A fluorescent dye and its preparation method and use

By designing and synthesizing a fluorescent dye with a structure of formula (I), the problem of high fluorescence background is solved, and the high signal-to-noise ratio application of low-background fluorescent dyes in viscosity testing and biomarker detection is achieved.

CN113501790BActive Publication Date: 2025-10-03FLUORESCENT DIAGNOSIS (SHANGHAI) BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202010207772.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-03-23
Publication Date
2025-10-03
Estimated Expiration
2040-03-23

AI Technical Summary

Technical Problem

Existing imidazolinone fluorescent dyes have the problem of high fluorescence background, resulting in a low detection signal-to-noise ratio, making them difficult to apply to the detection and labeling of samples with small sample volume, complex components and low substrate abundance.

Method used

A fluorescent dye was designed, the structure of which is shown in formula (I). It was synthesized via an aldol condensation reaction, has viscosity responsiveness, and the ratio of the fluorescence intensity in glycerol to the fluorescence intensity in methanol under 10-5 mol conditions is greater than 10. It is used to prepare a fluorescence-activated light-up probe.

Benefits of technology

The fluorescent dye has achieved low background fluorescence, enhanced the signal-to-noise ratio of detection, and expanded its application in viscosity testing, protein fluorescence labeling, nucleic acid fluorescence labeling, protein quantification or detection and other fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113501790B_ABST
    Figure CN113501790B_ABST
Patent Text Reader

Abstract

A fluorescent dye and its preparation method and use. The fluorescent dye has the advantages of sensitive and specific viscosity response and low background fluorescence. It can also be used as a fluorescence-activated light-up probe for fluorescent labeling, quantification or detection of proteins, enzymes or nucleic acids.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of fluorescent dyes, and in particular to a fluorescent dye with viscosity responsiveness and low background fluorescence, and a preparation method and application thereof. Background Art

[0002] The chromophores of fluorescent proteins are primarily imidazolinone dyes, which have good biocompatibility, excellent photostability, and tunable fluorescence properties. Studies have shown that these dyes are molecular rotors whose fluorescence properties vary with viscosity. When excited by light, the free molecular rotor releases excited-state energy in a non-radiative manner through intramolecular distortion. When the molecule is in a more viscous or rigid environment, the intramolecular distortion is restricted, and the excited-state energy is released primarily as radiative luminescence, exhibiting enhanced fluorescence. Therefore, molecular rotors are often used to detect changes in the microenvironment.

[0003] Currently, intramolecular luminescence based on restricted molecular rotors is not only used for viscosity detection, but is also widely applied in the construction of fluorescent sensors, protein labeling, and nucleic acid labeling. For example, when DCVJ binds to proteins such as BSA, the excited-state intramolecular twist of the molecular rotor is restricted, and the excited-state energy is released as radiative luminescence, manifesting as fluorescence activation, which can be used for the detection and quantification of target proteins. Dyes such as thiazole orange, upon binding to DNA and RNA, restrict their molecular conformation, emitting fluorescence, making them suitable for wash-free labeling and detection of DNA and RNA. Using DHBI as a target molecule, aptamers that specifically bind to it were screened through SELEX, resulting in the construction of fluorescent aptamers, overcoming the problem of the lack of naturally fluorescent RNA and making it possible to construct fluorescent RNA. Using malachite green as a target molecule, phage display technology has generated single-chain antibodies that specifically bind to malachite green derivatives and activate fluorescence, which are used for labeling cell membrane proteins. Molecular rotors such as BODIPY bind to amyloid and tua proteins and emit fluorescence, which is used in the study of diseases such as AIDS, Alzheimer's disease, and Parkinson's disease.

[0004] However, the types of imidazolinone molecular rotors derived entirely from fluorescent protein chromophores are very limited. Modification of these rotors through organic synthesis has greatly expanded the spectral range of imidazolinones and can effectively adjust other properties, such as photostability and oil-water partition coefficient. However, the molecular rotors currently obtained by this method generally suffer from the disadvantage of high fluorescence background, resulting in a low signal-to-noise ratio, making them difficult to apply to the detection and labeling of samples with small sample amounts, complex components, and low substrate abundance. Therefore, it is necessary to develop a class of imidazolinone molecular rotors with low background fluorescence, which can further expand the application of this type of molecular rotor. Summary of the Invention

[0005] The object of the present invention is to provide a fluorescent dye with viscosity responsiveness and low background fluorescence. The viscosity responsiveness of this type of molecular rotor is 10 -5 Under 1 mol / L conditions, the ratio of the fluorescence intensity in glycerol to that in methanol was greater than 10.

[0006] In one aspect of the present invention, a fluorescent dye is provided, wherein the fluorescent dye is represented by formula (I):

[0007]

[0008] in:

[0009] Ar is an arylene group or a heteroarylene group, and the hydrogen atoms in Ar are optionally substituted by halogen atoms; D- is HO- or N(X1)(X2)-, and X1 and X2 are independently selected from hydrogen, alkyl or modified alkyl; X1 and X2 are optionally connected to each other and form an aliphatic heterocycle together with the N atom; X1 and X2 optionally form an aliphatic heterocycle independently with Ar;

[0010] Y is O or S;

[0011] R1 is hydrogen or alkyl;

[0012] R2 is a halogen atom, -OH or -CN;

[0013] in:

[0014] The "alkyl" is C1-C 10 linear or branched alkyl; optionally, C1-C6 linear or branched alkyl; optionally, C1-C4 linear or branched alkyl; optionally, selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl ... hexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, 2-ethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 2,3-dimethylpentyl, 2,4-dimethylpentyl, 3-ethylpentyl, or 2,2,3-trimethylbutyl;

[0015] The "modified alkyl" is independently C1-C 16 A group obtained by replacing any carbon atom of a straight-chain or branched alkyl group with one or more groups selected from a halogen atom, -OH, -CO-, -O-, -CN, -SO3H, a primary amino group, a secondary amino group, or a tertiary amino group, or a group in which a carbon-carbon single bond is optionally and independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond;

[0016] The carbon atom is replaced, which means that the carbon atom or the carbon atom together with the hydrogen atoms thereon are replaced by the corresponding group;

[0017] The "halogen atoms" are each independently F, Cl, Br or I;

[0018] The "aliphatic heterocycle" is a saturated or unsaturated 4-15 membered monocyclic or polycyclic aliphatic heterocycle containing one or more heteroatoms selected from N, O, S or Si. When the aliphatic heterocycle contains a S atom, it is -S-, -SO- or -SO2-. The aliphatic heterocycle may be optionally substituted with a halogen atom, an alkyl group, an aryl group or a modified alkyl group.

[0019] The "arylene" is independently a 5-13 membered (optionally 6-membered or 10-membered) monocyclic or bicyclic or fused bicyclic or fused polycyclic aromatic group;

[0020] The "heteroarylene" is independently a 5-13 membered (optionally 6-membered or 10-membered) monocyclic or bicyclic or fused bicyclic or fused polycyclic heteroaromatic group containing one or more heteroatoms selected from N, O, S or Si in the ring;

[0021] The "primary amino group" is an R'NH2 group;

[0022] The "secondary amino group" is an R'NHR" group;

[0023] The "tertiary amino group" is an R'NR"R"' group;

[0024] Each R', R", and R'" are independently a single bond, hydrogen, alkyl, or alkylene;

[0025] The "alkylene" is C1-C 10 Alternatively, it is a C1-C7 straight chain or branched chain alkylene; Alternatively, it is a C1-C5 straight chain or branched chain alkylene;

[0026] Optionally, the "modified alkyl" is a group containing -OH, -O-, -NH2, ethylene glycol units (-(CH2CH2O) n -), -CN, -O-CO-, -NH-CO-, -SO2-O-, -SO-, Me2N-, Et2N-, -CH=CH-, -C≡CH, F, Cl, Br, I, one or more groups selected from cyano;

[0027] Optionally, Ar is a structure selected from the following formulas (II-1) to (II-7):

[0028]

[0029] Optionally, the compound represented by formula (I) is selected from the following compounds:

[0030]

[0031] The second aspect of the present invention is to provide a method for preparing the above-mentioned fluorescent dye, characterized in that it includes the steps of subjecting a compound of formula (a) to an aldol condensation reaction with a compound of formula (b):

[0032]

[0033] The third aspect of the present invention is to provide the use of the above-mentioned fluorescent dye in viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, which is a use other than a method for diagnosing a disease.

[0034] The fourth aspect of the present invention is to provide the use of the above-mentioned fluorescent dye in the preparation of reagents for viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

[0035] The fifth aspect of the present invention is to provide a fluorescence-activated light-up probe comprising the above-mentioned fluorescent dye.

[0036] The sixth aspect of the present invention is to provide the use of the above-mentioned fluorescence-activated light-up probe in protein fluorescence labeling, nucleic acid fluorescence labeling, protein quantification or detection, or nucleic acid quantification or detection, and the use is not for the diagnosis method of the disease.

[0037] The seventh aspect of the present invention is to provide the use of the above-mentioned fluorescence-activated light-up probe in the preparation of reagents for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

[0038] The fluorescent dyes obtained in the present invention can be used to measure sample viscosity, for example, for microscopic viscosity testing. According to another embodiment, the fluorescent dyes can be specifically bound to corresponding antibodies, aptamers, or amyloid proteins, or bonded to protein tags or enzymes via ligands or inhibitors to produce a series of fluorescence-activated light-up probes for fluorescent labeling, quantification, or monitoring of proteins, enzymes, or nucleic acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 For molecular rotor IV-1 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0040] Figure 2 For molecular rotor IV-2 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0041] Figure 3 For molecular rotor IV-3 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0042] Figure 4 For molecular rotor IV-4 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0043] Figure 5 For molecular rotor IV-5 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0044] Figure 6 For molecular rotor IV-6 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0045] Figure 7 For molecular rotor IV-17 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0046] Figure 8 For molecular rotor IV-18 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0047] Figure 9 For molecular rotor IV-19 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0048] Figure 10 For molecular rotor IV-20 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0049] Figure 11 For molecular rotor IV-21 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0050] Figure 12 For molecular rotor IV-22 (1×10 -5 M) Fluorescence emission intensity graph under different viscosity conditions;

[0051] Figure 13 For molecular rotors IV-39, IV-40, IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8 (1×10 -6 M) Fluorescence background comparison in PBS;

[0052] Figure 14 For molecular rotors IV-41, IV-43 and IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 (1×10 - 6 M) Fluorescence background comparison in PBS;

[0053] Figure 15 For molecular rotors IV-42 and IV-36 (1×10 -6 M) Fluorescence background comparison in PBS;

[0054] Figure 16 For molecular rotors IV-45, IV-46 and IV-3 (1×10 -6 M) Fluorescence background comparison in PBS;

[0055] Figure 17 For molecular rotors IV-47, IV-48 and IV-20 (1×10 -6 M) Fluorescence background comparison in PBS;

[0056] Figure 18 For molecular rotors IV-49, IV-50 and IV-5 (1×10 -6 M) Fluorescence background comparison in PBS;

[0057] Figure 19 For molecular rotors IV-51 and IV-1 (1×10 -6 M) Fluorescence background comparison in PBS;

[0058] Figure 20 Molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, and IV-22 are used to label RNA aptamers in cells, where A represents cells expressing the target RNA aptamer and B represents cells not expressing the target RNA aptamer.

[0059] Figure 21 This is a flow cytometry diagram of mRNA labeled by molecular rotors IV-21 and IV-41. DETAILED DESCRIPTION

[0060] Example 1:

[0061] Compound IV-1:

[0062]

[0063] Compound 1 (0.504 g, 2 mmol) and p-cyanobenzaldehyde (0.626 g, 5 mmol) were placed in a 250 ml round-bottom flask and dissolved in 100 ml of tetrahydrofuran. Anhydrous zinc chloride (0.545 g, 4 mmol) was added under Ar protection, and the system was heated to reflux in an oil bath at 80°C. The reaction was detected by TLC. The solvent was removed in vacuo, and the residue was separated by column chromatography to obtain the desired product (0.292 g, 40%). 1 H NMR (400MHz, DMSO-d6) δ11.07(s,1H),8.10(d,J=8.5Hz,2H),8.06(dd,J=7.8,2.1Hz,2H),8.03 (s,1H),7.94(d,J=8.3Hz,2H),7.44(d,J=15.9Hz,1H),7.03(s,1H),3.29(s,3H).MS(ESI):m / z Calcd.For C 20 H 13 F2N3O2 365.0976; found 364.0902,[MH] - .

[0064] Example 2:

[0065] Compound IV-2:

[0066]

[0067] According to the synthetic procedure of compound IV-1, (0.475 g, 65%). 1 H NMR (400MHz, DMSO-d6) δ11.04(s,1H),8.49(d,J=1.9Hz,1H),8.21(dt,J=8.0,1.4Hz,1H),8.10-8.02(m,2H),8.00(s,1 H),7.88(dt,J=7.7,1.4Hz,1H),7.67(t,J=7.8Hz,1H),7.43(d,J=16.0Hz,1H),7.01(s,1H),3.29(s,3H).MS(ESI):m / z Calcd.For C 20 H 13 F2N3O2365.0976; found 364.0903,[MH] - .

[0068] Example 3:

[0069] Compound IV-3:

[0070]

[0071] According to the synthetic procedure of compound IV-1, (0.221 g, 31%). 1 H NMR(400MHz,DMSO-d6)δ10.94(s,1H),10.11(s,1H),8.07–8.01(m,2H),7.95(d,J=15.7Hz,1H),7.74 (d,J=8.7Hz,2H),7.01(d,J=15.7Hz,1H),6.90(s,1H),6.87–6.83(m,2H),3.26(s,3H).MS(ESI):m / z Calcd.ForC 19 H 14 F2N2O3 356.0972; found 355.0901,[MH] - .

[0072] Example 4:

[0073] Compound IV-4:

[0074]

[0075] According to the synthetic procedure of compound IV-1, (0.207 g, 29%). 1 H NMR (400MHz, DMSO-d6) δ9.70 (s, 1H), 8.05 (d, J = 8.9Hz, 2H), 7.98-7.89 (m, 1H), 7.30 (t, J = 6.2Hz, 1H), 7.2 6(d,J=8.9Hz,1H),7.15(d,J=15.8Hz,1H),6.97(s,1H),6.87(d,J=7.5Hz,1H),3.27(s,3H).MS(ESI):m / z Calcd.For C 19 H 14 F2N2O3 356.0972; found 355.0900,[MH] - .

[0076] Example 5:

[0077] Compound IV-5:

[0078]

[0079] According to the synthetic procedure of compound IV-1, (0.186 g, 26%). 1H NMR (400MHz, DMSO-d6) δ8.16(d,J=8.5Hz,2H),7.99-7.86(m,3H),7.31(t,J=8.9Hz,2H),7.18(d,J=15.9Hz,1H),6. 95(s,1H),6.83-6.72(m,2H),3.59(t,J=5.9Hz,2H),3.51(t,J=5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m / z Calcd.For C 19 H 13 F3N2O2 358.0929; found 357.0856,[MH] - .

[0080] Example 6:

[0081] Compound IV-6:

[0082]

[0083] According to the synthetic procedure of compound IV-1, (0.222 g, 31%). 1 H NMR (400MHz, DMSO-d6) δ11.02(s,1H),8.09-8.03(m,2H),8.01(d,J=15.8Hz,1H),7.85(dt,J=10.6,2.1Hz,1H),7.72(d,J=7.8H z,1H),7.51(td,J=8.0,6.1Hz,1H),7.34(d,J=15.9Hz,1H),7.28(td,J=8.7,2.7Hz,1H),7.00(s,1H),3.28(s,3H).MS(ESI):m / z Calcd.For C 19 H 13 F3N2O2 358.0929; found357.0857,[MH] - .

[0084] Example 7:

[0085] Compound 2:

[0086]

[0087] Compound IV-5 (0.716 g, 2.0 mmol), tert-butyldimethylsilyl chloride (0.450 g, 3.0 mmol), and imidazole (0.204 g, 3.0 mmol) were placed in a 100 ml round-bottom flask, and 50 ml of dry dimethylformamide was added to dissolve the mixture. The mixture was stirred at room temperature under Ar protection and detected by TLC. After the reaction was completed, the system was poured into 150 ml of water and extracted three times with dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was removed under reduced pressure. The participating substances were separated by column chromatography to obtain compound 2 (0.927 g, 98%). 1 H NMR (400MHz, DMSO-d6) δ8.16(d,J=8.5Hz,2H),7.99-7.86(m,3H),7.31(t,J=8.9Hz,2H),7.18(d,J=15.9Hz,1H),6.95(s,1H),6 .83-6.72(m,2H),3.59(t,J=5.9Hz,2H),3.51(t,J=5.9Hz,2H),3.27(s,3H),3.05(s,3H),1.50(s,9H),0.2(s,6H).MS(ESI):m / z Calcd.ForC 25 H 28 F3N2O2Si 473.2; found 473.2,[M+H] + .

[0088] Compound IV-7:

[0089]

[0090] Compound 2 (0.473 g, 1 mmol) and Lawesson's reagent (0.808 g, 2 mmol) were placed in a 250 ml three-necked flask, 100 ml of toluene was added to dissolve, 2 drops of aniline were added, and the mixture was heated to reflux in an oil bath under Ar protection. The reaction was detected by TLC. After the reaction was completed, the solvent was removed under reduced pressure. The residue was dissolved in 50 ml of dichloromethane, and tetrabutylammonium fluoride (0.313 g, 1.2 mmol) was added. The mixture was stirred at room temperature under Ar protection. The reaction was detected by TLC. After the reaction was completed, the solvent was removed under reduced pressure. The residue was separated by column chromatography to obtain compound IV-7 (0.209 g, 56%). 1H NMR (400MHz, DMSO-d6) δ8.17(d,J=8.5Hz,2H),7.98-7.86(m,3H),7.31(t,J=8.9Hz,2H),7.18(d,J=15.9Hz,1H),6. 95(s,1H),6.83-6.72(m,2H),3.59(t,J=5.9Hz,2H),3.51(t,J=5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m / z Calcd.For C 19 H 13 F3N2NaOS397.0598; found 397.0597,[M+Na] + .

[0091] Example 8:

[0092] Compound 3:

[0093]

[0094] According to the synthetic procedure of compound 2, (0.932 g, 99%). 1 H NMR(400MHz, DMSO-d6)δ8.10(d,J=8.5Hz,2H),8.06(dd,J=7.8,2.1Hz,2H),8.03(s,1H),7.94(d,J=8 .3Hz,2H),7.44(d,J=15.9Hz,1H),7.03(s,1H),3.29(s,3H),1.51(s,9H),0.29(s,9H).MS(ESI):m / z Calcd.ForC 26 H 28 F2N3O2Si 480.2; found 480.2,[M+H] + .

[0095] Compound IV-8:

[0096]

[0097] According to the synthetic procedure of compound IV-7, (0.332 g, 49%). 1H NMR (400MHz, DMSO-d6) δ11.00(s,1H),8.11(d,J=8.5Hz,2H),8.07(dd,J=7.8,2.1Hz,2H),8.04 (s,1H),7.94(d,J=8.3Hz,2H),7.44(d,J=15.9Hz,1H),7.03(s,1H),3.29(s,3H).HMS(ESI):m / z Calcd.ForC 20 H 13 F2N3NaOS 404.0645; found 404.0646,[M+Na] + .

[0098] Example 9:

[0099] Compound 5:

[0100]

[0101] 3-Fluoro-4-hydroxy-benzaldehyde (0.560 g, 4.0 mmol) was dissolved in 40 ml of anhydrous ethanol in a 100 ml round-bottom flask. 10 g of anhydrous sodium sulfate and 5 ml of a 33% aqueous methylamine solution were added. The mixture was stirred at room temperature for 24 h under Ar protection, filtered, and the organic solvent was removed under pressure. The residue was dissolved in 10 ml of anhydrous ethanol, and compound 4 (0.790 g, 5.0 mmol) was added. The mixture was stirred at room temperature overnight under Ar protection, filtered the next day, and rinsed three times with cold ethanol to obtain compound 5 (0.796 g, 85%). 1 H NMR (400MHz, DMSO-d6) δ10.52(s,1H),8.19(m,1H),7.76(m,1H),6.99(t,J=8.8Hz,1H),6.89(s,1H),3.09(s,3H),2.34(s,3H).MS(ESI):m / z Calcd.For C 12 H 10 FN2O2 234.2; found 234.2,[MH] - .

[0102] Compound IV-9:

[0103]

[0104] According to the synthetic procedure of compound IV-1, (0.239 g, 21%). 1H NMR (400MHz, DMSO-d6) δ10.52(s,1H),8.11(d,J=8.5Hz,2H),8.07(d,J=7.8Hz,2H),7.84(d,J=8.0Hz,1H),7.6 7(d,J=8.4Hz,1H),7.32(m,1H),6.99(t,J=8.8Hz,1H),6.89(s,1H),6.78(m,1H),2.34(s,3H).HR-MS(ESI):m / z Calcd.For C 20 H 13 FN3O2 346.0997; found 346.0998,[MH] - .

[0105] Example 10:

[0106] Compound 6:

[0107]

[0108] According to the synthetic procedure of compound 5, (0.812 g, 91%). 1 H NMR (400MHz, CD3OD) δ7.28 (s, 1H), 7.19 (d, J = 8.0Hz, 2H), 3.59 (t, J = 5.6Hz, 3H), 3.12 (s, 3H), 1.23 (q, J = 5.6Hz, 3H). MS (ESI): m / z Calcd.For C 13 H 11 ClFN2O2 281.0; found 281.0,[MH] - .

[0109] Compound IV-10:

[0110]

[0111] According to the synthetic procedure of compound IV-1, (0.239 g, 21%). 1 H NMR (400MHz, CD3OD) δ7.84 (s, 2H), 7.28 (s, 1H), 7.19 (d, J = 8.0Hz, 2H), 3.12 (s, 3H), 1.23 (q, J = 5.6Hz, 3H). HR-MS (ESI): m / z Calcd.For C 21 H 14 ClFN3O2 395.0837; found394.0764,[MH] - .

[0112] Example 11:

[0113] Compound 7:

[0114]

[0115] According to the synthetic procedure of compound 5, (0.812 g, 91%). 1 H NMR (400MHz, CD3OD) δ7.28(s,1H),7.19(d,J=8.0Hz,2H),3.81(s,3H),3.12(s,3H),3.12(s,3H),1.58(m,1H),1.11(d,6H).MS(ESI):m / z Calcd.For C 15 H 15 BrFN2O2 353.0; found 3.0,[MH] - .

[0116] Compound IV-11:

[0117]

[0118] According to the synthetic procedure of compound IV-1, (0.209 g, 22%). 1 H NMR (400MHz, CD3OD) δ8.15(d,J=8.8Hz,2H),7.95(d,J=15.7Hz,1H),7.74(d,J=8.7Hz,2H),7.28(s,1H),7.19(d, J=8.0Hz,2H),7.01(d,J=15.7Hz,1H),6.87–6.83(m,2H),3.12(s,3H),1.58(m,1H),1.11(d,6H).HR-MS(ESI):m / z Calcd.For C 23 H 19 BrFN3O2 467.0645; found 466.0572,[MH] - .

[0119] Example 12:

[0120] Compound 8:

[0121]

[0122] According to the synthetic procedure of compound 5, (0.812 g, 91%). 1H NMR (400MHz, CD3OD) δ10.52(s,1H),7.76(d,J=8.5Hz,2H),6.95(s,1H),3.79(t,J=5.2Hz, 2H),3.35(s,3H),2.39(t,J=4.8Hz,2H),1.40(m,2H),1.20(t,J=4.8Hz,3H).MS(ESI):m / z Calcd.For C 14 H 214 FIN2O2388.0;found 388.0,[MH] - .

[0123] Compound IV-12:

[0124]

[0125] According to the synthetic procedure of compound IV-1, (0.156 g, 18%). 1 H NMR (400MHz, CD3OD) δ10.52(s,1H),7.98-7.86(m,3H),7.76(d,J=8.5Hz,2H),7.31(t,J=8.9Hz,2H),7.18(d,J=15.9Hz,1H), 6.95(s,1H),3.79(t,J=5.2Hz,2H),3.35(s,3H),2.39(t,J=4.8Hz,2H),1.40(m,2H),1.20(t,J=4.8Hz,3H).HR-MS(ESI):m / z Calcd.For C 21 H 17 ClFIN2O2 510.0007; found408.9936,[MH] - .

[0126] Example 13:

[0127] Compound 9:

[0128]

[0129] According to the synthetic procedure of compound 5, (0.732 g, 93%). 1 H NMR (400MHz, CD3OD) δ10.52 (s, 1H), 7.76 (d, J = 8.5Hz, 2H), 6.95 (s, 1H), 3.10 (s, 3H), 2.39 (s, 3H). MS (ESI): m / z Calcd.ForC 12 H 10Cl2N2O3 284.0; found 283.0,[MH] - .

[0130] Compound IV-13:

[0131]

[0132] According to the synthetic procedure of compound IV-1, (0.156 g, 18%). 1 H NMR (400MHz, CD3OD) δ10.52(s,1H),8.07–8.01(m,2H),7.95(d,J=15.7Hz,1H),7.76(d,J=8.5Hz,2H),7.0 1(d,J=15.7Hz,1H),6.95(s,1H),6.87–6.83(m,2H),3.10(s,3H),2.39(s,3H).HR-MS(ESI):m / zCalcd.For C 19 H 13 BrCl2N2O2 449.9537; found 448.9455,[MH] - .

[0133] Example 14:

[0134] Compound 10:

[0135]

[0136] According to the synthetic procedure of compound 5, (0.732 g, 93%). 1 H NMR (400MHz, DMSO-d6) δ10.52(s,1H),8.19(m,1H),7.76(m,1H),6.99(t,J=8.8Hz,1H) ,6.89(s,1H),3.01(q,J=4.8Hz,2H),2.34(s,3H),1.21(t,J=4.8Hz,3H).MS(ESI):m / z Calcd.For C 13 H 13 ClN2O2 264.1; found263.1,[MH] - .

[0137] Compound IV-13:

[0138]

[0139] According to the synthetic procedure of compound IV-1, (0.156 g, 18%). 1H NMR (400MHz, DMSO-d6) δ10.52(s,1H),8.19(m,1H),8.07–8.01(m,2H),7.95(d,J=15.7Hz,1H),7.76(m,1H),7.01(d,J=15.7Hz,1H) ,6.99(t,J=8.8Hz,1H),6.89(s,1H),6.87–6.83(m,2H),3.01(q,J=4.8Hz,2H),2.34(s,3H),1.21(t,J=4.8Hz,3H).HR-MS(ESI):m / z Calcd.For C 21 H 13 CLIN2O2486.9716; found 486.9715,[MH] - .

[0140] Example 15:

[0141] Compound 11:

[0142]

[0143] According to the synthetic procedure of compound 5, (0.732 g, 93%). 1 H NMR (400MHz, CD3OD) δ10.52(s,1H),8.19(m,1H),7.76(m,1H),6.99(t,J=8.8Hz,1H),6.89(s,1H),3.05(s,3H),2.34(s,3H).MS(ESI):m / z Calcd.For C 12 H 11 BrN2O2 294.0; found 293.0,[MH] - .

[0144] Compound IV-15:

[0145]

[0146] According to the synthetic procedure of compound IV-1, (0.156 g, 18%). 1H NMR (400MHz, CD3OD) δ10.52(s,1H),8.19(m,1H),7.95(d,J=15.7Hz,1H),7.76(m,1H),7.49(m,1H),7.40-7.22 (m,3H),7.01(d,J=15.7Hz,1H),6.99(t,J=8.8Hz,1H),6.89(s,1H),3.05(s,2H),2.34(s,3H).HR-MS(ESI):m / z Calcd.For C 19 H 14 BrClN2O2 415.9927; found 414.9854,[MH] - .

[0147] Example 16:

[0148] Compound 9:

[0149]

[0150] According to the synthetic procedure of compound 5, (0.732 g, 93%). 1 H NMR(400MHz,CD3OD)δ10.52(s,1H),7.76(d,J=8.5Hz,2H),6.95(s,1H),2.39(s,3H).MS(ESI):m / z Calcd.For C 11 H8Cl2N2O2270.0; found 271.0,[M+H] - .

[0151] Compound IV-16:

[0152]

[0153] According to the synthetic procedure of compound IV-1, (0.156 g, 18%). 1 H NMR (400MHz, CD3OD) δ10.52(s,1H),8.07–8.01(m,2H),7.95(d,J=15.7Hz,1H),7.76(d,J=8.5 Hz,2H),7.01(d,J=15.7Hz,1H),6.95(s,1H),6.87–6.83(m,2H),2.39(s,3H).HR-MS(ESI):m / z Calcd.ForC 18 H 11 BrCl2N2O2 435.9381; found 436.9459,[M+H] - .

[0154] Example 17:

[0155] Compound IV-17:

[0156]

[0157] According to the synthetic procedure of compound IV-1, (0.286 g, 28%). 1 H-NMR (400MHz, DMSO-d6): δ8.15(d,J=8.6Hz,2H),7.82(d,J=15.8Hz,1H),7.31–7.22(m,2H),7.21–7.17(m,1H),7.10(d,J=15.8 Hz,1H),6.94(s,1H),6.88–6.73(m,3H),3.59(t,J=5.8Hz,2H),3.51(t,J=6.0Hz,2H),3.26(s,3H),3.05(s,3H).HR-MS(ESI):m / z Calcd.For C 22 H 24 N3O3 378.1818; found378.1819,[M+H] + .

[0158] Example 18:

[0159] Compound IV-18:

[0160]

[0161] According to the synthetic procedure of compound IV-1, (0.486 g, 60%). 1 H-NMR (400MHz, DMSO-d6): δ8.43(d,J=1.8Hz,1H),8.16(t,J=8.5Hz,3H),7. 93(d,J=15.9Hz,1H),7.85(dt,J=7.8,1.4Hz,1H),7.66(t,J=7.8Hz,1H),7.4 0(d,J=15.9Hz,1H),6.98(s,1H),6.86-6.71(m,2H),3.60(t,J=5.9Hz,2H), 3.52(t,J=5.9Hz,2H),3.28(s,3H),3.06(s,3H).HR-MS(ESI):m / zCalcd.For C 23 H 23 N4O2 387.1821; found 387.1822,[M+H] + .

[0162] Example 19:

[0163] Compound IV-19:

[0164]

[0165] According to the synthetic procedure of compound IV-1, (0.286 g, 38%). 1 H-NMR (400MHz, DMSO-d6): δ8.17(d,J=8.6Hz,2H),7.91(d,J=15.8Hz,1H),7.79(dt,J=10.6,2.1Hz,1H),7.66(d,J=7.8Hz,1H),7.50(td,J=8.0,6.2Hz, 1H),7.34-7.20(m,2H),6.97(s,1H),6.84-6.73(m,2H),3.59(t,J=5.9Hz,2 H),3.52(t,J=5.9Hz,2H),3.27(s,3H),3.06(s,3H).MS(ESI):m / zCalcd.For C 22 H 23 N3O3F 380.1774; found 380.1775,[M+H] + .

[0166] Example 20:

[0167] Compound IV-20:

[0168]

[0169] According to the synthetic procedure of compound Ⅳ-1, (0.222g, 30%). 1 H NMR(400MHz, DMSO-d6):8.14(d,J=8.5Hz,2H),7.84(d,J=15.7Hz,1H),7.68(d,J=8.4Hz,2H),6.97(d,J=15.8Hz,1H),6.88(s,1H), 6.84(d,J=8.5Hz,2H),6.79(d,J=8.8Hz,2H),3.59(q,J=5.4Hz,2H),3.51(t,J=5.9Hz,2H),3.24(s,3H),3.05(s,3H).MS(ESI):m / z Calcd.For C 22 H 24 N3O3378.1818; found 378.1819,[M+H] + .

[0170] Example 21:

[0171] Compound IV-21:

[0172]

[0173] According to the synthetic procedure of compound Ⅳ-1, (0.352g, 56%). 1 H-NMR (400MHz, DMSO-d6): δ8.18(d,J=8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J=15.9Hz,1H),7. 00(s,1H),6.86-6.72(m,2H),3.60(t,J=5.9Hz,2H),3.52(t,J=5.6Hz,2H),3.28(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 23 H 23 N4O2 387.1821; found 387.1820,[M+H] + .

[0174] Example 22:

[0175] Compound IV-22:

[0176]

[0177] According to the synthetic procedure of compound IV-1, (0.252 g, 32%). 1 H-NMR (400MHz, DMSO-d6): δ8.16(d,J=8.5Hz,2H),7.93(t,J=4.4Hz,2H),7.90(d,J=6.1Hz,1H),7.31(t,J=8.9Hz,2H),7.18(d,J= 15.9Hz,1H),6.95(s,1H),6.83-6.72(m,2H),3.59(t,J=5.9Hz,2H),3.51(t,J=5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m / z Calcd.For C 22 H 23 FN3O2 380.1774; found 380.1775,[M+H] + .

[0178] Example 23:

[0179] Compound 13:

[0180]

[0181] According to the synthetic procedure of compound IV-1, (0.252 g, 32%). 1 H-NMR (400MHz, DMSO-d6): δ8.43(d,J=1.8Hz,1H),8.16(t,J=8.5Hz,3H),7.93(d,J=15.9Hz,1H),7.85(dt,J=7.8,1.4Hz,1H),7.66(t,J=7.8Hz,1H),7 .40(d,J=15.9Hz,1H),6.98(s,1H),6.86-6.71(m,2H),3.60(t,J=5.9Hz,2H ),3.52(t,J=5.9Hz,2H),3.28(s,3H),3.06(s,3H).MS(ESI):m / zCalcd.For C 23 H 23 N4O2 387.2; found 387.2,[M+H] + .

[0182] Compound 14:

[0183]

[0184] Compound 13 (0.774 g, 2.0 mmol) and potassium carbonate (0.276 g, 2.0 mmol) were placed in a 250 ml round-bottom flask, and 100 ml of acetonitrile was added to dissolve the mixture. 2 ml of allyl bromide was added under Ar protection, and the mixture was heated to reflux in an oil bath. The reaction was detected by TLC. After completion of the reaction, the mixture was filtered, and the solvent was removed under reduced pressure. The residue was separated by column chromatography to obtain compound 18 (0.673 g, 79%). 1 H-NMR (400MHz, DMSO-d6): δ8.43(d,J=1.8Hz,1H),8.16(t,J=8.5Hz,3H),7.93(d,J=15.9Hz,1H),7.85(dt,J=7.8,1.4Hz,1H),7.66(t,J=7.8Hz,1H),7. 40(d,J=15.9Hz,1H),6.98(s,1H),6.86-6.71(m,2H),3.81(s,2H),3.60(t, J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.41(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 26 H 27 N4O2 427.2; found 427.2,[M+H] + .

[0185] Compound IV-14:

[0186]

[0187] According to the synthetic procedure of compound IV-7, (0.152 g, 72%). 1 H-NMR (400MHz, DMSO-d6): δ8.43(d,J=1.8Hz,1H),8.16(t,J=8.5Hz,3H),7.93(d,J=15.9Hz,1H),7.85(dt,J=7.8,1.4Hz,1H),7.66(t,J=7.8Hz,1H),7. 40(d,J=15.9Hz,1H),6.98(s,1H),6.86-6.71(m,2H),3.81(s,2H),3.60(t, J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.41(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 26 H 27 N4OS 443.1906; found 443.1905,[M+H] + .

[0188] Example 24:

[0189] Compound 15:

[0190]

[0191] According to the synthetic procedure of compound 5, (0.692 g, 82%). 1 H NMR (400MHz, CD3OD) δ = 8.02 (d, J = 2.4Hz, 1H), 7.44 (dd, J = 8.7Hz, J = 2.4Hz, 1H), 7.09 (s, 1H), 6.51 (d, J = 8.7Hz, 1H), 3.56 (t, J HH=7.6Hz,2H),3.08(s,6H),1.66(m,2H),2.38(s,3H),0.95(t,J=7.6Hz,3H).MS(ESI):m / z Calcd.For C 15 H 21 N4O 273.2; found 273.2, [M+H] + .

[0192] Compound 16:

[0193]

[0194] According to the synthetic procedure of compound IV-1, (0.452 g, 34%). 1H NMR (400MHz, CD3OD) δ=8.02(d,J=2.4Hz,1H),7.95(m,2H),7.68-7.50(m,1H),7.44(dd,J=8.7Hz,J= 2.4Hz,1H),7.34-7.06(m,2H),7.09(s,1H),7.00(d,J=15.7Hz,1H),6.51(d,J=8.7Hz,1H),3.56(t,J HH=7.6Hz,2H),3.08(s,6H),1.66(m,2H),2.38(s,3H),0.95(t,J=7.6Hz,3H).MS(ESI):m / zCalcd.For C 22 H 24 FN4O 379.2; found 379.2,[M+H] + .

[0195] Compound IV-24:

[0196]

[0197] According to the synthetic procedure of compound IV-7, (0.152 g, 72%). 1 H NMR (400MHz, CD3OD) δ=8.02(d,J=2.4Hz,1H),7.95(m,2H),7.68-7.50(m,1H),7.44(dd,J=8.7Hz,J= 2.4Hz,1H),7.34-7.06(m,2H),7.09(s,1H),7.00(d,J=15.7Hz,1H),6.51(d,J=8.7Hz,1H),3.56(t,J HH=7.6Hz,2H),3.08(s,6H),1.66(m,2H),2.38(s,3H),0.95(t,J=7.6Hz,3H).HR-MS(ESI):m / zCalcd.For C 22 H 24 FN4S 395.1706; found 395.1705,[M+H] + .

[0198] Example 25:

[0199] Compound 17:

[0200]

[0201] According to the synthetic procedure of compound 5, (0.892 g, 80%). 1H NMR (400MHz, CD3OD) δ8.41(d,J=1.5Hz,1H),7.97(d,J=1.5Hz,1H),7.31(s,1H),5.86(s,1H),3.46 (t,J=6.6Hz,4H),3.15(s,3H),2.32(s,3H),1.61(m,4H),1.32(m,12H),0.89(t,6H).MS(ESI):m / z Calcd.ForC 22 H 36 N5O 386.3; found 386.3, [M+H] + .

[0202] Compound IV-25:

[0203]

[0204] According to the synthetic procedure of compound IV-1, (0.452 g, 34%). 1 H NMR (400MHz, CD3OD) δ8.41(d,J=1.5Hz,1H),7.97(d,J=1.5Hz,1H),7.85(d,J=15.7Hz,1H),7.49(m,1H),7.40-7.22(m,3H),7.31(s,1H),7 .01(d,J=15.7Hz,1H),5.86(s,1H),3.46(t,J=6.6Hz,4H),3.15(s,3H),2.32(s,3H),1.61(m,4H),1.32(m,12H),0.89(t,6H).MS(ESI):m / z Calcd.ForC 29 H 39 ClN5O 508.2843; found 508.2842,[M+H] + .

[0205] Example 26:

[0206] Compound 18:

[0207]

[0208] According to the synthetic procedure of compound 5, (0.812 g, 81%). 1 H NMR(400MHz, CDCl3)δ7.93(s,2H),7.31(s,1H),4.24(t,J=6.8Hz,2H),3.44(s,3H),2.82(s,2H),2.43(s,3H).MS(ESI):m / zCalcd.For C 14 H17 N6O 285.1; found 285.1, [M+H] + .

[0209] Compound IV-25:

[0210]

[0211] According to the synthetic procedure of compound IV-1, (0.312 g, 26%). 1 H NMR (400MHz, CDCl3) δ = 8.02 (d, J = 15.7Hz, 1H), 7.93 (m, 3H), 7.68-7.50 (m, 1H), 7.31 (s, 1H), 7.24-7.06 (m, 2H) ,7.01(d,J=15.7Hz,1H),4.24(t,J=6.8Hz,2H),3.44(s,3H),2.82(s,2H),2.43(s,3H).MS(ESI):m / zCalcd.For C 21 H 20 lN6O 499.0743; found 499.0742,[M+H] + .

[0212] Example 27:

[0213] Compound 19:

[0214]

[0215] According to the synthetic procedure of compound 5, (0.932 g, 85%). 1 H NMR (400MHz, CDCl3) δ = 7.59 (s, 2H), 6.71 (s, 1H), 3.24 (t, J = 5.6Hz, 4H), 3.06 (t, J = 8.4Hz, 2H), 2.67 (t,J=6.2Hz,4H),2.29(s,3H),1.86–1.82(m,4H),1.46(m,2H),1.21(t,J=8.4Hz,3H).MS(ESI):m / z Calcd.ForC 20 H 25 N3O 323.2; found 324.2, [M+H] + .

[0216] Compound IV-27:

[0217]

[0218] According to the synthetic procedure of compound 5, (0.932 g, 85%).1 H NMR (400MHz, CDCl3) δ = 8.31 (dd, J = 8.3Hz, J = 2.1Hz, 1H), 8.16 (s, 1H), 7.94 (d, J = 8.3Hz, 1H), 7.95 (d, J = 15.7Hz, 1H) ,7.59(s,2H),7.01(d,J=15.7Hz,1H),6.71(s,1H),3.24(t,J=5.6Hz,4H),3.06(t,J=8.4Hz,2H),2.67(t,J=6.2Hz,4 H),2.29(s,3 H),1.86–1.82(m,4 H),1.46(m,2 H),1.21(s,J=8.4Hz,3H).MS(ESI):m / z Calcd.For C 28 H 28 N4O2 436.2263; found 437.2340,[M+H] + .

[0219] Example 28:

[0220] Compound 20:

[0221]

[0222] Compound IV-21 (0.792 g, 2.0 mmol), p-toluenesulfonyl chloride (0.476 g, 2.5 mmol) and triethylamine (0.303 g, 3.0 mmol) were placed in a 250 ml round-bottom flask, 100 ml of dry dichloromethane was added to dissolve the mixture, and the mixture was stirred at room temperature under Ar protection. The reaction was completed by TLC detection. The system was poured into 200 ml of water and extracted three times with dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was removed under reduced pressure. The residue was separated by column chromatography to obtain compound 27 (0.822 g, 76%). 1 H-NMR (400MHz, DMSO-d6): δ8.18(d,J=8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J=15.9Hz,1H),7.18(d,J=8.2Hz,2H),7.00(s, 1H),6.86-6.72(m,2H),6.47(d,J=8.2Hz,2H),4.06(t,J=6.1Hz,2H),3. 49(t,J=6.1Hz,2H),3.28(s,3H),2.77(s,3H),2.31(s,3H).MS(ESI):m / z Calcd.For C 30 H 29N4O4S 541.2; found 541.2,[M+H] + .

[0223] Compound IV-28:

[0224]

[0225] Compound 20 (0.541 g, 1.0 mmol) and sodium sulfite (0.630 g, 5.0 mmol) were placed in a 100 ml round-bottom flask, and 20 ml of anhydrous DMF was added. The mixture was heated in an oil bath at 50°C under Ar protection for 24 h. The reaction was completed after TLC. The solvent was removed under reduced pressure, and the residue was separated by reverse phase chromatography to obtain the product (0.301 g, 60%). 1 H-NMR (400MHz, DMSO-d6): δ8.18(d,J=8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J=15.9Hz,1H),7.00(s,1H),6. 86-6.72(m,2H),3.85(m,4H),3.60(t,J=5.9Hz,2H),3.52(t,J=5.6Hz,2H),3.28(s,3H),3.16(m,4H),2.77(s,3H).MS(ESI):m / z Calcd.For C 23 H 21 N4O4S 499.1289; found 499.1288,[MH] - .

[0226] Example 29:

[0227] Compound IV-29:

[0228]

[0229] Compound IV-21 (0.386 g, 1.0 mmol), compound 31 (0.265 g, 1.2 mmol), EDCI (0.382 g, 2.0 mmol), and DMAP (0.183 g, 1.5 mmol) were placed in a 100 ml round-bottom flask, and 30 ml of anhydrous DMF was added to dissolve the mixture. The mixture was stirred at room temperature under Ar protection and detected by TLC. After the reaction was completed, the solvent was removed under reduced pressure and the residue was separated by column chromatography to obtain the product (0.490 g, 83%). 1H-NMR (400MHz, DMSO-d6): δ8.18(d,J=8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J=15.9Hz,1H),7.00(s,1H),6.86-6.72(m ,2H),4.17(s,2H),3.75(s,3H),3.6-3.7(m,10H),3.57(m,2H),3.52(t,J=5.6Hz,2H),3.38(s,3H),3.28(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 32 H 39 N4O7S 591.2819; found 591.2820,[M+H] + .

[0230] Example 30:

[0231] Compound 22:

[0232]

[0233] According to the synthetic procedure of compound 5, (0.612 g, 87%). 1 H NMR (400MHz, CDCl3) δ8.15(d,J=9.0Hz,2H),8.14(d,J=9.0Hz,2H),7.21(s,1H),4.23(s,2H),4. 11(s,3H),3.38(t,J=6.4Hz,2H),3.01(s,3H),2.92(t,J=6.4Hz,2H),2.41(s,3H).MS(ESI):m / z Calcd.ForC 18 H 25 N4O3 345.2; found 345.2,[M+H] + .

[0234] Compound IV-30:

[0235]

[0236] According to the synthetic procedure of compound IV-1, (0.422 g, 36%). 1H NMR (400MHz, CDCl3) δ8.15(d,J=9.0Hz,2H),8.14(d,J=9.0Hz,2H),7.95(d,J=16.0Hz,1H),7.82(d,J=8.4Hz,2H),7.32(d,J=8.4Hz,2H) ,7.21(s,1H),7.01(d,J=16.0Hz,1H),4.23(s,2H),4.11(s,3H),3.38(t,J=6.4Hz,2H),3.01(s,3H),2.92(t,J=6.4Hz,2H).MS(ESI):m / z Calcd.For C 25 H 28 BrN4O3511.1345; found 511.1344,[M+H] + .

[0237] Example 31:

[0238] Compound 23:

[0239]

[0240] According to the synthetic procedure of compound 23, (0.912 g, 89%). 1 H-NMR (400MHz, DMSO-d6): δ8.17(d,J=8.6Hz,2H),7.91(d,J=15.8Hz,1H),7.79(dt,J=10.6 ,2.1Hz,1H),7.66(d,J=7.8Hz,1H),7.50(td,J=8.0,6.2Hz,1H),7.34-7.20(m,2H),7.18(d ,J=8.2Hz,2H),6.97(s,1H),6.84-6.73(m,2H),6.47(d,J=8.2Hz,2H),4.06(t,J=6.1Hz,2H ),3.49(t,J=6.1Hz,2H),3.27(s,3H),3.06(s,3H),2.77(s,3H),2.31(s,3H).MS(ESI):m / z Calcd.For C 29 H 29 FN3O4S534.2; found 534.2,[M+H] + .

[0241] Compound IV-31:

[0242]

[0243] Compound 23 (0.534 g, 1.0 mmol) was dissolved in 35 ml of DMF in a 100 ml round-bottom flask. NaN3 (0.195 g, 3.0 mmol) was carefully added and heated in an oil bath at 50°C overnight under Ar protection. The next day, the system was cooled to room temperature and poured into 100 ml of water. The mixture was extracted three times with DCM, and the organic phases were combined and washed twice with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was removed under reduced pressure. The residue was used directly in the next reaction without purification.

[0244] The residue was dissolved in 30 ml of THF, and Ph3P (0.524 g, 2.0 mmol) and 2 ml of water were added. The mixture was stirred at room temperature overnight under Ar protection. The solvent was removed under pressure the next day, and the residue was separated by column chromatography to obtain the desired product (0.301 g, 79%). 1 H-NMR (400MHz, DMSO-d6): δ8.17(d,J=8.6Hz,2H),7.91(d,J=15.8Hz,1H),7.79(dt,J=10.6,2.1Hz,1H),7.66(d,J=7.8Hz,1H),7.50(td,J=8.0,6. 2Hz,1H),7.34-7.20(m,2H),6.97(s,1H),6.84-6.73(m,2H),3.38(t,J=6 .4Hz,2H),2.92(t,J=6.4Hz,2H),3.27(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 22 H 24 FN4O 379.1934; found 379.1935,[M+H] + .

[0245] Example 32:

[0246] Compound IV-32:

[0247]

[0248] Compound 24 (0.534 g, 1.0 mmol) was dissolved in 50 ml of ethanol in a 100 ml round-bottom flask. 33% dimethylamine solution was added and the mixture was heated to reflux in an oil bath at 90°C under Ar protection. TLC was used for detection. After the reaction was complete, the system was returned to room temperature and the solvent was removed under reduced pressure. The residue was separated by column chromatography to obtain the desired product (0.276 g, 68%). 1H-NMR (400MHz, DMSO-d6): δ8.17(d,J=8.6Hz,2H),7.91(d,J=15.8Hz,1H),7.79(dt,J=10.6,2.1Hz,1H),7.66(d,J=7.8Hz,1H),7.50(td,J=8.0,6.2Hz, 1H),7.34-7.20(m,2H),6.97(s,1H),6.84-6.73(m,2H),3.47(t,J=7.6Hz,2 H),2.96(s,3H),2.49(t,J=7.6Hz,2H),2.31(s,6H).MS(ESI):m / zCalcd.For C 24 H 28 FN4O 407.2247;found 407.2246,[M+H] + .

[0249] Example 33:

[0250] Compound 25:

[0251]

[0252] According to the synthetic procedure of compound 5, (0.842 g, 89%). 1 H NMR (400MHz, CDCl3) δ = 7.97 (d, J = 8.6Hz, 1 H), 7.88 (s, 1 H), 6.85 (s, 1 H), 6.56 (d, J = 8.6Hz, 1 H), 5.40 (s, 1 H),3.07(s,3H),2.84(s,3H),2.31(s,3H),1.94(s,3H),1.32(s,6H).MS(ESI):m / z Calcd.For C 19 H 24 N3O310.2; found 310.2, [M+H] + .

[0253] Compound IV-33:

[0254]

[0255] According to the synthetic procedure of compound IV-1, (0.222 g, 21%). 1H NMR (400MHz, CDCl3) δ=7.97(d,J=8.6Hz,1H),7.90(d,J=16.0Hz,1H),7.88(s,1H),7.87(d,J=4.0Hz,2H),7.43(d,J=4.0Hz,2H),7.01 (d,J=16.0Hz,1H),6.85(s,1H),6.56(d,J=8.6Hz,1H),5.40(s,1H),3.07(s,3H),2.84(s,3H),1.94(s,3H),1.32(s,6H).MS(ESI):m / z Calcd.For C 27 H 26 N4O422.2107; found 423.2186,[M+H] + .

[0256] Example 34:

[0257] Compound 26:

[0258]

[0259] According to the synthetic procedure of compound 5, (0.732 g, 81%). 1 H NMR (400MHz, CDCl3) δ = 7.40 (dd, J = 8.32, 1.93Hz, 1H), 7.29 (d, J = 1.89Hz, 1H), 7.15 (s, 1H), 6.68 (d, J = 8.35H z,1H),4.23-4.31(m,2H),3.40-3.49(m,2H),3.21(s,3H),3.03(s,3H),2.42(s,3H).MS(ESI):m / zCalcd.For C 15 H 18 N3O2 227.1; found 227.1,[M+H] + .

[0260] Compound IV-34:

[0261]

[0262] According to the synthetic procedure of compound IV-1, (0.222 g, 21%). 1H NMR (400MHz, CDCl3) δ = 7.95 (d, J = 16.0Hz, 1H), 7.87 (d, J = 4.0Hz, 2H), 7.43 (d, J = 4.0Hz, 2H), 7.40 (dd, J = 8.32, 1.93Hz, 1H), 7.29 (d, J = 1.89Hz, 1H), 7 .15(s,1H),7.01(d,J=16.0Hz,1H),6.68(d,J=8.35Hz,1H),4.23-4.31(m, 2H),3.40-3.49(m,2H),3.03(s,3H),2.42(s,3H).MS(ESI):m / zCalcd.For C 22 H 20 FN3O2 377.1540; found 378.1681,[M+H] + .

[0263] Example 35:

[0264] Compound 28:

[0265]

[0266] According to the synthetic procedure of compound IV-1, (0.732 g, 39%). 1 H NMR (400MHz, CDCl3) δ8.19 (d, J = 8.5Hz, 2H), 8.07 (m, 4H), 8.04 (s, 1H), 7.94 (d, J=8.3Hz,2H),7.44(d,J=15.9Hz,1H),7.03(s,1H),3.29(s,3H)..MS(ESI):m / z Calcd.For C 20 H 15 N4O3 359.1; found 359.1,[M+H] + .

[0267] Compound IV-35:

[0268]

[0269] Compound 28 (0.718 g, 2.0 mmol) and stannous chloride (0.758 g, 4.0 mmol) were placed in a 250 ml round-bottom flask and dissolved in 100 ml of ethyl acetate. The mixture was stirred at room temperature under Ar protection and monitored by TLC. After completion of the reaction, the system was poured into 150 ml of water and extracted three times with ethyl acetate. The organic phases were combined, dried over anhydrous sodium sulfate, and the excess was removed by removing the solvent under reduced pressure. The residue was separated and purified by column chromatography to obtain the target product (0.586 g, 89%). 1H NMR (400MHz, CDCl3) δ8.19 (d, J = 8.5Hz, 2H), 7.97 (m, 4H), 8.04 (s, 1H), 7.94 (d ,J=8.3Hz,2H),7.44(d,J=15.9Hz,1H),7.03(s,1H),3.29(s,3H).MS(ESI):m / z Calcd.For C 20 H 17 N4O 329.1402; found 329.1403,[M+H] + .

[0270] Example 36:

[0271] Compound 29:

[0272]

[0273] According to the synthetic procedure of compound 5, (0.756 g, 74%). 1 H NMR (400MHz, CDCl3) δ8.15 (1H, s), 7.81 (2H, m), 7.65 (1H, d, J = 9.0Hz), 7.16 (1H, dd, J = 9.0, J = 3.0Hz), 6.95 (s, 1 H),6.88(1H,d,J=3.0Hz),3.60(t,J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.28(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 19 H 21 N3O2 323.2; found 324.2,[M+H] + .

[0274] Compound IV-36:

[0275]

[0276] According to the synthetic procedure of compound IV-1, (0.272 g, 24%). 1H NMR (400MHz, CDCl3) δ8.15 (1H, s), 7.81 (2H, m), 7.65 (1H, d, J = 9.0Hz), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.16 (1H, dd, J = 9.0, J = 3 .0Hz),6.95(s,1H),6.88(1H,d,J=3.0Hz),3.60(t,J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.28(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 26 H 25 N3O3 427.1896; found428.1974,[M+H] + .

[0277] Example 37:

[0278] Compound IV-37:

[0279]

[0280] According to the synthetic procedure of compound 13, (0.322 g, 79%). 1 H-NMR (400MHz, DMSO-d6): δ8.16(d,J=8.5Hz,2H),7.93(t,J=4.4Hz,2H),7.90(d,J=6.1Hz,1H),7.31(t,J=8.9Hz,2H),7.18(d,J=15.9Hz ,1H),6.95(s,1H),6.83-6.72(m,2H),4.21(s,2H),3.59(t,J=5.9Hz,2H),3.51(t,J=5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m / z Calcd.For C 25 H 25 FN3O2418.1931; found 418.1932,[M+H] + .

[0281] Example 38:

[0282] Compound 30:

[0283]

[0284] According to the synthetic procedure of compound 5, (0.816 g, 89%). 1H NMR (400MHz, CDCl3) δ9.02 (d, 1H, J = 2.1Hz), 8.59 (d, 1H, J = 2.1Hz), 7.93 (d, 1H, J = 9.1Hz), 7.34 (d d,1H,J=9.1,2.5Hz),7.21(s,1H),7.00(d,1H,J=2.5Hz),3.11(s,6H),3.06(s,3H).MS(ESI):m / z Calcd.ForC17H 18 N4O 294.1; found 295.1, [M+H] + .

[0285] Compound IV-38

[0286]

[0287] According to the synthetic procedure of compound IV-1, (0.272 g, 24%). 1 H NMR (400MHz, CDCl3) δ = 9.02 (d, 1H, J = 2.1Hz), 8.59 (d, 1H, J = 2.1Hz), 7.95 (d, J = 16.0Hz, 1H), 7.93 (d, 1H, J = 9.1Hz), 7.49 (m, 1H), 7.40-7.2 2(m,3H),7.34(dd,1H,J=9.1,2.5Hz),7.21(s,1H),7.15(d,J=16.0Hz,1H),7.00(d,1H,J=2.5Hz),3.11(s,6H),3.06(s,3H).MS(ESI):m / z Calcd.ForC 25 H 21 N5O 407.1821; found 408.1825,[M+H] + .

[0288] Comparative Example 1:

[0289] Compound IV-39:

[0290]

[0291] According to the synthetic procedure of compound IV-1, (0.275 g, 75%). 1H NMR (400MHz, DMSO-d6) δ11.00 (s, 1H), 8.08-8.04 (m, 2H), 8.02 (d, J = 15.9Hz, 1H), 7.92-7.8 7(m,2H),7.49-7.45(m,2H),7.26(d,J=15.9Hz,1H),6.98(s,1H),3.29(s,3H).MS(ESI):m / z Calcd.For C 19 H 13 F2N3O2339.0951; found 339.0950,[MH] - .

[0292] Comparative Example 2:

[0293] Compound IV-40:

[0294]

[0295] According to the synthetic procedure of compound IV-1, (0.327 g, 55%). 1 H NMR (400MHz, DMSO-d6) δ9.70 (s, 1H), 8.05 (d, J = 8.9Hz, 2H), 7.98-7.89 (m, 1H), 7.30 (t, J = 6.2Hz, 1H), 7.2 6(d,J=8.9Hz,1H),7.15(d,J=15.8Hz,1H),6.97(s,1H),6.87(d,J=7.5Hz,1H),3.27(s,3H).MS(ESI):m / z Calcd.For C 18 H 12 F2N3O2 340.0903; found 340.090,[MH] - .

[0296] Comparative Example 3:

[0297] Compound IV-41:

[0298]

[0299] According to the synthetic procedure of compound IV-1, (0.342 g, 46%). 1H-NMR (400MHz, DMSO-d6): δ = 8.21 (d, 2H, J = 8.8Hz), 8.00 (d, 1H, J = 16Hz), 7.85 (d, 2H, J = 8.0Hz), 7.50-7.43 (m, 2H), 7.42 (d, J = 2.6 Hz,1H),7.24(s,1H),7.01(s,1H),6.92(d,2H,J=8.8Hz),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H).MS(ESI):m / z Calcd.For C 22 H 24 N3O2362.1869; found 362.1868,[M+H] + .

[0300] Comparative Example 4:

[0301] Compound IV-42:

[0302]

[0303] According to the synthetic procedure of compound IV-1, (0.312 g, 43%). 1 H NMR (400MHz, CDCl3) δ = 8.15 (1H, s), 8.00 (d, 1H, J = 16Hz), 7.85 (d, 2H, J = 8.0H z),7.81(2H,m),7.65(1H,d,J=9.0Hz),7.20(s,1H),7.50-7.43(m,3H),7.42 (d,1H,J=16Hz),7.16(1H,dd,J=9.0,J=3.0Hz),6.88(1H,d,J=3.0Hz),3.65( t,J=7.2Hz,2H),3.45(t,J=7.2Hz,2H),3.35(s,3H)3.03(s,3H).MS(ESI):m / z Calcd.For C 26 H 26 N3O2 412.2025; found 412.2026,[M+H] + .

[0304] Comparative Example 5:

[0305] Compound IV-43:

[0306]

[0307] According to the synthetic procedure of compound IV-1, (0.412 g, 46%). 1H-NMR (400MHz, DMSO-d6): δ = 8.72 (s, 2H), 8.00 (d, 1H, J = 16Hz), 7.50-7.43 (m, 2H), 7.42 (d, J = 2.6Hz, 1H), 7.24 (s ,1H),7.01(s,1H),6.92(d,2H,J=8.8Hz),3.75(t,J=6.8Hz,2H),3.60(t,2H,J=6.8Hz),3.05(s,3H).MS(ESI):m / z Calcd.For C 21 H 21 lN6O 373.1777; found 373.1778,[M+H] + .

[0308] Comparative Example 6:

[0309]

[0310] According to the synthetic procedure of compound IV-1, (0.192 g, 33%). 1 H NMR(400MHz,DMSO-d6)δ7.96-7.99(m,4H),7.33-7.37(m,3H),6.98(s,1H),3.24(s,3H).MS(ESI):m / z Calcd.ForC 19 H 12 F4N2O2 376.0835; found 376.0830,[MH] - .

[0311] Comparative Example 7:

[0312]

[0313] According to the synthetic procedure of compound IV-1, (0.192 g, 33%). 1 H NMR(400MHz,DMSO-d6)δ7.96-7.99(m,4H),7.33-7.37(m,3H),6.98(s,1H),3.24(s,3H).MS(ESI):m / z Calcd.ForC 19 H 12 F4N2O2 376.0835; found 376.0830,[MH] - .

[0314] Comparative Example 8:

[0315]

[0316] According to the synthesis steps of compound IV-1, 1 H NMR(400MHz,DMSO-d6)δppm 10.70(s,1H),8.35(s,2H),8.15(s,2H),7.82(d,J=15.8Hz,1H),7.22(d,J=15.9Hz,1H),6.95(s,1H),3.27(s,3H); HRMS(ESI)m / z:546.8647found(calcd for C 19 H 12 Br2Cl2N2O3,[M+H] + 546.8644).

[0317] Comparative Example 9:

[0318]

[0319] According to the synthesis steps of compound IV-1, 1 H NMR(400MHz,DMSO-d6)δppm 10.38(s,1H),8.18(d,J=2.0Hz,2H),8.12(s,2H),7.81(d,J=4.8Hz,1H),7.18(d,J=4.8Hz,1H),6. 93(s,1H),6.78(d,J=2.0Hz,2H),3.25(s,3H),3.04(s,6H); HRMS(ESI)m / z:505.9855found(calcd for C 21 H 19 Br2N3O2,[M+H] + 505.9896).

[0320] Comparative Example 10:

[0321]

[0322] According to the synthesis steps of compound IV-1, 1 H NMR(400MHz,DMSO-d6)δppm 10.38(s,1H),8.16(d,J=2.0Hz,2H),8.11(s,2H),7.80(d,J=4.8Hz,1H),7.18(d,J=4.8Hz,1H),6.91(s,1H),6.74 (d,J=2.0Hz,2H),3.44(d,J=4.8Hz,2H),3.25(s,3H),1.14(t,J=4.8Hz,6H); HRMS(ESI)m / z:534.0154found(calcd for C 23 H23 Br2N3O2,[M+H] + 534.0209).

[0323] Comparative Example 11:

[0324]

[0325] According to the synthetic procedure of compound IV-1, (0.156 g, 18%). 1 H NMR (400MHz, CD3OD) δ10.52(s,1H),8.07–8.01(m,2H),7.95(d,J=15.7Hz,1H),7.76(d,J=8.5Hz,2H),7.01 (d,J=15.7Hz,1H),6.95(s,1H),6.87–6.83(m,2H),4.12(s,3H),3.62(s,3H),1.50(s,9H).HR-MS(ESI):m / z Calcd.For C 24 H 21 F3N2O4 457.5381; found457.5380,[MH] - .

[0326] Comparative Example 12:

[0327]

[0328] The product was synthesized according to the method published in the literature (JACS, 2018, 140, 7381-7384). 1 H NMR (400MHz, CD3OD) δ8.17(d,J=8.3Hz,2H),7.79(d,J=15.6Hz,1H),7.55(d,J=8.8Hz,2H),6.84(s,1H),6.80(dd ,J=9.9,2.8Hz,2H),6.75(dd,J=8.8,5.6Hz,2H),6.66(d,J=15.6Hz,1H),4.82(s,2H),4.38(s,2H),3.59-3.43(m 8H),3.41-3.35(m,2H),3.20-3.13(m,2H),3.04(s,6H),2.12-1.17(m,18H).HR-MS(ESI):m / z Calcd.For C 37 H 44 ClF3N4O6 732.2901; found733.2980,[MH] - .

[0329] Comparative Example 13:

[0330]

[0331] The product was synthesized according to the method published in the literature (JACS, 2018, 140, 7381-7384). 1 H NMR (400MHz, CD3OD) δ8.17(d,J=8.3Hz,2H),7.79(d,J=15.6Hz,1H),7.55(d,J=8.8Hz,2H),6.84(s,1H),6.80(dd ,J=9.9,2.8Hz,2H),6.75(dd,J=8.8,5.6Hz,2H),6.66(d,J=15.6Hz,1H),4.82(s,2H),4.38(s,2H),3.59-3.43(m 8H),3.41-3.35(m,2H),3.20-3.13(m,2H),3.04(s,6H),2.12-1.17(m,18H).HR-MS(ESI):m / z Calcd.For C 38 H 44 ClF3N5O6 739.2948; found740.3026,[M+H] - .

[0332] Test Example 1:

[0333] The fluorescent dyes IV-1–IV-38 (molecular rotors) prepared in Examples 1-38 were dissolved in dimethyl sulfoxide to prepare a concentration of 1×10 -2 M mother liquor, add each mother liquor into glycerol and methanol respectively, mix well, and prepare the final concentration of 1×10 -5 The fluorescence emission spectra of the solutions of M were detected under the same conditions using the maximum excitation wavelength of each fluorescent dye according to the different fluorescent dyes. The results are shown in Table 1, indicating that the fluorescent dye of the present invention is sensitive to changes in viscosity.

[0334] Table 1

[0335]

[0336]

[0337] Test Example 2:

[0338] Molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, and IV-22 were added to a diethanol-glycerol mixed solution to prepare a final concentration of 1×10 -5M solution, excited at 480nm, the fluorescence emission spectra under different viscosity conditions are as follows Figure 1 、 Figure 2 、 Figure 3 、 Figure 4 、 Figure 5 、 Figure 6 、 Figure 7 、 Figure 8 、 Figure 9 、 Figure 10 、 Figure 11 、 Figure 12 As shown, the fluorescence intensity of the molecular rotor with the same concentration gradually increases under different viscosity conditions, indicating that the fluorescence intensity of the molecular rotor increases with the increase of the environmental viscosity, proving that the molecular rotor is sensitive to viscosity and is a molecular rotor.

[0339] Test Example 3:

[0340] Molecular rotors IV-39, IV-40, IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8; IV-41, IV-43 and IV-17, IV-18, IV-19, IV-20, IV-21, IV-22; IV-42 and IV-36; IV-45, IV-46 and IV-3; IV-47, IV-48 and IV-20; IV-49, IV-50 and IV-5; IV-51 and IV-1; dissolved in DMSO, configured as 1×10 -3 M mother liquor, remove the above mother liquor and add PBS solution to prepare the final concentration of 1×10 -6 M solution, respectively, was excited with the maximum excitation wavelength of each compound, and their fluorescence intensity in PBS was detected. The strongest fluorescence of each group was taken as 100 to normalize each sample. Figure 13 、 Figure 14 、 Figure 15 、 Figure 16 、 Figure 17 、 Figure 18 、 Figure 19 shown. Figure 13 、 Figure 14 、 Figure 15 The results show that compared with molecular rotors with no substitution on the aromatic ring of the electron-withdrawing group, the molecular rotors with substitutions of hydroxyl, cyano, fluorine, chlorine, bromine, or iodine atoms on the aromatic ring of the electron-withdrawing group in the present invention have lower background fluorescence. Figure 16 、 Figure 17 The results show that compared with molecular rotors with multiple substitutions on the aromatic ring of the electron-withdrawing group, the molecular rotor with a single substitution has a relatively low background fluorescence. This may be because the multiple substitutions change the electron cloud distribution of the aromatic structure on the electron-withdrawing group, resulting in an increase in the fluorescence background. Figure 18 、 Figure 19 The results show that the background fluorescence is lower when R1 is substituted with a simple alkyl group. This may be because R1 is larger or the heteroatoms (such as oxygen atoms and nitrogen atoms) on the modified alkyl group have a weak interaction with the aromatic ring on the electron-withdrawing group, thereby inhibiting non-radiative energy-consuming movements such as double bond rotation here, thereby causing the fluorescence background of the compound to increase.

[0341] Test Example 4:

[0342] Compounds IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, and IV-22 specifically bind to the RNA aptamer (UUGCCAUGUGUAUGUGGGAGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCCUCCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA). The fluorescence of the compounds after binding is significantly activated, and bright fluorescence is emitted under the excitation of excitation light of a suitable wavelength. The optical properties after binding are shown in Table 2. The compounds can also bind to the aptamer in cells, and cells expressing the RNA aptamer have bright fluorescence, as shown in Table 2. Figure 20 Middle A: Cells that do not express the RNA aptamer have no fluorescence, such as Figure 20 Middle B shows that this series of dyes can be used to label nucleic acids.

[0343] Table 2

[0344] name Ex / nm Em / nm <![CDATA[ε(M -1 cm -1 )]]> QY(-) IV-1 510 618 20667 0.17 IV-2 492 595 25000 0.36 IV-3 490 565 26000 0.27 IV-4 490 574 23333 0.37 IV-5 492 570 23000 0.33 IV-6 490 578 24000 0.37 IV-17 524 582 32000 0.47 IV-18 536 600 25000 0.43 IV-19 522 590 30000 0.43 IV-20 512 577 25500 0.36 IV-21 534 624 26222 0.28 IV-22 522 580 32000 0.46

[0345] Note: The fluorescence quantum yield was measured using the relative method with rhodamine 6G as the standard (QY=0.94).

[0346] Test Example 5:

[0347] Figure 21 ), IV-21 molecules can specifically label ACTB mRNA in cell lines expressing target RNA without obvious background fluorescence ( Figure 21 A), while the background fluorescence of IV-41 molecule is higher than that of IV-21, and it is impossible to clearly distinguish whether ACTB is expressed ( Figure 21 Middle B). Sequence Listing <110> Naying (Shanghai) Biotechnology Co., Ltd. <120> A fluorescent dye and its preparation method and use <160> 1 <170> SIPOSequenceListing 1.0 <210> 2 <211> 3 <212> RNA <213> Artificial sequence <220> <223> UUGCCAUGUGUAUGUGGGAGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCCGGCGGACACUUCCUCCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA <220> <400> 2

Claims

1. A fluorescent dye, wherein the fluorescent dye is represented by formula (I): in: When D- is N(X1)(X2)-, Ar is selected from the following structures (II-1) to (II-6): X1 and X2 are each independently selected from hydrogen, alkyl or modified alkyl; When D- is HO-, Ar is selected from the following formula , and at least one hydrogen atom in Ar is independently substituted by a halogen atom; Y is O or S; R1 is hydrogen or alkyl; R2 is a halogen atom, -OH or -CN; in: The "modified alkyl" is C1-C 16 A group obtained by replacing any carbon atom of a straight-chain or branched alkyl group by one or more groups selected from -OH, -CN, -NH2, -NHR", and -NR"R"'; The carbon atom is replaced, which means that the carbon atom or the carbon atom together with the hydrogen atoms thereon are replaced by the corresponding group; The "halogen atoms" are each independently F, Cl, Br or I; Each R" is independently an alkyl group; Each R'' is independently an alkyl group; The "alkyl" is a C1-C6 straight chain or branched chain alkyl.

2. The fluorescent dye according to claim 1, characterized in that The "alkyl" is a C1-C4 straight chain or branched chain alkyl.

3. The fluorescent dye according to claim 1, characterized in that The “alkyl” is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, and 2-ethylbutyl.

4. The fluorescent dye according to claim 1, characterized in that The "modified alkyl" is one or more groups selected from -OH, -NH2, -CN, Me2N-, and Et2N-.

5. The fluorescent dye according to claim 1, characterized in that The compound represented by formula (I) is selected from the following compounds:

6. The method for preparing the fluorescent dye according to any one of claims 1 to 5, characterized in that: The method comprises the steps of: subjecting a compound of formula (a) to an aldol condensation reaction with a compound of formula (b); 7. Use of the fluorescent dye according to any one of claims 1 to 5 in viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the use is not for a diagnostic method for a disease.

8. Use of the fluorescent dye according to any one of claims 1 to 5 in the preparation of a reagent for viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

9. A fluorescence-activated light-up probe comprising the fluorescent dye according to any one of claims 1 to 5.

10. Use of the fluorescence-activated light-up probe according to claim 9 in protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the use is not for a disease diagnosis method.

11. Use of the fluorescence-activated light-up probe according to claim 9 in preparing reagents for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

Citation Information

Patent Citations

  • Fluorescent dye as well as preparation method and application thereof

    CN107663384A

  • Fluorescent probe and preparation and application methods thereof

    CN109574880A