give the title compound as a white solid (161 mg, 0.3535 mmol, 35.5%). MS (ESI, pos.ion) m / z: 456.1 [M+H] + ; 1H NMR (400MHz, CDCl3) δ (ppm) 15.86 (s, 1H), 8.52 (s, 1H), 8.36 (s, 1H), 8.08 (s, 1H), 7.39–7.02 (m, 1H), 4.64 (d, J = 10.5Hz, 1H) ,4.23(t,J=10.7Hz,1H),3.85(d,J=7.4Hz,1H),3.29–2.96(m,5H),2.25–2.15(m,1H),1.97–1.85(m,1H),0.93–0.87(m,6H).

[0346] Biological activity test

[0347] HBV cell lines

[0348] HepG2.2.15 cells (SELLS, PNAS, 1987 and SELLS, JV, 1988) have a complete HBV genome integrated into their chromosomes and stably express viral RNA and viral proteins. HepG2.2.15 cells can secrete mature hepatitis B virus particles and HBsAg into the culture medium. The viral particle DNA and HBsAg secreted by HepG 2.2.15 cells can be quantified by qPCR and ELISA methods, and the effects of compounds on viral replication and HBsAg secretion can be detected.

[0349] Test 1: Inhibition experiment of the compound of the present invention on HBV virus replication

[0350] Experimental methods:

[0351] 8,000 HepG 2.2.15 cells were seeded into 96-well cell culture plates in duplicate for 3 days until the cells grew to full wells. The cells were treated with 4-fold serial dilutions of the compound for 10 days, and the medium was changed every other day. The final concentration of DMSO in all wells was 0.5% and DMSO was used as a drug-free control. The supernatant was collected on the 11th day for HBV DNA quantitative detection.

[0352] The qPCR method was used to detect viral genomic DNA. The HBV primers were as follows:

[0353] HBV-For-202, CAGGCGGGGTTTCTTGTTGA (SEQ ID NO: 1);

[0354] HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC (SEQ ID NO: 2).

[0355] The SYBR Premix Ex Taq II–Takara DRR081S kit was used, with 1 μL of cell culture supernatant as the template, and a plasmid containing the HBV genome was used as the standard curve to calculate the viral copy number. The concentration-viral copy number was processed using Graphpad Prism 5 software, and the IC of the compound on viral replication inhibition was calculated using a four-parameter nonlinear regression model. 50 .

[0356] Conclusion: The inhibition experiment of the compounds of the present invention on HBV virus replication shows that the compounds of the present invention have good inhibitory activity on HBV DNA replication, wherein the IC value of the compounds of the present invention on HBV DNA replication inhibition activity is 50 The IC values ​​of most compounds for HBV DNA replication inhibition were less than 0.1 μM. 50 Less than 0.05μM.

[0357] The results of the inhibitory activities of some compounds of the present invention on HBV DNA replication are shown in Table 1.

[0358] Table 1: Inhibitory activity of some compounds of the present invention on HBV DNA replication

[0359] Example <![CDATA[IC 50 (nM) <!-- 48 -->]]> Example 1 0.41

[0360] Test 2: Inhibition experiment of the compounds of the present invention on HBsAg secretion

[0361] Experimental methods:

[0362] 8,000 HepG 2.2.15 cells were seeded into 96-well cell culture plates in duplicate for 3 days until the cells grew to full wells. The cells were treated with 4-fold serial dilutions of the compound for 10 days, and the medium was changed every other day. The final concentration of DMSO in all wells was 0.5% and DMSO was used as a drug-free control. The supernatant was collected on the 11th day for HBsAg quantitative detection.

[0363] The ELISA method was used to detect the level of HBsAg secreted by cells after compound treatment. The method used the Hepatitis B Surface Antigen Diagnostic Kit (Shanghai Kehua Bioengineering Co., Ltd. S10910113). 25 μL of the supernatant to be tested (PBS diluted to 75 μL) was added to each well of the ELISA plate, and the positive and negative controls of the kit were set. After sealing the ELISA plate with sealing paper, incubate at 37°C for 60 minutes. Take out the ELISA plate, tear off the sealing paper, and add 50 μL of enzyme conjugate to each well. Oscillate on the oscillator for 10 seconds, seal the ELISA plate with sealing paper, and incubate at 37°C for 30 minutes. Take out the ELISA plate, tear off the sealing paper, and repeat the washing 5 times: discard the liquid in the well each time, add washing solution to fill each well, let it stand for 60 seconds, spin dry, and pat dry the liquid residue on absorbent paper. After washing, add a freshly prepared mixture of color developer A and color developer B to all wells immediately: 100 μL per well. Oscillate on a shaker for 10 seconds, seal the ELISA plate with sealing paper, and incubate at 37°C for 30 minutes. Add 50 μL of stop solution to all wells. Read the plate at a wavelength of 450 nm on an Envision plate reader. Use Graphpad Prism 5 software to process the concentration-HbsAg OD450 value data, and calculate the IC of the compound for HbsAg secretion inhibition using a four-parameter nonlinear regression model. 50 .

[0364] Conclusion: The inhibition experiment of the compounds of the present invention on HBsAg secretion shows that the compounds of the present invention have good inhibitory activity on HBsAg secretion, wherein the IC value of the inhibitory activity of the compounds of the present invention on HBsAg secretion is 50 The IC values ​​of most compounds for the inhibitory activity on HBsAg secretion were less than 0.1 μM. 50 Less than 0.05μM.

[0365] The inhibitory activity of some compounds of the present invention on HBsAg secretion is shown in Table 2.

[0366] Table 2: Inhibitory activity of some compounds of the present invention on HBsAg secretion

[0367] Example <![CDATA[IC 50 (nM)]]> Example 1 <0.24

[0368] Test 3: Pharmacokinetics of the compounds of the present invention in beagle dogs, mice and rats

[0369] (1) Beagle dog PK test

[0370] PK test of the compound of the present invention in beagle dogs (weight 10-12 kg, male, age 10-12 months, 3 dogs per group for oral administration and 3 dogs per group for intravenous injection)

[0371] Experimental methods:

[0372] Beagle dogs were given 2.5 mg / kg or 5 mg / kg of the test compound by oral gavage or 0.5 mg / kg or 1 mg / kg by intravenous injection.

[0373] After administration, venous blood was collected at time points (0.083, 0.25, 0.5, 1, 2, 4, 6, 8 and 24 hours) and collected in anticoagulant tubes with EDTA-K2. After liquid-liquid extraction, plasma samples were quantitatively analyzed on a triple quadrupole tandem mass spectrometer using multiple reaction ion monitoring (MRM). Pharmacokinetic parameters were calculated using WinNonlin 6.3 software using the non-compartmental model method.

[0374] Conclusion: The pharmacokinetic experimental data show that the compounds of the present invention exhibit good pharmacokinetic properties in beagle dogs when administered intravenously or orally, including good absorption (AUC (last) and AUC (INF) ) and good oral bioavailability (F).

[0375] (2) ICR mouse PK test experiment

[0376] PK test of the compound of the present invention in ICR mice (weight 20-25g, male, age 45-60 days, 3 mice per group for oral administration and 3 mice per group for intravenous injection)

[0377] Experimental methods:

[0378] ICR mice were given 10 mg / kg of the test compound by oral gavage or 2 mg / kg or 10 mg / kg by tail vein injection. Blood was collected from the orbital vein at time points (0.083, 0.25, 0.5, 1, 2, 4, 6, 8 and 24 hours) after administration and collected in anticoagulant tubes with EDTA-K2. After liquid-liquid extraction, plasma samples were quantitatively analyzed by multiple reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. Pharmacokinetic parameters were calculated using the non-compartmental model method using WinNonlin 6.3 software.

[0379] Conclusion: The pharmacokinetic experimental data show that the compound of the present invention has good pharmacokinetic properties in ICR mice and has a good application prospect in anti-HBV virus.

[0380] (3) PK test experiment in SD rats

[0381] PK test of the compound of the present invention in SD rats (weight 200-250g, male, age 2-3 months, 3 rats per group for oral administration and 3 rats per group for intravenous injection)

[0382] Experimental methods:

[0383] SD rats were given 2.5 mg / kg or 5 mg / kg of the test compound by oral gavage or 0.5 mg / kg or 1 mg / kg by intravenous injection. After administration, venous blood was collected at time points (0.083, 0.25, 0.5, 1, 2, 5, 7 and 24 hours) and collected in anticoagulant tubes with EDTA-K2. After liquid-liquid extraction, the plasma samples were quantitatively analyzed by multiple reaction ion monitoring (MRM) on a triple quadrupole tandem mass spectrometer. The pharmacokinetic parameters were calculated using the non-compartmental model method using WinNonlin 6.3 software. The pharmacokinetic experimental results of some compounds of the present invention in SD rat PK are shown in Table 3.

[0384] Table 3: Pharmacokinetic test results of some compounds of the present invention in SD rats

[0385]

[0386] Conclusion: The pharmacokinetic experimental data show that the compounds of the present invention exhibit good pharmacokinetic properties in SD rats when administered intravenously or orally, including good absorption (AUC (last) and AUC (INF) ) and good oral bioavailability (F).

[0387] Test 4: Stability test of the compounds of the present invention in liver microsomes of different species

[0388] Experimental methods:

[0389] Add 30 μL of the blank solution and liver microsomes mixed solution to a 96-well plate, add 15 μL of the buffer containing the test compound to each well, and make two samples in parallel. After pre-incubation at 37°C for 10 minutes, add 15 μL of NADPH solution (8 mM) at 0 min, 15 min, 20 min and 60 min. The final concentration of the test compound is 1 μM, the concentration of liver microsomes is 0.1 mg / mL, and the final concentration of NADPH is 2 mM. Incubate for 0, 15, 30, and 60 min respectively. After the incubation, add 150 μL of acetonitrile (containing internal standard) to the mixed system. The sample diluted with acetonitrile is centrifuged at 4,000 rpm for 5 minutes, and 150 μL of the supernatant is taken for LC-MS / MS analysis.

[0390] Conclusion: The experimental data of liver microsome stability show that the compounds of the present invention have good stability in liver microsomes of different species.

Claims

1. A compound, which is a compound represented by formula (I) or a tautomer or a pharmaceutically acceptable salt of the compound represented by formula (I), in, R 1 For R 1a O-; X is CR 7 ; Ring A is R 3 For R 10 -CH2-O- or R 10 -(CH2)2-O-, R 10 is cyclopropyl or cyclopentyl; or R 3 For R 10 -(CH2)3-O-, R 10 For R 11 O-, R 11 is methyl; Each R 1a , R 4 , R 5 , R 7 , R 8 and R 9 independently hydrogen or deuterium; R 6 It is isopropyl.

2. A compound comprising one of the following structures: or their tautomers or pharmaceutically acceptable salts.

3. A pharmaceutical composition comprising the compound according to any one of claims 1 to 2 or its tautomer or pharmaceutically acceptable salt; optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient or a combination of the excipients. The pharmaceutical composition according to claim 3 , further comprising other anti-HBV drugs. 5 . The pharmaceutical composition according to claim 4 , wherein the other anti-HBV drug is a HBV polymerase inhibitor, an immunomodulator or an interferon.

6. The pharmaceutical composition according to claim 5, wherein the other anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simu-leukin, clavudine, emtricitabine, famciclovir, interferon, baoganling CP, intefen, interleukin-2, mivotilide, nitazoxanide, ribavirin, interferon-A, sizoran, Euforavac, ampligen, Phosphazid, Heplisav, levamisole or propagermanium.

7. Use of the compound according to any one of claims 1-2 or the pharmaceutical composition according to any one of claims 3-6 in the preparation of a medicament for preventing, treating or alleviating a viral disease in a patient, wherein the viral disease refers to hepatitis B virus infection or a disease caused by hepatitis B virus infection.

8. The use according to claim 7, wherein the disease caused by hepatitis B virus infection is liver cirrhosis or hepatocellular carcinoma.

9. Use of the compound according to any one of claims 1 to 2 or the pharmaceutical composition according to any one of claims 3 to 6 in the preparation of a drug for inhibiting the production or secretion of HBsAg and / or for inhibiting the production of HBV DNA.

Images