Molecular Detection of Enterovirus and Echovirus
By amplifying the nucleic acids of enterovirus and bisexovirus in biological samples, combined with reverse transcription and real-time PCR technology, the complex and numerous diagnostic problems in the prior art are solved, and rapid and simple virus detection and distinction are achieved.
Patent Information
- Application Number
- CN202110548413.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2014-04-28
- Filing Date
- 2015-04-28
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2035-04-28
AI Technical Summary
Prior art When diagnosing enterovirus and bisexovirus, sample processing and viral nucleic acid detection are complex, requiring multiple steps and high technical requirements, and it is difficult to distinguish multiple types of viruses with the minimum number of steps in the human body.
Enterovirus and bisexual virus nucleic acids were amplified in biological samples using specific primer pairs, using reverse transcription and real-time PCR techniques to detect and distinguish enterovirus and bisexual virus directly from untreated biological samples.
The rapid and simple detection of the presence of enterovirus and bisexual virus in biological samples is achieved, which reduces sample processing steps, improves detection efficiency, and can distinguish multiple virus types in human samples.
Smart Images

Figure GDA0005072242540000251 
Figure GDA0005072242540000252 
Figure GDA0005072242540000261
Abstract
Description
[0001] This application is a divisional application of Chinese Patent Application No. 201580034925.0 (filing date: April 28, 2015, invention title: Molecular Detection of Enterovirus and Bicistrovirus). Field of the Invention
[0002] The present invention relates to methods for detecting and differentiating enteroviruses and bicistroviruses in biological samples. Background of the Invention
[0003] The following discussion of the background of the invention is provided only to assist the reader in understanding the invention and is not an admission that the invention is described as prior art or constitutes prior art.
[0004] Enteroviruses belong to the Picornaviridae family of viruses. They are transmitted from person to person by direct contact with viruses shed from the gastrointestinal or upper respiratory tract and affect millions of people worldwide each year. They are commonly found in respiratory secretions such as saliva, sputum, or nasal mucus, feces, and cerebrospinal fluid of infected individuals. Enterovirus infections can cause a variety of symptoms ranging from mild respiratory illness (common cold), hand, foot, and mouth disease, acute hemorrhagic conjunctivitis, aseptic meningitis, myocarditis, severe neonatal sepsis-like disease, and acute flaccid paralysis. Historically, poliomyelitis was the most notable disease caused by the enterovirus poliovirus. However, there are at least 62 non-polio enteroviruses that can cause disease in humans, including Coxsackie A virus, Coxsackie B virus, and echovirus.
[0005] Bicistroviruses are a genus of viruses in the Picornaviridae family, a large family of non-enveloped, positive-sense, single-stranded RNA viruses with an icosahedral capsid. The capsid is an arrangement of 60 protomers, each formed by 4 proteins (VP1-VP4), and encloses a linear RNA genome. The genus Bicistrovirus consists of two species: Human bicistrovirus and Ljungan virus. Human bicistrovirus is widely spread and causes mild gastrointestinal or respiratory diseases but is also involved in cases of myocarditis and encephalitis. More than 95% of people are infected with human bicistrovirus early in life (within the age range of 2-5 years).
[0006] Clinical detection of viruses is typically accomplished using any of a variety of methods. For example, virus particles or nucleic acids can be isolated from biological samples (such as cerebrospinal fluid, nasopharyngeal aspirates, throat swabs, blood, feces, urine, etc.). Retrospective diagnosis can be accomplished serologically. Although hemagglutination inhibition (HAI) and enzyme immunoassay (EIA) can be used to give type-specific diagnoses, the complement fixation test (CFT) is most widely used in this method. For more rapid diagnosis, antigen detection or RNA detection can be implemented. However, due to the large number of viruses in these families, screening of multiple antigens or nucleotide sequences is necessary. In addition, it is often necessary to extract nucleic acids from crude biological samples in order to accurately detect the presence of nucleic acids from microorganisms.
[0007] Given the high degree of complexity associated with the preparation and processing of viral nucleic acids from biological samples for detection, diagnosis, and / or quantification in the case of rapid diagnosis, methods involving fewer steps, fewer technical requirements, and shorter durations are needed. In addition, there is a further need for methods capable of differentiating multiple types of enteroviruses and parechoviruses from other viruses in humans with a minimum number of steps and without the need to extract nucleic acids from the sample. Summary of the Invention
[0008] Provided herein are methods for determining the presence or absence of enteroviruses and / or parechoviruses in a biological sample.
[0009] In one aspect, the present invention provides a method for determining the presence or absence of enteroviruses in a sample, the method comprising: if enteroviruses are present in the sample, amplifying enterovirus nucleic acids using at least one primer pair, wherein the first primer of the primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:1 or its complete complement or consisting of the same, and the second primer of the primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:2 or its complete complement or consisting of the same.
[0010] In some embodiments, a method for determining the presence or absence of enterovirus in a sample includes: (a) heating a biological sample to a first predetermined temperature for a first predetermined time to separate RNA secondary structures present in the sample; (b) contacting the sample with a reaction mixture to form a reaction mixture, wherein the reaction mixture comprises a primer pair, a DNA polymerase, a reverse transcriptase, and a plurality of free nucleotides containing adenine, thymine, cytosine, and guanine, wherein one primer of the primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:1 or its complete complement or consisting thereof, and the other primer of the primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:2 or its complete complement or consisting thereof; (c) cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions that permit RNA reverse transcription; (d) amplifying a target nucleic acid sequence, wherein the amplification comprises the steps of cooling the reaction mixture to a third predetermined temperature for a third predetermined time under conditions that permit the primer element of the primer to hybridize to its complementary sequence on the first and second strands of the cDNA (if present) and permit the DNA polymerase to extend the primer; and (e) repeating step (d). If an enterovirus target sequence is amplified in the reaction mixture to produce an amplicon, it is determined that enterovirus is present in the sample. In some embodiments, step (a) is performed before step (b) (e.g., heating the biological sample and contacting the heated sample with the reaction mixture to form a reaction mixture). In some embodiments, step (b) is performed before step (a) (e.g., contacting the biological sample with the reaction mixture to form a reaction mixture and subsequently heating the reaction mixture comprising the biological sample).
[0011] In some embodiments, the first primer of the primer pair for detecting enterovirus has a primer element that is at least 90% identical to SEQ ID NO:1 or the complete complement of SEQ ID NO:1 and a detectable label that is not a nucleic acid. In some embodiments, the first primer is a primer-probe. In some embodiments, the primer-probe has a probe element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:3 or the complete complement of SEQ ID NO:3. The probe element may further comprise a quencher, a fluorophore, and two self-complementary stem sequences, wherein each stem sequence is at least 4, 5, 6, or 7 nucleotides in length. Additionally, the second primer of the primer pair may have a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:2 or the complete complement of SEQ ID NO:2.
[0012] In some embodiments, the first primer of the primer pair for detecting enterovirus has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:2 or the complete complement of SEQ ID NO:2 and a detectable label that is not a nucleic acid. In some embodiments, the first primer is a primer-probe. In some embodiments, the primer-probe has a probe element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:3 or the complete complement of SEQ ID NO:3. In some embodiments, the probe element further comprises a quencher, a fluorophore, and two self-complementary stem sequences, each stem sequence having a length of at least 4, 5, 6, or 7 nucleotides. In some embodiments, the second primer of the primer pair may have a primer element that is at least 90% identical to SEQ ID NO:1 or the complete complement of SEQ ID NO:1.
[0013] Another aspect of the present invention provides a method for determining the presence or absence of Echovirus in a sample, the method comprising: if Echovirus is present in the sample, amplifying Echovirus nucleic acid using at least one pair of primers, wherein the first primer of the primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:4 or its complete complement or consisting of the same, and the second primer of the primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:5 or its complete complement or consisting of the same.
[0014] In some embodiments, a method for determining the presence or absence of Echovirus in a sample includes: (a) heating a biological sample to a first predetermined temperature for a first predetermined time to separate RNA secondary structures present in the sample, providing a reaction mixture comprising the sample, a primer pair, and a DNA polymerase, (b) contacting the sample with a reaction mixture to form a reaction mixture, wherein the reaction mixture comprises a primer pair, a DNA polymerase, a reverse transcriptase, and a plurality of free nucleotides containing adenine, thymine, cytosine, and guanine, wherein one primer of the primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:4 or its complete complement or consisting of the same, and the other primer of the primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:5 or its complete complement or consisting of the same, (c) cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions that permit RNA reverse transcription, (d) amplifying a target nucleic acid sequence, wherein amplification includes the steps of cooling the reaction mixture to a third predetermined temperature for a third predetermined time under conditions that permit the primer elements of the primers to hybridize to their complementary sequences on the first and second strands of the cDNA (if present) and permit the DNA polymerase to extend the primers, and (e) repeating step (d). If an Echovirus target sequence is amplified in the reaction mixture to produce an amplicon, it is determined that Echovirus is present in the sample. In some embodiments, step (a) is performed before step (b) (e.g., heating the biological sample and contacting the heated sample with the reaction mixture to form a reaction mixture). In some embodiments, step (b) is performed before step (a) (e.g., contacting the biological sample with the reaction mixture to form a reaction mixture and subsequently heating the reaction mixture comprising the biological sample).
[0015] In some embodiments, the first primer of a primer pair for detecting Echovirus has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:4 or the complete complement of SEQ ID NO:4 and a detectable label that is not a nucleic acid. In some embodiments, the first primer is a primer-probe. In some embodiments, the primer-probe has a probe element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:6 or the complete complement of SEQ ID NO:6. In some embodiments, the probe element may further comprise a quencher, a fluorophore, and two self-complementary stem sequences, wherein each stem sequence has a length of at least 4, 5, 6, or 7 nucleotides. Additionally, in some embodiments, the second primer of the primer pair may have a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:5 or the complete complement of SEQ ID NO:5.
[0016] In some embodiments, the first primer of the primer pair for detecting echovirus has a primer element that is at least 90% identical to SEQ ID NO: 5 or the complete complement of SEQ ID NO: 5 and a detectable label that is not a nucleic acid. In some embodiments, the first primer is a primer-probe. In some embodiments, the primer-probe has a nucleotide sequence that is at least 90% identical to SEQ ID NO: 6 or the complete complement of SEQ ID NO: 6. The probe element may further comprise a quencher, a fluorophore, and two self-complementary stem sequences, each stem sequence having a length of at least 4, 5, 6, or 7 nucleotides. Additionally, the second primer of the primer pair may have a primer element that is at least 90% identical to SEQ ID NO: 4 or the complete complement of SEQ ID NO: 4.
[0017] In some embodiments, the disclosed method is used to determine the presence or absence of enterovirus and echovirus in a sample, the sample being a biological sample selected from the group consisting of cerebrospinal fluid, blood, feces, throat swab, rectal swab, nasopharyngeal swab, plasma, serum, and urine. In some embodiments, nucleic acid is not extracted from the biological sample prior to reverse transcription and amplification. In some embodiments, the sample contains cDNA reverse transcribed from RNA. In some embodiments, the sample contains RNA, the reaction mixture further contains a reverse transcriptase, and the reaction mixture is heated to a predetermined temperature for a predetermined time to separate the RNA secondary structure in the sample and then cooled to reverse transcribe the RNA in the sample into cDNA in the presence of the reverse transcriptase.
[0018] Another aspect of the present invention provides a method for detecting the presence or absence of enterovirus and echovirus in a sample, comprising: (a) heating a biological sample to a first predetermined temperature for a first predetermined time to separate RNA secondary structures present in the sample; (b) contacting the sample with a reaction mixture to form a reaction mixture, wherein the reaction mixture comprises first and second primer pairs, a DNA polymerase, a reverse transcriptase, and a plurality of free nucleotides containing adenine, thymine, cytosine, and guanine, wherein one primer of the first primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:1 or its complete complement or consisting thereof, and the other primer of the first primer pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:2 or its complete complement or consisting thereof, and wherein one primer of the second primer pair has a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:4 or its complete complement or consisting thereof, and the other primer of the second primer pair has a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:5 or its complete complement or consisting thereof; (c) cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions that permit RNA reverse transcription; (d) amplifying a target nucleic acid sequence, wherein the amplification comprises the steps of cooling the reaction mixture to a third predetermined temperature for a third predetermined time under conditions that permit the primer elements of the primers to hybridize to their complementary sequences on the first and second strands of the cDNA (if present) and that permit the DNA polymerase to extend the primers; and (e) repeating step (d). If an enterovirus target sequence is amplified in the reaction mixture to produce an amplicon, it is determined that enterovirus is present in the sample, and if an echovirus target sequence is amplified in the reaction mixture to produce an amplicon, it is determined that echovirus is present in the sample. In some embodiments, step (a) is performed before step (b) (e.g., heating the biological sample and contacting the heated sample with the reaction mixture to form a reaction mixture). In some embodiments, step (b) is performed before step (a) (e.g., contacting the biological sample with the reaction mixture to form a reaction mixture and subsequently heating the reaction mixture comprising the biological sample).
[0019] Another aspect of the present invention provides a composition comprising a primer having a primer element that is at least 90% identical to a sequence selected from the group consisting of: SEQ ID NO:1, the complete complement of SEQ ID NO:1, SEQ ID NO:2, the complete complement of SEQ ID NO:2, SEQ ID NO:4, the complete complement of SEQ ID NO:4, SEQ ID NO:5, and the complete complement of SEQ ID NO:5. In some embodiments, the primer is directly or indirectly linked to a detectable label. The composition can be a primer-probe that further comprises a probe element directly or indirectly linked to the primer element by a polymerase-blocking group, wherein the probe element comprises a nucleic acid sequence that is at least 90% identical to: SEQ ID NO:3, the complete complement of SEQ ID NO:3, SEQ ID NO:6, or the complete complement of SEQ ID NO:6. In some embodiments, the primer-probe further comprises a quencher dye, and the detectable label is a fluorophore.
[0020] In one specific embodiment, the primer-probe comprises a 5′ quencher dye, SEQ ID NO:3 flanked by two self-complementary nucleotide sequences of at least 4 nucleotides in length, a fluorophore, and / or a nucleic acid comprising SEQ ID NO:2. In another specific embodiment, the primer-probe comprises a 5′ fluorophore, a nucleic acid comprising SEQ ID NO:6 flanked by two self-complementary nucleotide sequences of at least 4 nucleotides in length, a quencher dye, and a nucleic acid comprising SEQ ID NO:5. In some embodiments, the primer-probe further comprises a spacer consisting of polyethylene glycol. In some embodiments, the spacer comprises an 18-atom polyethylene glycol-based linker. In some embodiments, the spacer consists of a non-nucleotide material (i.e., a non-nucleotide spacer). In some embodiments, the spacer can be adjacent to the 5′ of the primer element.
[0021] The present invention also provides a kit, which comprises the oligonucleotides, primers and primer-probes disclosed herein. In one embodiment, the kit comprises a first primer having a primer element and a second primer having a primer element, wherein the primer element of the first primer specifically hybridizes to a nucleic acid comprising SEQ ID NO:1 or its complete complement or consisting thereof, and the primer element of the second primer specifically hybridizes to a nucleic acid comprising SEQ ID NO:2 or its complete complement or consisting thereof, and at least one of the primers is labeled with a non-nucleic acid detectable label. In one embodiment, the kit comprises a first primer having a primer element and a second primer having a primer element, wherein the primer element of the first primer specifically hybridizes to a nucleic acid comprising SEQ ID NO:4 or its complete complement or consisting thereof, and the primer element of the second primer specifically hybridizes to a nucleic acid comprising SEQ ID NO:5 or its complete complement or consisting thereof, and at least one of the primers is labeled with a non-nucleic acid detectable label.
[0022] In one embodiment, the kit comprises (a) a first primer pair containing a first primer and a second primer, the first primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:1 or its complete complement or consisting thereof, and the second primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:2 or its complete complement or consisting thereof; and (b) a second primer pair containing a first primer and a second primer, the first primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:3 or its complete complement or consisting thereof, and the second primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:5 or its complete complement or consisting thereof, wherein at least one of the primers of the first and second primer pairs is labeled with a non-nucleic acid detectable label.
[0023] In one embodiment, a kit is provided that comprises a primer pair for detecting enteroviruses and a primer pair for detecting parechoviruses as described herein. Another embodiment provides a kit that comprises a primer pair for detecting at least 64 enterovirus serotypes and a primer pair for detecting at least 8 parechovirus serotypes.
[0024] Another aspect of the present invention provides a method for amplifying a target nucleotide sequence, comprising providing a reaction mixture comprising double-stranded target DNA, a primer pair (wherein the first primer specifically hybridizes to a nucleic acid comprising SEQ ID NO:1 or its complete complement or consisting thereof, and the second primer specifically hybridizes to a nucleic acid comprising SEQ ID NO:2 or its complete complement or consisting thereof), a DNA polymerase, and a plurality of free nucleotides containing adenine, thymine, cytosine, and guanine; heating the reaction mixture to a first predetermined temperature for a first predetermined time to separate the strands of the double-stranded DNA from each other; cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions that allow the first and second primers to hybridize to their complementary sequences on the first and second strands of the target DNA and allow the DNA polymerase to extend the primers, and repeating the above steps. In some embodiments, at least one of the primers is a primer-probe comprising a detectable label that is not a nucleic acid. In some embodiments, the primers are the primers as described herein. In some embodiments, the DNA is cDNA.
[0025] Another aspect of the present invention provides a method for amplifying a target nucleotide sequence, comprising providing a reaction mixture comprising double-stranded target DNA, a primer pair (wherein the first primer specifically hybridizes to a nucleic acid comprising SEQ ID NO:4 or its complete complement or consisting thereof, and the second primer specifically hybridizes to a nucleic acid comprising SEQ ID NO:5 or its complete complement or consisting thereof), a DNA polymerase, and a plurality of free nucleotides containing adenine, thymine, cytosine, and guanine; heating the reaction mixture to a first predetermined temperature for a first predetermined time to separate the strands of the double-stranded DNA from each other; cooling the reaction mixture to a second predetermined temperature for a second predetermined time under conditions that allow the first and second primers to hybridize to their complementary sequences on the first and second strands of the target DNA and allow the DNA polymerase to extend the primers, and repeating the above steps. In some embodiments, at least one of the primers is a primer-probe comprising a detectable label that is not a nucleic acid. In some embodiments, the primers are the primers as described herein. In some embodiments, the DNA is cDNA.
[0026] The methods disclosed herein can additionally be used to diagnose an individual as being infected with an enterovirus or a parechovirus. DETAILED DESCRIPTION OF THE INVENTION
[0027] The present invention is directed to a diagnostic method for detecting enteroviruses and parechoviruses using a multiplexed analyte detection system. The method does not require an extraction or purification step to isolate viral (i.e., target) nucleic acids prior to PCR. The disclosed method can detect 64 enterovirus serotypes and parechovirus serotypes 1 - 8 in unextracted human biological samples.
[0028] More specifically, the sample-to-answer assay of the present disclosure is designed as a moderately complex multiplexed analyte detection system, where initially is sample preparation, followed by reverse transcription and real-time polymerase chain reaction (PCR) detection and discrimination of target enterovirus and parechovirus analytes. In some embodiments, both reverse transcription and real-time PCR are implemented in a centrifugal microfluidic disc such as a disposable Universal or Direct amplification disc (Focus Diagnostics (Cypress, CA, USA) and 3M Company (St. Paul, MN, USA)). In this embodiment, a biological sample is directly loaded into the sample-to-answer disc without separate front-end sample preparation. Qualitative detection and discrimination of enterovirus and parechovirus are then carried out using primers-probes such as chemical primers and real-time PCR to amplify and detect the target analyte on a cycling system such as the 3M Integrated Cycler system. In some embodiments, the target viral genomic RNA is reverse transcribed and specifically amplified and simultaneously detected in the same reaction well by a fluorescently labeled probe. The presence of each pathogen is determined by a different corresponding fluorescent signal. In some embodiments, the RNA in the sample is reverse transcribed in a first reaction (which may or may not be implemented in a consumable disc), and real-time PCR is carried out in a separate assay.
[0029] Primers, probes, and / or primers-probes dedicated to the amplification and detection of internal controls may be included in the same reaction mixture to monitor potential PCR inhibition. The reagents required for the amplification and detection of the target and RNA internal controls can be formulated as an integrated reaction mixture, which is provided as a single reaction aliquot.
[0030] Unless otherwise indicated, as used herein, the singular forms "a", "an", and "the" include plural referents. Thus, for example, reference to "oligonucleotide" includes plural oligonucleotide molecules, and reference to "nucleic acid" refers to one or more nucleic acids.
[0031] As used herein, "about" means plus or minus 10%.
[0032] A primer pair that "specifically hybridizes under stringent conditions" to a target gene need not hybridize to the entire gene. Thus, a primer pair can amplify the entire amplified gene or only an amplified segment of the gene, depending on the portion of the gene to which the primers specifically hybridize.
[0033] As used herein, the term "amplify" or "performing amplification" includes methods for copying a target nucleic acid thereby increasing the copy number of a selected nucleic acid sequence. Amplification can be exponential or linear. The target nucleic acid can be DNA (such as, for example, genomic DNA and cDNA) or RNA. The sequences amplified in this manner form "amplicons". Although the exemplary methods described below involve amplifying using polymerase chain reaction (PCR), a variety of other methods for amplifying nucleic acids are known in the art (such as, for example, isothermal methods, rolling circle methods, etc.). Those skilled in the art will understand that these other methods can be used in place of or in conjunction with the PCR method. See, for example, Saiki, "Amplification of Genomic DNA" in PCR Protocols, Innis et al., Eds., Academic Press, San Diego, CA 1990, pp 13-20; Wharam, et al., Nucleic Acids Res. 2001 Jun 1; 29(11):E54-E54; Hafner, et al., Biotechniques 2001 Apr; 30(4):852-860.
[0034] As used herein, the terms "complementary", "complementation" or "complementarity" when referring to polynucleotides (i.e., nucleotide sequences such as oligonucleotides or target nucleic acids) refer to the standard Watson / Crick pairing rules. Complementarity of nucleic acid sequences, where the 5' end of one sequence pairs with the 3' end of another, is "antiparallel association". For example, the sequence "5'-A-G-T-3'" is complementary to the sequence "3'-T-C-A-5'". Some bases that are not common in natural nucleic acids can be included in the nucleic acids described herein; these include, for example, inosine, 7-deazaguanine, locked nucleic acid (LNA) and peptide nucleic acid (PNA). Complementarity does not need to be perfect; stable double-strands can contain mismatched base pairs, degenerate or unpaired bases. Those skilled in the art of nucleic acids can empirically determine duplex stability considering a variety of variables, including, for example, the length of the oligonucleotide, the base composition and sequence of the oligonucleotide, the ionic strength and the incidence of mismatched base pairs. The complementary sequence can also be an RNA sequence complementary to a DNA sequence or its complementary sequence, and can also be cDNA. As used herein, the term "substantially complementary" means that two sequences specifically hybridize (defined below). Those skilled in the art will understand that substantially complementary sequences need not hybridize along their entire length. A nucleic acid that is "complete complement" or "fully complementary" to a reference sequence consists of a nucleotide sequence that is 100% complementary (under the Watson / Crick pairing rules) to the reference sequence along the full length of the nucleic acid that is the complete complement. The complete complement contains no mismatches with the reference sequence.
[0035] As used herein, the term "detection" as used in the context of detecting a signal from a detectable label to indicate the presence of a target nucleic acid in a sample does not require a method that provides 100% sensitivity and / or 100% specificity. As is known, "sensitivity" is the likelihood that a test will be positive given that the patient has the target nucleic acid, while "specificity" is the likelihood that a test will be negative given that the patient does not have the target nucleic acid. A sensitivity of at least 50% is preferred, although sensitivities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred. A specificity of at least 50% is preferred, although specificities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred. Detection also encompasses assays with false positives and false negatives. The false negative rate can be 1%, 5%, 10%, 15%, 20% or even higher. The false positive rate can be 1%, 5%, 10%, 15%, 20% or even higher.
[0036] "Fragment" in the context of a nucleic acid refers to a sequence of nucleotide residues that is at least about 5 nucleotides, at least about 7 nucleotides, at least about 9 nucleotides, at least about 11 nucleotides or at least about 17 nucleotides. Fragments are typically less than about 300 nucleotides, less than about 100 nucleotides, less than about 75 nucleotides, less than about 50 nucleotides or less than about 30 nucleotides. In some embodiments, fragments can be used in polymerase chain reaction (PCR), various hybridization methods or microarray methods to identify or amplify the same or related portions of RNA or DNA molecules. A fragment or segment can uniquely identify each polynucleotide sequence of the invention.
[0037] As used herein, a "kit" refers to a collection of components packaged for a particular purpose. Non-limiting examples of materials in which a kit can be packaged include boxes, bags, envelopes and tubes, although kit components can be supplied to the consumer in other types of packaging materials. In some embodiments, the primers and / or probes included in the kit are isolated polynucleotides and can be supplied in tubes, vials or other types of containers within the kit. In some embodiments, the kit further comprises instructions for using the kit components. The instructions can be printed on materials within the kit or provided in electronic form. In some embodiments, the printed instructions describe how to use the reagents included in the kit to detect the presence or absence of enteroviruses and / or echoviruses in a sample.
[0038] The term "multiplex PCR" as used herein refers to the simultaneous amplification of two or more products within the same reaction vessel. Each product is primed with a different primer pair. The multiplex reaction can further include specific probes for each product labeled with a detectable moiety. In some embodiments, the multiplex PCR reaction employs primer pairs in which one primer is a primer-probe such as, for example a primer.
[0039] As used herein, the term "oligonucleotide" refers to short polymers composed of deoxyribonucleotides, ribonucleotides, or any combination thereof. Oligonucleotides generally have a length of at least about 10, 11, 12, 13, 14, 15, 20, 25, 40, or 50 nucleotides up to about 100, 110, 150, or 200 nucleotides, more preferably about 10, 11, 12, 13, 14, or 15 nucleotides up to about 70 or 85 nt, and most preferably, a length of about 18 nucleotides up to about 26 nt. The single-letter codes for nucleotides are as described in Table 1 of Section 2422 of the USPTO Examination Guidelines. In this regard, the nucleotide name "R" means a purine such as guanine or adenine, "Y" means a pyrimidine such as cytosine or thymine (uracil if it is RNA); and "M" means adenine or cytosine. Oligonucleotides can be used as primers or as probes.
[0040] As used herein, a "primer" for amplification includes a primer element, where the primer element is an oligonucleotide that is complementary to and hybridizes with a target nucleotide sequence and causes nucleotide addition to the 3′ end of the primer in the presence of a DNA or RNA polymerase. In some embodiments, a primer consists of the primer element. However, a primer as used herein can contain other elements in addition to the primer element. For example, a primer can contain the primer element and a detectable label such as a fluorophore. In addition, a primer can contain a probe element in addition to the primer element. As used herein, the entire molecule is referred to as a primer. A primer-probe is an exemplary primer. For optimal expression and amplification, the 3′ nucleotide of the primer element in the primer should generally be the same as the target nucleic acid sequence at the corresponding nucleotide position. The term "primer" as used herein includes all forms of primers that can be synthesized, including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate-modified primers, labeled primers, etc. As used herein, a "forward primer" has a primer element that is complementary to the antisense strand of dsDNA. A "reverse primer" has a primer element that is complementary to the sense strand of dsDNA. An "exogenous primer" specifically refers to a primer added to a reaction vessel containing a sample and / or target nucleic acid to be amplified (i.e., not generated from amplification in the reaction vessel).
[0041] The length of the primer element in a primer is typically at least 10, 12, 15, 18, or 30 nucleotides up to a length of about 25, 50, 60, 100, 110, 125, or 200 nucleotides, preferably at least 15 up to about 60 nucleotides, and most preferably at least 25 up to about 40 nucleotides. In some embodiments, the primer, primer element, or probe length is 15 to 35 nucleotides. There is no standard length for optimal hybridization or polymerase chain reaction amplification. The optimal length for a specific primer application can be readily determined in the manner described by H. Erlich, PCR Technology, Principles and Applications for DNA Amplification, (1989). The primer element can be directly or indirectly linked to another component, such as the other component being a probe element and / or a fluorophore. Indirect linkage means that the two components are linked through one or more other components located between the two indirectly linked components. Two components are directly linked when they are directly connected to each other without using an intermediate component.
[0042] A "primer pair" is a pair of primers having primer elements that are directed to different regions of a target nucleic acid sequence. The primer pair comprises a forward primer and a reverse primer, each having a primer element that hybridizes to a different strand of the double-stranded target nucleic acid sequence under stringent conditions. The forward primer element is complementary to the antisense strand of the dsDNA and the reverse primer element is complementary to the sense strand. One primer of the primer pair can be a primer-probe (i.e., a bifunctional molecule comprising a PCR primer element covalently linked to a probe element by a polymerase blocking group, and in addition, the bifunctional molecule can comprise a fluorophore that interacts with a quencher).
[0043] As used herein, a "probe" is an oligonucleotide that specifically hybridizes to a target nucleotide sequence and is separate from the primer element. The probe sequence does not extend like the primer element and, as used herein, a probe is different from a "probe element" in that it does not contain a primer sequence element. However, a probe can comprise additional non-hybridizing elements, such as additional nucleotides or fluorophores. The probe is an exemplary probe. The probe comprises a donor and a quencher fluorophore at either end of the probe and are close enough to each other such that the fluorophore of the donor is quenched by the quencher. However, when the probe hybridizes to the amplified segment, the 5′ to 3′ exonuclease activity of Taq polymerase cleaves the probe thereby allowing the donor fluorophore to emit detectable fluorescence.
[0044] As used herein, " PCR monitoring system" refers to a method for real-time PCR. In this method, a probe that hybridizes to the amplified nucleic acid segment is included in the amplification master mix.
[0045] As used herein, a "probe element" or "probe sequence element" refers to the probe portion of a primer-probe and is a stretch of nucleotides that associates with a primer sequence, wherein the probe is linked or adjacent to the primer nucleic acid sequence in the stretch and specifically hybridizes to a target nucleic acid sequence to be detected under stringent conditions. In some embodiments, the probe sequence is fully complementary to the target sequence to which it is intended to hybridize under stringent conditions. In some embodiments, the probe element is 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, or 28 bases in length. In some embodiments, the probe element further comprises a self-complementary stem sequence.
[0046] As used herein, the term "primer-probe" is a bifunctional molecule, such as, for example a primer that comprises a PCR primer element covalently linked to a probe element at its 5′ end by a polymerase blocking group. The probe element comprises a probe target sequence (which specifically binds to the amplified product) flanked by a self-complementary stem sequence and is capable of forming a hairpin structure with a fluorophore at one end and a quencher at the other end. Sometimes, the fluorophore and the quencher interact to reduce background fluorescence. The primer sequence portion of the primer-probe is modified at the 5′ end such that a PCR blocker (usually an HEG monomer is added as the blocker) is included at the start of the hairpin loop.
[0047] In the initial PCR cycles, the primer portion of the primer-probe hybridizes to the target and is extended due to the action of the polymerase. During PCR, polymerase extension into the probe tail is blocked by including hexaethylene glycol (HEG) or an equivalent. In the first round of amplification, the 3′ target-specific primer anneals to and extends from the target nucleic acid, and the primer-probe is then incorporated into the newly synthesized strand, which has a newly synthesized target region for the 5′ probe. In the next round of denaturation and annealing, the probe region of the primer-probe hairpin loop hybridizes to the target, thus separating the fluorophore and the quencher and generating a measurable signal. This primer-probe is described in Whitcombe et al., Nature Biotech 17:804-807 (1999), which is incorporated herein by reference in its entirety.
[0048] As used herein, a "primer-probe detection system" refers to a system for real-time PCR that employs a primer wherein at least one primer of the primer pair is a primer-probe, such as, for example a primer.
[0049] An oligonucleotide (e.g., a probe or a primer) that is specific for a target nucleic acid will "hybridize" to the target nucleic acid under stringent conditions. As used herein, "hybridize" or "hybridizing" refers to the process by which a single-stranded oligonucleotide anneals to a complementary strand through base pairing under defined hybridization conditions.
[0050] "Specific hybridization" is the phenomenon in which two nucleic acid sequences have a high degree of complementarity. Specific hybridization complexes form under permissive annealing conditions and remain after any subsequent washing steps. Permissive conditions for nucleic acid sequence annealing can routinely be determined by those skilled in the art and can occur, for example, in the presence of about 6×SSC at 65°C. The stringency of hybridization can be expressed, in part, by reference to the temperature at which the washing step is carried out. At a defined ionic strength and pH, this temperature is typically chosen to be about 5°C to 20°C below the thermal melting point (Tm) of the specific sequence. Tm is the temperature at which 50% of the target nucleic acid dissociates from a perfectly matched probe (at a defined ionic strength and pH). The equations for calculating Tm and the conditions for nucleic acid hybridization are known in the art. Specific hybridization preferably occurs under stringent conditions, which are known in the art. Stringent hybridization conditions are hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and washing in 0.1×SSC at 60°C. The hybridization step is known in the art and is described, for example, in Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994.
[0051] As used herein, an oligonucleotide is "specific" for a nucleic acid if the oligonucleotide has at least 50% sequence identity to the nucleic acid when the oligonucleotide is aligned with the nucleic acid. An oligonucleotide that is specific for a nucleic acid is an oligonucleotide that is capable of hybridizing to the target of interest and substantially not hybridizing to nucleic acids of no interest under appropriate hybridization or washing conditions. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, and more preferably at least 98% sequence identity. Sequence identity can be determined using commercially available computer programs with default settings using algorithms known in the art. As used herein, sequences with "high sequence identity" have the same nucleotide at at least about 50% of the aligned nucleotide positions, preferably at least about 60% of the aligned nucleotide positions, and more preferably at least about 75% of the aligned nucleotide positions.
[0052] Oligonucleotides used as primers or probes for specific amplification (i.e., amplification of a specific target nucleic acid) or specific detection (i.e., detection of a specific target nucleic acid sequence) are generally capable of specifically hybridizing to the target nucleic acid under stringent conditions.
[0053] As used herein, the terms "sample" or "test sample" can include a biological sample, an isolated nucleic acid, or an isolated microorganism. In some embodiments, the sample is obtained from a biological source (i.e., a "biological sample"), such as tissue, body fluid, or microorganism collected from a subject. Sample sources include, but are not limited to, sputum (processed or unprocessed), bronchoalveolar lavage fluid (BAL), bronchial wash (BW), blood, body fluid, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g., biopsy material). Preferred sample sources include nasal and throat swabs, wound swabs, and nasal washes and CSF. The term "patient sample" as used herein refers to a sample obtained from a person seeking diagnosis and / or treatment of a disease. In some embodiments, the sample contains an isolated nucleic acid. In some embodiments, the sample contains a crude biological sample in which the nucleic acid has not been extracted. In some embodiments, the sample can be a biological sample that has been subjected to reverse transcription and thus contains cDNA.
[0054] The reagent mixture contains a sample, primers, and the reagents required for PCR and / or reverse transcription (RT).
[0055] "Amplification master mix" or "RT amplification master mix" contains all the reagents (including primers) for PCR amplification and / or reverse transcription, but does not contain the sample or target nucleic acid to be amplified.
[0056] As used herein, the terms "target nucleic acid", "target nucleic acid sequence", or "target sequence" refer to a sequence that includes a nucleotide segment of interest to be amplified and detected. A copy of the target sequence generated during an amplification reaction is called an amplification product, amplicon, or amplificate. The target nucleic acid can consist of a segment of a chromosome, a complete gene with or without intergenic sequence, a segment or portion of a gene with or without intergenic sequence, or a nucleic acid sequence for which a probe or primer is designed. The target nucleic acid can include a wild-type sequence, a mutation, a deletion or duplication, a tandem repeat region, a gene of interest, a region of a gene of interest, or any upstream or downstream region thereof, such as a 5′ untranslated region (UTR). The target nucleic acid can represent an alternative sequence or an allele of a particular gene. The target nucleic acid can be derived from genomic DNA, cDNA, or genomic RNA. The target nucleic acid as used herein can be DNA (such as genomic DNA or cDNA) or RNA. In some embodiments, the target sequence is a viral RNA sequence and / or its cDNA equivalent. In some embodiments, the target nucleic acid is an enterovirus sequence or a parechovirus sequence.
[0057] As used herein, "positive control nucleic acid" or "internal control" is a nucleic acid known to be present in a sample at a certain amount or level. In some embodiments, the positive control nucleic acid is not naturally present in the sample and is added to the sample prior to subjecting the reaction sample mixture to real-time polymerase chain reaction in the methods of the invention for determining the presence or absence of enterovirus and / or parechovirus. As used herein, the "cycle threshold" (Ct) of an analyte is the PCR cycle in which the fluorescence signal crosses a specific fluorescence threshold. Ct depends on the amplification reaction efficiency, which includes the initial template copy number, biological lysate, PCR amplification, hybridization or cleavage and detection sensitivity of the fluorescent probe.
[0058] As used herein, a "stem sequence" is a pair of self-complementary nucleotide sequences that flank a probe or probe element of a hybridizing nucleotide sequence. Each stem sequence is 4, 5, 6, 7, 8, 9 or 10 nucleotides in length. In some embodiments, the stem sequence is 6-7 nucleotides in length. The stem sequences flanking the probe element allow the probe element to form a hairpin loop.
[0059] Biological Samples and Sample Preparation
[0060] Samples in which enteroviruses and parechoviruses can be detected can be obtained from sterile and / or non-sterile locations using published methods. The sample can be a biological sample, including body fluids such as whole blood, plasma, serum, cell-free plasma, urine, cerebrospinal fluid (CSF), synovial fluid, pleural fluid, pericardial fluid, intraocular fluid and sputum. Typical samples are serum, plasma, throat or rectal swabs in transport medium, feces and CSF. Other suitable biological samples include tissue biopsies, fecal samples, endotracheal aspirates, throat and rectal swab samples, nasopharyngeal samples (nasal swabs). As used herein, "cell-free plasma" indicates plasma containing less than 1% cells by volume.
[0061] In some embodiments, the biological sample is suspected of containing enterovirus and / or parechovirus nucleic acid and / or is obtainable from an individual suspected of being infected with enterovirus and / or parechovirus. In some embodiments, the sample is a biological sample that has been subjected to reverse transcription to reverse transcribe RNA initially present in the biological sample (including enterovirus and / or parechovirus RNA if present) into cDNA. In this embodiment, the sample contains the target cDNA. In some embodiments, the cDNA is not extracted from the sample prior to RT-PCR or other detection assays.
[0062] Although the disclosed methods preferably employ untreated biological samples to obtain a direct, streamlined sample-to-answer method, the detection methods disclosed herein are also effective if used on nucleic acids (DNA and / or RNA) isolated and purified from biological samples according to any method known to those of ordinary skill in the art. If desired, the sample can be collected and concentrated by centrifugation or the like. Alternatively, the biological sample can be processed using commercially available nucleic acid extraction kits.
[0063] Reverse Transcription and Real-Time PCR
[0064] In the methods of the invention, the presence of enterovirus and / or parechovirus target RNA in a sample is tested by reverse transcription and polymerase chain reaction (RT-PCR). When used together, reverse transcription and polymerase chain reaction can be performed sequentially in two steps, or in one step by adding all of the RT and PCR reaction composition reagents to the sample.
[0065] In the two-step method, incubation of the sample in the reverse transcription reaction composition allows synthesis of DNA copies from the target RNA. The RT reagent mixture includes primers that hybridize to the target RNA to direct synthesis of the copy DNA. In addition, the RT reagent mixture includes dNTP, MgC1 2 , KCl, reverse transcriptase, and reverse transcriptase buffer. If it is anticipated that DNA copies will be prepared from more than one target RNA, more than one primer may be included. However, an RNase inhibitor is generally not used. The product of the reverse transcription reaction can optionally then be transferred to another assay tube where PCR is performed according to protocols known in the art. The amplification master mixture generally includes a primer pair that initiates synthesis of the desired DNA segment from the reverse transcription template. In addition, the amplification master mixture generally contains dNTP, a DNA polymerase such as a thermostable DNA polymerase such as Taq polymerase, and polymerase buffer. In some embodiments, the amplification master mixture further contains a cationic surfactant. If it is anticipated that multiple target sequences will be synthesized, more than one pair of primers is included. In addition, in some embodiments, a single new primer can be added that will amplify a DNA segment using the original RT primer as the second primer of the primer pair. Other reverse transcriptases that can be used for viral samples include, but are not limited to, HIV reverse transcriptase (Ambion), Transcriptor reverse transcriptase (Roche), Thermoscript reverse transcriptase (Invitrogen). Other DNA polymerases that can be used include, but are not limited to, Pfu, Vent, and Sequitherm DNA polymerases (EPICENTRE).
[0066] In some embodiments of the method of the present invention, a biological sample is combined with an RT amplification master mix comprising a DNA polymerase, a reverse transcriptase, an RNase inhibitor, salts, deoxynucleotides, an internal control, and probes and primers for the target and the internal control, whereby RT and PCR can be carried out in a single assay. In some embodiments, the biological sample is heated to separate the RNA secondary structures present in the sample, and the heated sample is contacted with the RT amplification master mix to form a reaction mixture. In some embodiments, the biological sample is contacted with the RT amplification master mix to form a reaction mixture, and subsequently the reaction mixture comprising the biological sample is heated to separate the RNA secondary structures present in the sample.
[0067] Regardless of whether RT-PCR is carried out as a two-step or one-step process, the RT step is run first and generally consists of a single-temperature incubation. In some embodiments, the single temperature is from about 42 °C to about 60 °C. Different temperatures are suitable for different RT enzymes and different primers, as known to those skilled in the art, and the temperature should be sufficient to allow the reverse transcription of RNA into cDNA. The subsequent PCR reaction generally consists of an initial incubation at a predetermined temperature that is sufficient to denature the cDNA and also activate the heat-activated Taq polymerase. This is followed by multiple cycles of cDNA target amplification. In some embodiments, the heating and cooling cycles are repeated at least 12, 13, 14, 15, 18, 19, 20, 21, 22, or 23 times up to 15, 20, 25, 20, 25, 30, 35, 40, or more times. In some embodiments, three operations are carried out during each cycle: target denaturation, primer annealing, and primer extension. In some embodiments, target denaturation occurs at a temperature above about 90 °C. The primer annealing temperature is determined by the melting temperature of the specific primer used in the reaction and primer extension can be carried out in the temperature range of about 56 °C to about 72 °C. When primer annealing and extension are carried out at the same temperature, this is a two-temperature PCR as compared to a three-temperature PCR in which each of the three steps occurs at a different temperature. After the amplification phase is completed, a final extension time is typically added to ensure the synthesis of all amplification products.
[0068] The PCR is preferably a multiplex PCR reaction. The reaction mixture may comprise primer pairs for enterovirus and primer pairs for echovirus. An internal control (IC) can also be included in the sample using oligonucleotide primers, probes, and / or primer-probes.
[0069] In some embodiments, PCR and / or RT-PCR are performed in a centrifugal microfluidic disc. As used herein, a "centrifugal microfluidic disc" is a disc that rotates about its axis within a thermal cycler and contains chambers that can store biological samples. Exemplary centrifugal microfluidic discs are the Direct Amplification Discs (8-well) and Universal Disc (96-well) from Focus Diagnostics, which are used in combination with the 3M TM 3M sold TM Integrated Cycler thermal cycler. The 3M TM Integrated Cycler can accept a Universal or Direct Amplification Disc and is capable of performing multiplex assays per disc. In some embodiments, biological samples are stored in a gene rotor disc. As used herein, a "gene rotor disc" is a centrifuge rotor insert that holds tubes or other chambers capable of accommodating samples and / or sample amplification mixtures. Examples of gene rotor discs are Qiagen Rotor Discs and / or Gene Discs, which are used in conjunction with the Qiagen Rotor-Gene Q thermal cycler.
[0070] Target nucleic acid and primers
[0071] According to the present invention, oligonucleotide primers and / or probes are used in the methods described herein to amplify and detect target enterovirus and / or parechovirus nucleic acids, such as all or part of an enterovirus and / or parechovirus-specific marker gene. In one embodiment, the method involves using primer pairs that target the 5′ untranslated region (UTR) of the enterovirus genome and primer pairs that target the 5′ UTR of the parechovirus genome (including fragments of any or both of these regions). The enterovirus primer pair is capable of detecting and / or hybridizing to the 5′ UTR of at least 64 serotypes of enterovirus. The parechovirus primer pair is capable of detecting and / or hybridizing to the 5′ UTR of at least 8 serotypes of parechovirus. In some embodiments, the enterovirus primer specifically hybridizes to a sequence (or its complement) within nucleotides 452 - 599 of the 5′ UTR of the enterovirus genome set forth in GenBank accession number KC436272. In some embodiments, the parechovirus primer specifically hybridizes to a sequence (or its complement) within positions 535 - 599 of the 5′ UTR of the parechovirus genome set forth in GenBank accession number AJ005695.
[0072] In addition, primers can also be used to amplify one or more control nucleic acid sequences.
[0073] The target nucleic acids described herein can be detected individually or in multiplexed form, using separate labels for each target. In one specific embodiment, the multiplex reaction comprises fluorescently labeled primer-probes such as those used in primer pairs specific for the 5′UTR of the enterovirus genome. A primer-probe and another fluorescently labeled primer-probe such as those used in primer pairs specific for the 5′UTR of the parechovirus genome. A primer-probe. In some embodiments, the fluorescent label of the enterovirus primer pair is different from that of the parechovirus primer pair.
[0074] In some embodiments, the provided primer mixes are degenerate at one or more nucleotide positions. Degenerate primers are used in PCRs where there is variability in the target nucleic acid sequence, i.e., the sequence information is polymorphic. Typically, degenerate primers will exhibit variability at no more than about 4, no more than about 3, preferably no more than about 2, and most preferably no more than about 1 nucleotide position within the primer.
[0075] Thus, in some embodiments, at least one primer of each primer pair in the amplification reaction comprises a detectable moiety. The detectable moiety can be on a probe covalently linked to the primer, such as on a primer-probe. The probe can be detectably labeled by methods known in the art. Effective labels include, for example, fluorophores (e.g., FITC, rhodamine, xanthene phosphor, Texas Red, carboxyfluorescein fluorophores such as FAM, JOE TM , xanthene dyes that fluoresce in the red region of the visible spectrum and can be effectively quenched by quenchers such as Dark Hole Quencher TM (BHQ TM ) of Cal Fluor Red ("CFR610"), I-BHQ2 dye, Quasar 32 P, 35 S, 3 H, 14 C, 125 I, 131 I, electron density reagents (e.g., gold), enzymes such as those commonly used in ELISA (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), colorimetric labels (e.g., colloidal gold), magnetic labels (e.g., Dynabeads TM) Proteins of biotin, digoxin, or hapten and the antiserum or monoclonal antibody against them. The fluorophore has the ability to absorb energy from light, internally transfer the energy, and emit the energy as light of a characteristic wavelength. After absorbing energy (a photon) from light, the fluorophore will rise from its ground state to a higher vibrational level of the excited singlet state. In the next stage, some of the energy is lost as heat, causing the fluorophore to return to the lowest vibrational level of the excited singlet state. The lowest vibrational level of the excited singlet state is relatively stable and has a longer lifetime. From this excited singlet state, the fluorophore can return to its ground state, either by emission of light (a photon) or by non-radiative energy transitions. The light emitted from the excited singlet state is called fluorescence. Other labels include ligands or oligonucleotides that are capable of forming complexes with their corresponding receptors or oligonucleotide complements, respectively. The label can be directly incorporated into the nucleic acid to be detected, or it can be attached to a probe (e.g., an oligonucleotide) or an antibody that hybridizes or binds to the nucleic acid to be detected.
[0076] Thus, after amplification and / or during amplification, if present, enterovirus and / or parechovirus target segment amplicons can be identified by using different detectable moieties such as by size and / or color. Although the targets are referred to as "enterovirus target segment amplicons" or "parechovirus target segment amplicons", it should be noted that the amplicons are actually generated from the cDNA equivalents of the viral genomic RNA sequences (and thus the target amplicons differ from the viral RNA target sequences by the presence of thymine instead of uracil). The detectable moiety can be a fluorescent dye. In some embodiments, different primer pairs are labeled with different distinguishable detectable moieties. Thus, for example, the CFR610 and FAM fluorescent dyes can be present on different primers in a multiplex PCR and bind to the different amplicon sequences obtained. In other embodiments, the forward primer is labeled with one detectable moiety and the reverse primer is labeled with a different detectable moiety, e.g., the FAM dye for the forward primer and the HEX dye for the reverse primer. The use of different detectable moieties is useful for differentiating between amplification products of the same length or that are very similar in length.
[0077] In some embodiments, the probe portion of the primer to be employed is detectably labeled and detection is achieved by detecting the label of each amplification product. A quencher can be further associated with the detectable label, which prevents detection of the label prior to target amplification of the probe element. SCORPION TM The primer contains such a probe element.
[0078] In some embodiments, at least one primer of each primer pair is a primer-probe. In these embodiments, the primer-probe further comprises a fluorophore associated with a quencher to reduce background fluorescence. After PCR extension using such a fluorophore-labeled primer-probe, the synthesized target region attaches to the same strand as the probe. Upon denaturation, the probe portion of the primer-probe hybridizes to a portion of the newly generated PCR product, physically separating the fluorophore from the quencher, thereby generating a detectable signal. Thus, in some embodiments, one primer of each primer pair can be a primer-probe that comprises a probe sequence element at the 5′ end of the primer, wherein the probe element further comprises a fluorophore and a quencher.
[0079] The inventors of the present invention have found that detection of a specific region of the 5′UTR of the enterovirus genome (i.e., nucleotides 452-599 of the 5′UTR) allows detection of any of 64 serotypes of enterovirus and can distinguish a sample containing enterovirus from a sample containing other non-enterovirus viral species or strains. Additionally, the inventors of the present invention have found that detection of a specific region of the 5′UTR of the parechovirus genome (i.e., nucleotides 535-599 of the 5′UTR) allows detection of any of 8 serotypes of parechovirus and distinguishes a sample containing parechovirus from those containing other non-parechovirus viral species or strains.
[0080] Enterovirus detection
[0081] The primers of the primer pair for detecting and / or amplifying enterovirus have primer elements that hybridize to a region within nucleotides 452-599 of the 5′UTR of the enterovirus genome. In some embodiments, the primer pair comprises primers having primer elements that specifically hybridize to a nucleic acid comprising the sequence 5′-AATTGTCACCATAAGCAGCCA-3′ (SEQ ID NO:1) or its complete complement, or consisting of the sequence 5′-AATTGTCACCATAAGCAGCCA-3′ (SEQ ID NO:1) or its complete complement. In some embodiments, one primer of the primer pair comprises or consists of a primer element sequence that is at least 90% identical to SEQ ID NO:1 or at least 90% identical to the complete complement of SEQ ID NO:1 and specifically hybridizes to SEQ ID NO:1 or its complete complement under stringent conditions. In some embodiments, the primer element is at least 16, 17, 18, 19 nucleotides in length and / or at most 18, 19, 20, 22, 25, 30, 40 or 50 nucleotides in length and is at least 84, 85, 86 or 90% identical to SEQ ID NO:1. The primer element may comprise or consist of at least 16, 17, 18, 19, 20 or 21 consecutive nucleotides of SEQ ID NO:1 or the complete complement of SEQ ID NO:1 and hybridizes to a nucleic acid comprising SEQ ID NO:1 or its complete complement or consisting of the same under stringent conditions.
[0082] In some embodiments, the primer pair for detecting and / or amplifying enterovirus comprises primers having primer elements that specifically hybridize to a nucleic acid comprising the sequence 5′-CCCCTGAATGCGGCTAATC-3′ (SEQ ID NO:2) or its complete complement or consisting of the same. In some embodiments, the primer element comprises a sequence that is at least 90% identical to SEQ ID NO:2 or at least 90% identical to the complete complement of SEQ ID NO:2 and specifically hybridizes to a nucleic acid comprising SEQ ID NO:2 or its complete complement or consisting of the same under stringent conditions. In some embodiments, the primer element is at least 16, 17, 18, 19 nucleotides in length and / or at most 18, 19, 20, 22, 25, 30, 40 or 50 nucleotides in length and is at least 84, 85, 86 or 90% identical to SEQ ID NO:2. The primer element may comprise or consist of at least 16, 17, 18, 19, 20 or 21 nucleotides of SEQ ID NO:2 or the complete complement of SEQ ID NO:2 and hybridizes to a nucleic acid comprising SEQ ID NO:2 or the complete complement of SEQ ID NO:2 or consisting of the same under stringent conditions.
[0083] In some embodiments, the primers for detecting and / or amplifying enterovirus nucleic acid are primer-probes. The primer-probe may comprise a primer element as discussed above, and a probe element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:3 or at least 90% identical to the complete complement of SEQ ID NO:3. In some embodiments, the probe element comprises at least 19, 20, 21, 22, 23, or 24 consecutive nucleotides of SEQ ID NO:3 or the complement of SEQ ID NO:3. The probe element specifically hybridizes to the corresponding region of SEQ ID NO:3 or the complement of SEQ ID NO:3 under stringent hybridization conditions.
[0084] In one specific embodiment, the enterovirus primer pair comprises two of the above-described enterovirus primers (i.e., a primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:1 or its complement (or consisting of SEQ ID NO:1 or its complement) and a primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:2 or its complement (or consisting of SEQ ID NO:2 or its complement)).
[0085] In another specific embodiment, one primer of the enterovirus primer pair comprises SEQ ID NO:1 or consists thereof and the other primer of the enterovirus primer pair is a primer-probe, the primer-probe comprising or consisting of (in the 5′ to 3′ direction): a quencher moiety linked to a nucleotide sequence consisting of a first stem sequence (followed by ACACGGACACCCAAAGTAGTCGGT (SEQ ID NO:3)) and a second stem sequence complementary to the first stem sequence, linked at its 3′ end to a fluorophore and a nucleotide spacer, the nucleotide spacer being a polyethylene glycol-based linker of 10, 14, 15, 16, 17, 18, 19, 20, 21, or 25 atoms, followed by SEQ ID NO:2.
[0086] A specific enterovirus primer pair consists of:
[0087] Enterovirus primer 1: 5′d AATTGTCACCATAAGCAGCCA 3′ (SEQ ID NO:1) Enterovirus primer 2 (primer-probe): 5′d BHQ-1- agcgcAC ACGGACACCCAAAGTAGTCGGTgcgct-FAM-spacer18-CCCCTGAATGCGGCTAATC 3′
[0088] Wherein "BHQ-1" is the black hole quencher moiety, the underlined sequence is a self-complementary stem sequence, "FAM" is fluorescein amidite, and "spacer 18" is a spacer comprising an 18-atom hexaethylene glycol linker.
[0089] Dual Echovirus detection
[0090] The primer of the primer pair for detecting and / or amplifying Bicistrovirus comprises a primer element that hybridizes to a region within nucleotides 535-599 of the 5′UTR of the Bicistrovirus genome. In some embodiments, one primer of the primer pair comprises or consists of a primer element sequence that is at least 90% identical to 5′GTTGTAAGGCCCACGAA 3′ (SEQ ID NO:4) or at least 90% identical to the complete complement of SEQ ID NO:4 and specifically hybridizes to SEQ ID NO:4 or its complete complement under stringent conditions. In some embodiments, the primer element is at least 16, 17, 18, 19 bases in length and / or up to 18, 19, 20, 22, 25, 30, 40 or 50 bases in length and is at least 84, 85, 86 or 90% identical to SEQ ID NO:4. The primer element may comprise or consist of at least 16, 17, 18, 19, 20 or 21 consecutive nucleotides of SEQ ID NO:4 or the complete complement of SEQ ID NO:4 and hybridizes to SEQ ID NO:4 or its complete complement under stringent conditions.
[0091] In some embodiments, the primer pair for detecting and / or amplifying Bicistrovirus comprises a primer having a primer element that specifically hybridizes to a nucleic acid comprising the sequence 5′-TCAGATCCATAGTGTCICTTGTTA-3′ (SEQ ID NO:5) or its complete complement or consisting thereof. In some embodiments, the primer element comprises a sequence that is at least 90% identical to SEQ IDNO:5 or at least 90% identical to the complete complement of SEQ ID NO:5 and specifically hybridizes to SEQ IDNO:5 or its complete complement under stringent conditions. In some embodiments, the primer element is at least 16, 17, 18, 19 nucleotides in length and / or up to 18, 19, 20, 22, 25, 30, 40 or 50 nucleotides in length and is at least 84, 85, 86 or 90% identical to SEQ ID NO:5. The primer element may comprise or consist of at least 16, 17, 18, 19, 20 or 21 nucleotides of SEQ ID NO:5 or the complete complement of SEQ ID NO:5 and hybridizes to SEQ ID NO:5 or or its complete complement under stringent conditions.
[0092] In some embodiments, the primers for detecting and / or amplifying Bicistrovirus nucleic acid are primer-probes. The primer-probe may comprise a primer element sequence (discussed above) and a probe element, the probe element comprising a nucleotide sequence that is at least 90% identical to 5′-ATGCCCAGAAGGTACCCG-3′ (SEQ ID NO:6) or at least 90% identical to the complete complement of SEQ ID NO:6. In some embodiments, the probe element comprises 19, 20, 21, 22, 23, or 24 consecutive nucleotides of SEQ ID NO:6 or the complement of SEQ ID NO:6. The probe element specifically hybridizes to the corresponding region of SEQ ID NO:6 that is complementary to SEQ ID NO:6 under stringent conditions.
[0093] In one specific embodiment, the Bicistrovirus primer pair comprises two of the above-described Bicistrovirus primers (i.e., a primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:4 or its complement or consisting of the same and a primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO:5 or its complement or consisting of the same).
[0094] In another specific embodiment, one primer of the Bicistrovirus primer pair comprises SEQ ID NO:4 or consists of the same and the other primer of the Bicistrovirus primer pair is a primer-probe that comprises or consists of (in the 5′ to 3′ direction): a fluorophore linked to a nucleotide sequence consisting of a first stem sequence (subsequently SEQ ID NO:6) and a second stem sequence complementary to the first stem sequence, linked at its 3′ end to a quencher and a spacer, the spacer being a polyethylene glycol linker of 10, 14, 15, 16, 17, 18, 19, 20, 21, or 25 atoms, followed by SEQ ID NO:5.
[0095] The specific Bicistrovirus primer pair consists of:
[0096] Bicistrovirus primer 1: 5′d GTTGTAAGGCCCACGAA 3′ (SEQ ID NO:4) Bicistrovirus primer 2 (primer-probe): 5′d Spacer 18-TCAGATCCATAGTGTCICTTGTTA 3′
[0097] wherein "CFR610" is the xanthene dye Cal Fluor Red The sequence within the box is a self-complementary stem sequence, "BHQ-2" is a black hole quencher and "Spacer 18" is a spacer that is a hexaethylene glycol linker containing 18 atoms.
[0098] The inventors of the present invention have found that the above primer pairs surprisingly outperform other primer pairs in multiplex direct amplification reactions in human biological samples and are capable of detecting 64 serotypes of enteroviruses and echovirus serotypes 1-8.
[0099] Product detection
[0100] The method of the present invention for determining the presence or absence of enteroviruses and / or echoviruses in a sample involves, among other steps, determining whether the enterovirus or echovirus nucleotide sequence is amplified in the sample. The determination step can be carried out during and / or after the PCR amplification process. In some embodiments, at least one primer of each primer pair (i.e., the primer pair for enteroviruses and the primer pair for echoviruses) is a primer-probe and generates a fluorescent signal during the PCR amplification process. Detection of a signal indicating amplification of the enterovirus sequence and / or the echovirus sequence thus indicates the presence of the virus in the sample.
[0101] In the present invention, a real-time PCR method that does not require a preparation step before detecting the amplified sample is preferably used. Most real-time methods detect the formation of the amplified product by monitoring the change in fluorescence during the thermal cycling process. In some embodiments, amplification of the echovirus sequence generates a different fluorescent signal compared to amplification of the enterovirus sequence, thus allowing the observer to distinguish between the two viruses.
[0102] Detectable-labeled primer-probes can be used for real-time PCR. For primer-probes such as Suitable detectable labels for primer-probes include fluorophores such as fluorescein bioconjugates and succinimidyl esters of amine-reactive carboxyfluorescein (commonly referred to as FAM). The primer-probe also contains a quencher. In the absence of the target, the quencher almost absorbs the fluorescence emitted by the fluorophore. During the Scorpion PCR reaction, in the presence of the target, the fluorophore and the quencher separate, which results in an increase in the emitted fluorescence. The fluorescence can be detected and measured in the reaction tube. Suitable quenchers include Black Hole ( Biosearch Technologies). Dark quenchers such as DABCYL are dyes that do not have natural fluorescence. BHQ dyes are true dark quenchers and do not have natural emission due to their polyaromatic azo backbone. Substituted electron-donating and electron-withdrawing groups on the aromatic ring produce a complete series of quenchers with broad absorption curves that span the visible wavelengths: BHQ-0 (493 nm), BHQ-1 (534 nm), BHQ-2 (579 nm), and BHQ-3 (672 nm). These quenchers can be paired with all common acceptor dyes to construct qPCR probes with effective quenching for multiplex assays. In addition to quenching by FRET, BHQ dyes have also been shown to effectively quench fluorescence by static quenching via the formation of a ground-state complex with the reporter dye. Other fluorophores and quenchers with multiple absorption and emission values are known in the art. Example
[0103] Accordingly, the methods generally described in this invention will be understood more readily by reference to the following examples, which are provided by way of illustration and are not intended to limit the methods and kits of this invention.
[0104] Example 1
[0105] A collection of clinical cerebrospinal fluid (CSF) samples or an artificial synthetic CSF collection was tested, and the results were compared with real-time PCR results to determine the clinical performance of the Simplexa Enterovirus and Duo-Echovirus Direct assays compared to real-time PCR methods using conventional nucleic acid extraction.
[0106] Simplexa Direct Assay : The Simplexa Direct kit (Focus Diagnostics, Cypress, CA) contains all the reagents for on-board extraction and real-time PCR. For each reaction on the Direct Amplification Disc, an untreated CSF sample was directly loaded into the sample well of a wedge structure on the disc without any sample preparation steps. The amplification reaction mixture was pipetted into the reaction well of the wedge structure, where the amplification reaction mixture contained Enterovirus primers 1 and 2 and Duo-Echovirus primers 1 and 2 as described below:
[0107] Enterovirus primer 1: 5′d AATTGTCACCATAAGCAGCCA 3′ (SEQ ID NO:1)
[0108] Enterovirus primer 2 (primer-probe): 5′d BHQ-1-agcgcACACGGACACCCAAAGTAGTCGGTgcgct-FAM-Spacer18-CCCCTGAATGCGGCTAATC 3′
[0109] Dual Echovirus primer 1: 5′d GTTGTAAGGCCCACGAA 3′ (SEQ ID NO:4)
[0110] Dual Echovirus primer 2 (primer-probe): 5′d CFR610-cgcgcgATGCCCAGAAGGTACCCGcgcg-BHQ-2-Spacer18-TCAGATCCATAGTGTCICTTGTTA 3′
[0111] The reaction mixture further comprises a DNA polymerase, a reverse transcriptase, an RNase inhibitor, salts, deoxynucleotides, an internal control, and probes and primers for the internal control. The wedge structure is sealed with foil and then the Direct Amplification Disc is inserted into a 3M TM Integrated Cycler (3M, St. Paul, MN, USA), and reverse transcription and real-time PCR are initiated in the cycler. The PCR cycling conditions include the following steps: i) the sample is preheated at 75 °C for 180 seconds, 1 cycle, ii) reverse transcription is carried out at 50 °C for 720 seconds, 1 cycle, iii) polymerase activation is carried out at 97 °C for 120 seconds, 1 cycle, iv) denaturation is carried out at 97 °C for 10 seconds and annealing / extension / detection are carried out at 56 °C for 10 seconds and 58 °C for 30 seconds, 45 cycles. The target DNA (derived from enterovirus and / or dual echovirus genomic RNA) is specifically amplified and simultaneously detected by the fluorescently labeled primer-probe in the same reaction. Data collection and analysis are performed using the Integrated Cycler Studio software.
[0112] Virus strain: The following strains were used in the LoD study: CVA1, CVA17, and CVA9, and dual echoviruses HPEV-1 and HPEV-3 (ZeptoMetrix, Buffalo, NY). The following dual echovirus strains were used in the specificity study: HPEV1, HPEV2, HPEV3, HPEV4, HPEV5, and HPEV6 (ZeptoMetrix, Buffalo, NY).
[0113] Limit of Detection (LoD) study: Perform LoD studies to determine the analytical sensitivity of the assay. The presumptive LoD for each virus stock was determined as the lowest concentration at which 4 / 4 replicates were detected in synthetic CSF (Golden West Biologicals, Temecula, CA).
[0114] Sensitivity and specificity study : The clinical performance of the Simplexa Enterovirus and Duo-Echovirus Direct assays was evaluated using a collection of 154 CSF samples, which included 7 Duo-Echovirus positive, 74 Enterovirus positive, and 74 Duo-Echovirus / Enterovirus negative, as reported by real-time PCR assay. In addition, a collection of 24 artificially Duo-Echovirus positive samples in synthetic CSF was used. The artificial collection was prepared using quantitative virus stocks of Duo-Echovirus serotypes 1-6 at 10X, 4X, 2X, and 1X concentrations of the Simplexa LoD.
[0115] Cross-reactivity study: Cross-reactivity was evaluated using a diverse collection of bacteria and viruses. Biological collections (whose infections can give clinical symptoms similar to Enterovirus and / or Duo-Echovirus infections) were used to determine cross-reactivity. The collection in synthetic CSF consisted of 10 6 CFU / mL of bacteria or 10 5 TCID 50 / mL of virus.
[0116] Results : LoD: LoD studies using synthetic CSF showed that the Simplexa Enterovirus and Duo-Echovirus Direct detected Enterovirus and Duo-Echovirus strains at <1X 10 3 TCID 50 / mL. The positive and negative percent agreements of the Simplexa Enterovirus and Duo-Echovirus Direct were 95.6% (65 / 68) and 89% (65 / 73) for Enterovirus and 92.6% (25 / 27) and 92.2% (71 / 77) for Duo-Echovirus, respectively, compared to real-time PCR assays using conventional extraction steps.
[0117] Table 1 - Detection Limits of Enterovirus and Duo-Echovirus Strains
[0118]
[0119] The relative positive and negative percent agreements of the Simplexa Enterovirus and Duo-Echovirus Direct are listed in Tables 2 and 3.
[0120] Table 2 - Enterovirus Agreement in CSF Samples
[0121]
[0122]
[0123] Table 3 - Consistency of two Echoviruses in CSF samples
[0124]
[0125] Cross - reactivity: No cross - reactivity was detected against the pathogens in Table 4.
[0126] Table 4 - Cross - reactive pathogens tested in synthetic CSF
[0127]
[0128]
[0129] The ability to detect the selected enterovirus types was further confirmed in subsequent studies. Exemplary enteroviruses detected using the Simplexa Enterovirus and Echovirus Direct assays in subsequent studies are shown in Table 5.
[0130] Table 5 - Selected enterovirus strains examined in subsequent studies
[0131]
[0132]
[0133] Conclusion : The Simplexa Enterovirus and Echovirus Direct assays can directly detect and distinguish enteroviruses and echoviruses from unextracted CSF samples, with performance comparable to that of conventional PCR assays using nucleic acid extraction. By targeting the 5′UTR of enteroviruses and the 5′UTR of echoviruses, 64 serotypes of enteroviruses and serotypes 1 - 6 in human CSF were effectively detected in this rapid "sample - to - answer" assay. HPEV7 and HPEV8 are not commercially available for testing, but bioinformatics (in silico) analysis indicates that these serotypes can be detected. Using an integrated thermal cycler capable of accommodating a disc, the performance of the Simplexa Enterovirus and Echovirus Direct assays in centrifugal microfluidic discs provides a compact system for the rapid detection of enteroviruses and echoviruses directly from human biological samples.
[0134] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0135] The invention described illustratively can be practiced suitably in the absence of any element or elements, limitation or limitations not specifically disclosed herein. Further, the terms and expressions employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features or portions thereof shown and described, but it is recognized that various modifications are possible within the scope of the claimed invention.
[0136] Accordingly, it should be understood that although the invention has been specifically disclosed by way of preferred embodiments and optional features thereof, modifications, improvements and variations of the invention disclosed therein can be made by those skilled in the art, and such modifications, improvements and variations are considered to be within the scope of the invention. The materials, methods and examples provided herein are representative of the preferred embodiments and are exemplary and are not intended to limit the scope of the invention.
[0137] The invention has been described herein broadly and generically. Each narrower genus and subgenus falling within the generic disclosure also forms part of the invention. This includes the use of the genus to remove any limitations or negative limitations on the subject matter of the invention, whether or not the excluded material is specifically recited herein.
[0138] In addition, where features or aspects of the invention are described in terms of a Markush group, those skilled in the art will recognize that the invention is thereby also described with respect to any individual member or subgroup of members of the Markush group.
[0139] All publications, patent applications, patents and other references mentioned herein are hereby incorporated by reference in their entirety to the same extent as if each was incorporated by reference individually. In case of conflict, the specification of the invention (including definitions) shall prevail.
[0140] Other embodiments are set forth in the appended claims.
[0141] In summary, the present application includes, but is not limited to, the following:
[0142] 1. A method for determining the presence or absence of enterovirus and / or parechovirus in a sample, the method comprising:
[0143] (a) If enterovirus is present in the sample, amplifying the nucleic acid of enterovirus using at least one first primer pair, wherein the first primer of the first pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:1 or its complete complement or consisting of the same, and the second primer of the first pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO:2 or its complete complement or consisting of the same; and / or
[0144] (b) If echovirus is present in the sample, amplify the nucleic acid of echovirus using at least one second primer pair, wherein the first primer of the second pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO: 4 or its complete complement or consisting of the same, and the second primer of the second pair has a primer element that specifically hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO: 5 or its complete complement or consisting of the same.
[0145] 2. The method according to item 1, wherein the first primer of the first pair has a primer element comprising a nucleotide sequence and a detectable label that is not a nucleic acid, and the nucleotide sequence is at least 90% identical to SEQ ID NO: 2 or the complete complement of SEQ ID NO: 2.
[0146] 3. The method according to item 2, wherein the first primer of the first pair is a primer probe.
[0147] 4. The method according to item 3, wherein the primer probe has a probe element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO: 3 or the complete complement of SEQ ID NO: 3.
[0148] 5. The method according to item 4, wherein the probe element further comprises a quencher, a fluorophore, and two self-complementary stem sequences, wherein each stem sequence has a length of at least 4 nucleotides.
[0149] 6. The method according to item 2, wherein the second primer of the first pair has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO: 1 or the complete complement of SEQ ID NO: 1.
[0150] 7. The method according to item 1, wherein the first primer of the first pair has a primer element comprising a nucleotide sequence and a detectable label that is not a nucleic acid, and the nucleotide sequence is at least 90% identical to SEQ ID NO: 1 or the complete complement of SEQ ID NO: 1.
[0151] 8. The method according to item 7, wherein the first primer of the first pair is a primer probe.
[0152] 9. The method according to item 8, wherein the primer probe has a probe element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO: 3 or the complete complement of SEQ ID NO: 3.
[0153] 10. The method according to item 9, wherein the probe element further comprises a quencher, a fluorophore, and two self-complementary stem sequences, each stem sequence having a length of at least 4 nucleotides.
[0154] 11. The method according to item 7, wherein the second primer of the first pair has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:2 or the complete complement of SEQ ID NO:2.
[0155] 12. The method according to item 1, wherein the first primer of the second pair has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:5 or the complete complement of SEQ ID NO:5, and a detectable label that is not a nucleic acid.
[0156] 13. The method according to item 12, wherein the first primer of the second primer pair is a probe.
[0157] 14. The method according to item 13, wherein the primer probe has a probe element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:6 or the complete complement of SEQ ID NO:6.
[0158] 15. The method according to item 14, wherein the probe element further comprises a quencher, a fluorophore, and two self-complementary stem sequences, each stem sequence having a length of at least 5 nucleotides.
[0159] 16. The method according to item 12, wherein the second primer of the second primer pair has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:4 or the complete complement of SEQ ID NO:4.
[0160] 17. The method according to item 1, wherein the first primer of the second pair has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:4 or the complete complement of SEQ ID NO:4, and a detectable label that is not a nucleic acid.
[0161] 18. The method according to item 17, wherein the first primer of the second primer pair is a primer probe.
[0162] 19. The method according to item 18, wherein the primer probe has a probe element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:6 or the complete complement of SEQ ID NO:6.
[0163] 20. The method according to item 19, wherein the probe element further comprises a quencher, a fluorophore, and two self-complementary stem sequences, each stem sequence having a length of at least 5 nucleotides.
[0164] 21. The method according to item 17, wherein the second primer of the second pair has a primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:5 or the complete complement of SEQ ID NO:5.
[0165] 22. The method according to item 1, wherein the sample is a biological sample selected from the group consisting of cerebrospinal fluid, blood, feces, throat swab, rectal swab, nasopharyngeal swab, plasma, serum, and urine.
[0166] 23. The method according to item 22, wherein the nucleic acid is not extracted from the biological sample.
[0167] 24. A composition comprising a non-nucleic acid detectable label directly or indirectly linked to a primer having a primer element, the primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:1, the complete complement of SEQ ID NO:1, SEQ ID NO:2, or the complete complement of SEQ ID NO:2.
[0168] 25. The composition according to item 24, which is a primer-probe and further comprises a probe element directly or indirectly linked to the primer element through a polymerase blocking group, wherein the probe element comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO:3 or the complete complement of SEQ ID NO:3.
[0169] 26. The primer-probe according to item 25, which further comprises a quenching dye, wherein the detectable label is a fluorophore.
[0170] 27. A composition comprising a non-nucleic acid detectable label directly or indirectly linked to a primer having a primer element, the primer element comprising a nucleotide sequence that is at least 90% identical to SEQ ID NO:4, the complete complement of SEQ ID NO:4, SEQ ID NO:5, or the complete complement of SEQ ID NO:5.
[0171] 28. The composition according to item 27, which is a primer-probe and further comprises a probe element directly or indirectly linked to the primer element through a polymerase blocking group, wherein the probe element comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO:6 or the complete complement of SEQ ID NO:6.
[0172] 29. The primer-probe according to item 28, which further comprises a quenching dye, wherein the detectable label is a fluorophore.
[0173] 30. A kit comprising:
[0174] (a) a first primer of a first primer pair and a second primer of the first primer pair, the first primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO: 1 or its complete complement or consisting thereof, the second primer having a primer element that specifically hybridizes to a nucleotide comprising SEQ ID NO: 2 or its complete complement or consisting thereof, wherein at least one primer of the first primer pair is linked to a non-nucleic acid detectable label; and
[0175] (b) a first primer of a second primer pair and a second primer of the second primer pair, the first primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO: 4 or its complete complement or consisting thereof, the second primer having a primer element that specifically hybridizes to a nucleic acid comprising SEQ ID NO: 5 or its complete complement or consisting thereof, wherein at least one primer of the second primer pair is directly or indirectly linked to a non-nucleic acid detectable label. Sequence Listing <110> Quest Diagnostics Investments Corporation <120> Molecular Detection of Enteroviruses and Bimucoviruses <130> 034827-0387 <140> PCT / US2015 / 027951 <141> 2015-04-28 <150> 61 / 985,223 <151> 2014-04-28 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: synthetic primer <400> 1 aattgtcacc ataagcagcc a 21 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic primer <400> 2 cccctgaatg cggctaatc 19 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic primer <400> 3 acacggacac ccaaagtagt cggt 24 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic primer <400> 4 gttgtaaggc ccacgaa 17 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic primer <220> <221> Modified base <222> (17)..(17) <223> Inosine <400> 5 tcagatccat agtgtcnctt gtta 24 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Synthetic primer <400> 6 atgcccagaa ggtacccg 18 <210> 7 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: Synthetic primer-probe <220> <221> misc_feature <222> (34)..(35) <223> The nucleotides at these positions are non-contiguous and separated by FAM-spacer 18 moiety <400> 7 agcgcacacg gacacccaaa gtagtcggtg cgctcccctg aatgcggcta atc 53 <210> 8 <211> 52 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: Synthetic primer-probe <220> <221> misc_feature <222> (28)..(29) <223> The nucleotides at these positions are non-contiguous and separated by BHQ-spacer 18 moiety <220> <221> Modified base <222> (45)..(45) <223> Inosine <400> 8 cgcgcgatgc ccagaaggta cccgcgcgtc agatccatag tgtcncttgt ta 52
Claims
1. A composition comprising: a first primer consisting of the nucleotide sequence of SEQ ID NO:1, and a second primer consisting of a quencher dye, a first probe sequence, two self-complementary nucleotide sequences of 4, 5, 6 or 7 nucleotides in length flanking the first probe sequence, a fluorophore, a spacer, and the nucleotide sequence of SEQ ID NO:2, wherein the first probe sequence consists of the nucleic acid sequence of SEQ ID NO:3, and the spacer is a polyethylene glycol-based linker of 15, 16, 17, 18, 19, 20 or 21 atoms.
2. A composition comprising: a third primer consisting of the nucleotide sequence of SEQ ID NO:4; and a fourth primer consisting of a fluorophore, a second probe sequence, two self-complementary nucleotide sequences of 4, 5, 6 or 7 nucleotides in length flanking the second probe sequence, a quencher dye, a spacer, and the nucleotide sequence of SEQ ID NO:5, wherein the second probe sequence consists of the nucleic acid sequence of SEQ ID NO:6, and the spacer is a polyethylene glycol-based linker of 15, 16, 17, 18, 19, 20 or 21 atoms.
Citation Information
Patent Citations
Isothermal amplification method for enterovirus EV nucleic acid
CN103215386A
Methods and agents for detecting parechovirus
US20100035230A1