Primers for specific detection of HIV-2 proviral DNA and their application

Abstract

The present invention discloses primers and fluorescent probes for specifically detecting HIV-2 proviral DNA, and a TaqMan qPCR method for detecting HIV-2 proviral DNA in a sample, which can be used for qualitatively or quantitatively detecting HIV-2 proviral DNA in a sample.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological detection, and more specifically relates to the detection of HIV-2 proviral DNA. Background Art

[0002] Acquired immunodeficiency syndrome (AIDS), also known as AIDS, is a highly harmful infectious disease caused by infection with the human immunodeficiency virus (HIV). HIV is a reverse transcription RNA virus that attacks the human immune system. It destroys CD4 T lymphocytes, causing the body to lose its immune function, making it susceptible to various diseases and leading to death (1). AIDS originated in Africa and was brought to the United States by immigrants. It was first reported in the United States in 1981 and then quickly spread to various countries. Based on genotypic differences, HIV can be divided into two large, multiple subtypes, HIV-1 and HIV-2. Currently, HIV-1 is prevalent in most parts of the world, while HIV-2 is only prevalent in West Africa, Europe (especially France and Portugal) and other regions (2,3).

[0003] Compared with the high infectivity and high lethality of HIV-1, HIV-2 is considered to be more like a mild variant. Studies have reported that without antiretroviral treatment, more than 98% of HIV-1 infected people will develop AIDS; while most HIV-2 patients have a normal life expectancy and no related complications, so people have long generally believed that HIV-2 will not cause disease like HIV-1 (4). In addition, due to the long incubation period of HIV and the narrow area of ​​incidence, people are not very interested in developing diagnostics and treatments for HIV-2. However, a long-term follow-up (including blood tests) of 4,900 patients from 1990 to 2013 reported that the way HIV-2 patients suffer from HIV-related infections and develop AIDS is almost the same as HIV-1, except that their disease progression is relatively slow (5). Recent studies have shown that even though the disease progresses more slowly, the life expectancy of HIV-2 patients is 10 years less than that of normal uninfected people, and 43% of HIV-2 infected people will develop AIDS (6). Therefore, HIV-2 is more lethal than previously thought, and the development of diagnostic reagents and therapeutic drugs needs to be paid attention to.

[0004] The HIV-2 genome consists of two single-stranded positive-strand RNAs, including three structural genes, gag, pol, and env, as well as regulatory genes such as tat, rev, nef, vif, vpr, and vpx. There is a long terminal repeat (LTR) at the 5' and 3' ends of the genome, which is rich in cis-regulatory elements and controls the expression of viral genes. Each gene has a different function. The 863-amino acid precursor protein encoded by the env gene can be glycosylated into gp160, gp120, and gp41. In particular, gp120 contains a neutralizing antigen determinant cluster and plays an important role in the fusion of viruses and cells. In addition, the env gene has the highest mutation rate. HIV-2 can be divided into 8 subtypes (AH) based on mutations in its gene region (7). Subtype A (the incidence population is mainly in countries adjacent to the Atlantic Ocean, such as Guinea) and subtype B (the incidence population is mainly in countries adjacent to the Bac Ninh Bay, such as Ghana) HIV-2 are clinically relevant, and the remaining subtypes only occur in a few areas (8).

[0005] Since the discovery of HIV-2 more than 30 years ago, it has not been widely spread, and most cases are imported cases (such as drug injection or sexual contact history). In 2018, the first two cases of non-imported HIV-2 infection were diagnosed in Hunan Province (9). The main reason for the narrow transmission area of ​​HIV-2 is its lower viral load and replication rate, which will lead to lower or even undetectable RNA virus in plasma, as well as lower transmissibility and longer asymptomatic period (10,11), which has brought great obstacles to the discovery and diagnosis of the virus. In addition, although the pathogenicity of HIV-2 is lower than that of HIV-1, some drugs that can effectively inhibit HIV-1, such as non-nucleotide reverse transcriptase inhibitors and protease inhibitors, are ineffective against HIV-2 treatment (12). Therefore, distinguishing HIV-1 from HIV-2 is very important for clinical treatment.

[0006] The most commonly used method for in vitro detection of HIV infection is the Gag antigen capture ELISA test (13), which is suitable for the detection of Gag antigen in cell culture supernatant or cell lysate. The experiment does not rely on the use of specific viruses or cell lines. The experimental method is simple and rapid, but the biggest drawback of this method is that it requires the acquisition of matching antibodies to quantify viral proteins. In addition, commonly used HIV detection methods include immunoblotting (WB) and PCR testing. At present, the routine procedure for detecting HIV antibodies in my country is primary screening-rescreening-confirmation, and the commonly used confirmation test method is WB. According to the 2004 "National AIDS Testing Technical Specifications", for samples that show HIV-2 specific indicator bands in HIV-1 / 2 mixed WB tests, HIV-2 antibody confirmation tests must be performed using HIV-2 immunoblotting tests. After a positive reaction, the sample should be sent to the national reference laboratory for nucleic acid sequence analysis. However, HIV-2 diagnosis has not been widely carried out because WB testing can produce a large number of uncertain or even false-positive results (14), as well as the lag in the evaluation of HIV-2 antibody confirmation kits in my country and the lack of standardized HIV-2 nucleic acid detection methods.

[0007] Fluorescence quantitative PCR technology is widely used in many fields such as animal disease detection, tumor gene detection, genetic gene detection and quantitative research in molecular biology. Fluorescence quantitative PCR technology is a method of adding fluorescent groups to the PCR reaction system. As the PCR products accumulate, the fluorescent signal is continuously enhanced and accumulated into an amplification curve. The fluorescence accumulation curve is used to monitor the entire PCR process in real time and perform qualitative and quantitative analysis on unknown templates. qRT-PCR (Quantitative Real-time PCR) technology mainly includes two categories: non-specific detection of amplified sequences and specific detection of amplified sequences. Non-specific detection of amplified sequences is mainly based on fluorescent molecules bound to DNA, such as SYBR Green I dye, which penetrates into the minor groove of DNA and can emit fluorescent signals. However, since it cannot bind to single-stranded DNA or RNA, and it can bind to any double-stranded DNA to produce non-specific signals, the accuracy and specificity of the detection are limited. Amplified sequence specific detection is divided into direct method and indirect method. The direct method refers to the direct generation of fluorescence by the probe labeled with fluorescence after binding to the amplified product, such as molecular beacons, fluorescent labeled primers and molecular probes, but this method is less used. The indirect method uses a hydrolysis probe strategy (such as the TaqMan system) to add a fluorescent reporter group (such as FAM, etc.) to the 5' end of the probe and a quencher group to the 3' end. Since the intact probe undergoes fluorescence resonance energy transfer after being exposed to excitation light, no signal can be detected; however, during the PCR amplification process, the primer / probe will bind to the template, and the fluorescent group at the 5' end of the probe will be cut off under the 5'-3' exonuclease activity of the Taq enzyme, thereby escaping from the shielding of the quencher group and receiving the fluorescent signal. Since the number of released fluorescent groups and the number of PCR products are one-to-one, the strength of the fluorescent signal represents the number of templates, thereby achieving quantification of the template (15).

[0008] Therefore, due to the drawbacks of traditional serological testing, such as the inability to detect HIV-2 during the infection window period and the cross-reaction between HIV-2 and HIV-1 in serology, the highly sensitive and specific qPCR technology has brought many conveniences to the detection of HIV-2. Researchers have begun to use qRT-PCR technology to detect HIV-2 RNA viruses in plasma, and can detect up to 500 copies / mL of plasma (16). However, according to the French National AIDS Research Agency, 36% of AIDS patients cannot detect HIV-2 RNA in their plasma (<100 copies / mL) (17). This is mainly due to the different levels of RNA viruses in the plasma caused by different stages of the disease in patients. Even with the development of PCR technology, such as the update of instruments, efficient PCR enzymes and other reagents, people can detect relatively low levels of HIV-2 RNA viruses in plasma (18), but there are still patients whose RNA cannot be detected in their samples.

[0009] Provirus is a part of the virus that is reverse transcribed from viral RNA into DNA and integrated into the host chromosome. Amplification experiments using HIV-1 RNA and proviral DNA as templates found that using proviral DNA as a template can significantly increase the amplification positive rate (19). In addition, DNA samples are more stable than RNA and can be stored for a long time under low temperature conditions. They have a wide range of sources (can be various tissues, organs or blood, not limited to plasma), and are relatively simple to extract and process. Therefore, detecting HIV-2 proviral DNA in the body is a better method for diagnosis (20). Currently, the main limitation to the quantification of HIV-2 proviral DNA is the lack of DNA standards. Summary of the invention

[0010] The present invention uses the conserved LTR region sequence of HIV-2 as the target, designs and synthesizes highly efficient and specific HIV-2 primers / probes, and constructs plasmids with their amplified sequences as DNA standards, which can accurately and specifically detect HIV-2 proviral DNA without any cross-reaction with DNA from other sources (such as humans, monkeys, rabbits, rats, and mice).

[0011] The purpose of the present invention is to provide primers and / or probes specific for HIV-2 proviral DNA, and a TaqMan qPCR method that can be used to detect HIV-2 proviral DNA in a sample. This method is suitable for detecting whether HIV-2 proviral DNA exists in a sample.

[0012] The term "HIV-2" refers to the virus that causes acquired immune syndrome (also known as AIDS virus) type 2, which is a reverse transcription RNA virus. After the RNA of the virus infects the host, it is reversely transcribed into the corresponding DNA and integrated into the host genomic DNA.

[0013] The term "HIV-2 proviral DNA" refers to DNA that is reverse transcribed and integrated into the host genome after HIV-2 infects host cells. In the present invention, "HIV-2 gene fragment" or "HIV-2 fragment" can be used interchangeably to refer to a fragment of HIV-2 proviral DNA.

[0014] In one aspect, the present invention provides a primer pair for specifically detecting HIV-2 proviral DNA, the primer pair comprising a forward primer 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1) and a reverse primer 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2).

[0015] Another aspect of the present invention provides a primer and probe combination for specifically detecting HIV-2 proviral DNA, wherein the primers include a forward primer and a reverse primer, wherein the forward primer is 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1), and the reverse primer is 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2); the sequence of the probe is 5'-TTGGCCGGTACTGGGCAGACGGCTCC-3' (SEQ ID NO: 3), and the 5' end of the probe is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher group.

[0016] In some embodiments, the reporter fluorescent group labeled at the 5' end of the fluorescent probe is FAM, and the quencher group labeled at the 3' end is NFQ-MGB or TAMRA.

[0017] Another aspect of the present invention provides the use of the above primer pair or primer and probe combination in detecting HIV-2 proviral DNA in a sample.

[0018] Another aspect of the present invention provides use of the above primer pair or primer and probe combination in preparing a reagent for detecting HIV-2 proviral DNA in a sample.

[0019] In some embodiments, the detecting is by qPCR detection or by digital PCR detection.

[0020] The qPCR described in the present invention refers to real-time fluorescence quantitative PCR (Real-time Quantitative PCR), which is to add a fluorescent group to the PCR reaction system, use the accumulation of fluorescent signals to monitor the PCR process in real time, and finally the unknown template can be quantitatively analyzed by the standard curve. In qPCR detection, the Ct value represents the cycle threshold, that is, the number of cycles experienced when the fluorescent signal in each reaction tube reaches the set threshold. Since the Ct value of each template is linearly related to the logarithm of the initial content of the template, the more the initial copy number, the smaller the Ct value. A standard curve can be made using a standard of a known initial content of a serial dilution, in which the abscissa represents the logarithm of the initial content and the ordinate represents the Ct value, or the ordinate represents the logarithm of the initial content and the abscissa represents the Ct value. As long as the Ct value of the unknown sample is obtained, the content of the sample can be calculated from the standard curve. qPCR is a mature technology in this field. When using existing instruments for qPCR detection, the Ct value of the sample can be directly obtained from the output results of the instrument.

[0021] In qPCR detection, fluorescent probes or fluorescent dyes can be used to obtain fluorescent signals. Common fluorescent probes can be, for example, TaqMan fluorescent probes, in which a specific fluorescent probe is added at the same time as a pair of primers during PCR amplification. The probe is an oligonucleotide with a reporter fluorescent group and a quencher fluorescent group labeled at both ends. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; during PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the reporter fluorescent group and the quencher fluorescent group, so that the fluorescence monitoring system can receive the fluorescent signal, that is, for each DNA chain amplified, a fluorescent molecule is formed, achieving complete synchronization of the accumulation of fluorescent signals and the formation of PCR products. In some embodiments, the reporter fluorescent group can be, for example, FAM, and the quencher group can be, for example, NFQ-MGB or TAMRA. Those skilled in the art know that other reporter fluorescent genes and corresponding quencher fluorescent groups can also be used in the present invention.

[0022] In qPCR detection, fluorescent dyes can also be used to obtain fluorescent signals. For example, an excess of fluorescent dyes can be added to the PCR reaction system. After the fluorescent dyes are non-specifically incorporated into the DNA double strands, fluorescent signals are emitted, while dye molecules that are not incorporated into the strands will not emit any fluorescent signals, thereby ensuring that the increase in fluorescent signals is completely synchronized with the increase in PCR products. Commonly used fluorescent dyes can be, for example, SYBR fluorescent dyes, sulforhodamine (Texas Red), fluorescein isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), JOE, VIC, ROX, and NED.

[0023] Digital PCR detection is also well known to those skilled in the art. In short, digital PCR (also known as single-molecule PCR) includes PCR amplification and fluorescence signal analysis. In the PCR amplification stage, the sample is diluted to the single-molecule level and evenly distributed into tens to tens of thousands of units for reaction. After the amplification is completed, the fluorescence signal of each reaction unit is collected. Finally, the original concentration or content of the sample is calculated by direct counting or Poisson distribution formula. Those skilled in the art are familiar with how to perform digital PCR detection.

[0024] Another aspect of the present invention provides a kit for specifically detecting HIV-2 proviral DNA in a sample, the kit comprising the above primer pair, or the above primer and probe combination.

[0025] In some embodiments, the kit further comprises any one or more reagents required for qPCR detection.

[0026] In some embodiments, any one or more reagents required for qPCR detection include one or more components selected from the following components: qPCR reaction solution (e.g., qPCR Master Mix (2×), which includes essential components such as enzymes required for qPCR reaction), water (e.g., nuclease-free high-purity water), and reference substances. The reference substances may be positive controls, such as HIV-2 proviral standards, such as plasmid DNA containing HIV-2 proviral DNA, and / or negative controls. The positive control substances may also be plasmid DNA, genomic DNA or cells with HIV-2 proviral DNA. The negative control substances may be plasmid DNA, genomic DNA, cells or water without HIV-2 proviral DNA. The kit may also include HIV-2 proviral DNA standards, such as plasmid DNA with HIV-2 proviral DNA fragments.

[0027] Another aspect of the present invention provides a method for detecting HIV-2 proviral DNA in a sample, comprising using the above primer and probe combination to perform qPCR detection on DNA extracted from the sample, and qualitatively or quantitatively detecting whether HIV-2 proviral DNA is present in the sample based on the qPCR detection result. The DNA extracted from the sample can be, for example, genomic DNA.

[0028] Another aspect of the present invention provides a method for detecting HIV-2 proviral DNA in a sample, comprising the following steps:

[0029] (1) Extract DNA from samples;

[0030] (2) using a primer and probe combination that specifically amplifies HIV-2 proviral DNA, such as the primer and probe combination described above, to perform qPCR detection on HIV-2 proviral DNA standards and sample DNA, wherein the HIV-2 proviral DNA standards are samples of different given concentrations prepared with DNA containing HIV-2 proviral DNA fragments;

[0031] (3) The qPCR test results of HIV-2 proviral DNA standards were used to prepare a standard curve and fit a linear equation, where R 2 ≥0.99; and the accuracy (RE%) of each standard concentration is -75% to 150%, and the lowest concentration that can be stably detected is determined;

[0032] (4) Result determination: If an obvious amplification curve appears in the qPCR results of the sample DNA; and the Ct value of the qPCR of the sample DNA is less than the Ct value at the lowest concentration point, it is a positive result, that is, HIV-2 proviral DNA is present in the sample; if there is no obvious amplification curve, or if there is an obvious amplification curve but the Ct value is greater than the Ct value at the lowest concentration point of the standard curve, it is a negative result, that is, HIV-2 proviral DNA is not present in the sample.

[0033] In some embodiments, what is extracted is genomic DNA in the sample. The sample DNA may be sample genomic DNA. Methods for extracting genomic DNA from a sample are well known in the art, for example, genomic DNA may be extracted using a DNA extraction kit.

[0034] In some embodiments, when preparing the standard curve in the above step (3), the Ct value of the HIV-2 proviral DNA standard is used as the vertical axis (Y), and the logarithm of the DNA concentration of the HIV-2 proviral DNA standard is used as the horizontal axis (X) to fit a linear equation.

[0035] In some embodiments, the HIV-2 proviral DNA standard comprises at least 6 samples of different given concentrations prepared with DNA containing HIV-2 proviral DNA fragments. The number of HIV-2 proviral DNA standards can be 6, 7, 8 or more. HIV-2 proviral DNA standards can be prepared, for example, by mixing plasmid DNA containing HIV-2 proviral DNA fragments with water.

[0036] When fitting the standard curve, such as R 2 If the accuracy of the concentration of each standard does not meet the above requirements, satisfactory fitting results can be obtained by repeating the experiment, or re-preparing the DNA standard, or using a DNA standard of a different concentration. The fitting of the standard curve and the method of obtaining a satisfactory fitting result are well known to those skilled in the art.

[0037] The highest concentration point refers to the highest limit of the concentration that can be stably detected by the above method, which can also be called the upper detection limit or the upper quantitative limit in the present invention. The lowest limit of the concentration that can be stably detected is the lowest concentration point, which can also be called the lower detection limit or the lower quantitative limit in the present invention.

[0038] The method of judging whether an obvious amplification curve appears is well known to those skilled in the art. For example, when the curve in the ΔRn vsCycle mode is S-shaped, it can be determined that an obvious amplification curve appears.

[0039] In some embodiments, the qPCR reaction system is 10 μL of PCR Master Mix (2×), 1 μL of primers / probes (20×) for specific amplification of HIV-2 proviral DNA, and 9 μL of DNA sample + nuclease-free high-purity water. The DNA sample can be sample DNA, DNA standard, or other control, negative control, or quality control.

[0040] In some embodiments, the qPCR reaction is performed by first activating UDG at 50°C for 2 min, then activating DNA polymerase at 95°C for 10 min, and then performing 40 cycles according to the following parameters: 95°C for 15 seconds, and 60°C for 1 min. In some embodiments, the qPCR reaction is performed on an Applied Biosystems ABI 7500 Real Time PCR instrument.

[0041] In some embodiments, the result determination may also be quantitative detection of HIV-2 proviral DNA in the sample, or may further include quantitative detection of HIV-2 proviral DNA in the sample. The quantitative detection may include, for example, determining the concentration of HIV-2 proviral DNA in the sample DNA based on the Ct value of the sample DNA and the fitted standard curve.

[0042] In the present invention, the sample may be, for example, an organ, tissue, whole blood, cell, body fluid sample or biological product.

[0043] In the present invention, the sample may be derived from, for example, humans or any animals, such as mice, rats, rabbits, monkeys, etc., or any other route.

[0044] In some embodiments, the methods of the invention are performed in vitro.

[0045] In some embodiments, the methods of the invention are non-diagnostic, for example, can be used to determine whether a biological product, such as a vaccine, antibody or cell product, is contaminated with HIV-2.

[0046] In the present application, the terms "HIV-2 positive", "containing HIV-2 proviral DNA", "HIV-2 infected" or similar expressions refer to cells infected with HIV-2, whose genomic DNA contains HIV-2 proviral DNA, or tissues and organs containing these cells.

[0047] The present invention provides a new HIV-2 detection method, which uses real-time fluorescence quantitative PCR (qPCR) technology to detect HIV-2 proviral DNA fragments integrated into the host genome, and provides specific primers and / or probes for the DNA fragments. The primers, probes and methods of the present invention can greatly improve the sensitivity and specificity of detecting HIV-2 in samples, and can be used to track and qualitatively or quantitatively detect HIV-2 proviral DNA in samples, to detect whether a sample is infected with human HIV-2 virus, or to distinguish whether HIV-1 patients have HIV-2 dual infection, and can be used for tracking and quantitative detection of HIV-2 proviral DNA in animal organs, tissues, cells and blood during the research of HIV-2 nucleic acid drugs or vaccines in animal models. Sequence Listing <110> Shanghai Essar Biotechnology Co., Ltd. <120> Primers for specific detection of HIV-2 proviral DNA and their application <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 caggtagagc ctgggtgttc 20 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 ggtctttaag caagcaagcg t 21 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <400> 3 ttggccggta ctgggcagac ggctcc 26 BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 It is the enzyme digestion map of the standard plasmid.

[0049] Figure 2 This is the result of enzyme digestion verification of the standard plasmid.

[0050] Figure 3 It is the amplification curve diagram of HIV-2 primer / probe sensitivity verification.

[0051] Figure 4 It is the linearity graph of HIV-2 primer / probe standard curve.

[0052] Figure 5 It is an amplification curve diagram to verify the specificity and universal applicability of HIV-2 primers / probes.

[0053] Figure 6 This is the amplification curve of HIV-2 primer / probe linear verification. Example

[0054] The technical solution of the present invention is further described in detail below through embodiments and in conjunction with the accompanying drawings, but the present invention is not limited to the following embodiments.

[0055] Unless otherwise specified, the qPCR experimental methods in the following examples are all Taqman qPCR methods, and the sequences mentioned are all expressed from the 5' end to the 3' end.

[0056] 1. Materials and Methods

[0057] 1.1 Primer / probe design

[0058] According to the information of NCBI gene database, the relatively conservative 5'-terminal long terminal repeat sequence (LTR) of HIV-2 provirus was used as a template to design and synthesize primers and fluorescent probes (synthesized by Thermo Fisher Scientific, Waltham, MA, USA). The designed primers / fluorescent probes were compared and analyzed by blast to select primer sequences that only amplify HIV-2 virus and have no cross-reaction with other viruses. The primer and probe information is shown in the following table:

[0059] Primer name HIV-2 Gene ID 9628880 Forward Primer CAGGTAGAGCCTGGGTGTTC Reverse primer GGTCTTTAAGCAAGCAAGCGT Probe FAM-TTGGCCGGTACTGGGCAGACGGCTCC-NFQ-MGB

[0060] 1.2 Construction of HIV-2 standard plasmid DNA

[0061] The 200 bp HIV-2 proviral DNA fragment containing the amplified sequence was double-digested with XbaI and BamHI and cloned into the pUC57 vector. After the plasmid was successfully constructed, it was identified by enzyme digestion and purified to remove endotoxin. The purified plasmid DNA was measured by Nanodrop and diluted into a standard for use. The copy number contained was 3.13×10 8 copy / ng plasmid. Plasmid map is as follows Figure 1As shown, the enzyme digestion results are as follows Figure 2 shown.

[0062] 1.3 Sample selection

[0063] The above primers / probes, standard plasmid DNA, and the enzyme system required for the corresponding PCR reaction can be used to detect HIV-2 proviral DNA in the sample DNA through TaqMan qPCR reaction. In this detection system, we selected tissues or cells from humans, crab-eating macaques, New Zealand rabbits, SD rats and mice as samples, and used QIAGEN's genomic DNA extraction kit DNeasy Blood & Tissue Kit to extract animal tissue or cell genomic DNA according to the standard procedures provided by the kit to test the specificity and sensitivity of the qPCR system.

[0064] 1.4 Fluorescence quantitative PCR reaction

[0065] TaqMan qPCR amplification reaction was completed using an ABI 7500 (Applied Biosystems) instrument, using standard plasmid DNA as template and adding Universal PCR Master Mix (2×), human HIV-2 specific primers and fluorescently labeled probes were used for amplification detection. The internal quality control and quantification of the qPCR reaction were performed by using standard plasmid as the standard. A certain amount of plasmid DNA was used for gradient dilution and used for standard curve verification. The copy number was calculated and the linearity of the standard curve was verified (R 2 ≥0.99) to control the whole qPCR reaction.

[0066] The reaction system is:

[0067] Element Volume (μL) PCR Master Mix (2×) 10 HIV-2 Primer / Probe (20×) 1 Sample DNA 5 RNase / DNase-free water 4

[0068] The PCR reaction procedure was as follows: first, 50°C for 2 min to activate UDG, then 95°C for 10 min to completely activate the DNA polymerase, and finally 95°C for 15 sec and 60°C for 1 min for 40 cycles to amplify the template DNA and quantify the HIV-2 proviral DNA in the sample.

[0069] 1.5 Validation of the detection limit of TaqMan qPCR reaction

[0070] The standard plasmid DNA was diluted in series, and the lowest content that could be detected by qPCR reaction was used as the detection limit. The detection limit was set as the lowest point of the standard curve, and the DNA content that could be stably detected after more than 3 repeated tests was used as the lowest point of the standard curve in the qPCR reaction.

[0071] 1.6 Verification of the universal applicability of TaqMan qPCR reactions

[0072] The above detection limit is used as the lowest point of the qPCR reaction standard curve to prepare a plasmid DNA standard curve and perform HIV-2 TaqMan qPCR reaction. This reaction system is used to verify the specificity of HIV-2 primers and whether this primer has cross-reaction with DNA from other sample sources (such as normal humans, cynomolgus monkeys, New Zealand rabbits, mice and other animal sources).

[0073] 1.7 Data Analysis

[0074] All PCR results in the experiment were completed by ABI 7500 instrument, collected using 7500Software v2.4, processed by 7500Software v2.4 and Microsoft Excel 2007 software, and drawn by Adobe PhotoshopCS6 software. In addition, the coefficient of variation (CV) was used to express the numerical variability in the experiment: CV% = standard deviation / mean * 100%; the accuracy (RE) was calculated using the formula: RE% = (actual value - theoretical value) / theoretical value * 100%. Among them, samples without amplification were considered negative, and samples above the detection limit and with obvious amplification curves were considered positive.

[0075] 2. Experimental results

[0076] 2.1 Selection of HIV-2 specific primers and labeled probes

[0077] Due to the high variability of HIV-2 viral genes, selecting relatively conservative regions to design primers / probes can ensure accurate detection of HIV-2 in samples from multiple patient sources. After analyzing the conservation and sensitivity of primers designed for each HIV-2 gene sequence (21), we selected highly conservative LTR regions to design primers / probes and performed blast tests on them against the NCBI database. The test results showed that these primers / probes had no homology with SIV or HIV-1, as well as other types of viruses or other species, and had high specificity.

[0078] 2.2 Sensitivity of HIV-2-specific primers / probes

[0079] To verify the sensitivity of the HIV-2 TaqMan qPCR method, standard plasmid DNA (starting at 100 pg, 3.13 × 10 7 The amplification curve of the sample was shown in Figure 2. Figure 3The experimental results show that the HIV-2 primer / probe can detect plasmid DNA as low as 25 ag or 7.8 copies, with high sensitivity; and the amplification efficiency of the qPCR reaction is greater than 90%.

[0080] 2.3 Establishment of a highly sensitive HIV-2 TaqMan qPCR reaction system

[0081] HIV-2 specific primers / probes, Universal PCR Master Mix (2×) and HIV-2 standard plasmid DNA were used to establish the TaqMan qPCR reaction system. The standard curve samples in the system were diluted from HIV-2 standard plasmids. The starting concentration was 100pg plasmid DNA, and the samples were diluted 10 times. The sample concentrations after dilution were 100pg / 5μL, 10pg / 5μL, 1pg / 5μL, 100fg / 5μL, 10fg / 5μL, 1fg / 5μL, 100ag / 5μL, 50ag / 5μL, and 25ag / 5μL. After the amplification, the numerical results were fitted to the standard curve with the Ct value as the ordinate (Y) and the logarithm of the copy number as the abscissa (X) (the abscissa of the linear graph of the standard curve is still marked with the original value of the standard), as shown in the figure. Figure 4 As shown, the linear regression equation of the standard curve after fitting is: y = -3.509x + 37.64; the correlation coefficient R 2 =0.997. The standard curve was used to calculate the HIV-2 proviral DNA content in the sample to be tested.

[0082] At the same time, the inter-batch variability analysis of this qPCR reaction system was carried out. In three independent experiments, after the Ct value and the standard plasmid DNA copy number were regressed to the standard curve, the variability of the batch samples was low, indicating that the experimental method was stable and reliable.

[0083] Table 1 Comparison of average Ct values ​​and inter-assay coefficients of variation for each diluted sample in three independent experiments

[0084]

[0085]

[0086] 2.4 Specificity and universal applicability of HIV-2 qPCR reaction system

[0087] In order to verify the specificity and universal applicability of the HIV-2 qPCR reaction system, HIV-2 primers / probes were used to amplify plasmid DNA with different copy numbers (from 31300000 to 7.8 copies) as well as genomic DNA from humans, cynomolgus monkeys, New Zealand rabbits, SD rats, and mice. The amplification curves are shown in Figure 2. Figure 5As shown, it was found that the HIV-2 primer / probe can specifically and stably detect HIV-2 in the plasmid without cross-reaction with the above-mentioned genomic DNA of humans and various animals.

[0088] The above results show that the HIV-2qPCR reaction system is highly specific, can stably detect HIV-2 provirus in samples, and will not have any cross-reaction with the genomes of other species.

[0089] 2.5 Dilution linearity of HIV-2 qPCR reaction system

[0090] In order to verify the linearity of HIV-2 specific primers / probes and qPCR reaction system, HIV-2 standard plasmid DNA (starting at 3.13×108copy) was diluted 20 times, 400 times, 8000 times and 160000 times respectively for qPCR detection. The amplification curve is shown in the figure. Figure 6 As shown, the analysis and comparison of the numerical results revealed that all the actual measured concentrations were linearly related to the sample dilution multiples.

[0091] Then the values ​​of the diluted samples of the four gradients were calculated, and the average values ​​of the two groups were taken. The results are shown in Table 2: the actual values ​​measured were slightly different from the theoretical values, with high accuracy; at the same time, the variability between the replicate wells of each dilution gradient sample was low.

[0092] Table 2 Comparison of accuracy and variability of each sample in the dilution linearity experiment

[0093] Dilute the sample Theoretical copy number Actual copy number Accuracy (RE%) Variation (CV%) 20× 15650000 13867578 -11.4 7.9 400× 782500 870311.2 11.2 7.2 8000× 39125 37189.67 -4.9 1.5 160000× 1956.25 1761.137 -10.0 1.0

[0094] 3. Clinical sample testing

[0095] In this study, a total of 52 serologically confirmed HIV-2 positive samples and 119 serologically confirmed HIV-2 negative samples were tested.

[0096] The test results of this method and the test results of the standard control method are shown in Table 3, wherein "this method" refers to the method of detecting according to the primers, probes, experimental methods described in the aforementioned "1. Materials and Methods" and the standard curve described in "2. Experimental Results", and the "standard control method" refers to the MIKROGEN recomLine HIV-1&HIV-2IgG strip immunoassay.

[0097] Table 3 Comparison of the test results of this method and the standard control method

[0098]

[0099] According to the test results of the control method, the subjects were divided into a positive group and a negative group, and the test results of this method were compared with the results of the control method. The results of the compliance rate are as follows:

[0100] Diagnostic sensitivity = 52 / (52+0)×100% = 100%

[0101] Diagnostic specificity = 117 / (2+117)×100% = 98.32%

[0102] Total compliance rate = (52 + 117) / (52 + 0 + 2 + 117) × 100% = 98.83%.

[0103] 4. Discussion

[0104] HIV-2 infected people have relatively low viral loads in their blood, so highly sensitive methods are needed for detection. The inventors have invented an HIV-2-specific TaqMan qPCR assay that can be used to detect HIV-2 proviral DNA in patients, which can play an important role in HIV-2 patient diagnosis and HIV-2 vaccine research.

[0105] Previous studies have shown that HIV-2 infected people have higher CD4 cell counts than HIV-1 infected people, both in the early stages of infection and when they have developed AIDS. This difference in CD4 cell count may be related to the low replication rate of HIV-2, which is mainly attributed to the characteristics of the HIV-2 virus, lower immune hyperactivation, better immune control, or a stronger inhibitory effect of the immune system on it (11,22). Therefore, in the absence of a reliable HIV-2 detection kit, people often use monitoring of CD4 cell counts to detect HIV-2 infection. However, this method cannot determine in advance whether a patient is infected with HIV, and cannot distinguish between infection with HIV-1 / 2 or other diseases, so it has great defects.

[0106] The antibody detection (such as ELISA or WB) and PCR detection methods developed in recent years have significantly improved the sensitivity of virus detection, especially the HIV-2-specific qPCR detection method, which can detect and quantify the provirus in blood samples. Ferns can directly detect HIV-2 viral RNA in plasma through LTR-specific reverse transcription-PCR (RT-PCR) method (23). Gueudin et al. can quantitatively detect HIV-2 provirus in patient PBMC by using qPCR (Real-time Quantitative PCR) technology targeting HIV-2 LTR region specific primers, indicating the high specificity of this method and the stability of repeated experiments between batches. The negative correlation between HIV-2 provirus load and CD4 cell count was determined (24), suggesting that HIV-2 viral load can be determined by detecting HIV-2 provirus DNA. Based on this principle, we designed specific primers and probes for HIV-2 provirus LTR and invented this method to detect HIV-2 provirus content in samples.

[0107] Compared with other detection methods, this method detects HIV proviral DNA through qPCR technology. The detection method avoids the reverse transcription step, is simpler than the RT-PCR method for detecting HIV-2 mRNA, and has high sensitivity. It can quickly determine HIV-2 infection and quantitatively detect the integration content of HIV-2 provirus. In addition, this method has high specificity in detecting HIV-2 provirus, and no cross reaction is found with HIV-1 or SIV gene sequences. The primers / probes designed by the conserved LTR region can detect multiple subtypes of HIV-2 virus and can be widely used in basic research and preclinical diagnosis of HIV-2 virus. This method and primers have no cross reaction with genomic DNA of samples from hosts and other animal sources (such as crab-eating macaques, New Zealand rabbits, mice, etc.), and can be used to detect whether biological products derived from these animals and their cells are infected or contaminated by HIV-2.

[0108] Another advantage of qPCR technology for HIV-2 provirus detection is that it can detect viruses in long-term stored samples in batches. Compared with RNA, the double-stranded structure of DNA makes it more stable and can be stored at low temperatures (such as -80°C) for 1 year or more without damage; and DNA samples can come from any organ / tissue of the human body, not just blood, so it has more advantages in detecting large batches of samples.

[0109] Moreover, since this primer / probe specifically detects HIV-2 and has no cross-reaction with the genomic DNA of other animals such as monkeys, rabbits, and mice, it can also be used to detect whether experimental animals have been infected with HIV-2 and monitor the biosafety of experimental animal models.

[0110] Although there are many HIV-2 subtypes, the primers / probes designed by us for its conserved LTR region can circumvent this difference and be used to detect multiple HIV-2 subtypes. Recently, a "semi-automated high-sensitivity plasma HIV-2 RNA PCR detection method" designed using LTR region primers / probes has been used clinically (25), but only limited subtype B samples are used for sensitivity analysis.

[0111] The HIV-2 provirus detection method we designed has strong specificity, high sensitivity, a wide sample source, and a large detection range. It can be widely used in HIV-2 laboratory or preclinical testing, providing a reliable, rapid and convenient means for the timely discovery of the virus.

[0112] References:

[0113] 1.Gallo RC, Sarin PS, Gelmann EP, Robert-Guroff M, Richardson E, Kalyanaraman VS, et al. Isolation of human T-cell leukemia virus in acquiredimmune deficiency syndrome (AIDS). Science. 1983; 220 (4599): 865-7.

[0114] 2.Barin F, Cazein F, Lot F, Pillonel J, Brunet S, Thierry D, et al. Prevalence of HIV-2and HIV-1group O infections among new HIV diagnoses in France:2003-2006.AIDS.2007;21(17):2351-3.

[0115] 3. Valadas E, Antunes F. HIV-2: the Portuguese connection. Clin InfectDis. 2004; 39(10): 1553-4; author reply 4.

[0116] 4.Tchounga B,Ekouevi DK,Balestre E,Dabis F.Mortality and survivalpatterns of people living with HIV-2.Curr Opin HIV AIDS.2016;11(5):537-44.

[0117] 5.Esbjornsson J,Mansson F,Kvist A,da Silva ZJ,Andersson S,Fenyo EM,etal.Long-term follow-up of HIV-2-related AIDS and mortality in Guinea-Bissau:aprospective open cohort study.Lancet HIV.2018.

[0118] 6.Le Hingrat Q,Charpentier C,Ghosn J,Thiebaut R,Peytavin G,DescampsD,et al.New insights are game-changers in HIV-2 disease management.LancetHIV.2019;6(4):e214.

[0119] 7.Chen Z,Luckay A,Sodora DL,Telfer P,Reed P,Gettie A,et al.Humanimmunodeficiency virus type 2(HIV-2)seroprevalence and characterization of adistinct HIV-2 genetic subtype from the natural range of simianimmunodeficiency virus-infected sooty mangabeys.J Virol.1997;71(5):3953-60.

[0120] 8.Damond F,Gueudin M,Pueyo S,Farfara I,Robertson DL,Descamps D,etal.Plasma RNA viral load in human immunodeficiency virus type 2 subtype A andsubtype B infections.J Clin Microbiol.2002;40(10):3654-9.

[0121] 9.Peng JY,Zheng J,He JM,Jiang Y,Yao D,Chen X.[Diagnostic andepidemiological features of the first two HIV-2 indigenous infections inHunan province].Zhonghua Liu Xing Bing Xue Za Zhi.2018;39(8):1077-81.

[0122] 10.Simon F,Matheron S,Tamalet C,Loussert-Ajaka I,Bartczak S,Pepin JM,et al.Cellular and plasma viral load in patients infected with HIV-2.AIDS.1993;7(11):1411-7.

[0123] 11.MacNeil A,Sarr AD,Sankale JL,Meloni ST,Mboup S,Kanki P.Directevidence of lower viral replication rates in vivo in human immunodeficiencyvirus type 2(HIV-2)infection than in HIV-1 infection.J Virol.2007;81(10):5325-30.

[0124] 12.Ekouevi DK,Balestre E,Coffie PA,Minta D,Messou E,Sawadogo A,etal.Characteristics of HIV-2 and HIV-1 / HIV-2 Dually Seropositive Adults inWest Africa Presenting for Care and Antiretroviral Therapy:The IeDEA-WestAfrica HIV-2 Cohort Study.PLoS One.2013;8(6):e66135.

[0125] 13.Looney DJ,Fisher AG,Putney SD,Rusche JR,Redfield RR,Burke DS,etal.Type-restricted neutralization of molecular clones of humanimmunodeficiency virus.Science.1988;241(4863):357-9.

[0126] 14.Pan HX,Huang QF,Ren YN,Xing WW.[Progress in HIV-2 detectionmethodology].Zhonghua Liu Xing Bing Xue Za Zhi.2019;40(7):864-9.

[0127] 15.Arya M,Shergill IS,Williamson M,Gommersall L,Arya N,Patel HR.Basicprinciples of real-time quantitative PCR.Expert Rev Mol Diagn.2005;5(2):209-19.

[0128] 16.Schutten M,van den Hoogen B,van der Ende ME,Gruters RA,OsterhausAD,Niesters HG.Development of a real-time quantitative RT-PCR for thedetection of HIV-2 RNA in plasma.J Virol Methods.2000;88(1):81-7.

[0129] 17.Drylewicz J,Matheron S,Lazaro E,Damond F,Bonnet F,Simon F,etal.Comparison of viro-immunological marker changes between HIV-1 and HIV-2-infected patients in France.AIDS.2008;22(4):457-68.

[0130] 18.Delarue S,Didier E,Damond F,Ponscarme D,Brengle-Pesce K,Resche-Rigon M,et al.Highly sensitive plasma RNA quantification by real-time PCR inHIV-2 group A and group B infection.J Clin Virol.2013;58(2):461-7.

[0131] 19.Ferrer P,Montecinos L,Tello M,Tordecilla R,Rodriguez C,Ferres M,etal.HIV-1 tropism:a comparison between RNA and proviral DNA in routineclinical samples from Chilean patients.Virol J.2013;10:318.

[0132] 20.Behrendt R,Fiebig U,Norley S,Gurtler L,Kurth R,Denner J.Aneutralization assay for HIV-2based on measurement of provirus integration byduplex real-time PCR.J Virol Methods.2009;159(1):40-6.21.Walther L,GrankvistO,Mirzai B,da Silva Z,Fredlund H,Biberfeld G,et al.Optimization of polymerasechain reaction for detection of HIV type 2 DNA.AIDS Res HumRetroviruses.1998;14(13):1151-6.

[0133] 22.de Silva TI,Cotten M,Rowland-Jones SL.HIV-2:the forgotten AIDSvirus.Trends Microbiol.2008;16(12):588-95.

[0134] 23.Ferns RB,Garson JA.Development and evaluation of a real-time RT-PCR assay for quantification of cell-free human immunodeficiency virus type 2using a Brome Mosaic Virus internal control.J Virol Methods.2006;135(1):102-8.

[0135] 24.Gueudin M,Damond F,Braun J,Taieb A,Lemee V,Plantier JC,etal.Differences in proviral DNA load between HIV-1-and HIV-2-infectedpatients.AIDS.2008;22(2):211-5.

[0136] 25.Chang M,Gottlieb GS,Dragavon JA,Cherne SL,Kenney DL,Hawes SE,etal.Validation for clinical use of a novel HIV-2 plasma RNA viral load assayusing the Abbott m2000 platform.J Clin Virol.2012;55(2):128-33.

Claims

1. Use of a primer pair for specifically detecting HIV-2 proviral DNA in detecting HIV-2 proviral DNA in a sample, wherein the use is non-diagnostic, and the primer pair comprises a forward primer 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1) and a reverse primer 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2).

2. Use of a primer pair for specifically detecting HIV-2 proviral DNA in preparing a reagent for detecting HIV-2 proviral DNA in a sample, the primer pair comprising a forward primer 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1) and a reverse primer 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2).

3. Application of a primer and probe combination for specific detection of HIV-2 proviral DNA in detecting HIV-2 proviral DNA in a sample, wherein the application is non-diagnostic, the primers comprising a forward primer and a reverse primer, wherein the forward primer is 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1), and the reverse primer is 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2); the sequence of the probe is 5'-TTGGCCGGTACTGGGCAGACGGCTCC-3' (SEQ ID NO: 3), the 5' end of the probe is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher group.

4. Use of a primer and probe combination for specifically detecting HIV-2 proviral DNA in the preparation of a reagent for detecting HIV-2 proviral DNA in a sample, the primer comprising a forward primer and a reverse primer, wherein the forward primer is 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1), and the reverse primer is 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2); the sequence of the probe is 5'-TTGGCCGGTACTGGGCAGACGGCTCC-3' (SEQ ID NO: 3), the 5' end of the probe is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher group.

5. The use according to claim 3 or 4, wherein the reporter fluorescent group labeled at the 5' end of the probe is FAM, and the quencher group labeled at the 3' end is NFQ-MGB or TAMRA.

6. The use according to any one of claims 1 to 4, wherein the detection is qPCR detection or digital PCR detection.

7. Non-diagnostic methods for detecting HIV-2 proviral DNA in samples, including using a primer pair that specifically detects HIV-2 proviral DNA, or using a primer and probe combination that specifically detects HIV-2 proviral DNA, performing qPCR on sample DNA, and qualitatively or quantitatively analyzing whether HIV-2 proviral DNA is present in the sample based on the qPCR test results; The primer pair includes a forward primer 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1) and a reverse primer 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2); The primer in the primer and probe combination is the primer pair, the sequence of the probe is 5'-TTGGCCGGTACTGGGCAGACGGCTCC-3' (SEQ ID NO: 3), the 5' end of the probe is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher group.

8. A non-diagnostic method for detecting HIV-2 proviral DNA in a sample, comprising the following steps: (1) Extracting DNA from samples; (2) using a primer pair that specifically detects HIV-2 proviral DNA, or using a primer and probe combination that specifically detects HIV-2 proviral DNA, to perform qPCR detection on HIV-2 proviral DNA standards and sample DNA, wherein the HIV-2 proviral DNA standards are samples of different given concentrations prepared with plasmid DNA containing HIV-2 proviral DNA fragments; wherein the primer pair comprises a forward primer 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1) and a reverse primer 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2), wherein the primer in the primer and probe combination is the primer pair, the sequence of the probe is 5'-TTGGCCGGTACTGGGCAGACGGCTCC-3' (SEQ ID NO: 3), and the 5' end of the probe is labeled with a reporter fluorescent group, and the 3' end of the probe is labeled with a quencher group; (3) The qPCR test results of HIV-2 proviral DNA standards were used to prepare a standard curve and fit a linear equation, where R 2 ≥0.99; and the accuracy (RE%) of each standard concentration is -75% to 150%, and the lowest concentration that can be stably detected is determined; (4) Result determination: If a clear amplification curve appears in the qPCR results of the sample DNA, and the Ct value of the qPCR of the sample DNA is less than the Ct value of the lowest concentration point, it is a positive result, that is, HIV-2 proviral DNA is present in the sample; If there is no obvious amplification curve, or if there is an amplification curve but the Ct value is greater than the Ct value at the lowest concentration point of the standard curve, it is a negative result, that is, there is no HIV-2 proviral DNA in the sample.

9. The method according to claim 8, wherein step (4) further comprises: The concentration of HIV-2 proviral DNA in the sample DNA was determined based on the Ct value of the sample DNA and the fitted standard curve.

10. A non-diagnostic method for detecting HIV-2 proviral DNA in a sample, comprising the following steps: (1) Extracting DNA from samples; (2) using a primer pair that specifically detects HIV-2 proviral DNA, or using a primer and probe combination that specifically detects HIV-2 proviral DNA, to perform qPCR detection on HIV-2 proviral DNA standards and sample DNA, wherein the HIV-2 proviral DNA standards are samples of different given concentrations prepared with plasmid DNA containing HIV-2 proviral DNA fragments; wherein the primer pair comprises a forward primer 5'-CAGGTAGAGCCTGGGTGTTC-3' (SEQ ID NO: 1) and a reverse primer 5'-GGTCTTTAAGCAAGCAAGCGT-3' (SEQ ID NO: 2), wherein the primer in the primer and probe combination is the primer pair, the sequence of the probe is 5'-TTGGCCGGTACTGGGCAGACGGCTCC-3' (SEQ ID NO: 3), and the 5' end of the probe is labeled with a reporter fluorescent group, and the 3' end of the probe is labeled with a quencher group; (3) The qPCR test results of HIV-2 proviral DNA standards were used to prepare a standard curve and fit a linear equation, where R 2 ≥0.99; and the accuracy (RE%) of each standard concentration is -75% to 150%, and the lowest concentration that can be stably detected is determined; (4) Result determination: Determine the concentration of HIV-2 proviral DNA in the sample DNA based on the Ct value of the sample DNA and the fitted standard curve.

Images