Compositions for modulating tau expression

Abstract

Disclosed herein are antisense compounds and methods for reducing tau mRNA and protein expression. Such methods, compounds, and compositions are useful for treating, preventing, or ameliorating tau-associated diseases, disorders, and conditions.

Description

[0001] This application is a divisional application of Chinese Patent Application No. 201480040726.6, filed on July 21, 2014, entitled "Composition for Regulating τ Protein Expression". The original application was a national phase application of International Application No. PCT / US2014 / 047486, which claimed priority to U.S. Application No. 61 / 856,551, filed on July 19, 2013; U.S. Application No. 61 / 879,621, filed on September 18, 2013; U.S. Application No. 61 / 885,371, filed on October 1, 2013; and U.S. Application No. 62 / 014,486, filed on June 19, 2014.

[0002] sequence list

[0003] This application is filed together with an electronic sequence listing. The sequence listing is provided as a 916Kb document entitled BIOL0227WOSEQ_ST 25.txt created on July 17, 2014. The information in the electronic sequence listing is incorporated herein by reference in its entirety. Technical Field

[0004] Compositions and methods are provided for reducing the expression of τ protein mRNA and protein in animals. These methods are suitable for treating, preventing, or improving neurodegenerative diseases, including τ protein lesions, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, and Dravet's syndrome.

[0005] The primary function of the tau protein is to bind to and stabilize microtubules, which are important cytoskeletal structural components involved in mitosis, cytokinesis, and vesicle transport. Tau proteins are found in a variety of tissues, but are particularly abundant in the axons of neurons. In humans, six tau protein homologs exist, resulting from alternative splicing of exons 2, 3, and 10. Splicing exons 2 and 3 at the N-terminus of the protein results in an acidic domain comprising 0, 1, or 2 amino acids, and is referred to as 0N, 1N, or 2N tau proteins, respectively. The effects of these domains on tau protein function are not fully understood, but they may play a role in interactions with the plasma membrane. Including exon 10 at the C-terminus results in a microtubule-binding domain encoded by exon 10. Because three microtubule-binding domains are present elsewhere in the tau protein, this tau protein homolog (including exon 10) is called the 4R tau protein, where 'R' refers to the number of repeating sequences in the microtubule-binding domain. The tau protein without exon 10 is called the 3R tau protein. Because more microtubule-binding domains (4R compared to 3R) increase binding to microtubules, 4Rτ protein is hypothesized to significantly increase microtubule binding and assembly. The 3R / 4Rτ protein ratio is developmentally regulated, with fetal tissues expressing only 3Rτ protein and adult human tissues expressing approximately equal amounts of 3R / 4Rτ protein. Deviations from the normal 3R / 4Rτ protein ratio are characteristic of neurodegenerative FTDτ protein pathogenesis. It is unknown how alterations in the 3R / 4Rτ protein ratio at subsequent stages in adult animals will affect τ protein pathogenesis.

[0006] Serine-threonine-directed phosphorylation regulates the microtubule-binding capacity of tau protein. Hyperphosphorylation promotes tau protein detachment from microtubules. Other post-translational modifications of tau protein have been described; however, the significance of these modifications remains unclear. Phosphorylation of tau protein is also developmentally regulated, with higher phosphorylation in fetal tissues and much lower phosphorylation in adults. An abnormally increased phosphorylation of tau protein is a characteristic feature of neurodegenerative diseases.

[0007] Microtubule networks are involved in many important processes within the cell, including structural integrity, required to maintain cell morphology and manipulate transport mechanisms. Because tau protein binding to microtubules stabilizes them, tau protein may be a key mediator of some of these processes, and disruption of normal tau protein in neurodegenerative diseases can disrupt some of these key cellular processes.

[0008] T-protein can be an important early indicator of neurodegenerative syndromes, recognized as a key component of neurofibrillary inclusions in Alzheimer's disease. In fact, neurofibrillary inclusions are aggregates of hyperphosphorylated T-protein. Along with plaques containing β-amyloid, neurofibrillary inclusions are hallmarks of Alzheimer's disease and significantly associated with cognitive impairment. 95% of T-protein accumulations in AD are found in neuronal processes known as neuroinflammatory dystrophy. The process by which this microtubule-associated protein detaches from microtubules and forms protein accumulations, and how this relates to neurotoxicity, is not fully understood.

[0009] Neuronal tau protein inclusions are a pathological feature not only of Alzheimer's disease but also of subgroups of frontotemporal dementia (FTD), PSP, and CBD. The association between tau protein and neurodegeneration has been solidified by the discovery that mutations in the tau protein gene cause subgroups of FTD. These genetic data have also highlighted the importance of the 3R:4R ratio of tau protein. Many tau protein mutations causing FTD result in altered tau protein splicing, preferentially including exon 10, and thus leading to an increase in 4R tau protein. Overall tau protein levels are normal. Whether changes in tau protein isoforms, amino acids, or both contribute to neurodegeneration remains unknown. Recent data suggest that PSP may also be associated with an increased 4R:3R tau protein ratio.

[0010] To help understand the impact of tau protein ratios on neurodegeneration, a mouse model based on a spliced ​​tau protein mutation (N279K) has been generated using a pocket gene containing the tau protein promoter and flanking intron sequences of exon 10. As in humans, these mice showed increased levels of 4Rt protein compared to transgenes expressing WTt protein, and developed behavioral and motor abnormalities, as well as the accumulation of tau protein in the brain and spinal cord.

[0011] The protein "tau protein" has been linked to a variety of brain diseases, including Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal ganglia degeneration, boxer's dementia, chromosomal Parkinson's disease, Lytico-Bodig disease, tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioma, subacute sclerosing panencephalitis, lead poisoning encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, argyrophilic grain disease, corticobasal or frontotemporal degeneration, and others. Tau protein-related conditions such as AD are the most common cause of dementia in older adults. AD affects an estimated 15 million people worldwide, with 40% of the affected population over 85 years of age. AD is characterized by two pathological markers: τ protein neurofibrillary inclusions (NFT) and β-amyloid plaques.

[0012] Currently, there are no acceptable options for treating this neurodegenerative disease. Therefore, one goal of this article is to provide methods for treating this disease. Invention Overview

[0013] This document provides methods, compounds, and compositions for regulating the expression of τ protein mRNA and protein. In some embodiments, the compounds used to regulate τ protein mRNA and protein expression are antisense compounds. In some embodiments, the antisense compounds are antisense oligonucleotides.

[0014] In some embodiments, regulation can be performed in cells or tissues. In some embodiments, the cells or tissues are in an animal. In some embodiments, the animal is a human. In some embodiments, the τ protein mRNA content is reduced. In some embodiments, the τ protein content is reduced. This reduction can occur in a time-dependent or dose-dependent manner.

[0015] Methods, compounds, and compositions are also provided for the prevention, treatment, and improvement of diseases, conditions, and symptoms. In some embodiments, such tau protein-related diseases, conditions, and symptoms are neurodegenerative diseases. In some embodiments, such neurodegenerative diseases, conditions, and symptoms include tau protein lesions, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, and Dravet syndrome.

[0016] This disease, condition, and symptom may share one or more risk factors, causes, or outcomes. Some risk factors and causes for the development of neurodegenerative diseases include aging, a personal or family history, or a genetic predisposition. Some symptoms and outcomes associated with the development of neurodegenerative diseases include, but are not limited to: the presence of hyperphosphorylated τ protein, the presence of neurofibrillary inclusions, decreased neurological function, memory loss, decreased motor function, decreased motor coordination, and disorder.

[0017] In some embodiments, the treatment method includes administering a tau protein antisense compound to an individual in need. In some embodiments, the treatment method includes administering a tau protein antisense oligonucleotide to an individual in need.

[0018] This disclosure provides implementation schemes with the following non-restrictive designations:

[0019] Implementation Scheme 1: A compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases from any one of the nucleobase sequences SEQ ID NO:20-2443 and SEQ ID NO:2478-2483.

[0020] Implementation Scheme 2: A compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NO:2444-2477 and SEQ ID NO:2484-2565.

[0021] Implementation Scheme 3: A compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases from any of the nucleobase sequences SEQ ID NO:20-2565.

[0022] Implementation Scheme 4: A compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 nucleobases of equal length complementary to nucleobases 135783-135980 of SEQ ID NO:1.

[0023] Implementation Scheme 5: A compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 nucleobases complementary to nucleobases 135853-135872 of SEQ ID NO:1.

[0024] Implementation Scheme 6: A compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 nucleobases of equal length complementary to nucleobases 135783-135929 of SEQ ID NO:1.

[0025] Implementation Scheme 7: A compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 nucleobases of equal length complementary to nucleobases 135783-135914 of SEQ ID NO:1.

[0026] Implementation Scheme 8: The compound as described in Implementation Schemes 4-7, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO:1 by at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.

[0027] Implementation Scheme 9: A compound as described in any of the previous implementation schemes, which consists of a single-stranded modified oligonucleotide.

[0028] Implementation Scheme 10: A compound as described in any of the previous implementation schemes, wherein at least one nucleoside inter-bond is a modified nucleoside inter-bond.

[0029] Implementation Scheme 11: The compound as described in Implementation Scheme 10, wherein at least one modified nucleoside inter-bond is a thiophosphate nucleoside inter-bond.

[0030] Implementation Scheme 12: The compound as described in Implementation Scheme 10, wherein each modified nucleoside inter-bond is a thiophosphate nucleoside inter-bond.

[0031] Implementation Scheme 13: A compound as described in any of the previous implementation schemes, wherein at least one nucleoside inter-bond is a phosphodiester nucleoside inter-bond.

[0032] Implementation Scheme 14: A compound as described in any of the previous embodiments, wherein at least one nucleoside inter-bond is a thiophosphate bond and at least one nucleoside inter-bond is a phosphodiester bond.

[0033] Implementation Scheme 15: A compound as described in any of the previous embodiments, wherein at least one nucleoside comprises a modified nucleobase.

[0034] Implementation Scheme 16: The compound as described in Implementation Scheme 15, wherein the modified nucleobase is 5-methylcytosine.

[0035] Implementation Scheme 17: A compound as described in any of the previous embodiments, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

[0036] Implementation Scheme 18: The compound as described in Implementation Scheme 17, wherein at least one modified sugar is a bicyclic sugar.

[0037] Implementation Scheme 19: The compound as described in Implementation Scheme 18, wherein the bicyclic sugar contains a chemical bond 4'-CH2-N(R)-O-2' bridge between the 2' and 4' positions of the sugar, wherein R is independently H, C1-C12 alkyl or protecting group.

[0038] Implementation Scheme 20: The compound as described in Implementation Scheme 18, wherein the bicyclic sugar comprises a 4'-CH2-N(R)-O-2' bridge, wherein R is independently H, C1-C12 alkyl or protecting group.

[0039] Implementation Scheme 21: The compound as described in Implementation Scheme 17, wherein at least one modified sugar comprises 2'-O-methoxyethyl.

[0040] Implementation Scheme 22: The compound as described in Implementation Scheme 17, wherein the modified sugar comprises a 2'-O(CH2)2-OCH3 group.

[0041] Implementation Scheme 23: A compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0042] A spacer segment consisting of 10 linked deoxynucleotides;

[0043] The 5' wing consists of five linked nucleosides; and

[0044] The 3' wing consists of five linked nucleosides;

[0045] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0046] Implementation Scheme 24: A compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0047] A spacer segment consisting of nine linked deoxynucleotides;

[0048] The 5' wing consists of five linked nucleosides; and

[0049] The 3' wing consists of five linked nucleosides;

[0050] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0051] Implementation Scheme 25: A compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0052] A spacer segment consisting of 7 linked deoxynucleotides;

[0053] The 5' wing consists of five linked nucleosides; and

[0054] The 3' wing consists of six linked nucleosides;

[0055] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0056] Implementation Scheme 26: A compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0057] A spacer segment consisting of eight linked deoxynucleotides;

[0058] The 5' wing consists of five linked nucleosides; and

[0059] The 3' wing consists of five linked nucleosides;

[0060] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0061] Implementation Scheme 27: A compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0062] A spacer segment consisting of eight linked deoxynucleotides;

[0063] The 5' wing consists of four linked nucleosides; and

[0064] The 3' wing consists of six linked nucleosides;

[0065] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0066] Implementation Scheme 28: A compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0067] A spacer segment consisting of eight linked deoxynucleotides;

[0068] The 5' wing consists of six linked nucleosides; and

[0069] The 3' wing consists of four linked nucleosides;

[0070] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0071] Implementation Scheme 29: A compound as described in any of the previous implementation schemes, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0072] Implementation Scheme 30: A compound as described in any of the previous implementation schemes, wherein the modified oligonucleotide consists of 19 linked nucleosides.

[0073] Implementation Scheme 31: A compound as described in any of the previous implementation schemes, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0074] Embodiment 32: A composition comprising at least one of a compound as described in any of the previous embodiments or a salt thereof and a pharmaceutically acceptable carrier or diluent.

[0075] Implementation Scheme 33: A method comprising administering to an animal a compound or composition as described in any of the previous implementation schemes.

[0076] Implementation Scheme 34: The method as described in Implementation Scheme 33, wherein the animal is a human.

[0077] Implementation Scheme 35: The method as described in Implementation Scheme 33, wherein the compound is applied to prevent, treat, improve, or slow the progression of τ protein-related diseases, conditions, or symptoms.

[0078] Implementation Scheme 36: The method described in Implementation Scheme 35, wherein the disease, symptom, or condition is tau protein lesion, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, or Dravet syndrome.

[0079] Implementation Scheme 37: Use of the compound or composition as described in any of the previous implementation schemes, for the manufacture of a medicament for the treatment of neurodegenerative diseases.

[0080] Implementation scheme 38: A compound consisting of ISIS 613099.

[0081] Implementation scheme 39: A compound consisting of ISIS 613361.

[0082] Implementation scheme 40: A compound consisting of ISIS 613370.

[0083] Implementation scheme 41: A compound consisting of ISIS 623782.

[0084] Implementation scheme 42: A compound consisting of ISIS 623996.

[0085] Embodiment 43: A composition comprising at least one of a compound or a salt thereof as described in any one of Embodiments 38-42 and a pharmaceutically acceptable carrier or diluent.

[0086] Implementation Scheme 44: A method comprising administering to an animal a compound or composition as described in any one of Implementation Schemes 38-43.

[0087] Implementation Scheme 45: The method as described in Implementation Scheme 44, wherein the animal is a human.

[0088] Implementation Scheme 46: The method as described in Implementation Scheme 44, wherein the compound is administered to prevent, treat, improve, or slow the progression of τ protein-related diseases, conditions, or symptoms.

[0089] Implementation Scheme 47: The method described in Implementation Scheme 46, wherein the disease, condition or symptom is tau protein lesion, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy or Dravet syndrome.

[0090] Implementation Scheme 48: Use of the compound or composition as described in any one of Implementation Schemes 38-43, for the manufacture of a medicament for the treatment of neurodegenerative diseases.

[0091] Detailed Explanation

[0092] It should be understood that the above general description and the following detailed description are illustrative and not limiting of the invention as claimed. In this document, the singular is used to include the plural unless otherwise specifically stated. Unless otherwise stated, the use of “or” as used herein means “and / or”. Additionally, unless otherwise stated, the use of “and” as used herein means “and / or”. Furthermore, the use of the term “including” and other forms such as “includes” and “included” is not limiting. And, unless otherwise specifically stated, terms such as “component” or “assembly” cover components and components comprising one unit as well as components and components comprising more than one subunit.

[0093] The section headings used herein are for organizational purposes only and are not intended to limit the subject matter. All documents or portions thereof referenced in this disclosure (including, but not limited to, patents, patent applications, published patent applications, articles, books, monographs, and GENBANK accession numbers and related sequence information available from databases such as the National Center for Biotechnology Information (NCBI)) and other data mentioned herein throughout the disclosure are expressly incorporated herein by reference, both in their entirety and in their entirety.

[0094] definition

[0095] Unless otherwise defined, the nomenclature used in analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry as described herein, and the procedures and techniques described herein, are those well-known and commonly used in this art. Standard techniques can be used for chemical synthesis and chemical analysis.

[0096] Unless otherwise indicated, the following terms have the following meanings:

[0097] "2'-O-methoxyethyl" (also known as 2'-MOE, 2'-OCH2CH2-OCH3, and MOE) refers to the O-methoxy-ethyl modification at the 2' position of the furanose ring. Sugars modified with 2'-O-methoxyethyl are modified sugars.

[0098] "2'-MOE nucleoside" (also known as 2'-O-methoxyethyl nucleoside) refers to a nucleoside containing a sugar moiety modified with 2'-MOE.

[0099] "Nucleosides substituted at the 2' position" refers to nucleosides containing a substituent other than H or OH at the 2' position of the furanyl ring. In some embodiments, nucleosides substituted at the 2' position include nucleosides with bicyclic sugar modifications.

[0100] "5-Methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-Methylcytosine is a modified nucleobase.

[0101] "Approximately" means within ±7% of the value. For example, if it is stated that "the compound inhibits the τ protein by at least approximately 70%", it means that the τ protein content is inhibited in the range of 63% to 77%.

[0102] "Concomitant administration" refers to the combined administration of two pharmaceutical agents in any manner in which their pharmacological effects are simultaneously expressed in the patient's body. Concomitant administration does not require the two pharmaceutical agents to be administered in a single pharmaceutical composition, in the same dosage form, or via the same route of administration. The effects of the two pharmaceutical agents themselves do not need to be expressed simultaneously. The effects only need to overlap for a period of time, without necessarily being prolonged together.

[0103] "Administration" means providing medicine or pharmaceutical agents to animals, including but not limited to administration by medical professionals and self-administration.

[0104] "Improvement" means at least one indicator that reduces, slows, terminates, or reverses the severity of a symptom or disease. The severity of the indicator can be determined by subjective or objective measurements known to a person skilled in the art.

[0105] "Animal" means human or non-human animals, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including but not limited to monkeys and chimpanzees.

[0106] An "antibody" is a molecule characterized by a specific reaction with an antigen in some way, where the antibody and the antigen are each defined by the other. An antibody can refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, light chain, Fab region, and Fc region.

[0107] "Antisense activity" refers to any detectable or measurable activity attributable to the hybridization of an antisense compound with its target nucleic acid. In some embodiments, antisense activity is a reduction in the amount or expression of the target nucleic acid or the protein encoded by the target nucleic acid.

[0108] "Antisense compounds" refer to oligomeric compounds that can hybridize with target nucleic acids via hydrogen bonds. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and site-based compounds.

[0109] "Antisense inhibition" means that the content of the target nucleic acid is reduced in the presence of an antisense compound that is complementary to the target nucleic acid compared to the absence of the antisense compound.

[0110] "Antisense mechanism" refers to all mechanisms involving hybridization of a compound with a target nucleic acid, where the result or effect of hybridization is target degradation or target occupancy, accompanied by inhibition of cellular mechanisms involved, such as transcription or splicing.

[0111] "Antisense oligonucleotide" refers to a single-stranded oligonucleotide with a nucleobase sequence that allows hybridization with the corresponding segment of the target nucleic acid.

[0112] "Base complementarity" refers to the ability of an antisense oligonucleotide to accurately pair (i.e., hybridize) with the corresponding nucleobases in a target nucleic acid, mediated by Watson-Crick, Hoogsteen, or anti-Hoogsteen hydrogen bonds between the corresponding nucleobases.

[0113] "Bicyclic sugar" refers to a furanose ring modified by two atoms bridging it. Bicyclic sugars are modified sugars.

[0114] "Bicyclic nucleoside" (also known as BNA) refers to a nucleoside having a bridge containing two carbon atoms that connect the sugar ring, thereby forming the sugar moiety of a bicyclic system. In some embodiments, the bridge connects the 4'-carbon and 2'-carbon of the sugar ring.

[0115] "Cap structure" or "terminal cap portion" refers to a chemical modification that has been incorporated into the end of any antisense compound.

[0116] “cEt” or “restricted ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting a 4'-carbon and a 2'-carbon, wherein the bridge has the following formula: 4'-CH(CH3)-O-2'.

[0117] "Restricted ethyl nucleoside" (also known as cEt nucleoside) refers to a nucleoside containing a bicyclic sugar moiety with a 4'-CH(CH3)-O-2' bridge.

[0118] A “chemically different region” refers to a region in an antisense compound that is chemically different from another region of the same antisense compound in some way. For example, a region containing a 2'-O-methoxyethyl nucleoside is chemically different from a region containing a nucleoside without 2'-O-methoxyethyl modification.

[0119] "Chimeric antisense compounds" refers to antisense compounds with at least two chemically dissimilar regions, each with multiple subunits.

[0120] "Co-administration" means the use of two or more pharmaceutical agents by an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition or in a separate pharmaceutical composition. Each of the two or more pharmaceutical agents may be administered via the same or different routes of administration. Co-administration encompasses simultaneous or sequential administration.

[0121] "Complementarity" refers to the ability of the nucleobases of the first and second nucleic acids to pair.

[0122] "comprise", "comprises" and "comprising" should be understood as meaning that the step or element or group of steps or elements is included, but does not exclude any other step or element or group of steps or elements.

[0123] "Continuous nucleobases" means nucleobases that are adjacent to each other.

[0124] "Design" or "designed" refers to the method of designing oligomeric compounds that specifically hybridize with selected nucleic acid molecules.

[0125] "Diluent" refers to a component in a composition that lacks pharmacological activity but is pharmaceutically necessary or required. For example, in injectable drugs, the diluent may be a liquid, such as a saline solution.

[0126] "Dosage" refers to the specified amount of a pharmaceutical agent delivered in a single administration or over a specified period of time. In some embodiments, the dosage may be administered once, twice, or more times via rapid bolus, tablet, or injection. For example, in some embodiments, when subcutaneous administration is required, the desired dosage requires a volume that is not easily provided by a single injection; therefore, two or more injections may be used to achieve the desired dosage. In some embodiments, the pharmaceutical agent is administered via extended periods or continuous infusion. Dosage may be specified as hourly, daily, weekly, or monthly pharmaceutical doses.

[0127] In the context of modulating activity or treating or preventing a condition, "effective dose" refers to a pharmaceutical agent administered to a subject requiring modulation, treatment, or prevention in the form of a single dose or a portion of a series of doses to effectively modulate the effect, or treat, prevent, or improve the condition. In an individual, the effective dose can vary depending on factors such as the individual's health and physical condition, the individual's taxonomic group, the formulation of the composition, the assessment of the individual's medical condition, and other relevant factors.

[0128] "Efficacy" refers to the ability to produce the desired effect.

[0129] "Expression" encompasses all the functions by which genetic code information is translated into structures that exist and function within the cell. These structures include, but are not limited to, the products of transcription and translation.

[0130] "Completely complementary" or "100% complementary" means that every nucleobase of the first nucleic acid has a complementary nucleobase in the second nucleic acid. In some implementations, the first nucleic acid is an antisense compound and the target nucleic acid is the second nucleic acid.

[0131] A "gapmer" refers to a chimeric antisense compound containing multiple internal regions of nucleosides that facilitate cleavage by ribonuclease H, located between external regions containing one or more nucleosides. The nucleosides constituting the internal regions are chemically different from those constituting the external regions. The internal regions can be called "gap regions," and the external regions can be called "wing regions."

[0132] "Narrow spacer" means that a chimeric antisense compound has a spacer segment with nine or fewer consecutive 2'-deoxyribonucleosides located between and closely adjacent to the 5' and 3' wings containing one to six nucleotides.

[0133] "Spacing widening" means that a chimeric antisense compound has a spacer segment with 12 or more consecutive 2'-deoxyribonucleosides located between and closely adjacent to the 5' and 3' wings containing 1 to 6 nucleotides.

[0134] "Hybridization" refers to the adhesion of complementary nucleic acid molecules. In some embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and target nucleic acids. In some embodiments, complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.

[0135] "Identifying animals with tau protein-related diseases" means identifying animals that have been diagnosed with tau protein-related diseases or are predisposed to developing them. Individuals predisposed to developing tau protein-related diseases include those with one or more risk factors for developing the disease, such as aging, a personal or family history of the disease, or a genetic predisposition to one or more tau protein-related diseases. This identification can be achieved by any method, including assessing an individual's medical history and standard clinical tests or evaluations (such as genetic testing).

[0136] "Close proximity" means that there are no intervening components between adjacent components.

[0137] "Individual" refers to a human or non-human animal selected for treatment or therapy.

[0138] "Inhibition of τ protein" refers to reducing the content or expression of τ protein mRNA and / or protein. In some embodiments, the content of τ protein mRNA and / or protein is inhibited in the presence of antisense compounds targeting τ protein (including antisense oligonucleotides targeting τ protein) compared to the expression level of τ protein mRNA and / or protein in the absence of antisense compounds (such as antisense oligonucleotides).

[0139] "Inhibit expression or activity" means to reduce or block expression or activity and does not necessarily indicate complete elimination of expression or activity.

[0140] "Nucleoside bond" refers to the chemical bond between nucleosides.

[0141] "Linked nucleosides" refers to adjacent nucleosides linked together by internucleotide bonds.

[0142] "Locked nucleic acid" or "LNA" or "LNA nucleotide" refers to a nucleic acid monomer that has a bridging group between the 4' and 2' positions of the nucleotide sugar unit, connecting two carbon atoms to form a bicyclic sugar. Examples of bicyclic sugars include, but are not limited to, A) α-L-methyleneoxy(4'-CH2-O-2')LNA; (B) β-D-methyleneoxy(4'-CH2-O-2')LNA; (C) ethyleneoxy(4'-(CH2)2-O-2')LNA; (D) aminooxy(4'-CH2-ON(R)-2')LNA; and (E) oxyamino(4'-CH2-N(R)-O-2')LNA, as described below.

[0143]

[0144] The LNA compounds used herein include, but are not limited to, compounds having at least one bridging group between the 4' and 2' positions of the sugar, wherein each bridging group independently comprises one or two to four linking groups independently selected from the following: -[C(R1)(R2)] n -, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O) x - and -N(R1)-; where: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R1 and R2 is independently H, protecting group, hydroxyl group, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C20 Aryl, heterocyclic, substituted heterocyclic, heteroaryl, substituted heteroaryl, C5-C7 alicyclic, substituted C5-C7 alicyclic, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfinyl (S(=O)-J1); and each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl or protecting group.

[0145] Examples of 4'-2' bridging groups covered in the definition of LNA include, but are not limited to, one of the following: -[C(R1)(R2)] n -、-[C(R1)(R2)] n -O-, -C(R1R2)-N(R1)-O-, or –C(R1R2)-ON(R1)-. Furthermore, other bridging groups covered in the LNA definition are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R1)-2', and 4'-CH2-N(R1)-O-2'- bridges, where each R1 and R2 is independently H, a protecting group, or C1-C. 12 alkyl.

[0146] The definition of LNA according to the present invention also includes LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is attached to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH2-O-2') bridge to form a bicyclic sugar moiety. The bridging group may also be a methylene (-CH2-) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH2-O-2')LNA is used. Furthermore, in the case of a bicyclic sugar moiety having an ethylidene bridging group at this position, the term ethylideneoxy (4'-CH2CH2-O-2')LNA is used. α-L-methyleneoxy (4'-CH2-O-2'), an isomer of methyleneoxy (4'-CH2-O-2')LNA, is also covered in the definition of LNA as used herein.

[0147] "Mismatch" or "non-complementary nucleobases" refers to a situation where the nucleobases of the first nucleic acid cannot pair with the corresponding nucleobases of the second or target nucleic acid.

[0148] "Modified nucleoside bonds" refers to nucleoside bonds that have been substituted or altered compared to naturally occurring nucleoside bonds (i.e., phosphodiester nucleoside bonds).

[0149] "Modified nuclei" refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. "Unmodified nuclei" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0150] "Modified nucleosides" refers to nucleosides that independently possess modified sugar moieties and / or modified nucleobases.

[0151] "Modified nucleotide" refers to a nucleotide that independently has a modified sugar moiety, a modified nucleoside internucleotide bond, and / or a modified nucleobase.

[0152] "Modified oligonucleotides" refers to oligonucleotides containing at least one modified nucleoside bond, a modified sugar, and / or a modified nucleobase.

[0153] "Modified sugar" means that there are substitutions and / or any changes compared to the natural sugar portion.

[0154] "Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, naturally occurring or modified nucleosides and nucleotides.

[0155] "Motif" refers to the form of unmodified and modified nucleosides in an antisense compound.

[0156] "Natural sugar moieties" refers to the sugar moieties present in DNA (2'-H) or RNA (2'-OH).

[0157] "Naturally occurring nucleoside inter-bonds" refers to 3' to 5' phosphodiester bonds.

[0158] "Non-complementary nucleobases" refer to a pair of nucleobases that do not form hydrogen bonds with each other or otherwise facilitate hybridization.

[0159] Nucleic acids are molecules composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering RNA (siRNA), and microRNA (miRNA).

[0160] "Nucleobase" refers to the heterocyclic portion that can pair with a base of another nucleic acid.

[0161] "Nucleobase complementarity" refers to the ability of a nucleobase to pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). Similarly, in RNA, adenine (A) is complementary to uracil (U). In some embodiments, a complementary nucleobase refers to a nucleobase in the antisense compound that can pair with a nucleobase in its target nucleic acid. For example, if a nucleobase at a certain position in the antisense compound can form a hydrogen bond with a nucleobase at a certain position in the target nucleic acid, then the hydrogen bond position between the oligonucleotide and the target nucleic acid at that nucleobase pair is considered complementary.

[0162] "Nucleobase sequence" refers to the order of consecutive nucleobases, and is independent of any sugars, bonds, and / or nucleobase modifications.

[0163] "Nucleoside" refers to a nucleobase linked to a sugar.

[0164] "Nucleoside mimics" include those structures used to substitute sugars or sugar and bases at one or more positions in an oligomer, without necessarily replacing bonds, such as morpholino, cyclohexenyl, cyclohexyl, tetrahydropiperanyl, bicyclic, or tricyclic sugar mimics, such as nucleoside mimics of non-furanose sugar units. Nucleotide mimics include those structures used to substitute nucleosides and bonds at one or more positions in an oligomer, such as peptide nucleic acids or morpholino (morpholino linked by -N(H)-C(=O)-O- or other non-phosphodiester bonds). Sugar substitutes are consistent with the slightly broader term nucleoside mimics, but are only intended to indicate the substitution of sugar units (furanose rings). The tetrahydropiperanyl rings provided herein illustrate examples of sugar substitutes in which the furanose sugar group has been replaced by a tetrahydropiperanyl ring system. "Mimetic" refers to a group that substitutes for sugars, nucleosides, and / or nucleoside bonds. Generally, mimics are used to replace sugars or sugar-nucleoside bond combinations and maintain nucleosides for hybridization with selected targets.

[0165] "Nucleotide" refers to a nucleoside that has a phosphate ester group covalently linked to the sugar moiety of the nucleoside.

[0166] "Off-target effects" refer to unwanted or harmful biological effects related to the regulation of RNA or protein expression of genes other than their intended target nucleic acids.

[0167] "Oligomer" or "oligomer" refers to a polymer having interconnected monomeric subunits and capable of hybridizing with at least one region of a nucleic acid molecule.

[0168] "Oligonucleotide" refers to a polymer of nucleosides that are independently linked, either modified or unmodified.

[0169] "Non-enteric administration" means administration by injection (e.g., rapid concentration) or infusion. Non-enteric administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intraventricular administration.

[0170] The term "peptide" refers to a molecule consisting of at least two amino acids linked by an amide bond. In the absence of restriction, as used herein, "peptide" can refer to both polypeptides and proteins.

[0171] "Pharmaceutical agent" means a substance that provides therapeutic benefit when administered to an individual. For example, in some embodiments, an antisense oligonucleotide targeting the τ protein is a pharmaceutical agent.

[0172] "Pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may contain antisense oligonucleotides and a sterile aqueous solution.

[0173] "Pharmaceutically acceptable derivatives" encompass pharmaceutically acceptable salts, conjugates, prodrugs, or isomers of the compounds described herein.

[0174] "Pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of an antisense compound, that is, a salt that retains the desired biological activity of the parent oligonucleotide without conferring undesirable toxicological effects.

[0175] "Thiophosphate bond" refers to the bond between nucleosides, where the phosphodiester bond is modified by replacing a non-bridging oxygen atom with a sulfur atom. The thiophosphate bond is a modified nucleoside bond.

[0176] "Partial" refers to a defined number of consecutive (i.e., linked) nucleobases in a nucleic acid. In some embodiments, the partial refers to a defined number of consecutive nucleobases in the target nucleic acid. In some embodiments, the partial refers to a defined number of consecutive nucleobases in the antisense compound.

[0177] "Prevention" or "preventing" refers to delaying or preventing the onset or occurrence of a disease, symptom, or illness for a period of time ranging from minutes to days, weeks to months, or indefinitely.

[0178] "Prodrug" refers to a therapeutic agent prepared in an inactive form and converted into an active form (i.e., a drug) by endogenous enzymes or other chemicals and / or conditions within the body or its cells.

[0179] "Effective dose for prevention and treatment" refers to the amount of medicine or pharmaceutical agent that provides preventive or therapeutic benefits to animals.

[0180] A “region” is defined as a portion of the target nucleic acid that has at least one identifiable structure, function, or feature.

[0181] "Ribosonucleotide" refers to a nucleotide that has a hydroxyl group at the 2' position of the sugar portion of the nucleotide. Ribonucleotides can be modified by a variety of substituents.

[0182] "Salt" refers to a physiologically and pharmaceutically acceptable salt of an antisense compound, that is, a salt that maintains the desired biological activity of the parent oligonucleotide without conferring undesirable toxicological effects.

[0183] A “segment” is defined as a smaller part or sub-part of the target nucleic acid’s internal region.

[0184] The “shortened” or “truncated” forms of antisense oligonucleotides taught in this article have one, two, or more nucleoside deletions.

[0185] "Side effects" refers to physiological responses attributable to treatment that are other than the desired effect. In some implementations, side effects include, but are not limited to, injection site reactions, abnormal liver function tests, abnormal kidney function, liver toxicity, kidney toxicity, central nervous system abnormalities, and myopathy.

[0186] "Single-stranded oligonucleotide" refers to an oligonucleotide that has not hybridized with its complementary strand.

[0187] As used in this article, "site" is defined as a unique nucleobase position within the target nucleic acid.

[0188] "Slowing the progression" means reducing the rate of disease progression.

[0189] "Specific hybridization" refers to the fact that an antisense compound has sufficient complementarity between the antisense oligonucleotide and the target nucleic acid to induce the desired effect under physiological conditions where specific binding is required, i.e., in vivo analysis and therapeutic treatment, while exhibiting minimal or no effect on non-target nucleic acids.

[0190] "Strict hybridization conditions" or "strict conditions" refer to the conditions under which an oligomeric compound hybridizes with its target sequence, but with a very small number of other sequences of the target.

[0191] "Subject" refers to a human or non-human animal selected for treatment or therapy.

[0192] "Target" refers to the protein that needs to be regulated.

[0193] "Target gene" refers to the gene that encodes the target.

[0194] "Targeting" or "targeted" refers to the method of designing and selecting antisense compounds that will specifically hybridize with the target nucleic acid and induce the desired effect.

[0195] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all refer to nucleic acids that can be targeted by antisense compounds.

[0196] "Target region" refers to the portion of the target nucleic acid that is targeted by one or more antisense compounds.

[0197] "Target segment" refers to the nucleotide sequence in the target nucleic acid that is targeted by the antisense compound. "5' target site" refers to the 5' terminal nucleotide of the target segment. "3' target site" refers to the 3' terminal nucleotide of the target segment.

[0198] "τ protein" refers to mammalian microtubule-associated protein τ protein (MAPT), including human microtubule-associated protein τ protein (MAPT).

[0199] "Tau protein-related diseases" refers to any disease associated with any tau protein nucleic acid or its expression products. Such diseases can include neurodegenerative disorders. These neurodegenerative disorders can include tau protein lesions, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, and Dravet syndrome.

[0200] "τ protein mRNA" refers to any messenger RNA expression product that encodes the DNA sequence of the τ protein.

[0201] "τ protein nucleic acid" refers to any nucleic acid that encodes the τ protein. For example, in some embodiments, the τ protein nucleic acid includes a DNA sequence encoding the τ protein, an RNA sequence transcribed from DNA encoding the τ protein (including genomic DNA containing introns and exons), and an mRNA sequence encoding the τ protein. "τ protein mRNA" refers to the mRNA that encodes the τ protein.

[0202] "τ protein" refers to the polypeptide expression product of τ protein nucleic acid.

[0203] "Therapeutic effective dose" refers to the amount of therapeutic benefit that a medicine provides to an individual.

[0204] "Treatment" or "treating" refers to the application of a composition to alter or improve a disease or condition.

[0205] "Unmodified nucleobases" refers to purine bases adenine (A) and guanine (G), and pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0206] "Unmodified nucleotide" refers to a nucleotide consisting of a naturally occurring nucleobase, a sugar moiety, and a nucleoside bond. In some embodiments, the unmodified nucleotide is an RNA nucleotide (i.e., β-D-ribonucleoside) or a DNA nucleotide (i.e., β-D-deoxyribonucleoside).

[0207] "Pterion" refers to multiple modified nucleosides that endow oligonucleotides with properties such as enhanced inhibitory activity, enhanced binding affinity to target nucleic acids, or resistance to degradation caused by nucleases in vivo.

[0208] Some implementation schemes

[0209] Some embodiments provide methods, compounds, and compositions for inhibiting the expression of τ protein mRNA and protein. Some embodiments provide methods, compounds, and compositions for reducing the levels of τ protein mRNA and protein.

[0210] Some embodiments provide antisense compounds targeting the τ protein nucleic acid. In some embodiments, the τ protein nucleic acid is a sequence described in the following GENBANK accessions: GENBANK accession NT_010783.15, truncated from nucleotides 9240000 to 9381000 (incorporated herein as SEQ ID NO:1); GENBANK accession NM_001123066.3 (incorporated herein as SEQ ID NO:2); GENBANK accession NM_016841.4, a variant mRNA sequence skipping exons 3, 4, 6, 8, 10, and 12 (incorporated herein as SEQ ID NO:3); GENBANK accession NT_010783.14, truncated from nucleotides 2624000 to 2761000 (incorporated herein as SEQ ID NO:4); GENBANK accession DR002467.1 (incorporated herein as SEQ ID NO:4); GENBANK accession DR002467.1 (incorporated herein as SEQ ID NO:4). NO:5 is incorporated herein; GENBANK Registry No. NM_001203251.1 (incorporated herein as SEQ ID NO:6); and GENBANK Registry No. NM_016835.4 (incorporated herein as SEQ ID NO:7).

[0211] Some implementations provide methods for treating, preventing, or improving tau protein-related diseases, conditions, and symptoms in individuals in need. Methods for preparing pharmaceutical agents for treating, preventing, or improving tau protein-related diseases, conditions, or symptoms are also covered. Tau protein-related diseases, conditions, and symptoms include neurodegenerative diseases. In some implementations, tau protein-related diseases include tau protein lesions, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, or Dravet syndrome.

[0212] Some embodiments provide compounds comprising modified oligonucleotides, the modified oligonucleotides consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases from either of the nucleobase sequences SEQ ID NO:20-2443 and SEQ ID NO:2478-2483.

[0213] Some embodiments provide compounds comprising modified oligonucleotides, the modified oligonucleotides consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases from either of the nucleobase sequences SEQ ID NO:2444-2477 and SEQ ID NO:2484-2565.

[0214] Some embodiments provide compounds comprising modified oligonucleotides, the modified oligonucleotides consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases from any of the nucleobase sequences SEQ ID NO:20-2565.

[0215] Some embodiments provide compounds comprising modified oligonucleotides, the modified oligonucleotides consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to nucleobases 135783-135980 of SEQ ID NO:1.

[0216] Some embodiments provide compounds comprising modified oligonucleotides, the modified oligonucleotides consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to nucleobases 135853-135872 of SEQ ID NO:1.

[0217] Some embodiments provide compounds comprising modified oligonucleotides, the modified oligonucleotides consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to nucleobases 135783-135929 of SEQ ID NO:1.

[0218] Some embodiments provide compounds comprising modified oligonucleotides, the modified oligonucleotides consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to nucleobases 135783-135914 of SEQ ID NO:1.

[0219] In some embodiments, the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO:1 by at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.

[0220] In some embodiments, the compound is a single-stranded modified oligonucleotide.

[0221] In some embodiments, at least one nucleoside internucleotide in the modified oligonucleotide is a modified nucleoside internucleotide.

[0222] In some embodiments, at least one modified nucleoside inter-bond is a thiophosphate nucleoside inter-bond.

[0223] In some implementations, each modified nucleoside inter-bond is a phosphate thioside inter-bond.

[0224] In some embodiments, at least one nucleoside inter-bond is a phosphodiester nucleoside inter-bond.

[0225] In some embodiments, at least one internucleotide bond is a thiophosphate bond and at least one internucleotide bond is a phosphodiester bond.

[0226] In some embodiments, at least one nucleoside contains a modified nucleobase.

[0227] In some embodiments, the modified nucleobase is 5-methylcytosine.

[0228] In some embodiments, at least one nucleoside in the modified oligonucleotide contains a modified sugar.

[0229] In some embodiments, at least one modified sugar is a bicyclic sugar.

[0230] In some embodiments, the bicyclic sugar contains a chemical bond 4'-CH2-N(R)-O-2' bridge between the 2' and 4' positions of the sugar, wherein R is independently H, C1-C12 alkyl, or a protecting group.

[0231] In some embodiments, the bicyclic sugar contains a 4'-CH2-N(R)-O-2' bridge, wherein R is independently H, C1-C12 alkyl, or a protecting group.

[0232] In some embodiments, at least one modified sugar contains 2'-O-methoxyethyl.

[0233] In some embodiments, the modified sugar contains a 2'-O(CH2)2-OCH3 group.

[0234] In some implementations, the modified oligonucleotide comprises:

[0235] A spacer segment consisting of 10 linked deoxynucleotides;

[0236] The 5' wing consists of five linked nucleosides; and

[0237] The 3' wing consists of five linked nucleosides;

[0238] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0239] In some implementations, the modified oligonucleotide comprises:

[0240] A spacer segment consisting of nine linked deoxynucleotides;

[0241] The 5' wing consists of five linked nucleosides; and

[0242] The 3' wing consists of five linked nucleosides;

[0243] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0244] In some implementations, the modified oligonucleotide comprises:

[0245] A spacer segment consisting of 7 linked deoxynucleotides;

[0246] The 5' wing consists of five linked nucleosides; and

[0247] The 3' wing consists of six linked nucleosides;

[0248] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0249] In some implementations, the modified oligonucleotide comprises:

[0250] A spacer segment consisting of eight linked deoxynucleotides;

[0251] The 5' wing consists of five linked nucleosides; and

[0252] The 3' wing consists of five linked nucleosides;

[0253] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0254] In some implementations, the modified oligonucleotide comprises:

[0255] A spacer segment consisting of eight linked deoxynucleotides;

[0256] The 5' wing consists of four linked nucleosides; and

[0257] The 3' wing consists of six linked nucleosides;

[0258] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0259] In some implementations, the modified oligonucleotide comprises:

[0260] A spacer segment consisting of eight linked deoxynucleotides;

[0261] The 5' wing consists of six linked nucleosides; and

[0262] The 3' wing consists of four linked nucleosides;

[0263] The spacer segment is located between the 5' and 3' wings, and each nucleoside in each wing contains a modified sugar.

[0264] In some implementations, the modified oligonucleotide consists of 20 linked nucleosides.

[0265] In some implementations, the modified oligonucleotide consists of 19 linked nucleosides.

[0266] In some implementations, the modified oligonucleotide consists of 18 linked nucleosides.

[0267] Some embodiments provide a composition comprising at least one of any of the compounds described herein or their salts and a pharmaceutically acceptable carrier or diluent.

[0268] Some embodiments provide methods including administering any of the compounds or compositions described herein to animals.

[0269] In some embodiments, the animal is a human.

[0270] In some implementations, the compound is administered to prevent, treat, improve, or slow the progression of tau protein-related diseases, conditions, or symptoms.

[0271] In some implementations, the disease, condition, or symptom is tau protein lesion, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, or Dravet syndrome.

[0272] Some embodiments provide for the use of any of the compounds or compositions described herein in the manufacture of a medicament for the treatment of neurodegenerative conditions.

[0273] Some implementations provide compounds according to formula (Ia):

[0274]

[0275] Or a pharmaceutically acceptable salt thereof. In some embodiments, a pharmaceutical composition comprising a compound having the following formula (Ia) is provided.

[0276] Some implementations provide compounds according to formula (IIa):

[0277]

[0278] Or a pharmaceutically acceptable salt thereof. In some embodiments, a pharmaceutical composition comprising a compound having the following formula (IIa) is provided.

[0279] Some implementations provide compounds according to formula (IIIa):

[0280]

[0281] Or a pharmaceutically acceptable salt thereof. In some embodiments, a pharmaceutical composition comprising a compound having the following formula (IIIa) is provided.

[0282] Some implementations provide compounds according to the following formula (IVa):

[0283]

[0284] Or a pharmaceutically acceptable salt thereof. In some embodiments, a pharmaceutical composition comprising a compound having the following formula (IVa) is provided.

[0285] Some implementations provide compounds according to the following formula (Va):

[0286]

[0287] Or a pharmaceutically acceptable salt thereof. In some embodiments, a pharmaceutical composition comprising a compound having the following formula (Va) is provided.

[0288] Antisense compounds

[0289] Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleotide analogs, oligonucleotide mimics, antisense compounds, antisense oligonucleotides, and siRNA. Oligomeric compounds can be "antense" relative to the target nucleic acid, meaning they can hybridize with the target nucleic acid via hydrogen bonding.

[0290] In some embodiments, the antisense compound has a nucleobase sequence that contains the reverse complementary sequence of the target segment of its targeted nucleic acid when written in a 5' to 3' orientation. In some such embodiments, the antisense oligonucleotide has a nucleobase sequence that contains the reverse complementary sequence of the target segment of its targeted nucleic acid when written in a 5' to 3' orientation.

[0291] In some embodiments, the antisense compound targeting the τ protein nucleic acid is 12 to 30 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 12 to 25 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 12 to 22 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 14 to 20 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 15 to 25 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 18 to 22 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 19 to 21 subunits in length. In some embodiments, the antisense compound has a length of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 30, 18 to 50, 19 to 30, 19 to 50, or 20 to 30 connected subunits.

[0292] In some embodiments, the antisense compound targeting the τ protein nucleic acid is 12 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 13 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 14 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 15 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 16 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 17 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 18 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 19 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 20 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 21 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 22 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 23 subunits long. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 24 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 25 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 26 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 27 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 28 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 29 subunits in length. In some embodiments, the antisense compound targeting the τ protein nucleic acid is 30 subunits in length. In some implementations, the antisense compound targeting the τ protein nucleic acid has a length of 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits, or falls within the range defined by any two of the above values. In some implementations, the antisense compound is an antisense oligonucleotide, and the linked subunit is a nucleoside.

[0293] In some implementations, the antisense oligonucleotide targeting the τ protein nucleic acid can be a shortened or truncated antisense oligonucleotide. For example, a single subunit can be deleted from the 5' end (5' truncated) or from the 3' end (3' truncated). A shortened or truncated antisense compound targeting the τ protein nucleic acid may have two subunits deleted from the 5' end of the antisense compound, or two subunits deleted from the 3' end of the antisense compound. Alternatively, the deleted nucleosides can be distributed throughout the antisense compound, for example, in an antisense compound with one nucleoside deletion at the 5' end and one at the 3' end.

[0294] When a single additional subunit is present in an extended antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound with two subunits added at the 5' end (5' addition) or two subunits added at the 3' end (3' addition). Alternatively, the added subunits may be distributed throughout the entire antisense compound, for example, in an antisense compound with one subunit added at the 5' end and one subunit added at the 3' end.

[0295] It is possible to increase or decrease the length of antisense compounds, such as antisense oligonucleotides, and / or introduce mismatched bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), the ability of a series of antisense oligonucleotides of 13 to 25 nucleotides in length to induce target RNA cleavage in an oocyte injection model was tested. Antisense oligonucleotides of 25 nucleotides in length with 8 or 11 mismatched bases near the end of the antisense oligonucleotide were able to induce target mRNA-specific cleavage, but to a lesser extent than antisense oligonucleotides without mismatches. Similarly, target-specific cleavage can be achieved using antisense oligonucleotides of 13 nucleotides (including those with 1 or 3 mismatches).

[0296] Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches with bcl-xL mRNA has the ability to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide exhibits potent in vivo antitumor activity.

[0297] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem antisense oligonucleotides with 14 nucleotides, as well as antisense oligonucleotides with 28 and 42 nucleotides containing two or three of the tandem antisense oligonucleotides, to inhibit human DHFR translation in rabbit reticulocyte analysis. Each of the three 14-nucleotide antisense oligonucleotides individually inhibited translation, but to a lesser extent than the 28- or 42-nucleotide antisense oligonucleotides.

[0298] Antisense compound motif

[0299] In some implementations, the antisense compound targeting the τ protein nucleic acid has chemically modified subunits arranged in a specific pattern or motif to endow the antisense compound with properties such as enhanced inhibitory activity, enhanced binding affinity to the target nucleic acid, or resistance to degradation caused by in vivo nucleases.

[0300] Chimeric antisense compounds typically contain at least one modified region to confer enhanced resistance to nuclease degradation, increased cellular uptake, enhanced binding affinity to target nucleic acids, and / or enhanced inhibitory activity. The second region of the chimeric antisense compound may optionally serve as the acceptor of the cellular endonuclease ribonuclease H, which cleaves the RNA strand of the RNA:DNA double helix.

[0301] Antisense compounds with a spacer motif are considered chimeric antisense compounds. In a spacer, an internal region containing multiple nucleotides favorable for ribonuclease H cleavage is located between external regions containing multiple nucleotides chemically distinct from the nucleosides of the internal regions. In the case of antisense oligonucleotides with a spacer motif, the spacer segment generally serves as the acceptor for endonuclease cleavage, while the wings contain modified nucleosides. In some embodiments, the regions of the spacer are distinguished by the type of sugar moiety constituting each dissimilar region. The type of sugar moiety used to distinguish the regions of the spacer may, in some embodiments, include β-D-ribonucleosides, β-D-deoxyribonucleosides, nucleosides modified at the 2' position (such 2'-position modified nucleosides may particularly include 2'-MOE and 2'-O-CH3), and bicyclic sugar-modified nucleosides (such bicyclic sugar-modified nucleosides may include nucleosides having 4'-(CH2)nO-2' bridges (where n=1 or n=2) and 4'-CH2-O-CH2-2'). In some embodiments, the wing region may include several modified sugar moieties, including, for example, 2'-MOE. In some embodiments, the wing region may include several modified and unmodified sugar moieties. In some embodiments, the wing region may include various combinations of 2'-MOE nucleotides and 2'-deoxynucleotides.

[0302] Each dissimilar region may contain a homogeneous sugar motif, a variable or alternating sugar motif. The wing-spacer-wing motif is often described as “XYZ”, where “X” represents the length of the 5’ wing, “Y” represents the length of the spacer, and “Z” represents the length of the 3’ wing. “X” and “Z” may contain homogeneous, variable, or alternating sugar motifs. In some embodiments, “X” and “Y” may include one or more 2’-deoxynucleotides. “Y” may contain a 2’-deoxynucleotide. Spacers described herein as “XYZ” have a configuration such that the spacer is positioned adjacent to each of the 5’ and 3’ wings. Therefore, there are no intervening nucleotides between the 5’ wing and the spacer, or between the spacer and the 3’ wing. Any antisense compound described herein may have a spacer motif. In some embodiments, “X” and “Z” are the same; in other embodiments, they are different.

[0303] In some embodiments, the spacers provided herein comprise, for example, 20-mers having a motif of 5-10-5.

[0304] In some embodiments, the spacers provided herein include, for example, 19-mers having a motif of 5-9-5.

[0305] In some embodiments, the spacers provided herein comprise, for example, 18-mers having a motif of 5-8-5.

[0306] In some embodiments, the spacers provided herein comprise, for example, 18-mers having a motif of 4-8-6.

[0307] In some embodiments, the spacers provided herein include, for example, 18-mers having a motif of 6-8-4.

[0308] In some embodiments, the spacers provided herein comprise, for example, 18-mers having motifs 5-7-6.

[0309] Target nucleic acid, target region and nucleotide sequence

[0310] The nucleotide sequences encoding the τ protein include, but are not limited to, the following: GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000 (incorporated as SEQ ID NO:1); GENBANK accession number NM_001123066.3 (incorporated as SEQ ID NO:2); GENBANK accession number NM_016841.4, a variant mRNA sequence skipping exons 3, 4, 6, 8, 10, and 12 (incorporated as SEQ ID NO:3); GENBANK accession number NT_010783.14, truncated from nucleotides 2624000 to 2761000 (incorporated as SEQ ID NO:4); GENBANK accession number DR002467.1 (incorporated as SEQ ID NO:5); GENBANK accession number NM_001203251.1 (incorporated as SEQ ID NO:4); GENBANK accession number DR002467.1 (incorporated as SEQ ID NO:5); GENBANK accession number NM_001203251.1 (incorporated as SEQ ID NO:4). NO:6 is incorporated herein; and GENBANK Registry No. NM_016835.4 (incorporated herein as SEQ ID NO:7).

[0311] It should be understood that the sequence described in each of the examples contained herein is independent of any modification to the sugar moiety, nucleoside internucleotide, or nucleobase. Therefore, an antisense compound defined by SEQ ID NO may independently contain one or more modifications to the sugar moiety, nucleoside internucleotide, or nucleobase. Antisense compounds described by Isis No. indicate a combination of nucleobase sequence and motif.

[0312] In some implementations, the target region is a structurally defined region of the target nucleic acid. For example, the target region may encompass the 3' UTR, 5' UTR, exons, introns, exon / intron junctions, coding regions, translation initiation regions, translation termination regions, or other defined nucleic acid regions. The structurally defined regions of the τ protein may be obtained from accession numbers from sequence databases such as NCBI, and this information is incorporated herein by reference. In some implementations, the target region may encompass the sequence from the 5' target site of one target segment within the target region to the 3' target site of another target segment within the same target region.

[0313] Targeting involves identifying at least one target segment that hybridizes with an antisense compound, thereby producing the desired effect. In some embodiments, the desired effect is a reduction in the content of the target nucleic acid in mRNA. In some embodiments, the desired effect is a reduction in the content of the protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

[0314] The target region may contain one or more target segments. Multiple target segments within the target region may overlap. Alternatively, they may not overlap. In some embodiments, target segments within the target region are separated by up to about 300 nucleotides. In some embodiments, target segments within the target region are separated by a certain number of nucleotides on the target nucleic acid, the number being approximately, up to, or up to about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides, or a range defined by any two of the foregoing values. In some embodiments, target segments within the target region are separated by up to or up to about 5 nucleotides on the target nucleic acid. In some embodiments, the target segments are continuous. The target region encompasses the range of the starting nucleic acid having either a 5' target site or a 3' target site as listed herein.

[0315] Suitable target segments can exist within the 5' UTR, coding region, 3' UTR, introns, exons, or exon / intron junctions. Target segments containing start or stop codons are also suitable. Suitable target segments can especially exclude structurally defined regions, such as start or stop codons.

[0316] Identifying a suitable target segment may involve comparing the sequence of the target nucleic acid with other sequences throughout the genome. For example, the BLAST algorithm can be used to identify regions of similarity among different nucleic acids. This comparison prevents the selection of antisense compound sequences that may hybridize in a nonspecific manner with sequences other than the selected target nucleic acid (i.e., non-target or off-target sequences).

[0317] The activity of antisense compounds within the active target region (e.g., as defined by the percentage reduction in target nucleic acid content) may vary. In some embodiments, a decrease in τ protein mRNA content may indicate inhibition of τ protein expression. A decrease in τ protein content may also indicate inhibition of target mRNA expression. A decrease in the percentage of hyperphosphorylated τ protein-positive cells indicates inhibition of τ protein expression. Furthermore, phenotypic changes indicate inhibition of τ protein expression. Improvements in neurological function indicate inhibition of τ protein expression. Improvements in memory and motor function indicate inhibition of τ protein expression. A decrease in nerve fiber inclusions indicates inhibition of τ protein expression.

[0318] Hybridization

[0319] In some implementations, the antisense compounds disclosed herein hybridize with the τ protein nucleic acid. The most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases of the nucleic acid molecules (e.g., Watson-Crick, Hough, or anti-Hough hydrogen bonding).

[0320] Hybridization can be performed under different conditions. Strict conditions are sequence-dependent and determined by the properties and composition of the nucleic acid molecules to be hybridized.

[0321] Methods for determining whether a sequence can specifically hybridize with a target nucleic acid are well known in the art. In some embodiments, the antisense compounds provided herein can specifically hybridize with the nucleic acid of the τ protein.

[0322] Complementarity

[0323] When a sufficient number of nucleobases in an antisense compound can form hydrogen bonds with corresponding nucleobases in the target nucleic acid, thereby producing the desired effect (such as antisense inhibition of the target nucleic acid, such as τ protein nucleic acid), the antisense compound and the target nucleic acid are complementary to each other.

[0324] Non-complementary nucleobases between the antisense compound and the τ protein nucleic acid are permissible, provided that the antisense compound can still specifically hybridize with the target nucleic acid. Furthermore, the antisense compound can hybridize on one or more segments of the τ protein nucleic acid, therefore, the insertion into or adjacent segments does not involve hybridization events (e.g., loop structures, mismatches, or hairpin structures).

[0325] In some embodiments, the antisense compound provided herein, or a designated portion thereof, has at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity with the τ protein nucleic acid, the target region, the target segment, or a designated portion thereof. The percentage of complementarity between the antisense compound and the target nucleic acid can be determined using conventional methods.

[0326] For example, in an antisense compound, 18 out of 20 nucleosides are complementary to the target region, and therefore specific hybridization will indicate 90% complementarity. In this example, the remaining non-complementary nucleosides may cluster or alternate with complementary nucleosides and do not need to be adjacent to each other or to complementary nucleosides. Thus, an antisense compound of 18 nucleosides in length with 4 (four) non-complementary nucleosides flanked by two regions that are completely complementary to the target nucleic acid will have 77.8% overall complementarity with the target nucleic acid and is therefore within the scope of this invention. The percentage of complementarity between the antisense compound and the target nucleic acid region can be conventionally determined using the BLAST (basic local alignment search tool) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). The percentages of homology, sequence identity, or complementarity can be determined, for example, using the Gap program (Wisconsin Sequence Analysis Package, version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) with preset settings, using the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

[0327] In some embodiments, the antisense compound or a designated portion thereof provided herein is completely complementary (i.e., 100% complementary) to the target nucleic acid or a designated portion thereof. For example, the antisense compound may be completely complementary to the τ protein nucleic acid or its target region, segment, or sequence. As used herein, “completely complementary” means that each nucleobase of the antisense compound is able to accurately pair with the corresponding nucleobase of the target nucleic acid. For example, an antisense compound having 20 nucleobases is completely complementary to a target sequence of 400 nucleobases, provided that a corresponding portion of the target nucleic acid having 20 nucleobases is completely complementary to the antisense compound. Complete complementarity may also be used for designated portions of the first and / or second nucleic acids. For example, a 20-nucleobase portion of a 30-nucleobase antisense compound may be “completely complementary” to a target sequence of 400 nucleobases. An oligonucleotide with 30 nucleosides has a 20-nucleobase portion that is completely complementary to the target sequence if the target sequence also has a 20-nucleobase portion, where each nucleobase is complementary to the corresponding 20-nucleobase portion of the antisense compound. However, the entire 30-nucleobase antisense compound may or may not be completely complementary to the target sequence, depending on whether the remaining 10 nucleosides of the antisense compound are also complementary to the target sequence.

[0328] The non-complementary nucleobase may be located at the 5' or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobase may be located in an internal position within the antisense compound. When two or more non-complementary nucleobases are present, they may be continuous (i.e., linked) or discontinuous. In one embodiment, the non-complementary nucleobase is located in the wing of the spacer antisense oligonucleotide.

[0329] In some embodiments, antisense compounds of length of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides contain at most 4, 3, 2, or 1 non-complementary nucleotides relative to the target nucleic acid (such as τ protein nucleic acid) or a designated portion thereof.

[0330] In some embodiments, antisense compounds of length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides contain at most 6, 5, 4, 3, 2, or 1 non-complementary nucleotides relative to the target nucleic acid (such as τ protein nucleic acid) or a designated portion thereof.

[0331] The antisense compounds provided herein also include antisense compounds complementary to a portion of the target nucleic acid. As used herein, “portion” refers to a defined number of consecutive (i.e., linked) nucleobases within a region or segment of the target nucleic acid. “Portion” may also refer to a defined number of consecutive nucleobases in the antisense compound. In some embodiments, the antisense compound is complementary to a portion of the target segment having at least 8 nucleobases. In some embodiments, the antisense compound is complementary to a portion of the target segment having at least 9 nucleobases. In some embodiments, the antisense compound is complementary to a portion of the target segment having at least 10 nucleobases. In some embodiments, the antisense compound is complementary to a portion of the target segment having at least 11 nucleobases. In some embodiments, the antisense compound is complementary to a portion of the target segment having at least 12 nucleobases. In some embodiments, the antisense compound is complementary to a portion of the target segment having at least 13 nucleobases. In some embodiments, the antisense compound is complementary to a portion of the target segment having at least 14 nucleobases. In some embodiments, the antisense compound is complementary to a portion of the target segment having at least 15 nucleobases. It also covers antisense compounds that are partially complementary to the target segment having at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobases (or the range defined by any two of these values).

[0332] consistency

[0333] The antisense compounds described herein may also have a defined percentage of identity with a specific nucleotide sequence SEQ ID NO or a compound or portion thereof represented by a specific Isis number. As used herein, an antisense compound is considered identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, RNA containing uracil but not thymidine in a disclosed DNA sequence will be considered identical to the DNA sequence because both uracil and thymidine pair with adenine. Shortened and extended forms of the antisense compounds described herein, as well as compounds with inconsistent bases relative to the antisense compounds provided herein, are also covered. Inconsistent bases may be adjacent to each other or scattered throughout the antisense compound. The percentage of identity of an antisense compound is calculated based on the number of bases with consistent base pairings relative to the sequence it is compared with.

[0334] In some embodiments, the antisense compound or a portion thereof has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% similarity to one or more antisense compounds disclosed herein or to a portion thereof.

[0335] In some embodiments, a portion of the antisense compound is compared to an equal-length portion of the target nucleic acid. In some embodiments, a portion having 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides is compared to an equal-length portion of the target nucleic acid.

[0336] In some embodiments, a portion of the antisense oligonucleotide is compared to an equal-length portion of the target nucleic acid. In some embodiments, a portion having 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides is compared to an equal-length portion of the target nucleic acid.

[0337] Modification

[0338] Nucleosides are base-sugar combinations. The nucleobase (also called the base) portion of a nucleoside is typically a heterocyclic base portion. A nucleotide is a nucleoside that further includes a phosphate ester group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include pentofuranosyl sugars, the phosphate ester group may be linked to the 2', 3', or 5' hydroxyl portion of the sugar. Oligonucleotides are formed by the covalent bonding of adjacent nucleosides to each other to form linear polymeric oligonucleotides. Within the oligonucleotide structure, the phosphate ester group is generally considered as an internucleotide bond forming the oligonucleotide.

[0339] Modification of antisense compounds encompasses the substitution or alteration of nucleoside bonds, sugar moieties, or nucleobases. Modified antisense compounds are often superior to their native forms due to desired properties such as enhanced cellular uptake, increased affinity for nucleic acid targets, enhanced stability in the presence of nucleases, or enhanced inhibitory activity.

[0340] Chemically modified nucleosides can also be used to enhance the binding affinity of shortened or truncated antisense oligonucleotides to their target nucleic acids. Therefore, similar results can often be obtained with shorter antisense compounds containing such chemically modified nucleosides.

[0341] Modified nucleoside interbonds

[0342] The naturally occurring nucleoside bonds in RNA and DNA are 3' to 5' phosphodiester bonds. Compared to antisense compounds with naturally occurring nucleoside bonds, antisense compounds with one or more modified (i.e., non-naturally occurring) nucleoside bonds are often preferred due to their desired properties (such as enhanced cellular uptake, enhanced affinity for target nucleic acids, and enhanced stability in the presence of nucleases).

[0343] Oligonucleotides with modified nucleoside bonds include those retaining a phosphorus atom and those without a phosphorus atom. Representative phosphorus-containing nucleoside bonds include, but are not limited to, phosphate diesters, phosphate triesters, methylphosphonates, aminophosphates, and thiophosphates. Methods for preparing phosphorus-containing and phosphorus-free bonds are well known.

[0344] In some embodiments, the antisense compound targeting the τ protein nucleic acid comprises one or more modified nucleoside internucleotides. In some embodiments, the modified nucleoside internucleotides are dispersed throughout the antisense compound. In some embodiments, the modified nucleoside internucleotides are phosphate thioester bonds. In some embodiments, each nucleoside internucleotide of the antisense compound is a phosphate thioester nucleoside internucleotide.

[0345] Modified sugar portion

[0346] The antisense compound may optionally contain one or more nucleosides in which the glycosyl group has been modified. Such a modified glycosyl group can confer on the antisense compound enhanced nuclease stability, enhanced binding affinity, or other beneficial biological properties. In some embodiments, the nucleoside comprises a chemically modified furanose ring moiety. Examples of chemically modified furanose rings include, but are not limited to, the addition of substituents (including 5' and 2' substituents; non-homogeneous ring bridging to form a bicyclic nucleic acid (BNA); and ribosyl epoxide atoms with S, N(R) or C(R1)(R2) (R, R1, and R2 are each independently H, C1-C). 12 Alkyl or protecting group substitution; and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleosides (for other disclosed nucleosides with double substitution at the 5' and 2' positions, see PCT International Application WO 2008 / 101157, published August 21, 2008); or ribosyl epoxy atom substituted with S and further substituted at the 2' position (see U.S. Patent Application US2005-0130923, published June 16, 2005); or substitution at the 5' position of BNA (see PCT International Application WO 2007 / 134181, published November 22, 2007, wherein LNA is substituted, for example, with 5'-methyl or 5'-vinyl).

[0347] Examples of nucleosides having modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R- or S-type), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, and 2'-O(CH2)2OCH3 substituents. The substituent at the 2' position may also be selected from allyl, amino, azide, thio, O-alkyl, O-C1-C... 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R) m(R) n O-CH2-C(=O)-N(R) m (R) n ) and O-CH2-C(=O)-N(R l )-(CH2)2-N(R m (R) n ), where each R l R m and R n Independently H or substituted or unsubstituted C1-C 10 alkyl.

[0348] As used herein, “bicyclic nucleoside” refers to a modified nucleoside comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, nucleosides comprising a bridging group between the 4' and 2' ribosyl ring atoms. In some embodiments, the antisense compounds provided herein comprise one or more bicyclic nucleosides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, one of the following: 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' and 4'-CH(CH2OCH3)-O-2' (and analogues thereof, see U.S. Patent 7,399,845, issued July 15, 2008); 4'-C(CH3)(CH3)-O-2' (and analogues thereof, see... International application published January 8, 2009 (WO / 2009 / 006478); 4'-CH2-N(OCH3)-2' (and similar applications, see international application published December 11, 2008 (WO / 2008 / 150729); 4'-CH2-ON(CH3)-2' (see U.S. patent application published September 2, 2004 (US2004-0171570); 4'-CH2-N(R)-O-2', wherein R is H, Cl-C 12 Alkyl or protecting group (see U.S. Patent 7,427,672, issued September 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' (and its analogues, see International Application WO 2008 / 154401, published December 8, 2008).

[0349] Other reports related to bicyclic nucleosides can also be found in published literature (see, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahllestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication Nos. US2008-0039618; US2009-0012281; U.S. Patent Serial Nos. 60 / 989,574; 61 / 026,995; 61 / 026,998; 61 / 056,564; 61 / 086,231; 61 / 097,787; and 61 / 099,844; Publication of PCT International Application WO WO 2004 / 106356; WO 2005 / 021570; WO 2007 / 134181; WO 2008 / 150729; WO 2008 / 154401; and WO 2009 / 006478. Each of the above bicyclic nucleosides can be prepared to have one or more stereochemical sugar configurations, including, for example, α-L-ribofranose and β-D-ribofranose (see PCT International Application PCT / DK98 / 00393, published March 25, 1999, as WO99 / 14226).

[0350] In some embodiments, the bicyclic sugar moiety of BNA nucleotide includes, but is not limited to, compounds having at least one bridging group between the 4' and 2' positions of the pentofuranosyl sugar moiety, wherein such bridging group independently comprises one or two to four linking groups independently selected from: -[C(R a(R) b )] n -、-C(R a )=C(R b )-、-C(R a ) = N-, -C(=O)-, -C(=NR) a -, -C(=S)-, -O-, -Si(R) a )2-、-S(=O) x -and-N(R) a )-;

[0351] in:

[0352] x is 0, 1, or 2;

[0353] n is 1, 2, 3 or 4;

[0354] Each R a and R b Independently, it is H, protecting group, hydroxyl group, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic, substituted heterocyclic, heteroaryl, substituted heteroaryl, C5-C7 alicyclic, substituted C5-C7 alicyclic, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfinyl (S(=O)-J1); and

[0355] Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl or protecting group.

[0356] In some embodiments, the bridging group of the bicyclic sugar moiety is -[C(Ra (R) b )] n -、-[C(R a (R) b )] n -O-、-C(R a R b -N(R)-O- or -C(R) a R b )-ON(R)-. In some embodiments, the bridging base is 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2'-, wherein each R is independently H, a protecting group or Cl-C. 12 alkyl.

[0357] In some embodiments, the bicyclic nucleoside is further defined by isomer configuration. For example, a nucleoside containing a 4'-2'-methylene-oxy-bridged group may be in the α-L or β-D configuration. α-L-methyleneoxy(4'-CH2-O-2')BNA has previously been incorporated into antisense oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0358] In some embodiments, the bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy(4'-CH2-O-2')BNA; (B) β-D-methyleneoxy(4'-CH2-O-2')BNA; (C) ethyleneoxy(4'-(CH2)2-O-2')BNA; (D) aminooxy(4'-CH2-ON(R)-2')BNA; and (E) oxyamino(4'-CH2-N(R)-O-2') BNA; and (F) methyl(methyleneoxy)(4'-CH(CH3)-O-2')BNA; (G) methylene-thio(4'-CH2-S-2')BNA; (H) methylene-amino(4'-CH2-N(R)-2')BNA; (I) methylcarbocyclic(4'-CH2-CH(CH3)-2')BNA; and (J) propylenecarbocyclic(4'-(CH2)3-2')BNA, as described below.

[0359]

[0360] Where Bx is the base moiety and R is independently H, a protecting group, or C1-C. 12 alkyl.

[0361] In some embodiments, a bicyclic nucleoside having Formula I is provided:

[0362]

[0363] in:

[0364] Bx represents the heterocyclic base moiety;

[0365] -Q a -Q b -Q c -for-CH2-N(R) c -CH2-, -C(=O)-N(R) c -CH2-, -CH2-ON(R) c )-、-CH2-N(R c -O- or -N(R) c )-O-CH2;

[0366] R c For C1-C 12 Alkyl or amino protecting groups; and

[0367] T a and T b Each can be independently an H, a hydroxyl protecting group, a binding group, a reactive phosphorus group, a phosphorus moiety, or a covalently linked group with the supporting medium.

[0368] In some embodiments, a bicyclic nucleoside having formula II is provided:

[0369]

[0370] in:

[0371] Bx represents the heterocyclic base moiety;

[0372] T a and T b Each can be independently an H, a hydroxyl protecting group, a binding group, a reactive phosphorus group, a phosphorus moiety, or a covalent linker with the supporting medium;

[0373] Z a It can be a C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.

[0374] In one embodiment, each substituted group is independently mono- or poly-substituted by a substituent selected from the following: halogen, side oxygen, hydroxyl, OJ c NJ c J d SJ c N3, OC (=X)Jc and NJ e C(=X)NJ c J d , where each J c J d and J e Independently H, C1-C6 alkyl, or substituted C1-C6 alkyl and X is O or NJ c .

[0375] In some embodiments, a bicyclic nucleoside having formula III is provided:

[0376]

[0377] in:

[0378] Bx represents the heterocyclic base moiety;

[0379] T a and T b Each can be independently an H, a hydroxyl protecting group, a binding group, a reactive phosphorus group, a phosphorus moiety, or a covalent linker with the supporting medium;

[0380] Z b It is a C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(=O)-).

[0381] In some embodiments, a bicyclic nucleoside having formula IV is provided:

[0382]

[0383] in:

[0384] Bx represents the heterocyclic base moiety;

[0385] T a and T b Each can be independently an H, a hydroxyl protecting group, a binding group, a reactive phosphorus group, a phosphorus moiety, or a covalent linker with the supporting medium;

[0386] R d It is a C1-C6 alkyl, a substituted C1-C6 alkyl, a C2-C6 alkenyl, a substituted C2-C6 alkenyl, a C2-C6 ynyl or a substituted C2-C6 ynyl;

[0387] Each q a q b q c and q dIndependently, it is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl or substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl;

[0388] In some embodiments, a bicyclic nucleoside having formula V is provided:

[0389]

[0390] in:

[0391] Bx represents the heterocyclic base moiety;

[0392] T a and T b Each can be independently an H, a hydroxyl protecting group, a binding group, a reactive phosphorus group, a phosphorus moiety, or a covalent linker with the supporting medium;

[0393] q a q b q e and q f Each is independently hydrogen, halogen, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C1-C 12 Alkoxy, substituted C1-C 12 Alkoxy, OJ j SJ j SOJ j SO2J j NJ j J k N3, CN, C(=O)OJ j C(=O)NJ j J k C(=O)J j OC(=O)NJ j J k 、N(H)C(=NH)NJ j J k 、N(H)C(=O)NJ j J k Or N(H)C(=S)NJ j J k ;

[0394] or qe Together with q f Together = C(q) g )(q h );

[0395] q g and q h Each is independently H, halogen, C1-C 12 Alkyl or substituted C1-C 12 alkyl.

[0396] The synthesis and preparation of the methyleneoxy(4'-CH2-O-2')BNA monomers adenine, cytosine, guanine, 5-methylcytosine, thymine, and uracil, as well as their oligomerization and nucleic acid recognition properties, have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNA and its preparation are also described in WO 98 / 39352 and WO 99 / 14226.

[0397] Analogs of methyleneoxy (4'-CH2-O-2')BNA and 2'-thio-BNA have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). The preparation of locked nucleoside analogs constituting the acceptor oligodeoxyribonucleotide double helix as a nucleic acid polymerase has also been described (Wengel et al., WO 99 / 14226). Furthermore, the synthesis of 2'-amino-BNA (a novel configuration-restricted high-affinity oligonucleotide analog) has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). Additionally, 2'-amino-BNA and 2'-methylamino-BNA have been prepared, and their thermal stability with complementary RNA and DNA strands of the double helix has been previously reported.

[0398] In some embodiments, a bicyclic nucleoside having formula VI is provided:

[0399]

[0400] in:

[0401] Bx represents the heterocyclic base moiety;

[0402] T a and T b Each can be independently an H, a hydroxyl protecting group, a binding group, a reactive phosphorus group, a phosphorus moiety, or a covalent linker with the supporting medium;

[0403] Each q i q j q kand q l Independently H, halogen, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C1-C 12 Alkoxy, substituted C1-C 12 Alkoxy, OJ j SJ j SOJ j SO2J j NJ j J k N3, CN, C(=O)OJ j C(=O)NJ j J k C(=O)J j OC(=O)NJ j J k 、N(H)C(=NH)NJ j J k 、N(H)C(=O)NJ j J k Or N(H)C(=S)NJ j J k ;and

[0404] q i Together with q j or q l Together with q k Together = C(q) g )(q h ), where q g and q h Each is independently H, halogen, C1-C 12 Alkyl or substituted C1-C 12 alkyl.

[0405] A carbocyclic bicyclic nucleoside with a 4'-(CH2)3-2' bridge and an alkenyl analog (i.e., a bridging group 4'-CH=CH-CH2-2') has been described (Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides, as well as their oligomerization and biochemical studies, have also been described (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0406] As used in this article, “4'-2' bicyclic nucleoside” or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside containing a furanose ring with a bridge connecting the two carbon atoms (i.e., the 2' and 4' carbon atoms connecting the sugar ring).

[0407] As used herein, "monocyclic nucleoside" refers to a nucleoside that includes a modified sugar moiety that is not a bicyclic sugar moiety. In some embodiments, the sugar moiety of the nucleoside or its analogues may be modified or substituted at any position.

[0408] As used herein, "2'-modified sugar" refers to a furanyl sugar modified at the 2' position. In some embodiments, such modification includes substituents selected from: including but not limited to halogens, substituted and unsubstituted alkoxy groups, substituted and unsubstituted thioalkyl groups, substituted and unsubstituted aminoalkyl groups, substituted and unsubstituted alkyl groups, substituted and unsubstituted allyl groups, and substituted and unsubstituted alkynyl groups. In some embodiments, the 2'-position modification is selected from, including but not limited to, substituents such as O[(CH2)]. n O] m CH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n F, O(CH2) n ONH2, OCH2C(=O)N(H)CH3 and O(CH2) n ON[(CH2) n [CH3]2, where n and m are 1 to about 10. Other 2'-substituents may also be selected from: C1-C 12Alkyl, substituted alkyl, alkenyl, alkynyl, alkylaryl, aralkyl, O-alkylaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclic alkyl, heterocyclic alkylaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, group that improves pharmacokinetic properties, or group that improves the pharmacodynamic properties of antisense compounds, and other substituents with similar properties. In some embodiments, the modified nucleoside comprises a 2'-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). This 2'-MOE substitution has been described as improving binding affinity compared to unmodified nucleosides and other modified nucleosides (such as 2'-O-methyl, O-propyl, and O-aminopropyl). Oligonucleotides with 2'-MOE substituents have also been shown to be antisense inhibitors of gene expression and have promising characteristics for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

[0409] As used herein, “modified tetrahydropiperanoid nucleotide” or “modified THP nucleotide” refers to a nucleotide having a six-membered tetrahydropiperanoid “sugar” (sugar substitute) that replaces a pentafuranose residue in a common nucleotide. Modified THP nucleotides include, but are not limited to, those known in the art as hexanoic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), fluoroHNA (F-HNA), or those having formula VII:

[0410]

[0411] Independently for each of the at least one tetrahydropiperanoside analogues of formula VII:

[0412] Bx represents the heterocyclic base moiety;

[0413] T a and T b Each independently involves attaching a tetrahydropiperanoid nucleoside analog to the nucleoside internucleotide group of an antisense compound, or T a and Tb One of them involves attaching a tetrahydropiperanoid nucleoside analog to the nucleoside internucleotide group of an antisense compound, and T... a and T b The other one is H, a hydroxyl protecting group, a linked binding group, or a 5' or 3' terminal group;

[0414] q1, q2, q3, q4, q5, q6 and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and each R1 and R2 is selected from hydrogen, hydroxyl, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein X is O, S or NJ1, and each J1, J2 and J3 are independently H or C1-C6 alkyl.

[0415] In some embodiments, a modified THP nucleoside of formula VII is provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In some embodiments, a THP nucleoside of formula VII is provided, wherein one of R1 and R2 is fluorine. In some embodiments, R1 is fluorine and R2 is H; R1 is methoxy and R2 is H; and R1 is H and R2 is methoxyethoxy.

[0416] As used herein, "modified at the 2' position" or "substituted at the 2' position" refers to nucleosides containing a substituent at the 2' position other than H or OH. Modified nucleosides at the 2' position include, but are not limited to, bicyclic nucleosides with bridging groups connecting two carbon atoms of the sugar ring, bicyclic nucleosides connecting the 2' carbon of the sugar ring to another carbon, and nucleosides with non-bridging 2' substituents such as allyl, amino, azide, thio, O-allyl, O-Cl-C 10 Alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-ON(R) m (R) n ) or O-CH2-C(=O)-N(R m (R) n ), where each R m and R n Independently H or substituted or unsubstituted C1-C 10 Alkyl group. Nucleosides modified at the 2' position may further include other modifications, for example, at other positions on the sugar and / or on the nucleobase.

[0417] As used in this article, "2'-F" refers to a nucleoside containing a fluorine group at the 2' position.

[0418] As used herein, “2’-OMe”, “2’-OCH3”, or “2’-O-methyl” each refer to a nucleoside of a sugar containing a -OCH3 group at the 2’ position of the sugar ring.

[0419] As used herein, “MOE”, “2'-MOE”, “2'-OCH2CH2OCH3”, or “2'-O-methoxyethyl” each refer to a nucleotide of a sugar containing a -OCH2CH2OCH3 group at the 2' position of the sugar ring.

[0420] As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In some embodiments, one or more of the nucleosides are modified. In some embodiments, the oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

[0421] Many other bicyclic and tricyclic sugar substitute ring systems are also known in the art and can be used to modify nucleosides incorporated into antisense compounds (see, for example, review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854).

[0422] Various additional substitutions can be made to this ring system to enhance its activity.

[0423] Methods for preparing modified sugars are well known to those skilled in the art.

[0424] In nucleotides with modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) remain capable of hybridizing with appropriate nucleic acid targets.

[0425] In some embodiments, the antisense compound comprises one or more nucleosides having a modified sugar moiety. In some embodiments, the modified sugar moiety is 2'-MOE. In some embodiments, the 2'-MOE-modified nucleoside is arranged within the spacer motif. In some embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH3)-O-2') bridging group. In some embodiments, the (4'-CH(CH3)-O-2')-modified nucleoside is arranged throughout the wing region of the spacer motif.

[0426] Composition and method of preparing pharmaceutical composition

[0427] Antisense oligonucleotides can be mixed with pharmaceutically acceptable active or inert substances to prepare pharmaceutical compositions or formulations. The composition and the method of preparing the pharmaceutical composition depend on many guidelines, including but not limited to the route of administration, disease severity, or dosage.

[0428] Antisense compounds targeting the τ protein nucleic acid can be used in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. Pharmaceutically acceptable diluents include phosphate-buffered saline (PBS). PBS is suitable for compositions not delivered enterically. Therefore, in one embodiment, a pharmaceutical composition comprising an antisense compound targeting the τ protein nucleic acid and a pharmaceutically acceptable diluent is used in the methods described herein. In some embodiments, the pharmaceutically acceptable diluent is PBS. In some embodiments, the antisense compound is an antisense oligonucleotide.

[0429] Pharmaceutical compositions containing antisense compounds encompass any pharmaceutically acceptable salt, ester, or salt of such ester, or any other oligonucleotide, that provides (directly or indirectly) its biologically active metabolites or residues when administered to animals (including humans). Thus, for example, this disclosure also describes pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0430] Prodrugs may include additional nucleosides incorporated at one or both ends of an antisense compound, which can be cleaved by endogenous nucleases in vivo to form an active antisense compound.

[0431] Combined antisense compounds

[0432] Antisense compounds can be covalently linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the resulting antisense oligonucleotide. Typical binding groups include cholesterol and lipid moieties. Other binding groups include carbohydrates, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinones, acridine, fluorescein, rhodamine, coumarin, and dyes.

[0433] Antisense compounds may also be modified to have one or more stabilizing groups, which are generally attached to one or both ends of the antisense compound to enhance properties such as nuclease stability. Cap structures are included in the stabilizing groups. These end modifications protect antisense compounds with terminal nucleic acids from exonuclease degradation and can facilitate delivery and / or localization within cells. The cap may be present at the 5' end (5' cap) or the 3' end (3' cap), or at both ends. Cap structures are well known in the art and include, for example, inverted deoxy-base-free caps. Additionally, 3' and 5' stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO03 / 004602, published January 16, 2003.

[0434] Cell culture and antisense compound treatment

[0435] The effects of antisense compounds on the content, activity, or expression of τ protein nucleic acids can be tested in vitro in various cell types. Cell types used for this analysis are available from commercial suppliers (e.g., American Type Culture Collection, Manassus, VA; Zen-Bio, Research Triangle Park, NC; Clonetics, Walkersville, MD) and cultured using commercially available reagents (e.g., Invitrogen Life Technologies, Carlsbad, CA) according to the supplier's instructions. Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes.

[0436] In vitro testing of antisense oligonucleotides

[0437] This article describes a method for treating cells with antisense oligonucleotides, which can be appropriately modified for use with other antisense compounds.

[0438] When the cells reach approximately 60% to 80% confluence during culture, they can be treated with antisense oligonucleotides.

[0439] One commonly used reagent for introducing antisense oligonucleotides into cultured cells is the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Antisense oligonucleotides can be mixed with liposomes in OPTI-MEM1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotides and liposome concentrations ranging from 2 to 12 μg / mL per 100 nM antisense oligonucleotides.

[0440] Another reagent used to introduce antisense oligonucleotides into cultured cells includes lipofectamine (Invitrogen, Carlsbad, CA). Antisense oligonucleotides can be mixed with lipofectamine in OPTI-MEM 1 serum-reduced medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotides and lipofectamine concentrations ranging from 2 to 12 μg / mL per 100 nM antisense oligonucleotides.

[0441] Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

[0442] Cells are treated with antisense oligonucleotides using conventional methods. Cells can be collected 16 to 24 hours after antisense oligonucleotide treatment, at which time the RNA or protein content of the target nucleic acid is measured using methods known in the art and described herein. Generally, when the treatment is performed in multiple replicates, the data are presented as the average of the replicates.

[0443] The concentration of antisense oligonucleotides used varies between cell lines. Methods for determining the optimal concentration of antisense oligonucleotides for a particular cell line are well known in the art. When transfecting with lipoamine, concentrations of antisense oligonucleotides in the range of 1 nM to 300 nM are typically used. When transfecting using electroporation, higher concentrations of antisense oligonucleotides in the range of 625 nM to 20,000 nM are used.

[0444] RNA isolation

[0445] RNA analysis can be performed on total cellular RNA or poly(adenosine monophosphate)+ mRNA. Methods for RNA isolation are well-known in the art. RNA is prepared using methods well-known in the art, such as TRIZOL reagents (Invitrogen, Carlsbad, CA), according to the manufacturer's recommended protocol.

[0446] Analyze the inhibitory effect on target content or expression.

[0447] The inhibitory effect on the content or expression of τ protein nucleic acids can be analyzed in a variety of ways known in the art. For example, the content of the target nucleic acid can be quantified by, for example, Northern ink dot assay, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(adenylated)+ mRNA. Methods for RNA isolation are well known in the art. Northern ink dot assay is also routine in the art. Quantitative real-time PCR can be conveniently performed using commercially available ABI PRISM 7600, 7700, or 7900 sequence detection systems (available from PE-Applied Biosystems, Foster City, CA and used according to the manufacturer's instructions).

[0448] Quantitative real-time PCR analysis of target RNA content

[0449] The content of target RNA can be quantified by quantitative real-time PCR using an ABI PRISM 7600, 7700, or 7900 sequence detection system (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Quantitative real-time PCR methods are well known in the art.

[0450] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction to produce complementary DNA (cDNA), which is then used as the acceptor for real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are available from Invitrogen (Carlsbad, CA). The RT real-time PCR reaction is performed using methods well known to those skilled in the art.

[0451] The gene (or RNA) target levels obtained by real-time PCR were corrected using the expression levels of genes with constant expression (such as cyclophilin A) or by quantifying total RNA using RIBOGREEN (Invitrogen, Carlsbad, CA). Cyclophilin A expression was quantified by real-time PCR, either simultaneously with, in combination with, or separately from the target. Total RNA was quantified using the RIBOGREEN RNA quantification reagent (Invitrogen, Eugene, OR). Methods for quantifying RNA using RIBOGREEN are taught in Jones, LJ et al. (Analytical Biochemistry, 1998, 265, 368-374). RIBOGREEN fluorescence was measured using a CYTOFLUOR 4000 instrument (PE Applied Biosystems).

[0452] The probes and primers are designed to hybridize with the τ protein nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art and may include the use of software such as PRIMER EXPRESS software (Applied Biosystems, Foster City, CA).

[0453] Analysis of protein content

[0454] Antisense inhibition of τ protein nucleic acid can be assessed by measuring τ protein content. τ protein content can be assessed or quantified using a variety of methods well-known in the art, such as precipitation assays, Western ink dot assays (immunomodulation), enzyme-linked immunosorbent assays (ELISA), quantitative protein analysis, protein activity assays (e.g., caspasin activity assays), immunohistochemistry, immunocytochemistry, or fluorescence activated cell sorting (FACS). Antibodies targeting the target can be identified and obtained from various sources, such as the MSRS Antibody Catalog (Aerie, Birmingham, MI), or can be prepared using conventional monoclonal or multiclonal antibody production methods well-known in the art.

[0455] In vivo testing of antisense compounds

[0456] Antisense compounds, such as antisense oligonucleotides, are tested in animals to assess their ability to inhibit tau protein expression and produce phenotypic changes (such as improvements in cognitive and motor function). In some embodiments, cognition is measured by novel object recognition and nest-building behavior. In some embodiments, motor function is measured in animals by walking priming analysis, pole rotation, grip strength, pole climbing, open field expression, balance beam, and hind paw footprint tests. In some embodiments, antisense compounds, such as antisense oligonucleotides, are tested in animals to assess their ability to reduce hyperphosphorylated tau protein and neurofibrillary tangles. In some embodiments, antisense compounds, such as antisense oligonucleotides, are tested to assess their ability to prevent seizures and / or reduce seizure severity in a PTZ-induced seizure model.

[0457] The antisense oligonucleotides can be tested in normal animals or in experimental disease models. For animal administration, the antisense oligonucleotides are prepared in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes non-enteral routes, such as intraperitoneal, intravenous, and subcutaneous. The dosage and frequency of administration of the antisense oligonucleotides are calculated within the capabilities of those skilled in the art and depend on factors such as the route of administration and animal body weight. After a period of treatment with the antisense oligonucleotides, RNA is isolated from CNS tissues or CSF, and changes in τ protein nucleic acid expression are measured.

[0458] Certain indications

[0459] In some embodiments, this document provides methods, compounds, and compositions for treating an individual, comprising administering one or more of the pharmaceutical compositions described herein. In some embodiments, the individual suffers from a neurodegenerative disease. In some embodiments, the individual is at risk of developing a neurodegenerative disease, including but not limited to tau protein lesions, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, and Dravet syndrome. In some embodiments, the individual has been identified as having a tau protein-related disease. In some embodiments, this document provides methods for preventively reducing tau protein expression in an individual. Some embodiments include treating the individual in need by administering to the individual a therapeutically effective amount of an antisense compound targeting tau protein nucleic acid.

[0460] In one implementation, administration of a therapeutically effective amount of an antisense compound targeting the τ protein nucleic acid is accompanied by monitoring the τ protein level in the individual to determine the individual's response to the administration of the antisense compound. The individual's response to the administration of the antisense compound can be used by a physician to determine the amount and duration of the therapeutic intervention.

[0461] In some embodiments, administration of an antisense compound targeting the τ protein nucleic acid results in a reduction of τ protein expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or within a range defined by any two of these values. In some embodiments, administration of an antisense compound targeting the τ protein nucleic acid results in improved motor function in the animal. In some implementations, the administration of the tau protein antisense compound improves motor function by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or within a range defined by any two of these values.

[0462] In some embodiments, a pharmaceutical composition comprising an antisense compound targeting the tau protein is used to prepare an agent for treating patients suffering from or susceptible to neurodegenerative diseases, including tau protein lesions, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, and Dravet syndrome.

[0463] Some hotspots

[0464] 1. Nucleotides 135783-135980 of SEQ ID NO:1

[0465] In some embodiments, the antisense oligonucleotide is designed to target nucleotides 135783-135980 of SEQ ID NO:1 (GENBANK Registry No. NT_010783.15, truncated from nucleotides 9240000 to 9381000). In some embodiments, nucleotides 135783-135980 are hotspot regions. In some embodiments, nucleotides 135783-135980 are targeted by the antisense oligonucleotide. In some embodiments, the antisense oligonucleotide is 18, 19, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotide is a spacer. In some embodiments, the spacer is a 5-10-5 MOE spacer, a 5-9-5 MOE spacer, a 5-7-6 MOE spacer, and a 5-8-5 MOE spacer. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphate thioester nucleoside internucleotide bonds. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphodiester nucleosides. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphate thioester and phosphodiester nucleotides (e.g., the antisense oligonucleotide has a "mixed backbone").

[0466] In some implementations, nucleobases 135783-135980 are targeted by the following ISIS numbers: 424879, 424880, 548937, 613114-613120, 622096-622150, 623988-623996, 664511-664542, and 664661-664819.

[0467] In some implementations, nucleobases 135783-135980 are targeted by the following SEQ ID NOs: 56, 57, 248, 462-467, 1668-1698, 2025-2048, 2301-2309, 2331-2443 and 2478-2483.

[0468] In some embodiments, antisense oligonucleotides targeting nucleobases 135783-135980 achieve a reduction in the content of τ protein mRNA and / or protein in vitro and / or in vivo by at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, and at least 47%. At least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, or at least 93%.

[0469] 2. Nucleotides 135853-135872 of SEQ ID NO:1

[0470] In some embodiments, the antisense oligonucleotide is designed to target nucleotides 135853-135872 of SEQ ID NO:1 (GENBANK Registry No. NT_010783.15, truncated from nucleotides 9240000 to 9381000). In some embodiments, nucleotides 135853-135872 are hotspot regions. In some embodiments, nucleotides 135853-135872 are targeted by the antisense oligonucleotide. In some embodiments, the antisense oligonucleotide is 18, 19, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotide is a spacer. In some embodiments, the spacer is a 5-10-5 MOE spacer, a 5-9-5 MOE spacer, a 5-7-6 MOE spacer, or a 5-8-5 MOE spacer. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphate thioester nucleoside internucleotide bonds. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphodiester nucleosides. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphate thioester and phosphodiester nucleotides (e.g., the antisense oligonucleotide has a "mixed backbone").

[0471] In some implementations, nucleobases 135853-135872 are targeted by the following ISIS numbers: 424879, 424880, 613117, 613118, 622114-622125, 623993-623996, 664522-664542, 664676-664713, 664729-664766, and 664783-664819.

[0472] In some implementations, nucleobases 135853-135872 are targeted by the following SEQ ID NOs: 56, 57, 248, 464-465, 1668-1673, 2039-2048, 2306-2309, 2345-2443, and 2478-2483.

[0473] In some embodiments, antisense oligonucleotides targeting nucleobases 135853-135872 achieve a reduction in the content of τ protein mRNA and / or protein in vitro and / or in vivo by at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, or at least 56%. At least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, or at least 87%.

[0474] 3. Nucleotides 135783-135929 of SEQ ID NO:1

[0475] In some embodiments, the antisense oligonucleotide is designed to target nucleotides 135783-135929 of SEQ ID NO:1 (GENBANK Registry No. NT_010783.15, truncated from nucleotides 9240000 to 9381000). In some embodiments, nucleotides 135783-135929 are hotspot regions. In some embodiments, nucleotides 135783-135929 are targeted by the antisense oligonucleotide. In some embodiments, the antisense oligonucleotide is 18, 19, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotide is a spacer. In some embodiments, the spacer is a 5-10-5 MOE spacer, a 5-9-5 MOE spacer, a 5-7-6 MOE spacer, or a 5-8-5 MOE spacer. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphate thioester nucleoside internucleotide bonds. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphodiester nucleosides. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphate thioester and phosphodiester nucleotides (e.g., the antisense oligonucleotide has a "mixed backbone").

[0476] In some implementations, nucleobases 135783-135929 are targeted by the following ISIS numbers: 424879, 424880, 548937, 613114-613119, 622096-622138, 623988-623996, 664511-664542, and 664661-664819.

[0477] In some implementations, nucleobases 135783-135929 are targeted by the following SEQ ID NOs: 56, 57, 248, 462-466, 1668-1686, 2025-2048, 2301-2309, 2331-2443, and 2478-2483.

[0478] In some embodiments, antisense oligonucleotides targeting nucleobases 135783-135929 achieve a reduction in the content of τ protein mRNA and / or protein in vitro and / or in vivo by at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, and at least 47%. At least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, or at least 93%.

[0479] 4. Nucleotides 135783-135914 of SEQ ID NO:1

[0480] In some embodiments, the antisense oligonucleotide is designed to target nucleotides 135783-135914 of SEQ ID NO:1 (GENBANK Registry No. NT_010783.15, truncated from nucleotides 9240000 to 9381000). In some embodiments, nucleotides 135783-135914 are hotspot regions. In some embodiments, nucleotides 135783-135914 are targeted by the antisense oligonucleotide. In some embodiments, the antisense oligonucleotide is 18, 19, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotide is a spacer. In some embodiments, the spacer is a 5-10-5 MOE spacer, a 5-9-5 MOE spacer, a 5-7-6 MOE spacer, or a 5-8-5 MOE spacer. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphate thioester nucleoside internucleotide bonds. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphodiester nucleosides. In some embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphate thioester and phosphodiester nucleotides (e.g., the antisense oligonucleotide has a "mixed backbone").

[0481] In some implementations, nucleobases 135783-135914 are targeted by the following ISIS numbers: 424879, 424880, 548937, 613114-613119, 622096-622133, 623988-623996, 664511-664542, and 664661-664819.

[0482] In some implementations, nucleobases 135783-135914 are targeted by the following SEQ ID NOs: 56, 57, 248, 462-466, 1668-1681, 2025-2048, 2301-2309, 2331-2443, and 2478-2483.

[0483] In some implementations, nucleobases 135783-135914 are targeted by the following ISIS numbers: 424879, 424880, 548937, 613114-613119, 622096-622133 and 623988-623996.

[0484] In some implementations, nucleobases 135783-135914 are targeted by the following SEQ ID NOs: 56, 57, 248, 462-466, 1668-1681, 2025-2048, and 2301-2309.

[0485] In some embodiments, antisense oligonucleotides targeting nucleobases 135783-135914 achieve a reduction in the content of τ protein mRNA and / or protein in vitro and / or in vivo by at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, and at least 47%. At least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, or at least 93%.

[0486] The embodiments of various aspects provided by the present invention are also described in any of the following paragraphs.

[0487] Implementation Scheme 1. A compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NO:20-2443 and SEQ ID NO:2478-2483.

[0488] Implementation Scheme 2. The compound of Implementation Scheme 1, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NO:446, 313, 321, 1634 and 2309.

[0489] Implementation Scheme 3. The compound of Implementation Scheme 1, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases comprising SEQ ID NO:446.

[0490] Implementation Scheme 4. The compound of Implementation Scheme 1, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases comprising SEQ ID NO:313.

[0491] Implementation Scheme 5. The compound of Implementation Scheme 1, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases comprising SEQ ID NO:321.

[0492] Implementation Scheme 6. The compound of Implementation Scheme 1, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases comprising SEQ ID NO:1634.

[0493] Implementation Scheme 7. The compound of Implementation Scheme 1, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases comprising SEQ ID NO:2309.

[0494] Implementation Scheme 8. A compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NO:2444-2477 and SEQ ID NO:2484-2565.

[0495] Implementation Scheme 9. A compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases of any of the nucleobase sequences SEQ ID NO:20-2565.

[0496] Implementation Scheme 10. A compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases complementary to nucleobases 135783-135980 of SEQ ID NO:1.

[0497] Implementation Scheme 11. A compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases complementary to nucleobases 135853-135872 of SEQ ID NO:1.

[0498] Implementation Scheme 12. A compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases complementary to nucleobases 135783-135929 of SEQ ID NO:1.

[0499] Implementation Scheme 13. A compound comprising a modified oligonucleotide, said modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases complementary to nucleobases 135783-135914 of SEQ ID NO:1.

[0500] Implementation Scheme 14. The compound as described in Implementation Schemes 4-7, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO:1 by at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.

[0501] Implementation Scheme 15. A compound as described in any of the previous implementation schemes, which consists of a single-stranded modified oligonucleotide.

[0502] Implementation Scheme 16. The compound as described in any of the previous embodiments, wherein at least one nucleoside inter-bond is a modified nucleoside inter-bond.

[0503] Implementation Scheme 17. The compound as described in Implementation Scheme 16, wherein at least one modified nucleoside inter-bond is a thiophosphate nucleoside inter-bond.

[0504] Implementation Scheme 18. The compound as described in Implementation Scheme 16, wherein each modified nucleoside inter-bond is a thiophosphate nucleoside inter-bond or a phosphate diester nucleoside inter-bond.

[0505] Implementation Scheme 19. The compound of any one of Implementation Schemes 1 to 18, wherein at least one nucleoside inter-bond is a phosphodiester nucleoside inter-bond.

[0506] Implementation Scheme 20. The compound according to any one of Implementation Schemes 1 to 18, wherein the two nucleoside bonds are phosphodiester nucleoside bonds.

[0507] Implementation Scheme 21. The compound according to any one of Implementation Schemes 1 to 18, wherein the three nucleoside inter-bonds are phosphodiester nucleoside inter-bonds.

[0508] Implementation Scheme 22. The compound according to any one of Implementation Schemes 1 to 18, wherein the four internucleotide bonds are phosphodiester internucleotide bonds.

[0509] Implementation Scheme 23. The compound according to any one of Implementation Schemes 1 to 18, wherein the five nucleoside inter-bonds are phosphodiester nucleoside inter-bonds.

[0510] Implementation Scheme 24. The compound according to any one of Implementation Schemes 1 to 18, wherein the six internucleotide bonds are phosphodiester internucleotide bonds.

[0511] Implementation Scheme 25. The compound according to any one of Implementation Schemes 1 to 18, wherein at least six nucleoside inter-bonds are phosphodiester nucleoside inter-bonds.

[0512] Implementation Scheme 26. The compound as described in any of the previous embodiments, wherein at least one nucleoside inter-bond is a thiophosphate bond and at least one nucleoside inter-bond is a phosphodiester bond.

[0513] Implementation Scheme 27. The compound of any one of Implementation Schemes 1 to 17, wherein each modified nucleoside inter-bond is a thiophosphate nucleoside inter-bond.

[0514] Implementation Scheme 28. A compound as described in any of the previous embodiments, wherein at least one nucleoside comprises a modified nucleobase.

[0515] Implementation Scheme 29. The compound as described in Implementation Scheme 28, wherein the modified nucleobase is 5-methylcytosine.

[0516] Implementation Scheme 30. The compound as described in any of the previous embodiments, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

[0517] Implementation Scheme 31. The compound as described in Implementation Scheme 30, wherein the at least one modified sugar is a bicyclic sugar.

[0518] Implementation Scheme 32. The compound of Implementation Scheme 31, wherein the bicyclic sugar comprises a chemical bond 4'-CH2-N(R)-O-2' bridge between the 2' and 4' positions of the sugar, wherein R is independently H, C1-C12 alkyl or protecting group.

[0519] Implementation Scheme 33. The compound of Implementation Scheme 31, wherein the bicyclic sugar comprises a 4'-CH2-N(R)-O-2' bridge, wherein R is independently H, C1-C12 alkyl or protecting group.

[0520] Implementation Scheme 34. The compound of Implementation Scheme 31, wherein at least one modified sugar comprises 2'-O-methoxyethyl.

[0521] Implementation Scheme 35. The compound of Implementation Scheme 31, wherein the modified sugar comprises a 2'-O(CH2)2-OCH3 group.

[0522] Implementation Scheme 36. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0523] A spacer segment consisting of 10 linked deoxynucleotides;

[0524] The 5' wing consists of five linked nucleosides; and

[0525] The 3' wing consists of five linked nucleosides;

[0526] The spacer segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar.

[0527] Implementation Scheme 37. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0528] A spacer segment consisting of nine linked deoxynucleotides;

[0529] The 5' wing consists of five linked nucleosides; and

[0530] The 3' wing consists of five linked nucleosides;

[0531] The spacer segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar.

[0532] Implementation Scheme 38. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0533] A spacer segment consisting of 7 linked deoxynucleotides;

[0534] The 5' wing consists of five linked nucleosides; and

[0535] The 3' wing consists of six linked nucleosides;

[0536] The spacer segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar.

[0537] Implementation Scheme 39. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0538] A spacer segment consisting of eight linked deoxynucleotides;

[0539] The 5' wing consists of five linked nucleosides; and

[0540] The 3' wing consists of five linked nucleosides;

[0541] The spacer segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar.

[0542] Implementation Scheme 40. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0543] A spacer segment consisting of eight linked deoxynucleotides;

[0544] The 5' wing consists of four linked nucleosides; and

[0545] The 3' wing consists of six linked nucleosides;

[0546] The spacer segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar.

[0547] Implementation Scheme 41. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide comprises:

[0548] A spacer segment consisting of eight linked deoxynucleotides;

[0549] The 5' wing consists of six linked nucleosides; and

[0550] The 3' wing consists of four linked nucleosides;

[0551] The spacer segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar.

[0552] Implementation Scheme 42. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0553] Implementation Scheme 43. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide consists of 19 linked nucleosides.

[0554] Implementation Scheme 44. The compound as described in any of the previous embodiments, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0555] Implementation Scheme 45. A composition comprising at least one of a compound as described in any of the previous embodiments or a salt thereof and a pharmaceutically acceptable carrier or diluent.

[0556] Implementation Scheme 46. A method comprising administering to an animal a compound or composition as described in any of the previous implementation schemes.

[0557] Implementation Scheme 47. The method as described in Implementation Scheme 46, wherein the animal is a human.

[0558] Implementation Scheme 48. The method of Implementation Scheme 46, wherein the compound is administered to prevent, treat, improve, or slow the progression of τ protein-related diseases, conditions, or symptoms.

[0559] Implementation Scheme 49. The method as described in Implementation Scheme 48, wherein the disease, condition or symptom is tau protein lesion, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy or Dravet syndrome.

[0560] Implementation Scheme 50. The method as described in Implementation Scheme 48, wherein the disease, symptom, or condition is Alzheimer's disease.

[0561] Implementation Scheme 51. Use of the compound or composition as described in any of the previous embodiments, which is for the manufacture of a medicament for the treatment of neurodegenerative diseases, conditions, or symptoms.

[0562] Implementation Scheme 52. The use as described in Implementation Scheme 51, wherein the disease, condition or symptom is tau protein lesion, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy or Dravet syndrome.

[0563] Implementation Scheme 53. The use as described in Implementation Scheme 51, wherein the disease, symptom, or condition is Alzheimer's disease.

[0564] Implementation Scheme 54. The compound or composition as described in any one of Implementation Schemes 1-46 is for the treatment of neurodegenerative diseases, conditions or symptoms.

[0565] Implementation Scheme 55. The compound or composition as described in Implementation Scheme 54, wherein the disease, condition or symptom is tau protein lesion, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy or Dravet syndrome.

[0566] Implementation Scheme 56. The compound or composition as described in Implementation Scheme 54, wherein the disease, symptom or condition is τ protein lesion, Alzheimer's disease.

[0567] Implementation Scheme 57. A compound comprising ISIS 613099.

[0568] Implementation scheme 58. A compound comprising ISIS 613361.

[0569] Implementation Scheme 59. A compound comprising ISIS 613370.

[0570] Implementation Scheme 60. A compound comprising ISIS 623782.

[0571] Implementation Scheme 61. A compound comprising ISIS 623996.

[0572] Implementation Scheme 62. A compound comprising modified oligonucleotides according to the following formula: Ges Aeo TeoAeo Teo Tds Ads Tds mCds mCds Tds Tds Tds Gds Ads Geo mCeo mCes Aes mCe; wherein,

[0573] A = adenine,

[0574] mC = 5'-methylcytosine

[0575] G = Guanine,

[0576] T = thymine,

[0577] e=2'-O-methoxyethyl modified nucleosides

[0578] d = 2'-deoxynucleotide, and

[0579] o = phosphate diester nucleoside bond, and

[0580] s = thiophosphate nucleoside bond.

[0581] Implementation Scheme 63. A compound comprising modified oligonucleotides according to the following formula: Aes mCeo AeomCeo Aeo mCds mCds Tds Tds mCds Ads Tds Tds Tds Ads mCeo Teo Ges Tes mCe; wherein,

[0582] A = adenine,

[0583] mC = 5'-methylcytosine

[0584] G = Guanine,

[0585] T = thymine,

[0586] e=2'-O-methoxyethyl modified nucleosides

[0587] d = 2'-deoxynucleotide, and

[0588] o = phosphate diester nucleoside bond, and

[0589] s = thiophosphate nucleoside bond.

[0590] Implementation Scheme 64. A compound comprising a modified oligonucleotide according to the following formula: Ges Geo TeoTeo Teo Tds mCds Ads Ads Ads mCds Ads mCds Ads mCds mCeo Teo Tes mCes Ae; wherein,

[0591] A = adenine,

[0592] mC = 5'-methylcytosine

[0593] G = Guanine,

[0594] T = thymine,

[0595] e=2'-O-methoxyethyl modified nucleosides

[0596] d = 2'-deoxynucleotide,

[0597] o = phosphate diester nucleoside bond, and

[0598] s = thiophosphate nucleoside bond.

[0599] Implementation Scheme 65. A compound comprising modified oligonucleotides according to the following formula: mCes mCeo GeoTeo Tes Tds Tds mCds Tds Tds Ads mCds mCds Aeo mCeo mCes mCes Te; wherein,

[0600] A = adenine,

[0601] mC = 5'-methylcytosine

[0602] G = Guanine,

[0603] T = thymine,

[0604] e=2'-O-methoxyethyl modified nucleosides

[0605] d = 2'-deoxynucleotide,

[0606] o = phosphate diester nucleoside bond, and

[0607] s = thiophosphate nucleoside bond.

[0608] Implementation Scheme 66. A compound comprising modified oligonucleotides according to the following formula: Aes Aeo TeoTeo Tes Gds mCds Tds mCds Tds Tds Ads mCds Teo mCeo mCes mCes Ae; wherein,

[0609] A = adenine,

[0610] mC = 5'-methylcytosine

[0611] G = Guanine,

[0612] T = thymine,

[0613] e=2'-O-methoxyethyl modified nucleosides

[0614] d = 2'-deoxynucleotide,

[0615] o = phosphate diester nucleoside bond, and

[0616] s = thiophosphate nucleoside bond.

[0617] Implementation Scheme 67. A composition comprising at least one of a compound or a salt thereof as described in any one of Implementation Schemes 57-66 and a pharmaceutically acceptable carrier or diluent.

[0618] Implementation Scheme 68. A method comprising administering to an animal a compound or composition as described in any one of Implementation Schemes 57-66.

[0619] Implementation Scheme 69. The method as described in Implementation Scheme 68, wherein the animal is a human.

[0620] Implementation Scheme 70. The method as described in Implementation Scheme 67 or 68, wherein the compound is administered to prevent, treat, improve, or slow the progression of τ protein-related diseases, conditions, or symptoms.

[0621] Implementation Scheme 71. The method as described in Implementation Scheme 70, wherein the disease, condition or symptom is tau protein lesion, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy or Dravet syndrome.

[0622] Implementation Scheme 72. The method as described in Implementation Scheme 71, wherein the disease, symptom, or condition is Alzheimer's disease.

[0623] Implementation Scheme 73. Use of the compound or composition as described in any one of Implementation Schemes 57-66, for the manufacture of a medicament for the treatment of neurodegenerative diseases.

[0624] Implementation Scheme 74. The use as described in Implementation Scheme 73, wherein the neurodegenerative condition is tau protein lesion, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, or Dravet syndrome.

[0625] Implementation Scheme 75. The use as described in Implementation Scheme 73, wherein the neurodegenerative condition is Alzheimer's disease.

[0626] Implementation Scheme 76. The compound or composition as described in any one of Implementation Schemes 1-45 or 57-66 is for the treatment of neurodegenerative diseases.

[0627] Implementation Scheme 77. A compound or composition for treating neurodegenerative disorders as described in any one of Implementation Schemes 1-45 or 57-66, wherein the neurodegenerative disorder is selected from tau protein lesions, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglia degeneration (CBD), epilepsy, or Dravet syndrome.

[0628] Implementation Scheme 78. The compound or composition as described in any one of Implementation Schemes 1-45 or 57-66 is for the treatment of Alzheimer's disease.

[0629] Example

[0630] Non-restrictive disclosure and inclusion by reference

[0631] While certain compounds, compositions, and methods described herein have been specifically described according to certain embodiments, the following examples are illustrative only and are not intended to be limiting. Each reference mentioned in this application is incorporated herein by reference in its entirety.

[0632] Example 1: Antisense inhibition of human τ protein in HepG2 cells by MOE spacers

[0633] Antisense oligonucleotides targeting the τ protein nucleic acid were designed and their effects on τ protein mRNA were tested in vitro. HepG2 cells were transfected with 100 nM antisense oligonucleotides using a lipid transfection reagent. After a treatment period of approximately 24 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. The human primer-probe set RTS3104 (forward sequence AAGATTGGGTCCCTGGACAAT, designated as SEQ ID NO:10; reverse sequence AGCTTGTGGGTTTCAATCTTTTTATT, designated as SEQ ID NO:11; probe sequence CACCCACGTCCCTGGCGGA, designated as SEQ ID NO:12) was used to measure mRNA levels. [The remaining text appears to be a fragmented and incomplete sentence, possibly due to OCR errors. A more accurate translation would require the full context.] Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells.

[0634] The newly designed chimeric antisense oligonucleotides in the table below are designed as 5-10-5 MOE spacers. The spacers are 20 nucleotides in length, with the central spacer containing 10 2'-deoxynucleotides and flanked by wings each containing 5 nucleotides in the 5' and 3' directions. Each nucleotide in the 5' and 3' wings is 2'-MOE modified. The internucleotide bonds throughout each spacer are phosphate thioester bonds. All cytosine residues throughout each spacer are 5-methylcytosine. The "start site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 5' end. The "stop site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 3' end. Each spacer listed in Table 1 below targets either the human τ protein genome sequence designated herein as SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000) or the human τ protein mRNA sequence designated herein as SEQ ID NO:2 (GENBANK accession number NM_001123066.3). 'n / a' indicates that the oligonucleotide does not target the gene sequence with 100% complementarity. The sequences listed in Table 2 do not target SEQ ID NO:1 or 2 with 100% complementarity, but instead target either SEQ ID NO:3 (GENBANK accession number NM_016841.4, a variant mRNA sequence skipping exons 3, 4, 6, 8, 10, and 12) or SEQ ID NO:4 (GENBANK accession number NT_010783.14, truncated from nucleotides 2624000 to 2761000).

[0635] Table 1

[0636] Inhibition of τ protein mRNA by the 5-10-5 MOE spacer targeting SEQ ID NO:1 and 2

[0637]

[0638]

[0639] Table 2

[0640] Inhibition of τ protein mRNA by the 5-10-5 MOE spacer targeting SEQ ID NO:3 and 4

[0641]

[0642] Example 2: Dose-dependent antisense inhibition of human τ protein in HepG2 cells by 5-10-5 MOE spacers

[0643] Spacers from the aforementioned studies that exhibited significant in vitro inhibition of τ protein mRNA were selected and tested in HepG2 cells at various doses. Cells were plated at a density of 10,000 cells per well and transfected using lipid transfection reagents with antisense oligonucleotides at concentrations of 12.5 nM, 25.0 nM, 50.0 nM, 100.0 nM, or 200.0 nM as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer and probe set RTS3104. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells. In cells treated with antisense oligonucleotides, τ protein mRNA content was significantly reduced in a dose-dependent manner.

[0644] Table 3

[0645]

[0646] Example 3: Antisense inhibition of human τ protein in SH-SY5Y cells by 5-10-5 MOE spacers

[0647] Additional antisense oligonucleotides targeting the τ protein nucleic acid were designed and their effects on τ protein mRNA were tested in vitro. The antisense oligonucleotides were tested in a series of experiments under similar culture conditions. Results for each experiment are presented in separate tables shown below. Cultured SH-SY5Y cells were transfected with 7,000 nM antisense oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer and probe set RTS3104. Results were obtained as shown below. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells.

[0648] The newly designed chimeric antisense oligonucleotides in the table below are designed as 5-10-5 MOE spacers. The spacers are 20 nucleotides in length, with the central spacer containing 10 2'-deoxynucleotides and flanked by wings each containing 5 nucleotides in the 5' and 3' directions. Each nucleotide in the 5' and 3' wings is 2'-MOE modified. The internucleotide bonds throughout each spacer are phosphate thioester bonds. All cytosine residues throughout each spacer are 5-methylcytosine. The "start site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 5' end. The "stop site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 3' end. Each spacer listed in the table below targets either the human τ protein genome sequence designated herein as SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000) or the human τ protein mRNA sequence designated herein as SEQ ID NO:2 (GENBANK accession number NM_001123066.3). 'n / a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

[0649] Table 4

[0650]

[0651]

[0652]

[0653] Table 5

[0654]

[0655]

[0656]

[0657] Example 4: Dose-dependent antisense inhibition of human τ protein in SH-SY5Y cells by 5-10-5 MOE spacers

[0658] Spacers from the aforementioned studies that exhibited significant in vitro inhibition of τ protein mRNA were selected and tested in SH-SY-5Y cells at various doses. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 1.25 μM, 2.50 μM, 5.00 μM, 10.00 μM, and 20.00 μM as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer and probe set RTS3104. According to... Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells. In cells treated with antisense oligonucleotides, τ protein mRNA content was significantly reduced in a dose-dependent manner.

[0659] Table 6

[0660]

[0661] Example 5: Antisense inhibition of human τ protein in SH-SY5Y cells by 5-10-5 MOE spacers

[0662] Additional antisense oligonucleotides targeting the τ protein nucleic acid were designed, and their effects on τ protein mRNA were tested in vitro. Cultured SH-SY5Y cells were plated at a density of 20,000 cells per well and transfected with 6,000 nM antisense oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells, and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer and probe set RTS3104. [The remaining text appears to be incomplete and requires further context.] Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells.

[0663] The newly designed chimeric antisense oligonucleotides in the table below are designed as 5-10-5 MOE spacers. Each spacer is 20 nucleotides in length, with a central spacer containing 10 2'-deoxy nucleotides and flanked by wings each containing 5 nucleotides in the 5' and 3' directions. Each nucleotide in the 5' wings and each nucleotide in the 3' wings is modified with 2'-MOE. The internucleotide bonds throughout each spacer are phosphate thioester bonds. All cytosine residues throughout each spacer are 5-methylcytosine. "Start site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 5'. "Termination site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 3'. Each spacer listed in the table below targets the human τ protein genome sequence designated herein as SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000).

[0664] Table 7

[0665]

[0666]

[0667]

[0668]

[0669] Example 6: Dose-dependent antisense inhibition of human τ protein in SH-SY5Y cells by 5-10-5 MOE spacers

[0670] Spacers from the aforementioned studies that exhibited significant in vitro inhibition of τ protein mRNA were selected and tested in SH-SY-5Y cells at various doses. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 0.625 μM, 1.25 μM, 2.500 μM, 5.00 μM, 10.00 μM, and 20.00 μM as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer and probe set RTS3104. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells. In cells treated with antisense oligonucleotides, τ protein mRNA content was significantly reduced in a dose-dependent manner.

[0671] Table 8

[0672]

[0673] Example 7: Antisense inhibition of human τ protein in SH-SY5Y cells by MOE spacers with thiophosphate and phosphodiester nucleoside bonds.

[0674] Antisense oligonucleotides targeting the τ protein nucleic acid were designed and their effects on τ protein mRNA were tested in vitro. The antisense oligonucleotides were tested in a series of experiments under similar culture conditions. Results for each experiment are presented in separate tables shown below. Cultured SH-SY5Y cells were transfected with 8,000 nM antisense oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer and probe set RTS3104. Results were obtained as shown below. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells.

[0675] The newly designed chimeric antisense oligonucleotides in the table below are designed as 5-10-5 MOE spacers. The spacers are 20 nucleotides in length, with a central spacer containing 10 2'-deoxy nucleotides and flanked by wings each containing 5 nucleotides in the 5' and 3' directions. Each nucleotide in the 5' and 3' wings is 2'-MOE modified. The internucleotide bonds throughout each spacer are either phosphate thioester or phosphodiester bonds. All cytosine residues throughout each spacer are 5-methylcytosine. The 'Chemistry' row describes the internucleotide bonds of each oligonucleotide. 's' indicates a phosphate thioester bond and 'o' indicates a phosphodiester bond. The 'start site' indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 5'. The 'stop site' indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 3'.

[0676] Each spacer listed in the table below targets the human τ protein genome sequence designated herein as SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000), or the human τ protein mRNA sequence designated herein as SEQ ID NO:2 (GENBANK accession number NM_001123066.3) or SEQ ID NO:3 (GENBANK accession number NM_016841.4). Several oligonucleotides presented in Tables 10, 12, and 16 target variant mRNA sequences designated herein as SEQ ID NO:5 (GENBANK accession number DR002467.1), SEQ ID NO:6 (GENBANK accession number NM_001203251.1), or SEQ ID NO:7 (GENBANK accession number NM_016835.4). Oligonucleotides are presented in the various tables based on the major gene sequence to which they target with 100% complementarity. 'n / a' indicates that the antisense oligonucleotide does not target that specific gene sequence with 100% complementarity.

[0677] Table 9

[0678] Inhibition of τ protein mRNA by 5-10-5 MOE spacers containing thiophosphate and phosphodiester nucleoside internucleotide bonds targeting SEQ ID NO:1 and 3

[0679]

[0680]

[0681] Table 10

[0682] Inhibition of τ protein mRNA by 5-10-5 MOE spacers containing thiophosphate and phosphodiester nucleoside internucleotide bonds targeting SEQ ID NO:5 and 6

[0683]

[0684] Table 11

[0685] Inhibition of τ protein mRNA by 5-10-5 MOE spacers containing thiophosphate and phosphodiester nucleoside internucleotide bonds targeting SEQ ID NO:1 and 3

[0686]

[0687]

[0688]

[0689] Table 12

[0690] Inhibition of τ protein mRNA by 5-10-5 MOE spacers containing thiophosphate and phosphodiester nucleoside internucleotide bonds targeting SEQ ID NO:6 and 7

[0691]

[0692] Table 13

[0693] Inhibition of τ protein mRNA by 5-10-5 MOE spacers containing thiophosphate and phosphodiester nucleoside internucleotide bonds targeting SEQ ID NO:1 and 3

[0694]

[0695]

[0696]

[0697] Table 14

[0698] Inhibition of τ protein mRNA by 5-10-5 MOE spacers containing thiophosphate and phosphodiester nucleoside internucleotide bonds targeting SEQ ID NO:1 and 3

[0699]

[0700]

[0701]

[0702] Table 15

[0703] Inhibition of τ protein mRNA by 5-10-5 MOE spacers containing thiophosphate and phosphodiester nucleoside internucleotide bonds targeting SEQ ID NO:1 and 3

[0704]

[0705]

[0706] Table 16

[0707] Inhibition of τ protein mRNA by 5-10-5 MOE spacers containing thiophosphate and phosphodiester nucleoside internucleotide bonds targeting SEQ ID NO:5 and 6

[0708]

[0709] Example 8: Dose-dependent antisense inhibition of human τ protein in SH-SY5Y cells by a 5-10-5 MOE spacer with thiophosphate and phosphodiester nucleoside internucleotide bonds.

[0710] Spacers from the aforementioned studies that exhibited significant in vitro inhibition of τ protein mRNA were selected and tested in SH-SY-5Y cells at various doses. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 1.25 μM, 2.500 μM, 5.00 μM, 10.00 μM, and 20.00 μM as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer and probe set RTS3104. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells. In cells treated with antisense oligonucleotides, τ protein mRNA content was significantly reduced in a dose-dependent manner.

[0711] Table 17

[0712]

[0713]

[0714] Table 18

[0715]

[0716] Example 9: Antisense inhibition of human τ protein in SH-SY5Y cells by spacers consisting of 5-10-5 MOE, 5-8-5 MOE, 4-8-6 MOE, or 6-8-4 MOE.

[0717] Antisense oligonucleotides targeting the τ protein nucleic acid were designed and their effects on τ protein mRNA were tested in vitro. The antisense oligonucleotides were tested in a series of experiments under similar culture conditions. ISIS 613412 is also included in the analysis. Results for each experiment are presented in separate tables shown below. SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected with 8,000 nM antisense oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3104. Results were obtained as shown below. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells.

[0718] The newly designed chimeric antisense oligonucleotides in the table below are designed as 5-8-5MOE, 4-8-6MOE, or 6-8-4MOE spacers. The 5-8-5MOE spacer is 18 nucleotides long, with the central spacer containing 8 2'-deoxynucleotides and flanked by wings containing 5 nucleotides each in the 5' and 3' directions. The 4-8-6MOE spacer is 18 nucleotides long, with the central spacer containing 8 2'-deoxynucleotides and flanked by wings containing 4 and 6 nucleotides respectively in the 5' and 3' directions. The 6-8-4MOE spacer is 18 nucleotides long, with the central spacer containing 8 2'-deoxynucleotides and flanked by wings containing 6 and 4 nucleotides respectively in the 5' and 3' directions. Each nucleotide in the 5' wings and each nucleotide in the 3' wings is modified with 2'-MOE. Throughout each spacer in the table below (except for ISIS 613412), the internucleotide motif is 5'-sooosssssssssooss-3', where each "s" represents a thiophosphate internucleotide bond and each "o" represents a phosphodiester internucleotide bond. The internucleotide motif for ISIS 613412 is 5'-soooossssssssssooss-3', where each "s" represents a thiophosphate internucleotide bond and each "o" represents a phosphodiester internucleotide bond. All cytosine residues throughout each spacer are 5-methylcytosine. The "start site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 5' position. The "stop site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 3' position. Each spacer listed in the table below targets SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000), SEQ ID NO:4 (GENBANK accession number NT_010783.14, truncated from nucleotides 2624000 to 2761000), SEQ ID NO:5 (GENBANK accession number DR002467.1), or SEQ ID NO:6 (GENBANK accession number NM_001203251.1). 'n / a' indicates that the antisense oligonucleotide does not target that specific gene sequence with 100% complementarity.

[0719] Table 19

[0720] Inhibition of τ protein mRNA by 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1 and SEQ ID NO:4

[0721]

[0722]

[0723]

[0724] Table 20

[0725] Inhibition of τ protein mRNA by the 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1

[0726]

[0727]

[0728]

[0729] Table 21

[0730] Inhibition of τ protein mRNA by the 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1

[0731]

[0732]

[0733]

[0734] Table 22

[0735] Inhibition of τ protein mRNA by targeting the 5-10-5 and 5-8-5 MOE spacers of SEQ ID NO:1

[0736]

[0737]

[0738] Table 23

[0739] Inhibition of τ protein mRNA by targeting the 5-10-5 and 5-8-5 MOE spacers of SEQ ID NO:1

[0740]

[0741]

[0742] Table 24

[0743] Inhibition of τ protein mRNA by targeting the 5-10-5 and 5-8-5 MOE spacers of SEQ ID NO:1

[0744]

[0745]

[0746] Table 25

[0747] Inhibition of τ protein mRNA by targeting the 5-10-5 and 5-8-5 MOE spacers of SEQ ID NO:1

[0748]

[0749]

[0750] Table 26

[0751] Inhibition of τ protein mRNA by targeting the 5-10-5 and 5-8-5 MOE spacers of SEQ ID NO:1

[0752]

[0753]

[0754] Table 27

[0755] Inhibition of τ protein mRNA by targeting the 5-8-5MOE spacer of SEQ ID NO:1

[0756]

[0757]

[0758] Table 28

[0759] Inhibition of τ protein mRNA by the 5-8-5MOE spacer targeting SEQ ID NO:1 and 2

[0760]

[0761]

[0762] Table 29

[0763] Inhibition of τ protein mRNA by the 5-8-5MOE spacer targeting SEQ ID NO:1 and 2

[0764]

[0765]

[0766] Table 30

[0767] Inhibition of τ protein mRNA by the 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1

[0768]

[0769]

[0770] Table 31

[0771] Inhibition of τ protein mRNA by targeting the 5-10-5 and 5-8-5 MOE spacers of SEQ ID NO:1

[0772]

[0773]

[0774] Table 32

[0775] Inhibition of τ protein mRNA by the 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1

[0776]

[0777]

[0778] Table 33

[0779] Inhibition of τ protein mRNA by the 5-8-5MOE spacer targeting SEQ ID NO:5 and 6

[0780]

[0781]

[0782] Table 34

[0783] Inhibition of τ protein mRNA by 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1 and 2

[0784]

[0785]

[0786] Table 35

[0787] Inhibition of τ protein mRNA by 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1 and 2

[0788]

[0789]

[0790] Table 36

[0791] Inhibition of τ protein mRNA by 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1 and 2

[0792]

[0793]

[0794] Table 37

[0795] Inhibition of τ protein mRNA by 5-10-5MOE and 5-8-5MOE spacers targeting SEQ ID NO:1 and 2

[0796]

[0797]

[0798] Table 38

[0799] Inhibition of τ protein mRNA by targeting the 5-8-5MOE spacer of SEQ ID NO:1

[0800]

[0801]

[0802] Table 39

[0803] Inhibition of τ protein mRNA by targeting the 5-8-5MOE spacer of SEQ ID NO:1

[0804]

[0805]

[0806] Example 11: Dose-dependent antisense inhibition of human τ protein in SH-SY5Y cells

[0807] Spacers from the above studies that exhibited significant in vitro inhibition of τ protein mRNA were selected and tested in SH-SY5Y cells at various doses. Antisense oligonucleotides were tested in a series of experiments under similar culture conditions. Results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 0.938 μM, 0.1.875 μM, 3.750 μM, 7.500 μM, and 15.00 μM as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3104. Results were obtained as shown in the table below. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells. In cells treated with antisense oligonucleotides, τ protein mRNA content was significantly reduced in a dose-dependent manner.

[0808] Table 40

[0809]

[0810] Table 41

[0811]

[0812] Table 42

[0813]

[0814] Table 43

[0815]

[0816]

[0817] Table 44

[0818]

[0819] Table 45

[0820]

[0821] Table 46

[0822]

[0823] Table 47

[0824]

[0825] Example 12: Antisense inhibition of human τ protein in HepG2 cells by spacers consisting of 5-10-5 MOE, 5-8-5 MOE, 4-8-6 MOE, or 6-8-4 MOE.

[0826] Antisense oligonucleotides targeting the τ protein nucleic acid were designed and their effects on τ protein mRNA were tested in vitro. The antisense oligonucleotides were tested in a series of experiments under similar culture conditions. ISIS 613412 is also included in the analysis. Results for each experiment are presented in separate tables shown below. HepG2 cells cultured at a density of 20,000 cells per well were transfected with 8,000 nM antisense oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3104. Results were obtained as shown below. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells.

[0827] The newly designed chimeric antisense oligonucleotides in the table below are designed as 5-8-5MOE, 4-8-6MOE, or 6-8-4MOE spacers. The 5-8-5MOE spacer is 18 nucleotides long, with the central spacer containing 8 2'-deoxynucleotides and flanked by wings containing 5 nucleotides each in the 5' and 3' directions. The 4-8-6MOE spacer is 18 nucleotides long, with the central spacer containing 8 2'-deoxynucleotides and flanked by wings containing 4 and 6 nucleotides respectively in the 5' and 3' directions. The 6-8-4MOE spacer is 18 nucleotides long, with the central spacer containing 8 2'-deoxynucleotides and flanked by wings containing 6 and 4 nucleotides respectively in the 5' and 3' directions. Each nucleotide in the 5' wings and each nucleotide in the 3' wings is modified with 2'-MOE. Throughout each spacer in the table below (except for ISIS 613412), the internucleotide motif is 5'-sooosssssssssooss-3', where each "s" represents a thiophosphate internucleotide bond and each "o" represents a phosphodiester internucleotide bond. The internucleotide motif for ISIS 613412 is 5'-soooossssssssssooss-3', where each "s" represents a thiophosphate internucleotide bond and each "o" represents a phosphodiester internucleotide bond. All cytosine residues throughout each spacer are 5-methylcytosine. The "start site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 5' position. The "stop site" indicates the nucleotide in the human gene sequence targeted by the spacer closest to the 3' position. Each spacer listed in the table below targets the human tau protein genome sequence designated herein as SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000).

[0828] Table 48

[0829] Inhibition of τ protein mRNA by targeting the 5-10-5 MOE spacer of SEQ ID NO:1

[0830]

[0831]

[0832] Table 49

[0833] Inhibition of τ protein mRNA by targeting the 5-10-5MOE, 5-8-5MOE, 4-8-6MOE and 6-8-4 spacer of SEQ ID NO:1

[0834]

[0835]

[0836]

[0837] Example 13: The effect of MOE spacers on human τ protein in SH-SY5Y cells

[0838] Quantity-dependent antisense inhibition

[0839] Spacers from the above studies that exhibited significant in vitro inhibition of τ protein mRNA were selected and tested in SH-SY5Y cells at various doses. Antisense oligonucleotides were tested in a series of experiments under similar culture conditions. Results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 0.938 μM, 0.1.875 μM, 3.750 μM, 7.500 μM, and 15.00 μM as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3104. Results were obtained as shown in the table below. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells. In cells treated with antisense oligonucleotides, τ protein mRNA content was significantly reduced in a dose-dependent manner.

[0840] Table 50

[0841]

[0842] Table 51

[0843]

[0844] Table 52

[0845]

[0846] Table 53

[0847]

[0848] Table 54

[0849]

[0850] Table 55

[0851]

[0852] Example 14: Design of 5-7-6 MOE, 5-8-5 MOE, 5-9-5 MOE, and 5-10-5 MOE spacers with thiophosphate and phosphodiester nucleoside internucleotide bonds in the hotspot region of the human τ protein.

[0853] Design antisense oligonucleotides targeting the τ protein nucleic acid, which were identified as 'hotspots' in the above studies.

[0854] The newly designed chimeric antisense oligonucleotides in the table below are designed as 5-7-6MOE, 5-8-5MOE, 5-9-5MOE, or 5-10-5MOE spacers. The 5-7-6MOE spacer is 18 nucleotides long, with a central spacer containing 7 2'-deoxynucleotides and flanked by wings containing 5 and 6 nucleotides respectively in the 5' and 3' directions. The 5-8-5MOE spacer is 18 nucleotides long, with a central spacer containing 8 2'-deoxynucleotides and flanked by wings containing 5 nucleotides each in the 5' and 3' directions. The 5-9-5MOE spacer is 19 nucleotides long, with a central spacer containing 9 2'-deoxynucleotides and flanked by wings containing 5 nucleotides each in the 5' and 3' directions. The 5-10-5MOE spacer is 20 nucleotides in length, with the central spacer containing 10 2'-deoxynucleotides and flanked by wings each containing 5 nucleotides in the 5' and 3' directions. Each nucleotide in the 5' wings and each nucleotide in the 3' wings is 2'-MOE modified. The internucleotide bonds throughout each spacer are either phosphate thioester or phosphodiester bonds. The 'Chemistry' line describes the internucleotide bonds of each oligonucleotide. 's' indicates a phosphate thioester bond and 'o' indicates a phosphodiester bond. All cytosine residues throughout each spacer are 5-methylcytosine.

[0855] “Start site” indicates the nucleotide closest to the 5' of the human gene sequence targeted by the spacer. “Termination site” indicates the nucleotide closest to the 3' of the human gene sequence targeted by the spacer. Each spacer listed in the table below targets the human τ protein genome sequence designated herein as SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000) or the human τ protein mRNA sequence designated herein as SEQ ID NO:2 (GENBANK accession number NM_001123066.3). 'n / a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

[0856] Table 56

[0857] MOE spacers targeting SEQ ID NO:1 and 2

[0858]

[0859]

[0860]

[0861]

[0862]

[0863]

[0864] Example 15: Administration of antisense oligonucleotides targeting human tau protein mRNA in the middle ventricle of hτ mice

[0865] The efficacy of the selected compounds was tested by administering ICV to human τ protein transgenic mice (Duff et al., Neurobiology of Disease 7:87-98, 2000).

[0866] Treatment and surgery

[0867] Four mice in each group were administered ISIS 613255, ISIS 613329, ISIS 613344, ISIS 613361, ISIS 613369, ISIS 613370, ISIS 613397, ISIS 613045, ISIS 613099, ISIS 613118, and ISIS 613136 at a dose of 200 μg via rapid intravenous infusion (ICV). Similarly, two control mice were treated with ISIS 424880, and four control mice were treated with PBS. All procedures were performed under isoflurane anesthesia and in accordance with IACUC guidelines. For rapid ICV infusion in mice, antisense oligonucleotides were injected into the right ventricle of human tau protein transgenic mice. 10 μL of PBS containing 300 μg of oligonucleotides was injected over approximately 10 seconds. Tissue was collected 14 days after oligonucleotide administration.

[0868] RNA analysis

[0869] On day 14 following oligonucleotide administration, RNA was extracted from the hippocampus, spinal cord, and cortex for real-time PCR analysis targeting τ protein mRNA levels. Human τ protein mRNA levels were measured using the human primer and probe set RTS3104. Results were calculated as the percentage inhibition of human τ protein mRNA expression compared to the control. All antisense oligonucleotides significantly inhibited human τ protein mRNA levels.

[0870] Table 57

[0871] Percentage reduction in human τ protein mRNA levels in hτ mice

[0872]

[0873] Example 16: Antisense inhibition of human τ protein in SH-SY5Y cells by 5-7-6MOE, 5-8-5MOE, 5-9-5MOE and 5-10-5MOE spacers.

[0874] The antisense oligonucleotides described in the examples above, as well as the newly designed antisense oligonucleotides targeting human τ protein nucleic acids, were tested in a series of experiments under similar culture conditions. Results for each experiment are presented in separate tables below. Cultured SH-SY5Y cells were transfected with 8,000 nM antisense oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3104. Results were obtained as shown below. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells.

[0875] The newly designed chimeric antisense oligonucleotides in the table below are designed as 5-7-6MOE, 5-8-5MOE, 5-9-5MOE, or 5-10-5MOE spacers. The 5-7-6MOE spacer is 18 nucleotides long, with a central spacer containing 7 2'-deoxynucleotides and flanked by wings containing 5 and 6 nucleotides respectively in the 5' and 3' directions. The 5-8-5MOE spacer is 18 nucleotides long, with a central spacer containing 8 2'-deoxynucleotides and flanked by wings containing 5 nucleotides each in the 5' and 3' directions. The 5-9-5MOE spacer is 19 nucleotides long, with a central spacer containing 9 2'-deoxynucleotides and flanked by wings containing 5 nucleotides each in the 5' and 3' directions. The 5-10-5MOE spacer is 20 nucleotides in length, with the central spacer containing 10 2'-deoxynucleotides and flanked by wings each containing 5 nucleotides in the 5' and 3' directions. Each nucleotide in the 5' and 3' wings is 2'-MOE modified. The internucleotide bonds throughout each spacer are either phosphate thioester or phosphodiester bonds. The 'bond chemistry' line describes the internucleotide bonds of each oligonucleotide. 's' indicates a phosphate thioester bond and 'o' indicates a phosphodiester bond. All cytosine residues throughout each spacer are 5-methylcytosine.

[0876] “Start site” indicates the nucleotide closest to the 5' of the human gene sequence targeted by the spacer. “Termination site” indicates the nucleotide closest to the 3' of the human gene sequence targeted by the spacer. Each spacer listed in the table below targets the human τ protein genome sequence designated herein as SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000) or the human τ protein mRNA sequence designated herein as SEQ ID NO:2 (GENBANK accession number NM_001123066.3). 'n / a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

[0877] Table 58

[0878]

[0879]

[0880] Table 59

[0881]

[0882]

[0883]

[0884] Table 60

[0885]

[0886]

[0887]

[0888] Table 61

[0889]

[0890]

[0891]

[0892] Example 17: Dose-dependent antisense inhibition of human τ protein in SH-SY5Y cells

[0893] Spacers from the above studies that exhibited significant in vitro inhibition of τ protein mRNA were selected and tested in SH-SY5Y cells at various doses. Antisense oligonucleotides were tested in a series of experiments under similar culture conditions. Results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 0.247 μM, 0.741 μM, 2.22 μM, 6.67 μM, and 20.00 μM as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and τ protein mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3104. Results were obtained as shown in the table below. Total RNA content was measured to adjust for τ protein mRNA content. Results are presented as a percentage of τ protein inhibition relative to untreated control cells. In cells treated with antisense oligonucleotides, τ protein mRNA content was significantly reduced in a dose-dependent manner.

[0894] Table 62

[0895]

[0896] Table 63

[0897]

[0898] Table 64

[0899]

[0900] Example 18: Administration of antisense oligonucleotides targeting human tau protein mRNA in the middle ventricle of hτ mice

[0901] The efficacy of the selected compounds was tested by administering ICV to human τ protein transgenic mice (Duff et al., Neurobiology of Disease 7:87-98, 2000).

[0902] Treatment and surgery

[0903] Four mice in each group were administered ISIS 613099, ISIS 613361, ISIS 613370, ISIS 623782, or ISIS 623996 via rapid ICV concentration. Similarly, two control mice were treated with ISIS 424880, and four control mice were treated with PBS. All procedures were performed under isoflurane anesthesia and in accordance with IACUC guidelines. For rapid ICV concentration in mice, antisense oligonucleotides were injected into the right ventricle of human tau protein transgenic mice. 10 μL of PBS containing 200 μg of oligonucleotides was injected over approximately 10 seconds. Tissue was collected 14 days after oligonucleotide administration.

[0904] RNA analysis

[0905] On day 14 following oligonucleotide administration, RNA was extracted from the hippocampus, spinal cord, and cortex for real-time PCR analysis targeting τ protein mRNA levels. Human τ protein mRNA levels were measured using the human primer and probe set RTS3104. Results were calculated as the percentage inhibition of human τ protein mRNA expression compared to the control. All antisense oligonucleotides significantly inhibited human τ protein mRNA levels in several tissues.

[0906] Table 65

[0907] Percentage reduction in human τ protein mRNA levels in hτ mice

[0908]

[0909] Example 19: Design of oligonucleotides targeting human τ protein

[0910] ISIS number 603054 was designed to target the human τ protein. The nucleobase sequence and bond chemistry of ISIS number 603054 are given in Table 66 below. ISIS number 603054 is a 5-10-5 MOE spacer. ISIS number 603054 is 20 nucleotides in length, with the central spacer containing 10 2'-deoxynucleotides and flanked by wings each containing 5 nucleotides in the 5' and 3' directions. Each nucleotide in the 5' wings and each nucleotide in the 3' wings is 2'-MOE modified. All cytosine residues throughout each spacer are 5-methylcytosine. The "start site" indicates the nucleotide in the human gene sequence closest to the 5' region targeted by the spacer. The "stop site" indicates the nucleotide in the human gene sequence closest to the 3' region targeted by the spacer. Each spacer listed in Table 1 below targets either the human τ protein genome sequence designated herein as SEQ ID NO:1 (GENBANK accession number NT_010783.15, truncated from nucleotides 9240000 to 9381000) or the human τ protein mRNA sequence designated herein as SEQ ID NO:2 (GENBANK accession number NM_001123066.3).

[0911] Table 66

[0912] In vivo study of ICV in hτ mice and wild-type C57Bl6 mice

[0913]

[0914] Example 20: In vivo analysis in mice of oligonucleotides targeting human τ protein

[0915] The oligonucleotides shown in the table below are designed to target the τ protein. Mice, human τ protein transgenic mice “hτ” (Duff et al., Neurobiology of Disease 7:87-98, 2000; Davies et al., J. Neurochem. (2003) 86, 582–590) or wild-type WT C57Bl6 mice, were grouped into groups of 3 or 4 mice. Each mouse in each group was administered a single ICV dose of the oligonucleotides in the table below, at a dose of 300 μg or 200 μg. Three hours after injection, each mouse was evaluated according to seven different criteria. The seven criteria were: (1) the mouse was intelligent, alert and responsive; (2) the mouse did not need stimulation to stand or bend over; (3) the mouse did not need stimulation to exhibit any movement; (4) the mouse exhibited forward movement when lifted; (5) the mouse did not exhibit any movement when lifted; (6) the mouse responded to tail pinching; and (7) the mouse breathed regularly. For each of the seven different criteria, each mouse was assigned a subscore, with a subscore of 0 if it met the criterion and 1 if it did not. After assessing all seven criteria, the subscores for each mouse were totaled and then averaged over each group. For example, if a mouse was intelligent, alert, and responsive and met all criteria 3 hours after a 300 μg ICV dose, it would receive a total score of 0. If another mouse was not intelligent, alert, and responsive but met all other criteria 3 hours after a 300 μg ICV dose, it would receive a score of 1. Mice treated with saline typically received a score of 0. The results are presented in Table 67 below as the mean scores for each treatment group. “ND” means no data. These results show that ISIS 613099, ISIS 613361, ISIS 613370, ISIS 623782, ISIS 623996, ISIS 424880, and ISIS 603054 were well tolerated.

[0916] Table 67

[0917] In vivo study of ICV in hτ mice and wild-type C57Bl6 mice

[0918]

[0919] Example 20: In vivo analysis in rats of oligonucleotides targeting human τ protein

[0920] Sprague Dawley rats were divided into groups of four. Each rat in the group was administered a single 1 mg intrathecal (IT) dose or a single 3 mg intrathecal (IT) dose of ISIS 613099, ISIS 613361, ISIS 613370, ISIS 623782, ISIS 623996, ISIS 424880, or ISIS 603054. Three hours after injection, movement at seven different body sites was assessed for each rat. The seven body sites were (1) the rat's tail; (2) the rat's hindquarters; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior body parts; and (7) the rat's head. For each of the seven different body sites, a subscore was assigned to each rat, with a subscore of 0 for movement of the body site and 1 for paralysis of the body site. After assessing each of the seven body sites, the sub-scores for each rat were totaled and then averaged over each group. For example, if a rat moves its tail, head, and all other assessed body sites 3 hours after administration of a 3 mg IT dose, it will receive a total score of 0. If another rat does not move its tail but moves all other assessed body sites 3 hours after administration of a 3 mg IT dose, it will receive a score of 1. Rats treated with saline typically receive a score of 0. Scores at the top of the range indicate toxicity. The results are presented in Table 68 below as average scores for each treatment group.

[0921] Table 68

[0922] In in vivo studies, 1 mg and 3 mg IT rapid concentrations

[0923]

Claims

1. A modified oligonucleotide or a pharmaceutically acceptable salt thereof, said modified oligonucleotide comprising 18 linked nucleosides, wherein said modified oligonucleotide has a nucleobase sequence comprising 18 consecutive nucleosides containing the nucleobase sequence SEQ ID NO: 1602, and said modified oligonucleotide comprises: A spacer segment consisting of eight linked deoxynucleotides; The 5' wing consists of five linked nucleosides; and The 3' wing consists of five linked nucleosides; The spacer segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside in each wing segment contains a 2'-O-methoxyethyl sugar, wherein at least one internucleotide bond is a thiophosphate internucleotide bond, at least one internucleotide bond is a phosphate diester internucleotide bond, and each cytosine is 5-methylcytosine.

2. The modified oligonucleotide of claim 1 or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.

3. The modified oligonucleotide of claim 1 or a pharmaceutically acceptable salt thereof, wherein... (i) At least one nucleoside in the modified oligonucleotide comprises a modified sugar, optionally, wherein (a) the at least one modified sugar is a bicyclic sugar, wherein the bicyclic sugar comprises a 4'-CH2-N(R)-O-2' chemical bridge, wherein R is independently selected from H and C1-C6 alkyl; or wherein the bicyclic sugar comprises a 4'-CH(R)-O-2' chemical bridge, wherein R is methyl, H or -CH2-O-CH3; or (b) at least one modified sugar comprises 2'-O-methoxyethyl or 2'-O-methyl; and / or (ii) At least one nucleoside in the modified oligonucleotide contains a sugar substitute, optionally, wherein the at least one sugar substitute is a morpholino or peptide nucleic acid.

4. A pharmaceutically acceptable salt of the modified oligonucleotide as described in any one of claims 1-3, wherein the modified oligonucleotide is a sodium salt.

5. A coupled antisense compound comprising a modified oligonucleotide as described in any one of claims 1-4 or a pharmaceutically acceptable salt thereof.

6. A composition comprising at least one of the modified oligonucleotides or pharmaceutically acceptable salts thereof as described in any one of claims 1-4, or the conjugated antisense compound as described in claim 5, and a pharmaceutically acceptable carrier or diluent.

7. The composition of claim 6, wherein the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS).

8. Use of the modified oligonucleotide or a pharmaceutically acceptable salt thereof as described in any one of claims 1-4, or the conjugated antisense compound as described in claim 5, or the pharmaceutical composition as described in claim 6 or 7 in the preparation of a medicament for treating tau protein disorders, wherein the tau protein disorders are Alzheimer's disease, frontotemporal dementia, FTDP-17, progressive supranuclear palsy, chronic traumatic encephalopathy, corticobasal ganglia degeneration, epilepsy, or Dravet syndrome.

9. The use as claimed in claim 8, wherein the modified oligonucleotide or a pharmaceutically acceptable salt thereof, the coupled antisense compound, or the composition is administered intrathecally.

Images