Neuroprotective gene therapy targeting the AKT pathway

Abstract

Compositions and methods for treating retinal degeneration are provided. In one aspect, an adeno-associated virus (AAV) vector is provided herein, comprising an AAV capsid, wherein a vector genome is encapsidated, and the vector genome comprises an AAV inverted terminal repeat (ITR) sequence, a human protein kinase B (AKT) coding sequence, and an expression control sequence that directs the expression of AKT in a host cell.

Description

Background Art

[0001] Retinitis pigmentosa (RP) is a general term for inherited retinal dystrophies that affect an estimated 1 in 3000-7000 people worldwide. Clinical onset is characterized by impaired dark (night) vision, accompanied by malfunction and death of rod photoreceptors. It is attributed to the degeneration of cone photoreceptors in the central retina, a process that, as it progresses, destroys peripheral vision and eventually leads to complete blindness. In many cases, this phenotype is caused by null mutations in genes essential for rod phototransduction, structure or homeostasis, providing a straightforward explanation for the loss of this photoreceptor subtype. However, these mutations generally cannot explain the progressive deterioration of cones in advanced disease.

[0002] What is needed is a treatment for retinal degeneration associated with RP and other ocular disorders in subjects in need thereof. Summary of the invention

[0003] The invention is illustrated by the following examples, which demonstrate that delivery of a vector for expression of AKT promotes significant preservation of photoreceptor number, structure, and visual function.

[0004] In one aspect, an adeno-associated virus (AAV) vector, the AAV vector comprises an AAV capsid, the AAV capsid is encapsidated with a vector genome, the vector genome comprises an AAV inverted terminal repeat (ITR) sequence, a human protein kinase B (AKT) coding sequence and an expression control sequence that directs the expression of AKT in a host cell. In one embodiment, the AKT coding sequence comprises an AKT1, AKT2 or AKT3 coding sequence. In one embodiment, the coding sequence is SEQ ID NO: 9.

[0005] In another aspect, a pharmaceutical composition is provided, comprising a pharmaceutically acceptable carrier and at least an AAV vector comprising an AKT sequence as described herein.

[0006] In another aspect, a method for treating retinal degeneration is provided. The method comprises administering an AAV vector as described herein to a subject in need thereof. In one embodiment, the AAV vector is administered subretinal or intravitreally.

[0007] In another aspect, a plasmid for producing an AAV vector is provided. In certain embodiments, the plasmid comprises nt 1253 to 5070 of SEQ ID NO: 1 or nt 1253 to 3868 of SEQ ID NO: 3, or a sequence sharing at least 80% identity thereto.

[0008] In yet another aspect, a method for producing a recombinant AAV (rAAV) is provided. The method comprises culturing a packaging cell comprising nt 1253 to 5070 of SEQ ID NO: 1 or nt 1253 to 3868 of SEQ ID NO: 3 in the presence of viral sequences sufficient to allow packaging of the gene expression cassette viral genome into an infectious AAV envelope or capsid.

[0009] In another aspect, a viral vector comprising a vector genome comprising nt 1253 to 5070 of SEQ ID NO: 1 or nt 1253 to 3868 of SEQ ID NO: 3 is provided.

[0010] In another aspect, the viral vector comprises a vector genome comprising a 5' ITR, a CMV enhancer, a chicken β-actin promoter, a Kozak sequence, an AKT coding region, a bGH poly A, and a 3' ITR.

[0011] In another aspect, the viral vector comprises a vector genome including a 5' ITR, a GRK1 promoter, an SV40 intron, a Kozak sequence, an AKT coding sequence, bGH poly A, and a 3' ITR.

[0012] In another aspect, provided is a composition for use in a method for treating retinal degeneration, wherein the composition comprises the AAV vector provided herein.

[0013] Still other aspects and advantages of the present invention will be apparent from the following detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1A-1H The design and characterization of the AAV7m8 vector are shown. Figure 1A ) Summary of the vector expression cassette. Rheb mRNA expression in transduced 84-31 cells compared to untreated controls ( Figure 1B ) and AKT3 mRNA expression ( Figure 1C ) quantification. Data are expressed as mean ± SD (N = 3). ****P < 0.0001. ( Figure 1D ) in AAV7m8.eGFP (2×10 9 Representative fundus images of mouse retina after subretinal delivery of (vg). Figure 1E ) Retinal tropism of AAV7m8 after subretinal injection. Untreated ( Figure 1F ) and AAV.AKT3 (1×10 9 vg) and AAV.eGFP (1×109 vg) co-injection ( Figure 1G-1H )PN45 rd10 Retinal flat mount.

[0015] Figure 2A-2G This showed that caRheb enhancement failed to attenuate photoreceptor degeneration. Figure 2A ) Cross-section of Pde6brd10 retina at PN45 after subretinal injection of AAV.eGFP or AAV.caRheb (plus AAV.eGFP) at PN13-14. ( Figure 2B ) Quantification of total ONL thickness in Pde6brd10 retinas treated with AAV.eGFP, AAV.caRheb / AAV.eGFP, or untreated. ( Figure 2C ) with AAV.eGFP (2×10 9 vg) alone or with AAV.eGFP (1×10 9 vg) and AAV.caRheb (1×10 9 vg) Quantification of GFP+ONL cells per 200 μm in eyes treated with co-injection. ( Figure 2D ) Right / left ratio of optokinetic reflex (OKR) for assessment of visual acuity. Mixed rod-cone A-wave amplitude ( Figure 2E ), mixed rod-cone B-wave amplitude ( Figure 2F ) and cone B707 wave amplitude ( Figure 2G ) were measured by electroretinogram (ERG). Data represent mean ± SEM. Index is indicated in the form of numerical values ​​within the data column.

[0016] Figure 3A-3H AKT3 gene transfer promotes photoreceptor survival and structural preservation. Untreated ( Figure 3A ) and treated with AAV.AKT3 / AAV.eGFP ( Figure 3B ) Representative images of Rd10 mouse retinas. ( Figure 3C ) and eGFP colocalization. Untreated ( Figure 3D ) and treated with AAV.AKT3 / AAV.eGFP ( Figure 3E ) Representative images of Rd10 retinas. ( Figure 3F ) colocalization with eGFP. Figure 3G ) Representative images of the transition area between untreated retinal sections and subretinal blebs at PN45. Figure 3H) Quantification of ONL thickness between treatment groups at PN30 and PN45. Data are presented as mean ± SEM. **P < 0.01; ***P < 0.001; ****P < 0.0001; ns (not significant).

[0017] Figure 4A-4D Shown are the effects of AKT3 gene transfer on retinal and visual function in Pde6brd10 retinas. Figure 4A ) Assessment of mixed rod-cone a-wave amplitudes between untreated and AAV.eGFP-treated and AAV.AKT3-treated retinas. ( Figure 4B ) Assessment of mixed rod-cone b-wave amplitudes between treatments. Figure 4C ) Photopic (cone) b-wave amplitudes between treatment groups. Figure 4D ) Ratio of right / left eye visual acuity examined by optokinetic response (OKR). The right eye was treated with AAV7m8.eGFP alone (2×10 9 vg) or treated in combination with AAV.AKT3, while the left eye was untreated. Data represent mean ± SEM. *P < 0.05; ***P < 0.001. The index is indicated by the value within the bar.

[0018] Figure 5A-5H It was shown that AKT3-induced neuroprotection is associated with mTOR activation. Figure 5A ) Representative images of Rd10 retinas treated with AAV.AKT3 / AAV.eGFP and stained with antibodies against the mTORC2 activation marker phospho-AKTSer. ( Figure 5B ) Colocalization with eGFP marking the area of ​​subretinal delivery. ( Figure 5C ) Higher magnification of AAV.AKT3 / AAV.eGFP transduced sections stained with mTORC2 markers. ( Figure 5D ) Pde6brd10 retinas treated with AAV.eGFP alone and stained with mTORC2 markers. ( Figure 5E ) Representative images of Pde6brd10 retinas treated with AAV.AKT3 / AAV.eGFP and stained for the typical mTORC1 activation marker phospho-S6Ser240 / 244. ( Fig. 5F ) colocalization with eGFP. Figure 5G ) Higher magnification of AAV.AKT3 / AAV.eGFP transduced sections stained with mTORC1 markers. ( Figure 5H ) Pde6brd10 retinas treated with AAV.eGFP alone and stained with mTORC1 markers.

[0019] Figure 6A-Figure 6IThis shows that AKT3 overexpression does not disrupt photoreceptor quiescence but activates Müllerian cells. Figure 6A-6C ), AAV7m8.eGFP (2×10 9 vg)Processing( Figure 6D-6F ) or AAV7m8.AKT3 (1×10 9 vg) and AAV7m8.eGFP (1×10 9 vg) co-injection ( Figure 6G-Figure 6I ) Representative images of cross sections of Pde6brd10 retinas. Sections were stained with antibodies against GFAP (a marker for Mullerian cells) and Ki67 (a marker for cell proliferation).

[0020] Figure 7A-7K Long-term AKT3 gene transfer stimulates chronic Mfüller cell gliosis in wild-type retinas. Untreated ( Figure 7A-7C ), using AAV7m8.eGFP (2×10 9 vg)Processing( Figure 7D-7F ) and AAV7m8.AKT3 (1×10 9 vg) and AAV7m8.eGFP (1×10 9 vg) co-injection ( Figure 7G-Figure 7I Representative photomicrographs of wild-type retinas. Sections were stained with antibodies against Ki67 and GFAP. Figure 7J ) Transition zone between untreated retinal slices and retinal slices treated with AAV.eGFP. Figure 7K ) Transition zone between the untreated area and the AAV.AKT3 / AAV.eGFP-treated area.

[0021] Figure 8A-8F The photoreceptor-specific expression of AKT3 mediates the expression of Pde6b rd10 Neuroprotection in the retina. ( Fig. 8A ) Depiction of the vector expression cassette. The AKT3 transgene is regulated by the photoreceptor-specific GRK1 promoter. Mixed a-waves ( Figure 8B ), mixed b waves ( Figure 8C ) and cone b waves ( Fig.8D ) Quantification of ERG responses. Fig. 8E ) with AAV7m8.GRK1.AKT3 (1×10 9 vg) Representative cross-sections of PN45 Pde6brd10 treated with AKT antibody to show photoreceptor-specific expression of AKT3. Fig.8F) Quantification of ONL thickness between treatment groups at PN 45. Data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0022] Figure 9A-9H AAV.GRK1.AKT3 does not stimulate reactive gliosis in Pde6brd10 retinas. Figure 9A-9C ) Representative images of untreated mouse retinas stained with typical markers for Müller cells (GFAP) and cell proliferation (Ki67) at PN45. ( Figure 9D-9F ) with AAV7m8.GRK1.AKT3 (1×10 9 vg) and AAV7m8.eGFP (1×10 9 vg) Co-treated PN45 Pde6br d10 Representative photomicrographs of the retina. Transition region between untreated and injected portions of the Pde6brd10 retina ( Figure 9G ) and colocalization with eGFP tracer ( Figure 9H ).

[0023] Figure 10A-10B AAV.caRheb was shown to stimulate mTORC1 activity in vitro but not in photoreceptors. Fig. 10A ) Evaluation of pS6 in 84-31 cells that were untreated or treated with AAV.eGFP or AAV.caRheb Ser240 / 244 Western blot of the expression of , S6 and GAPDH (loading control). Values ​​indicate biological replicates for each treatment condition. ( Fig. 10B ) with AAV7m8.eGFP (2×10 9 vg) (top panel) or with AAV7m8.caRheb (1×10 9 vg) and AAV7m8.eGFP (1×10 9 vg) co-injected (bottom panel) and treated with a Ser240 / 244 Representative photomicrographs of retinal sections stained with antibodies.

[0024] Figures 11A-11D Shown that long-term AKT3 gene transfer leads to retinal disintegration in wild-type animals. C57B1 / 6 (wild-type) mice received subretinal injection at PN13. Figure 11A-11B ) PN125 retinal histology revealed that AAV7m8.eGFP (2×10 9 Normal photoreceptor structure in animals treated with vg. Figure 11C-11D) with AAV7m8.eGFP (1×10 9 vg) and AAV7m8.AKT3 (1×10 9 Animals co-injected with the combination of α-vg) showed extensive disorganization of retinal layers and loss of photoreceptor number and structure.

[0025] Fig.12 A vector map of pAAV.CAG.Myr.HA.hAKT3(p1116) (SEQ ID NO: 1) is shown.

[0026] Fig.13 A vector map of pAAV.GRK1.Myr.HA.hAKT3(p1294) (SEQ ID NO: 3) is shown.

[0027] Fig.14 A vector map of p618.Hopt.AKT3 (SEQ ID NO: 5) is shown.

[0028] Fig.15A and Fig. 15B An alignment of the hAKT3 native sequence (SEQ ID NO: 7) and the hAKTopt sequence (SEQ ID NO: 13) is shown, and Fig. 15C The percent identity matrix of the alignment is shown. DETAILED DESCRIPTION

[0029] Described herein are recombinant replication-deficient adeno-associated virus (rAAV) vectors with AAV capsids for delivering nucleic acid sequences encoding human protein kinase B (AKT) and compositions containing the vectors. Also provided are uses of these compositions for treating ocular disorders.

[0030] As described below, stimulation of the mTOR signaling pathway using a conventional gene augmentation strategy delayed photoreceptor death and preserved visual function in preclinical models of inherited vision loss. Protein kinase B, also known as AKT1 or RAC-α serine / threonine protein kinase, is responsible for cell survival and biosynthetic responses through phosphorylation of multiple protein targets including p53, FoxO / FH transcription factors, and CREB. AKT consists of three closely related serine / threonine protein kinases (AKT1, AKT2, and AKT3) called AKT kinases, which regulate many cellular processes including metabolism, proliferation, survival, growth, and angiogenesis.

[0031] As used herein, the term "AKT" refers to AKT1, AKT2 or AKT3. The term "hAKT" refers to the coding sequence of human AKT. In certain embodiments, AKT refers to AKT1. In certain embodiments, AKT refers to AKT2. In certain embodiments, AKT refers to AKT3. Further, the term AKT is used herein to refer to a protein or a nucleic acid encoding the protein. The hAKT1 nucleic acid sequence can be found in SEQ ID NO: 9. The hAKT1 amino acid sequence can be found in SEQ ID NO: 10. The hAKT2 nucleic acid sequence can be found in SEQ ID NO: 11. The hAKT2 amino acid sequence can be found in SEQ ID NO: 12. The hAKT3 nucleic acid sequence can be found in SEQ ID NO: 7. The hAKT3 amino acid sequence can be found in SEQ ID NO: 8. In certain embodiments, the hAKT coding sequence is an engineered sequence, such as the hAKT3 coding sequence (sometimes referred to as "hAKTopt") found in SEQ ID NO: 13.

[0032] Nucleic acid sequences encoding hAKT are provided herein. In one embodiment, a nucleic acid encoding the hAKT1 amino acid sequence found in SEQ ID NO: 10 is provided. In another embodiment, a nucleic acid encoding the amino acid sequence found in SEQ ID NO: 12 is provided. In yet another embodiment, a nucleic acid sequence encoding the hAKT3 amino acid sequence found in SEQ ID NO: 8 is provided. Other isoforms of AKT are known in the art and may be used herein.

[0033] Described herein are compositions and methods for delivering nucleic acids encoding human protein kinase B (AKT) to mammalian subjects to treat ocular disorders and retinal degeneration associated therewith. In certain embodiments, such compositions comprise an engineered AKT coding sequence, such as the AKT coding sequence provided in SEQ ID NO: 13. It is expected that this optimization of the transgenic cassette will maximize the production level of the experimental protein compared to the level that can be produced using the native sequence. However, compositions comprising native AKT1, AKT2 or AKT3 coding sequences as provided in the following, respectively, are also contemplated herein: SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 7. It should be understood that when an embodiment is described for any one of AKT1, AKT2, and AKT3, it is intended to narrate similar embodiments for the other AKTs therein.

[0034] The technical and scientific terms used herein have the same meanings as those generally understood by those of ordinary skill in the art and by reference to the disclosure, which provides a general guide for those skilled in the art for many of the terms used in this application. The definitions contained in this specification are provided for the purpose of clearly describing the components and compositions herein and are not intended to limit the claimed invention.

[0035] As used herein, the term "subject" used herein means a mammal, including humans, veterinary or farm animals, livestock or pets, and animals commonly used in clinical studies. In one embodiment, the subject of these methods and compositions is a human. Still other suitable subjects include but are not limited to mice, rats, dogs, cats, pigs, cattle, sheep, non-human primates, etc. As used herein, the term "subject" can be used interchangeably with "patient".

[0036] In one embodiment, the subject is a child, i.e., under 18 years of age. In another embodiment, the subject is a young child, i.e., 8 years of age or less. In another embodiment, the subject is a toddler, i.e., 3 years of age or less. In yet another embodiment, the subject is a toddler, i.e., 1 year of age or less. In yet another embodiment, the subject is a newborn or infant, i.e., one month old or younger. In another embodiment, the subject is an adult, i.e., 60 years of age or older. In yet another embodiment, the subject is an elderly person, i.e., 35 years of age, 40 years of age, 45 years of age, 50 years of age, 55 years of age, 60 years of age, 65 years of age, 70 years of age, 75 years of age, 80 years of age, 85 years of age or older.

[0037] In certain embodiments of the present invention, the subject suffers from an "eye disorder" for which the components, compositions and methods of the present invention are designed to treat. In certain embodiments, the subject suffers from or is at risk of retinal degeneration, which may or may not be associated with an eye disorder. As used herein, "eye disorders" include cone-rod dystrophy and retinal diseases, which include but are not limited to Stargardt disease (autosomal dominant or autosomal recessive), retinitis pigmentosa and pattern dystrophy. In one embodiment, the subject suffers from retinitis pigmentosa. In one embodiment, the subject suffers from achromatopsia. In another embodiment, the subject suffers from choroideremia or X-linked inherited retinal degeneration. In another embodiment, the subject suffers from retinal degeneration associated with an eye disorder. In another embodiment, the subject suffers from retinal degeneration not associated with an eye disorder. Clinical signs of such eye diseases include but are not limited to decreased peripheral vision, decreased central (reading) vision, decreased night vision, loss of color perception, decreased visual acuity, decreased photoreceptor function, pigment changes and eventual blindness.

[0038] Retinal degeneration is a kind of retinopathy, and the retinopathy is the retinal degeneration caused by the gradual death of retinal cells. Retinal degeneration has multiple causes, including arterial or venous occlusion, diabetic retinopathy, RLF / ROP (posterior lens fibrosis / retinopathy of prematurity) or disease (usually hereditary). The signs and symptoms of retinal degeneration include but are not limited to visual impairment, night blindness, retinal detachment, light sensitivity, tubular vision and peripheral vision loss to the complete loss of vision. Retinal degeneration and remodeling cover a group of symptom of molecular, cellular and tissue levels, and the symptom is caused by hereditary retinal diseases such as retinitis pigmentosa (RP), genetic and environmental diseases such as age-related macular degeneration (AMD) and other damage to the eye / retina (including trauma and retinal detachment). These retinal changes and obvious plasticity lead to neuronal rewiring and reprogramming events, and the events include changes in gene expression, re-neurite generation and the formation of new synapses, which produce destructive circuits in bipolar cells by changes in dendritic trees and redundant axon growth. In addition, neuronal migration occurs along the vertical axis of the retina along the Müller cell rows, indicating altered metabolic signaling, and the retinal pigment epithelium (RPE) invades the retina, forming pigmented spicules, a classic clinical observation in RP disease (see, e.g., Bryan William Jones, Robert E. Marc, and Rebecca L. Pfeiffer, Retinal Degeneration, Remodeling and Plasticity).

[0039] As used herein, the term "treatment" refers to any method used to confer a benefit on a subject, i.e., the method can alleviate one or more symptoms or aspects of an ocular disease, disorder, or condition, delay the onset of one or more symptoms or aspects, reduce the severity or incidence of one or more symptoms or aspects, or produce prevention of one or more symptoms or aspects. For purposes of the present invention, treatment can be administered before, during, and / or after the onset of symptoms. In certain embodiments, treatment occurs after the subject receives conventional therapy. As used herein, the term "treatment" includes eliminating, substantially inhibiting, slowing or reversing the progression of a condition, substantially improving the clinical or aesthetic symptoms of a condition, or substantially preventing the appearance of clinical or aesthetic symptoms of a condition, or reducing the severity and / or frequency of one or more symptoms caused by an ocular disease, disorder, or condition.

[0040] The term "exogenous" as used herein with reference to a nucleic acid or amino acid sequence or protein means that the nucleic acid or amino acid sequence or protein does not naturally occur at the location where it occurs in a chromosome or host cell. An exogenous nucleic acid sequence also refers to a sequence derived from and inserted into the same host cell or subject, but it exists in a non-natural state, for example, a different copy number or under the control of a different regulatory element.

[0041] The term "heterologous" as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein originates from a different organism or a different species of the same organism than the host cell or subject in which the nucleic acid or protein is expressed. The term "heterologous" when used with reference to a protein or nucleic acid in a plasmid, expression cassette or vector indicates that the protein or nucleic acid is present with another sequence or subsequence to which the protein or nucleic acid in question is not found in the same relationship in nature.

[0042] In the context of nucleic acid sequences, the terms "sequence identity", "sequence identity percentage" or "identical percentage" refer to residues in two sequences that are identical when aligned for maximum correspondence. The length of the sequence identity comparison may exceed the full length of the AKT coding sequence or may be a fragment of at least about 100 to 150 nucleotides, or may be as desired. However, identity between smaller fragments may also be desired, such as at least about nine nucleotides, typically at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides. Multiple sequence alignment programs may also be used for nucleic acid sequences. Examples of such programs include "Clustal W", "CAP sequence assembly", "BLAST", "MAP" and "MEME", which are accessible via Web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, the vector NTI utility program is also used. Many algorithms known in the art may be used to measure nucleotide sequence identity, including those contained in the above-mentioned programs. As another example, the GCG 6.1 version of the program Fasta can be used. TM Compare polynucleotide sequences. Commonly used sequence analysis software, more specifically BLAST or analysis tools provided by public databases, may also be used. Similarly, for amino acid sequences, "percent sequence identity" and the like may be readily determined over the full length of a protein or a fragment thereof. Suitably, the fragment length is at least about 8 amino acids, and may be up to about 450 amino acids.

[0043] The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it occurs in nature). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of the coexisting materials in the natural system is isolated, even if later reintroduced into the natural system. Such a polynucleotide could be part of a vector and / or such a polynucleotide or polypeptide could be part of a composition and still be isolated because such a vector or composition is not part of its natural environment.

[0044] "Engineering" means that the nucleic acid sequence encoding the AKT protein described herein is assembled and placed in any suitable genetic element, such as naked DNA, bacteriophage, transposon, cosmid, episome, etc., which transfers the AKT sequence contained therein to a host cell, for example, for the production of a non-viral delivery system (e.g., RNA-based system, naked DNA, etc.) or for the production of a viral vector in a packaging host cell and / or for delivery to a host cell of a subject. In one embodiment, the genetic element is a plasmid. Methods for preparing such engineered constructs are known to nucleic acid manipulation technicians and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0045] As used herein, the term "transgene" refers to an exogenous or engineered protein-encoding nucleic acid sequence under the control of a promoter or expression control sequence in an expression cassette, rAAV genome, recombinant plasmid or production plasmid, vector or host cell described in this specification. In certain embodiments, the transgene is a human protein kinase B (AKT) sequence that encodes a functional AKT protein. In some embodiments, the transgene is a nucleic acid encoding the AKT amino acid sequence shown in SEQ ID NO: 8. In certain embodiments, the transgene is encoded by the sequence shown in SEQ ID NO: 7. In some embodiments, the transgene is a nucleic acid encoding the AKT amino acid sequence shown in SEQ ID NO: 10. In certain embodiments, the transgene is encoded by the sequence shown in SEQ ID NO: 9. In some embodiments, the transgene is a nucleic acid encoding the AKT amino acid sequence shown in SEQ ID NO: 12. In certain embodiments, the transgene is encoded by the sequence shown in SEQ ID NO: 11. In certain embodiments, the transgene is encoded by the sequence shown in SEQ ID NO: 13. In certain embodiments, the transgene is an engineered AKT coding sequence that shares at least 70% identity with SEQ ID NO: 7, 9, 11, or 13. For example, SEQ ID NO: 13 shares about 75% identity with SEQ ID NO: 7 (see Figure 15A-Figure 15C As described herein, the present invention contemplates further modifications to the native sequences.

[0046] In one embodiment, the nucleic acid sequence encoding AKT further includes a nucleic acid encoding a tag polypeptide covalently linked to AKT. The tag polypeptide can be selected from a known "epitope tag", which includes but is not limited to a myc tag polypeptide, a glutathione-S-transferase tag polypeptide, a green fluorescent protein tag polypeptide, a myc-pyruvate kinase tag polypeptide, a His6 tag polypeptide, an influenza virus hemagglutinin tag polypeptide, a flag tag polypeptide, a myr (myristoylated) polypeptide, and a maltose binding protein tag polypeptide. In one embodiment, the nucleic acid sequence comprises a MYR tag, such as found in SEQ ID NO: 1 or SEQ ID NO: 3.

[0047] As used herein, a "vector" is a nucleic acid molecule into which an exogenous or heterologous or engineered nucleic acid transgene may be inserted, which may then be introduced into an appropriate host cell. The vector preferably has one or more replication origins and one or more sites into which the recombinant DNA may be inserted. The vector generally has a convenient device by which cells having the vector may be selected from cells without the vector, for example, the vector encodes a drug resistance gene. Common vectors include plasmids, viral genomes, and (mainly in yeast and bacteria) "artificial chromosomes". Certain plasmids are described herein.

[0048] A "viral vector" is defined as a replication-defective virus containing an exogenous or heterologous AKT nucleic acid transgene. In one embodiment, an expression cassette as described herein can be engineered onto a plasmid for delivery to a host cell and / or for producing a viral vector. Suitable viral vectors are preferably replication-defective and selected from those targeting ocular cells. The viral vector may comprise any virus suitable for gene therapy, including but not limited to: adenovirus; herpes virus; lentivirus; retrovirus; parvovirus, etc.; however, for ease of understanding, adeno-associated virus is referred to herein as an exemplary viral vector.

[0049] "Replication-defective virus" or "viral vector" refers to a synthetic or recombinant viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, wherein any viral genomic sequence also packaged in the viral capsid or envelope is replication-defective; that is, it cannot produce progeny virions, but retains the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless"-containing only the transgene of interest, which is flanked by the signals required for amplification and packaging of the artificial genome), but these genes can be supplied during production. Therefore, this is considered safe for gene therapy because replication and infection by progeny virions will not occur unless the viral enzymes required for replication are present.

[0050] In yet another embodiment, the expression cassette (including any of the expression cassettes described herein) is used to produce a recombinant AAV genome.

[0051] As used herein, the term "host cell" may refer to a packaging cell line in which recombinant AAV is produced by a production plasmid. In an alternative, the term "host cell" may refer to any target cell in which transgenic expression is desired. Therefore, "host cell" refers to a prokaryotic or eukaryotic cell containing an exogenous or heterologous DNA introduced into the cell by any means (e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion technology, high-speed DNA-coated pellets, viral infection, and protoplast fusion). In certain embodiments herein, the term "host cell" refers to a culture of eye cells of various mammalian species for in vitro evaluation of the compositions described herein. In yet other embodiments, the term "host cell" is intended to refer to the eye cells of a subject receiving eye disease treatment in vivo.

[0052] As used herein, the term "eye cell" refers to any cell in the eye or associated with an eye function. The term may refer to any of the following: photoreceptor cells (comprising rod photoreceptor cells, cone photoreceptor cells and photosensitive ganglion cells), retinal pigment epithelium (RPE) cells, Mueller cells, choroid cells, bipolar cells, horizontal cells and amacrine cells. In one embodiment, the eye cell is a photoreceptor cell. In another embodiment, the eye cell is a RPE cell.

[0053] According to standard naming conventions familiar to those skilled in the art, "plasmid" is generally designated herein by a lowercase p preceded and / or followed by an uppercase letter and / or number. Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those skilled in the art. In addition, the skilled artisan can readily construct any number of other plasmids suitable for use in the present invention. The properties, construction, and use of such plasmids and other vectors in the present invention will be apparent to those skilled in the art of the present disclosure.

[0054] As used herein, the term "transcription control sequence" or "expression control sequence" refers to a DNA sequence, such as an initiator sequence, an enhancer sequence or a promoter sequence, which induces, represses or otherwise controls the transcription of a protein-coding nucleic acid sequence to which it is operably linked.

[0055] As used herein, the term "operably linked" or "operably associated" refers to both expression control sequences that are contiguous with a nucleic acid sequence encoding AKT and / or expression control sequences that act in trans or at a distance to control its transcription and expression.

[0056] As used herein, the term "AAV" or "AAV serotype" refers to dozens of naturally occurring and available adeno-associated viruses, as well as artificial AAVs. Among the AAVs isolated or engineered and well characterized from humans or non-human primates (NHPs), human AAV2 is the first AAV developed as a gene transfer vector; it has been widely used in efficient gene transfer experiments in different target tissues and animal models. Unless otherwise specified, the AAV capsids, ITRs, and other selected AAV components described herein can be easily selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8, and AAVAnc80, any known or mentioned AAV variants, or AAVs or variants or mixtures thereof that have not yet been discovered. See, for example, WO 2005 / 033321, which is incorporated herein by reference. In another embodiment, the AAV capsid is an AAV8bp capsid that preferentially targets bipolar cells. See WO 2014 / 024282, which is incorporated herein by reference. In certain embodiments, the AAV capsid is an AAV7m8 capsid, which has been shown to be preferentially delivered to the outer retina. See Dalkara et al., In Vivo-Directed Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous, Sci Transl Med 5, 189ra76 (2013), which is incorporated herein by reference. In one embodiment, the AAV capsid is an AAV8 capsid. In another embodiment, the AAV capsid is an AAV9 capsid. In another embodiment, the AAV capsid is an AAV5 capsid. In another embodiment, the AAV capsid is an AAV2 capsid.

[0057] As used herein, when referring to AAV, the term "variant" means any AAV sequence derived from a known AAV sequence, comprising an AAV sequence that shares at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or higher sequence identity with an amino acid or nucleic acid sequence. In another embodiment, the AAV capsid comprises a variant, which may comprise up to about 10% change with any described or known AAV capsid sequence. In other words, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity or about 97% to about 98% identity with the AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with the AAV capsid. When determining the identity percentage of the AAV capsid, any variable protein (e.g., vp1, vp2 or vp3) can be compared. In one embodiment, the AAV capsid shares at least 95% identity with AAV8vp3. In another embodiment, the AAV capsid shares at least 95% identity with AAV2 capsid. In another embodiment, a self-complementary AAV capsid is used.

[0058] ITR or other AAV components can be easily separated or engineered from AAV using techniques available to those skilled in the art. Such AAV can be separated, engineered or obtained from academic, commercial or public sources (e.g., American Type Culture Collection, Manassas, VA). Alternatively, AAV sequences can be engineered by reference to disclosed sequences (such as in the literature or in databases such as GenBank, PubMed) by synthesis or other suitable means. AAV viruses can be engineered by conventional molecular biology techniques, so that these particles can be optimized for cell-specific delivery of nucleic acid sequences, for minimizing immunogenicity, for regulating stability and particle life, for efficient degradation, for accurate delivery to the nucleus, etc.

[0059] As used herein, "artificial AAV" means, but is not limited to, AAV with a non-naturally occurring capsid protein. Such artificial capsids can be produced by any suitable technique using a combination of selected AAV sequences (e.g., fragments of vp1 capsid proteins) and heterologous sequences, which can be obtained from different selected AAVs, non-continuous portions of the same AAV, from non-AAV viral sources, or from non-viral sources. Artificial AAV can be, but is not limited to, pseudotyped AAVs, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. Pseudotyped vectors can be used in the present invention, in which the capsid of one AAV is replaced by a heterologous capsid protein. In one embodiment, AAV2 / 5 and AAV2 / 7m8 are exemplary pseudotyped vectors.

[0060] "Self-complementary AAV" refers to a plasmid or vector having an expression cassette in which the coding region carried by the recombinant AAV nucleic acid sequence has been designed to form an intramolecular double-stranded DNA template. After infection, instead of waiting for cell-mediated second-chain synthesis, two complementary half-scAAVs will associate to form a double-stranded DNA (dsDNA) that is easy to replicate and transcribe immediately. See, for example, DM McCarty et al., "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", "Gene Therapy", (August 2001), Vol. 8, No. 16, pp. 1248-1254. Self-complementary AAV is described in, for example, U.S. Pat. Nos. 6,596,535; 7,125,717; and 7,456,683, each of which is incorporated herein by reference in its entirety.

[0061] "Administration" or "route of administration" includes any known route of administration suitable for delivering the selected composition and can deliver an effective amount to the selected target cells characterized by an eye disease. The route of administration that can be used for the method of the present invention includes one or more of the following: oral, parenteral, intravenous, intranasal, sublingual, intraocular injection, subretinal injection, intravitreal injection, by reservoir formulation or device, by eye drops, by inhalation. In certain embodiments, the method involves delivering the composition to RPE, photoreceptor cells and / or other eye cells by subretinal injection. In certain embodiments, intravitreal injection is used to eye cells. In yet other embodiments, injection is used to eye cells by eyelid vein. In view of the present disclosure, those skilled in the art can select other methods of administration. If necessary, routes of administration can be combined. In certain embodiments, administration is repeated regularly. The pharmaceutical composition described herein is designed to be delivered to a subject in need by any suitable route or combination of different routes. Nucleic acid molecules and / or carriers described herein can be delivered in the form of a single composition or multiple compositions. Optionally, two or more different AAVs, or multiple viruses, can be delivered [see, for example, WO 202011 / 126808 and WO 2013 / 049493]. In another embodiment, the multiple viruses can contain different replication-defective viruses (e.g., AAV and adenovirus) alone or in combination with proteins.

[0062] Certain compositions described herein are isolated or synthetically or recombinantly engineered nucleic acid sequences that provide sequences encoding human AKT. In one embodiment, an isolated or engineered nucleic acid sequence encoding human AKT is provided. In certain embodiments, the sequence comprises one or more additional restriction sites to allow the addition of markers such as epitope tags. When aligned with a natural nucleic acid sequence, the engineered sequence encoding AKT can have at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90% identity percentage, including any integer between any of these ranges. In one embodiment, the engineered sequence encoding AKT has a percent identity to the native sequence of at least 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0063] A variety of expression cassettes are provided that use SEQ ID NO: 7 to express AKT protein. In one embodiment, an example of a plasmid containing such an expression cassette is shown in SEQ ID NO: 1. In one embodiment, an example of a plasmid containing such an expression cassette is shown in SEQ ID NO: 3. In another embodiment, the expression cassette does not contain a Myr tag. An expression cassette that uses SEQ ID NO: 13 to express AKT protein is shown in SEQ ID NO: 5.

[0064] As used herein, "expression cassette" refers to a nucleic acid molecule comprising a coding sequence, a promoter, and other regulatory sequences of an AKT protein, which may be engineered into a genetic element or plasmid and / or packaged into a capsid of a viral vector (e.g., a viral particle). In one embodiment, the expression cassette includes an engineered nucleic acid sequence encoding AKT. In one embodiment, the expression cassette includes an AKT coding sequence operably connected to an expression control sequence, which guides the expression of the AKT coding sequence and / or gene product in a host cell.

[0065] "Recombinant AAV" or "rAAV" is a DNAse-resistant viral particle containing two elements, namely the AAV capsid and a vector genome containing at least non-AAV coding sequences packaged in the AAV capsid. Unless otherwise specified, this term can be used interchangeably with the phrase "rAAV vector". rAAV is a "replication-defective virus" or "viral vector" because it lacks any functional AAV rep gene or functional AAV cap gene and cannot produce offspring. In certain embodiments, the only AAV sequence is the AAV inverted terminal repeat sequence (ITR), which is usually located at the 5' and 3' extreme ends of the vector genome to allow genes and regulatory sequences located between the ITRs to be packaged in the AAV capsid.

[0066] As used herein, "vector genome" refers to the nucleic acid sequence packaged inside the rAAV capsid that forms the virus particle. Such nucleic acid sequences contain AAV inverted terminal repeats (ITRs). In the examples herein, the vector genome contains at least AAV 5'ITR, coding sequence and AAV 3'ITR from 5' to 3'. ITR or non-full-length ITR from AAV2 (an AAV different from the capsid source) can be selected. In certain embodiments, ITR is from the same AAV source as that providing the rep function during the production or trans-supplementation of AAV. Further, other ITRs can be used. Further, the vector genome contains a regulatory sequence that guides the expression of a gene product.

[0067] Various plasmids are known in the art for producing rAAV vectors and can be used in the compositions and methods described herein. The production plasmid is cultured in a host cell expressing AAV cap and / or rep proteins. In the host cell, each rAAV genome is rescued and packaged into capsid proteins or envelope proteins to form infectious viral particles. In one embodiment, the production plasmid is a production plasmid described herein or in WO2012 / 158757, which is incorporated herein by reference.

[0068] One type of production plasmid is SEQ ID NO: 1 and Fig.12 The production plasmid shown in , the production plasmid is called pAAV.CAG.myr.hAKT3. Another production plasmid is shown in SEQ ID NO: 2 and Fig.13 Yet another production plasmid is shown in SEQ ID NO: 3 and Fig.14 Such plasmids are plasmids containing: 5'AAV ITR sequence; selected promoter; polyA sequence; and 3'ITR. A nucleic acid sequence encoding AKT is inserted between the selected promoter and the polyA sequence. In certain embodiments, the production plasmid is modified to optimize the efficiency of vector plasmid production. Such modifications are contemplated herein. In other embodiments, terminators and other sequences are included in the plasmid.

[0069] In still other embodiments, a recombinant adeno-associated virus (AAV) vector for delivering AKT constructs and sequences described herein is provided. The AAV vector comprises an AAV capsid and a nucleic acid sequence, the nucleic acid sequence comprising an AAV inverted terminal repeat (ITR) sequence and a nucleic acid sequence encoding human protein kinase B (AKT) and an expression control sequence for guiding AKT to be expressed in a host cell. Adeno-associated virus (AAV) viral vectors are AAV DNase-resistant particles with an AAV protein capsid, in which a nucleic acid sequence for delivery to a target cell is packaged. The AAV capsid is composed of 60 capsid (cap) protein subunits VP1, VP2, and VP3, which are arranged in an icosahedral symmetric manner, with a ratio of about 1:1:10 to 1:1:20, depending on the selected AAV. AAV can be selected as the source of the capsid of the AAV viral vector as identified above. In certain embodiments, the AAV capsid for a viral vector can be produced by mutagenesis (i.e., by insertion, deletion, or substitution) of one of the above-mentioned AAV capsids or its encoding nucleic acid. In some embodiments, the AAV capsid is chimeric, comprising domains from two or three or four or more AAV capsid proteins in the above-mentioned AAV capsid proteins. In some embodiments, the AAV capsid is a chimera of vpl monomers, vp2 monomers, and vp3 monomers from two or three different AAVs or recombinant AAVs. In some embodiments, the rAAV composition comprises more than one of the above-mentioned capsid proteins.

[0070] In order to package the expression cassette or rAAV genome or production plasmid into virions, ITR is the only AAV component that needs to be in cis in the same construct as the transgene. In one embodiment, the coding sequence for replication (rep) and / or capsid (cap) is removed from the AAV genome and supplied in trans or supplied by a packaging cell line to produce an AAV vector. For example, as described above, the pseudotype AAV can contain ITRs from a source different from the source of the AAV capsid. Additionally or alternatively, a chimeric AAV capsid is used. Still other AAV components can be selected. The sources of such AAV sequences are described herein and can also be isolated or engineered from academic, commercial or public sources (e.g., the American Type Culture Collection in Manassas, Virginia). Alternatively, the AAV sequence can be synthesized or otherwise suitable by reference to a disclosed sequence (e.g., in the literature or in, for example, obtained from publicly available sequences in databases such as those provided by

[0071] Methods for producing and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, e.g., U.S. Pat. No. 7,790,449; U.S. Pat. No. 7,282,199; WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; and US 7,588,772 B2. In one system, a production cell line is transiently transfected with a construct encoding a transgene flanked by ITRs and a construct encoding rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding a transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpes virus, thereby requiring separation of rAAV from contaminating viruses. Recently, systems have been developed that do not require infection with a helper virus to recover AAV - by which the desired helper functions are also provided in trans (i.e., adenovirus El, E2a, VA and E4 or herpesvirus UL5, UL8, UL52 and UL29, and herpesvirus polymerase). In these newer systems, helper functions can be provided by transiently transfecting the system with a construct encoding the desired helper function, or the cells can be engineered to stably contain genes encoding helper functions, the expression of which can be controlled at the transcriptional or post-transcriptional level.

[0072] In yet another system, transgenes flanked by ITRs and rep / cap genes are introduced into insect cells by infection with a baculovirus-based vector. For a review of these production systems, see generally, e.g., Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of which are incorporated herein by reference in their entirety. Methods for making and using these and other AAV production systems are also described in the following U.S. Patents, the contents of each of which are incorporated herein by reference in their entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, for example, Grieger and Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol. 99: 119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med. 10: 717-733; and references cited below, each of which is incorporated herein by reference in its entirety.

[0073] Methods for constructing any embodiment of the present invention are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012). Similarly, methods for producing rAAV virions are well known and the selection of an appropriate method is not a limitation of the present invention. See, for example, K. Fisher et al., (1993) J. Virol., 70: 520-532 and U.S. Pat. No. 5,478,745.

[0074] The rAAV vector provided herein comprises an AAV capsid and an AAV expression cassette having a sequence encoding AKT, such as those described above. In certain embodiments, the rAAV expression cassette comprises an AAV reverse terminal repeat sequence and a nucleic acid sequence encoding AKT and an expression control sequence for guiding the expression of the encoded protein in a host cell. In other embodiments, the rAAV expression cassette further comprises one or more of an intron, a Kozak sequence, a polyA, and a post-transcriptional regulatory element. Such rAAV vectors used in pharmaceutical compositions for delivery to the eye can adopt a capsid from any of many known AAVs, and the known AAVs include those described herein.

[0075] Other conventional components of the expression cassettes and vectors provided herein can be optimized for specific species using techniques known in the art, including, for example, codon optimization, as described herein. The components of the cassettes, vectors, plasmids, viruses, or other compositions described herein include a promoter sequence as part of an expression control sequence. In another embodiment, the promoter is cell-specific. The term "cell-specific" means that the specific promoter selected for the recombinant vector can direct the expression of the AKT transgene in one or more specific eye cell types. In one embodiment, the promoter is specific for the expression of the transgene in photoreceptor cells. In another embodiment, the promoter is specific for the expression in rods and cones. In another embodiment, the promoter is specific for the expression in rods. In another embodiment, the promoter is specific for the expression in cones. In one embodiment, the photoreceptor-specific promoter is the human rhodopsin kinase promoter. The rhodopsin kinase promoter has been shown to be active in both rods and cones. See, e.g., Sun et al., "Gene Therapy with a Promoter Targeting Both Rods and Cones Rescues Retinal Degeneration Caused by AIPL1 Mutations," Gene Ther. 2010 Jan; 17(1): 117-131, which is incorporated herein by reference in its entirety. In one embodiment, the promoter is modified to add one or more restriction sites to facilitate cloning.

[0076] In yet other embodiments, the promoter is a human rhodopsin promoter. In one embodiment, the promoter is modified to include restrictions on cloning ends. See, for example, Nathans and Hogness, "Isolation and nucleotide sequence of the gene encoding human rhodopsin," Proceedings of the National Academy of Sciences (PNAS), 81: 4851-5 (August 1984), which is incorporated herein by reference in its entirety. In another embodiment, the promoter is a portion or fragment of the human rhodopsin promoter. In another embodiment, the promoter is a variant of the human rhodopsin promoter.

[0077] Other exemplary promoters include the human G-protein coupled receptor protein kinase 1 (GRK1) promoter (Genbank accession number AY327580). In another embodiment, the promoter is a 292nt fragment (positions 1793-2087) of the GRK1 promoter (see Beltran et al., Gene Therapy 201017: 1162-74, which is hereby incorporated by reference in its entirety). In one embodiment, the promoter is the GRK1 promoter of nt 1427-1790 of SEQ ID NO: 3. In another preferred embodiment, the promoter is the human interphotoreceptor retinoid binding protein proximal (IRBP) promoter. In one embodiment, the promoter is a 235nt fragment of the hIRBP promoter. In one embodiment, the promoter is the RPGR proximal promoter (Shu et al., Investigative Ophthalmology and Visual Sciences (IOVS), May 2102, which is incorporated by reference in its entirety). Other promoters that can be used in the present invention include, but are not limited to, the rod opsin promoter, the red-green opsin promoter, the blue opsin promoter, the cGMP-β-phosphodiesterase promoter (Qgueta et al., Invest Ophthalmol Vis Sci., IOVS, Dec 2000; 41(13):4059-63), the mouse opsin promoter (Beltran et al. 2010 cited above), the rhodopsin promoter (Mussolino et al., Gene Ther, Jul 2011, 18(7):637-45); the alpha subunit of cone transducin (Morrissey et al., BMC Dev, Biol, Jan 2011, 11:3); the beta phosphodiesterase (PDE) promoter; the retinitis pigmentosa (RP1) promoter (Nicord et al., J. Gene Med. Med, December 2007, 9(12): 1015-23); NXNL2 / NXNL1 promoter (Lambard et al., PLoS One, October 2010, 5(10): e13025), RPE65 promoter; retinal degeneration slow / peripherin 2 (Rds / perph2) promoter (Cai et al., Exp Eye Res. 2010 August; 91(2): 186-94); and VMD2 promoter (Kachi et al., Human Gene Therapy, 2009(20: 31-9). Each of these documents is incorporated herein by reference in its entirety.In another embodiment, the promoter is selected from the human EF1α promoter, rhodopsin promoter, rhodopsin kinase, inter-photoreceptor binding protein (IRBP), cone opsin promoter (red-green, blue), cone opsin upstream sequence containing red-green cone locus control region, cone transduction and transcription factor promoter (neural retinal leucine zipper (Nrl) and photoreceptor-specific nuclear receptor Nr2e3, bZIP).

[0078] In other embodiments, the promoter is a ubiquitous promoter or a constitutive promoter. An example of a suitable promoter is a hybrid chicken β-actin (CBA) promoter with a cytomegalovirus (CMV) enhancer element. In another embodiment, the chicken β-actin promoter with a CMV enhancer sequence is nt 1443-3104 of SEQ ID NO: 1. In yet another embodiment, the chicken β-actin promoter with a CMV enhancer sequence is nt 1493 to 2075 of SEQ ID NO: 5. In another embodiment, the promoter is a CB7 promoter. Other suitable promoters include human β-actin promoter, human elongation factor-1 alpha promoter, cytomegalovirus (CMV) promoter, simian virus 40 promoter, and herpes simplex virus thymidine kinase promoter. See, e.g., Damdindori et al., (August 2014) "Comparative Analysis of Constitutive Promoters Located in Adeno-Associated Viral Vectors". PLoS ONE, 9(8): e106472. Still other suitable promoters include viral promoters, constitutive promoters, regulatable promoters (see, e.g., WO 2011 / 126808 and WO 2013 / 04943). Alternatively, promoters responsive to physiological cues can be used in the expression cassettes, rAAV genomes, vectors, plasmids and viruses described herein. In one embodiment, due to the size limitation of the AAV vector, the size of the promoter is relatively small, less than 1000 bp. In another embodiment, the promoter is less than 400 bp. Other promoters may be selected by one skilled in the art. In one embodiment, the AKT construct comprises a CBA promoter with a CMV enhancer element. In another embodiment, the AKT construct comprises a GRK1 promoter. In one embodiment, the GRK1 promoter is the promoter shown in nt 1427 to 1790 of SEQ ID NO:3.

[0079] In certain embodiments, the promoter is an inducible promoter. The inducible promoter may be selected from known promoters, including rapamycin / rapamycin analogs (rapalog) promoters, ecdysone promoters, estrogen-responsive promoters, and tetracycline-responsive promoters or heterodimeric repressor switches. See Sochor et al., "An Autogenously Regulated Expression System for Gene Therapeutic Ocular Applications". Scientific Reports, 2015 November 24; 5: 17105 and Daber R, Lewis M., "A novel molecular switch". J Mol Biol. 2009 August 28; 391 (4): 661-70, electronic version 2009 June 21, both of which are incorporated herein by reference in their entirety.

[0080] In other embodiments, the cassettes, vectors, plasmids and viral constructs described herein contain other suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; TATA sequences; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); introns; sequences that enhance protein stability; and, when necessary, sequences that enhance secretion of the encoded product. The expression cassette or vector may not contain any of the elements described herein, and may contain one or more of any of the elements described herein. Examples of suitable polyA sequences include, for example, SV40, bovine growth hormone (bGH) polyA and TK polyA. Examples of suitable enhancers include, for example, CMV enhancers, RSV enhancers, alpha-fetoprotein enhancers, TTR minimal promoter / enhancers, LSP (TH binding globulin promoter / α1-microglobulin / double Kunitz inhibitor enhancers) and other enhancers. In one embodiment, a Kozak sequence is included upstream of the transgenic coding sequence to enhance translation from the correct start codon. In another embodiment, CBA exon 1 and introns are included in the expression cassette. In one embodiment, the transgene is placed under the control of the hybrid chicken beta actin (CBA) promoter. This promoter consists of the following: cytomegalovirus (CMV) immediate early enhancer, proximal chicken beta actin promoter and CBA exon 1 flanked by intron 1 sequences.

[0081] In certain embodiments, the Kozak sequence is GCCGCCACC (SEQ ID NO: 1, nt 3121 to 3129).

[0082] In certain embodiments, the expression cassette contains a 5' ITR, a CBA promoter, a CMV enhancer, a human AKT3 coding sequence (SEQ ID NO: 7), a bGH polyA, and a 3' ITR.

[0083] In certain embodiments, the expression cassette contains a 5' ITR, hGRK1 promoter, human AKT3 sequence (SEQ ID NO: 7), bGH poly A, and a 3' ITR.

[0084] In certain embodiments, the expression cassette contains a 5' ITR, a CBA promoter, a CMV enhancer, an engineered human AKT3 sequence (SEQ ID NO: 13), bGH poly A, and a 3' ITR.

[0085] In certain embodiments, the expression cassette contains a 5' ITR, an hGRK1 promoter, an engineered human AKT3 sequence (SEQ ID NO: 13), bGH poly A, and a 3' ITR.

[0086] In certain embodiments, the nucleic acid sequences, vectors, expression cassettes or rAAV viral vectors described herein can be used in pharmaceutical compositions that also contain a pharmaceutically acceptable carrier, buffer, diluent and / or adjuvant, etc. Such pharmaceutical compositions are used to express AKT in ocular cells by delivery via, for example, recombinantly engineered AAV or artificial AAV.

[0087] To prepare these pharmaceutical compositions containing nucleic acid sequences, vectors, expression cassettes and rAAV viral vectors, it is preferred to assess the contamination of the sequence or vector or viral vector by conventional methods, and then the sequence or vector or viral vector is formulated into a pharmaceutical composition suitable for application to the eye. Such formulations involve the use of pharmaceutically and / or physiologically acceptable vehicles or carriers, especially vehicles or carriers suitable for application to the eye such as buffered saline or other buffers (e.g., HEPES), to maintain pH at an appropriate physiological level, and optionally, involve the use of other pharmaceutical agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will generally be a liquid. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free phosphate buffered saline. Various such known carriers are provided in U.S. Patent Publication No. 7,629,322, which is incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is a balanced salt solution. In one embodiment, the carrier comprises Tween. If the virus is to be stored long term, it can be frozen in the presence of glycerol or Tween 20.

[0088] In an exemplary embodiment, the composition of the carrier or excipient contains 180 mM NaCl, 10 mM NaPi, pH 7.3 and 0.0001%-0.01% Pluronic F68 (PF68). The exact composition of the saline component of the buffer is in the range of 160 mM to 180 mM NaCl. Optionally, a different pH buffer (possibly HEPES, sodium bicarbonate, TRIS) is used instead of the specifically described buffer. Still alternatively, a buffer containing 0.9% NaCl can be used.

[0089] Optionally, in addition to rAAV and / or variants and carriers, the compositions of the invention may also contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, and p-chlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0090] In the case of AAV viral vectors, quantification of genome copies ("GC"), vector genomes ("VG"), or viral particles can be used as a measure of the dose contained in a formulation or suspension. The number of genome copies (GC) of the replication-defective viral composition of the present invention can be determined using any method known in the art. One method for performing AAV GC titration is as follows: a purified AAV vector sample is first treated with DNase to eliminate unencapsidated AAV genomic DNA or contaminating plasmid DNA from the production process. The DNase-resistant particles are then subjected to heat treatment to release the genome from the capsid. The released genome is then quantified by real-time PCR using a primer / probe set targeting a specific region of the viral genome (usually a polyA signal). In another method, the effective dose of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding an AKT transgene is measured as described below: SKMcLaughlin et al., 1988 Journal of Virology (J. Virol.), 62: 1963, which is incorporated by reference in its entirety.

[0091] As used herein, the term "dose" may refer to the total dose delivered to a subject during treatment or the amount delivered by administration of a single unit (or multiple units or divided doses). The pharmaceutical viral composition may be formulated in dosage units to contain an amount of a replication-defective virus carrying a nucleic acid sequence encoding AKT as described herein, the amount ranging from about 1.0×10 9 GC to about 1.0×10 15 GC, including all integers and fractions within the range. In one embodiment, the composition is formulated to contain at least 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 ,7×10 9 , 8×10 9 or 9×10 9 GC, including all integers and fractions within the range. In another embodiment, the composition is formulated to contain at least 1×10 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 ,7×10 10 , 8×10 10 or 9×10 10GC, including all integers and fractions within the range. In another embodiment, the composition is formulated to contain at least 1×10 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 ,7×10 11 , 8×10 11 or 9×10 11 GC, including all integers and fractions within the range. In another embodiment, the composition is formulated to contain at least 1×10 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 ,7×10 12 , 8×10 12 or 9×10 12 GC, including all integers and fractions within the range. In another embodiment, the composition is formulated to contain at least 1×10 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 ,7×10 13 , 8×10 13 or 9×10 13 GC, including all integers and fractions within the range. In another embodiment, the composition is formulated to contain at least 1×10 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 ,7×10 14 , 8×10 14 or 9×10 14 GC, including all integers and fractions within the range. In another embodiment, the composition is formulated to contain at least 1×10 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 ,7×10 15 , 8×10 15or 9×10 15 GC, including all integers and fractions within the range. In one embodiment, for human use, the dosage range may be 1×10 10 To about 1×10 12 GC, including all integers or fractional amounts within the range. All doses can be measured by any known method, including by qPCR or digital droplet PCR (ddPCR), as described, for example, in: M. Lock et al., "Human Gene Ther Methods". April 2014; 25(2): 115-25. doi: 10.1089 / hgtb.2013.131, which is incorporated herein by reference.

[0092] These above-mentioned dosages can be administered with various volumes of carrier, excipient or buffer formulations, ranging from about 25 to about 1000 microliters, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 75 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 225 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 275 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 325 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 375 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 550 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 650 μL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is between about 700 and about 1000 μL.

[0093] In certain embodiments, for small animal subjects such as mice, the viral construct is expressed at about 1×10 9 GC to about 1×10 11For example, a dose of GC is delivered in a volume of about 1 μL to about 3 μL. For larger veterinary subjects whose eyes are about the same size as human eyes, the larger human doses and volumes described above can be used. See, for example, Diehl et al., J. Applied Toxicology, 21: 15-23 (2001) for a discussion of good practices for administering substances to various veterinary animals. This document is incorporated herein by reference.

[0094] It is desirable to utilize the lowest effective concentration of virus or other delivery vehicle to reduce the risk of undesirable effects such as toxicity, retinal dysplasia and detachment. Still other dosages within these ranges may be selected by the attending physician taking into account the physical state of the subject (preferably a human) being treated, the age of the subject, the particular ocular condition, and the extent of development of the condition (if progressive).

[0095] In certain aspects, described herein is a method for treating, delaying or stopping the progression of blindness in a mammalian subject with an eye condition or a risk of suffering from an eye condition. In one embodiment, the subject suffers from retinal degeneration. In certain embodiments, the rAAV carrying the AKT sequence preferably suspended in a physiologically compatible carrier, diluent, excipient and / or adjuvant is administered to a desired subject (e.g., a human subject). This method includes administering any of the following to a subject in need: a nucleic acid sequence, an expression cassette, an rAAV genome, a plasmid, a vector or an rAAV vector or a composition containing these substances. In certain embodiments, the composition is delivered subretinal. In another embodiment, the composition is delivered in the vitreous. In still another embodiment, the composition is delivered using a combination of administration routes suitable for treating eye conditions, including but not limited to administration through the eyelid vein or other intravenous or conventional administration routes.

[0096] For use in these methods, as further described herein, the volume and viral titer of each dose are determined separately and may be the same or different from other treatments performed in the same or contralateral eye. Dosage, administration and regimen may be determined by the attending physician according to the teachings of this specification. In certain embodiments, the composition is administered in a single dose selected from those listed above and applied to a single affected eye. In other embodiments, the composition is administered to two affected eyes simultaneously or sequentially in a single dose selected from those listed above. Sequential administration may mean that the time interval between administrations from one eye to another eye is a few minutes, hours, days, weeks or months. In other embodiments, the method involves administering the composition to the eye in two or more doses (e.g., divided doses). In another embodiment, multiple injections are performed in different parts of the same eye. In another embodiment, a second administration of rAAV containing a selected expression cassette (e.g., a cassette containing AKT) is performed at a later time point. Such time points may be weeks, months or years after the first administration. In one embodiment, such a second administration is performed with a rAAV having a capsid different from that of the rAAV administered for the first time. In another embodiment, the rAAV administered for the first time and the second time have the same capsid.

[0097] In still other embodiments, the compositions described herein are delivered in the form of a single composition or multiple compositions. Optionally, two or more different AAVs, or multiple viruses are delivered [see, e.g., WO 2011 / 126808 and WO 2013 / 049493]. In another embodiment, the multiple viruses contain different replication-defective viruses (e.g., AAV and adenovirus).

[0098] In certain embodiments, it is desirable to perform non-invasive retinal imaging and functional studies to identify the eye area (e.g., rod and cone photoreceptors) to be targeted for treatment. In these embodiments, clinical diagnostic tests are used to determine the precise location of one or more subretinal injections. These tests include, for example, electroretinograms (ERGs), visual field examinations, local anatomical mapping of retinal layers and measurement of retinal layer thickness by confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), local anatomical mapping of cone density by adaptive optics (AO), functional ophthalmological examinations, etc., which depend on the species, physical condition and dosage of the treated subject. In view of the imaging and functional studies performed, in certain embodiments, one or more injections are performed in the same eye to target different areas of the affected eye. As further described herein, the volume and viral titer of each injection are determined separately and may be the same or different from other injections performed in the same or contralateral eye. In another embodiment, a single larger volume injection is performed to treat the entire eye. In one embodiment, the volume and concentration of the rAAV composition are selected so that only the area of ​​damaged eye cells is affected. In another embodiment, the volume and / or concentration of the rAAV composition is greater in order to reach a greater portion of the eye (including intact photoreceptors).

[0099] In certain embodiments of the methods described herein, a one-time intraocular delivery of a composition as described herein (eg, AAV delivery of an AKT expression cassette) can be used to prevent vision loss and blindness in a subject at risk for an ocular disorder or retinal degeneration.

[0100] In certain embodiments, the composition is administered prior to the onset of disease. In other embodiments, the composition is administered prior to the onset of vision impairment or loss. In other embodiments, the composition is administered after the onset of vision impairment or loss. In yet other embodiments, the composition is administered when less than 90% of the rods and / or cones or photoreceptors are functioning or preserved compared to an unaffected eye (e.g., the contralateral eye).

[0101] In certain embodiments, the methods include performing additional studies, such as functional and imaging studies, to determine the efficacy of the treatment. For animals, such tests include assessment of retinal and visual function by observing rod and cone photoreceptor function through electroretinography (ERG), optokinetic nystagmus, pupillometry, water maze testing, light-dark preference, optical coherence tomography (measurement of thickness of retinal layers), histology (retinal thickness, rows of nuclei in the outer nuclear layer, immunofluorescence to record transgene expression, cone photoreceptor counts, staining of retinal sections with peanut agglutinin - which recognizes cone photoreceptor sheaths).

[0102] Specifically for human subjects, after administration of a dose of the composition described in this specification, the following is used to test the efficacy of the treatment of the subject: electroretinogram (ERG) to check rod and cone photoreceptor function, pupillometry visual acuity assessment, contrast sensitivity color vision test, visual field test (Humphrey visual fields / Goldmann visual fields), visual field test movement test (obstacle course) and / or reading speed test. Other useful post-treatment efficacy tests that subjects receive after treatment with the pharmaceutical compositions described herein include: functional magnetic resonance imaging (fMRI), full-field light sensitivity test, retinal structure study (including optical coherence tomography), fundus photography, fundus autofluorescence (FAF), adaptive optics laser scanning ophthalmoscopy, movement test, test of reading speed and accuracy, microperimetry and / or ophthalmoscopy. These and other efficacy tests are described in U.S. Patent No. 8,147,823 and co-pending International Patent Application Publications WO 2014 / 011210 or WO 2014 / 124282, which are incorporated herein by reference.

[0103] In yet other embodiments, any of the methods described above is combined with another therapy or secondary therapy. In still other embodiments, the method for treating these eye diseases involves treating the subject with a combination of the composition described in detail herein and another therapy such as antibiotic treatment, palliative treatment of pain, etc. The other therapy can be any currently known or still unknown therapy that helps prevent, prevent or improve these mutations or defects or any effect associated with them. The secondary therapy can be applied before, at the same time or after the composition described above is applied. In certain embodiments, the secondary therapy involves non-specific methods for maintaining retinal cell health, such as administering neurotrophic factors, antioxidants, anti-apoptotic agents. The non-specific method is achieved by injecting protein, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue or genetically modified cells. The latter can include encapsulated genetically modified cells.

[0104] In certain embodiments, a method of producing a recombinant rAAV comprises obtaining a plasmid containing an AAV expression cassette as described above, and culturing a packaging cell carrying the plasmid in the presence of viral sequences sufficient to allow packaging of the AAV viral genome into an infectious AAV envelope or capsid. Specific methods for producing rAAV vectors are described above and can be employed to produce rAAV vectors that can deliver the expression cassettes or vector genomes described above or in the examples below.

[0105] In yet other embodiments, vectors comprising any of the expression cassettes described herein are provided. As described above, such vectors can be plasmids of various origins and can be used in certain embodiments to produce recombinant replication-defective viruses as further described herein.

[0106] It should be noted that the term "a" or "an" refers to one or more. Thus, the terms "a or an", "one or more" and "at least one" are used interchangeably herein. The words "comprise", "comprises" and "comprising" will be interpreted as being inclusive rather than exclusive. The words "consist of", "consisting of" and their variants will be interpreted as being exclusive rather than inclusive. Although the various embodiments in the specification are presented using "comprising" language, in other cases, it is also intended to use the language of "consisting of" or "consisting essentially of" to explain and describe the relevant embodiments. As used herein, unless otherwise stated, the term "about" means a variability of 10% relative to a given reference. As used herein, the term "regulate" or its variants refers to the ability of a composition to inhibit one or more components of a biological pathway.

[0107] Unless otherwise defined in this specification, technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art and with reference to the public texts, which provide those skilled in the art with a general guide to many of the terms used in this application.

[0108] The following examples are illustrative only and are not intended to limit the invention.

[0109] Examples

[0110] Mutations in more than 250 known genes are associated with hereditary retinal degeneration. The clinical success of gene replacement therapy for congenital blindness due to RPE65 mutations has established a platform for the upstream treatment of other forms of targeted hereditary eye diseases. Unfortunately, several challenges associated with complex disease pathology and the limitations of current gene transfer technology have hindered the development of relevant strategies for each specific form of hereditary retinal degeneration. Here, a gene enhancement strategy is described that delays retinal degeneration by stimulating the anabolic features necessary for photoreceptor survival and structural maintenance. Two key regulatory points in the typical insulin / AKT / mTOR pathway are targeted by AAV-mediated gene enhancement in a mouse model of retinitis pigmentosa. AAV vectors expressing serine / threonine kinase AKT3 promote the significant retention of photoreceptor quantity, structure and partial visual function. This protective effect is associated with the successful reprogramming of photoreceptor metabolism toward pathways associated with cell growth and survival. In general, these findings emphasize the importance of AKT activity and downstream pathways associated with anabolism in photoreceptor survival and maintenance.

[0111] Example 1: Materials and Methods

[0112] animal

[0113] C57Bl / 6 and Pde6brd10 mice were obtained from the Jackson Laboratory and housed on a 12-hour light / dark cycle. Animals were housed at the University of Pennsylvania in compliance with ARVO guidelines and institutional and federal regulations for the care and use of laboratory animals.

[0114] AAV vectors

[0115] Plasmids encoding human AKT3 cDNA sequences containing N-terminal myristoylation (MYR) and HA tags were kindly provided by William Sellers (Addgene #9017 plasmid). The MYR-HA-hAKT3 sequence was amplified and cloned into an AAV proviral expression plasmid using the In-Fusion HD cloning system (Clonetech). Human Rheb cDNA clones were obtained from Origene. Inverse PCR mutagenesis was used to generate the S16H mutation with the following primer sequences: 5′ [phospho] CACGTGGGGAAATCCTCATTGAC 3′ (S16H forward) (SEQ ID NO: 14) and 5′ CCGGTAGCCCAGGAT 3′ (SEQ ID NO: 15). Human Rheb cDNA containing the S16H mutation was then cloned into an AAV proviral expression plasmid using the In-Fusion HD cloning system. To generate viral vectors, a helper plasmid expressing AAV7m8 Cap was kindly provided by John Flannery and David Schaffer (Addgene Plasmid Shared Information Library #64839 plasmid). AAV7m8-AKT3 and AAV7m8-eGFP vectors were generated using previously described methods46 and purified by the Center for Advanced Retinal and Ocular Therapeutics (CAROT) Research Vector Core (University of Pennsylvania, PA, USA) using CsCl gradient ultracentrifugation.

[0116] Cell culture and AAV transduction

[0117] 84-31 cells were kindly provided by Dr. James Wilson (University of Pennsylvania) and cultured in Dulbecco's modified Eagle's medium-glutamine (DMEM-GlutaMax) supplemented with 10% FBS and 1% penicillin-streptomycin. For AAV transduction, 84-31 cells were plated at 2.5×10 5 The cells were plated in 6-well culture dishes at a density of 1×10 cells / well. 6 The cells were transduced at a multiplicity of infection (MOI) of 1:1 and maintained at 37°C with 5% CO2.

[0118] RNA isolation and gene expression analysis

[0119] RNA was isolated using Macherey-Nagel Nucleospin RNA kit. First-strand cDNA was synthesized using 500 ng of total RNA according to the manufacturer's protocol using the SuperScript III first-strand synthesis system. Real-time PCR was performed using the Power SYBR green PCR master mix (Invitrogen) using the Applied Biosystems 7500Fast system. The following primer sequences were used: 5'CCACTCCTCCACCTTTGAC 3' (human GAPDH forward; SEQ ID NO: 16), 5'ACCCTGTTGCTGTAGCCA 3' (human GAPDH reverse; SEQ ID NO: 17), 5'ACTCCTACGATCCAACCATAGA 3' (human Rheb forward; SEQ ID NO: 18), 5'TGGAGTATGTCTGAGGAAAGATAGA 3' (human Rheb reverse; SEQ ID NO: 19), 5'AGGATGGTATGGACTGCATGG 3' (human AKT3 forward; SEQ ID NO: 20), and 5'GTCCACTTGCAGAGTAGGAAAA 3' (human AKT3 reverse; SEQ ID NO: 21). Relative gene expression was quantified using the ΔΔCT method and normalized to GAPDH.

[0120] Subretinal injection

[0121] Subretinal injections were performed as previously described. Each retina received 1 uL of the vector preparation. Eyes that received the AAV.eGFP vector alone were injected with 2×10 9 1×10 genomes of each vector were administered to eyes that received a combination of AAV.eGFP plus AAV.AKT3 or AAV.caRheb. 9 vector genomes (2×10 9 total vector genomes) was administered.

[0122] Electroretinogram

[0123] Mice were anesthetized and maintained as previously described. Pupils were dilated with 1% tropicamide (Alcon Laboratories, Fort Worth, TX). Light responses were recorded using a clear plastic contact lens with an embedded platinum wire, and a platinum wire loop was placed in the animal's mouth to serve as a reference electrode. ERGs were recorded using an Espion E2 system (Diagnosys, Lowell, MA). Three ERG responses were recorded with the following parameters: scotopic response (dark adaptation, 0.01 scot cd sm -2 stimulation), maximum mixed rod-cone response (dark adaptation, 500 scot cd sm -2 stimulation), maximum cone response.

[0124] Optomotor response

[0125] Visual acuity was assessed by measuring optokinetic responses (OKR) using OptoMotry software and equipment (Cerebral Mechanics, Inc, Medicine Hat, AB, Canada) as described previously. Recordings were performed by an investigator blinded to the experimental treatment.

[0126] Immunohistochemistry

[0127] Eyes were enucleated, harvested, and prepared for cryosections as previously described (Dooley SJ et al. (2018). Spliceosome-mediated pre-mRNA trans-splicing can repair CEP290 mRNA. Mol Ther Nucleic Acids 12: 294-308). Sections were incubated in blocking buffer containing phosphate-buffered saline (PBS), 10% normal goat serum (CST), and 2% Triton X-100 for one hour at room temperature. Afterwards, sections were incubated overnight in a humidified chamber in a primary antibody solution containing a combination of the previously described components and the following antibodies: rabbit anti-cone arrestin (1:400; Millipore #ab15282), rabbit anti-phospho-S6-Ser240 / 244 (1:100; Cell Signaling Technology (CST) #5364), rabbit anti-phospho-AKT-Ser273 (1:100; Cell Signaling Technology #406 0), mouse anti-rhodopsin (1:400; Abcam #ab5417), rabbit anti-HA (1:100; Cell Signaling Technology #3724), rabbit anti-Ki67 (1:400; Abcam #ab15580), mouse anti-PCNA (1:400; Abcam #ab29), chicken anti-GFAP (1:400; Abcam #ab4674), and rabbit anti-AKT (1:100; Cell Signaling Technology #4691). After the primary antibody incubation, the sections were washed three times with PBS and incubated in the secondary antibody solution for 2 hours at room temperature in a humidified chamber containing PBS, 10% normal goat serum, 2% Triton X-100 and a combination of the following secondary antibodies: alexa fluor-594 goat anti-chicken (1:500; Abcam #ab150176), alexa fluor-594 goat anti-mouse (1:500; #ab150116), alexa fluor-594 goat anti-rabbit (1:500; Abcam #ab150080), Cy5-conjugated goat anti-rabbit (1:500; KPL Corporation (KPL) #072-02-15-16). The sections were removed from the secondary antibody incubation and washed three times with PBS. The sections stained for the presence of phosphorylated antigens were incubated and washed in a solution containing Tris-buffered saline (TBS) instead of PBS.

[0128] ONL measurement

[0129] All retinal sections were tiled using the EVOS FL Auto 2 cell imaging system using a 40X objective. In each image, ONL thickness was measured at three equidistant points, which were spaced 75-100 μm apart. These measurements were averaged across all images to represent the average ONL thickness of the section. Three retinal sections were averaged for each sample. The number of ONLs from a specific area of ​​the retina transduced with the vector was quantified by counting the number of GFP+ONL cells per 200 μm area. Once again, three retinal sections were averaged for each sample to obtain these measurements.

[0130] Western blotting

[0131] Protein samples were separated using the NuPage electrophoresis system (Thermo Fisher). The samples were heated at 70°C and loaded onto a 4-12% Bis-Tris protein gel (Thermo Fisher). The separated proteins were then transferred to a PVDF membrane with an XCell II blotting module (Thermo Fisher) at 35 volts for 1.5 hours. After protein transfer, the membrane was incubated at room temperature for 1 hour in a Tris buffered saline containing 0.1% (v / v) Tween 20 (BioRad) (TBST) and 5% (w / v) bovine serum albumin (BSA; Sigma-Aldrich). Afterwards, the blot was incubated in the previously described solution containing the following primary antibodies: rabbit anti-498 phospho-S6-Ser240 / 244 (1:1000; Cell Signaling Technology #5364, rabbit anti-S6 (1:1000; Cell Signaling Technology #2217), rabbit anti-GAPDH (1:1000; Cell Signaling Technology #5174). The primary antibodies were incubated overnight at 4°C. The blot was removed from the primary antibody solution and washed three times in TBST for 5 minutes each. Afterwards, it was placed in a secondary antibody solution consisting of TBST, 5% BSA, and HRP-conjugated anti-rabbit ECL (1:10,000; GE Healthcare) for 1 hour at room temperature. The membrane was washed three times in TBST and then incubated with ECL2 (Thermo Fisher Scientific) for 5 minutes according to the manufacturer's instructions. Finally, the membrane was imaged using Amersham Imager 600 (GE Healthcare) under chemiluminescence settings.

[0132] statistics

[0133] Unless otherwise stated, all data are expressed as mean ± SEM. Unpaired Student's t-test was used to compare differences between two treatment groups. One-way analysis of variance (ANOVA) followed by Tukey's honestly significant difference test was used to compare differences between three or more experimental groups. Calculation of statistical significance was determined using GraphPad Prism 7.0. Differences were considered statistically significant at P < 0.05.

[0134] Example 2: AKT3 gene therapy for the treatment of eye diseases

[0135] Effect of AKT3 or caRheb overexpression on Pde6b in retinitis pigmentosa rd10 Effects of (rd10) mouse model

[0136] The disease in the rd10 mouse model is caused by a point mutation in the gene encoding the β-subunit of the rod phosphodiesterase (PDE), which renders the PDE complex nonfunctional and produces a block in the rod phototransduction cascade. In addition, PDE plays a key role in recycling cGMP to GMP, thereby promoting the closure of voltage-gated ion channels. The loss of PDE complex activity promotes the constitutive influx of Na+ and Ca2+ ions and the activation of the cell death cascade. Rd10 mice begin to show a gradual thinning of the outer nuclear layer (ONL) of the photoreceptors around postnatal day 18 (PN18). By PN30, photoreceptors in the central and peripheral regions of the retina are significantly lost, and a layer of abnormal cone cell bodies is usually retained in the central retina at PN45. In the studies described below, the neuroprotective potential of AKT3 or Rheb delivery on visual function, structural morphology, and photoreceptor retention was evaluated. The potential mechanisms of neuroprotective effects were further studied by examining the expression of markers indicating mTOR activation. Additionally, the long-term safety of AKT3 or Rheb overexpression with respect to its potential for oncogenic proliferation of retinal neurons was examined.

[0137] Design and characterization of AAV7m8 vector

[0138] Gene transfer vectors derived from AAV have emerged as the best gene delivery platform for targeting neuronal tissue. AAV7m8 is a variant of AAV2 generated by in vivo selection and shows enhanced retinal and cell transduction properties. AAV7m8 vectors were generated that encode a hyperactive version of human AKT3 (AAV.AKT3), a constitutively active Rheb mutant (AAV.caRheb), and an enhanced green fluorescent protein reporter gene (AAV.eGFP) as a control ( Figure 1A). The AKT3 transgene contains an N-terminal myristoylation (MYR) sequence, which enhances membrane targeting and localization. The caRheb transgene contains a typical S16H mutation that confers resistance to TSC-mediated GTPase-activating protein (GAP) activity. 84-31 cells transduced with AAV.caRheb or AAV.AKT3 vectors showed strong target gene mRNA expression compared to untreated controls ( Figure 1B-Figure 1C Subretinal delivery of AAV7m8 results in strong labeling of photoreceptors, retinal pigment epithelium (RPE), and Müllerian cells in the mouse retina ( Figure 1D-1E Coinjection of the experimental vector with the reporter vector allows transgene expression to be specifically localized to the subretinal delivery zone ( Figure 1G-1H ), thereby allowing adequate identification of the treated retinal area.

[0139] caRheb gene transfer fails to alleviate retinal degeneration in Pde6brd10 mice

[0140] The effect of caRheb genetic enhancement on the Pde6brd10 retina was studied. At PN13-14 (a time point before the onset of rod death), animals received a unilateral subretinal injection of AAV carrying the experimental transgene as well as AAV containing eGFP (so that the injected portion of the retina could be identified). Controls included injection of AAV containing eGFP alone or no AAV injection. After injection, visual function was measured using electroretinography (ERG) and optokinetic response (OKR). At PN45, retinal histology was examined to determine the effect of AAV.caRheb on photoreceptor survival ( Figure 2A-2C Quantification of total ONL thickness per retina showed no significant differences in the number of remaining photoreceptor cell bodies between experimental and control treatments (untreated or injected with AAV.eGFP alone) ( Figure 2B In addition to total ONL thickness, the number of GFP+ONL cells per 200 μm section area was measured in retinas transduced with AAV.eGFP alone or co-transduced with AAV.caRheb. Again, no statistically significant changes in ONL cell number between these groups were observed ( Figure 2C In addition, ERG ( Figure 2D-2F ) and OKR( Figure 2G ) compared to controls measured by 1:1. Collectively, these data indicate that caRheb gene transfer does not promote photoreceptor neuroprotection in the retina of Pde6brd10 mice.

[0141] AKT3 gene enhancement promotes photoreceptor survival and structural preservation in Pde6brd10 retinas

[0142] The effects of AKT3 genetic enhancement on photoreceptor survival and structural integrity in the Pde6brd10 retina were examined. Following injection of AAV.AKT3 at PN13-14, histological analysis of retinal structure at PN30 and PN45 revealed a robust neuroprotective effect on photoreceptors, particularly in retinal areas co-labeled with eGFP, as reflected by immunostaining and ONL measurements between treatment groups ( Figure 3C ). There was no evidence of histological rescue in AAV.GFP injected eyes compared to untreated eyes at any time point. Immunostaining to detect specific types of photoreceptors that were preserved revealed that cone photoreceptors were preserved in the retinal regions transduced with the AAV.AKT3 vector (as assessed by staining for cone arrestin) ( Figure 3D-Figure 3F Similarly, immunostaining for rhodopsin revealed that rod photoreceptors were preserved in AAV.AKT3-transduced areas, but not in unexposed areas of the retina or AAV.eGFP or untreated control retinas.

[0143] Significantly, immunostaining for rhodopsin also revealed enhanced retention of rod outer segments at PN30 harvest compared to controls, suggesting the importance of this pathway in mediating survival and maintenance of rod photoreceptor ultrastructure ( Figure 3A-3C ).

[0144] Effects of AKT3 gene transfer on retinal and visual functions in Pde6brd10 retinas

[0145] Retinal and visual function were assessed at PN30 and PN45 time points by electroretinogram (ERG) and optokinetic response (OKR) measurements, respectively. Analysis of mixed rod-cone responses in eyes treated with AAV.AKT3 revealed that at PN30, a-wave amplitude was improved compared to untreated controls as well as controls treated with AAV.eGFP ( Figure 4A In addition, stimulation of eyes treated with AAV.AKT3 also induced an increase in mixed b-wave responses compared with eyes treated with AAV.eGFP ( Figure 4B ), but there was only a trend toward increased retention compared to untreated eyes at this time point. However, at PN45, there were no significant differences in these outcome measures between treatment groups ( Figure 4A-4B Cone-specific b-wave responses were also measured, but no statistically significant differences between treatment groups were observed at any time point tested ( Figure 4C). Visual acuity in response to gene transfer was examined by measuring optokinetic responses (OKR). Data represent the right / left eye ratio of those recordings in which the untreated left eye served as an intra-animal control and the right eye was treated with AAV.eGFP alone or in combination with AAV.AKT3. Treatment with AAV.AKT3 / AAV.eGFP did not preserve visual acuity relative to the AAV.eGFP control at any time point ( Figure 4D ). Overall, these data suggest that AKT3 gene transfer prolongs cell survival and some functions in the early and middle stages of the disease but may not be sufficient for long-term maintenance.

[0146] AKT3 gene enhancement stimulates biosynthesis and cell survival pathways

[0147] It was hypothesized that the AKT3-induced neuroprotective response would activate pathways associated with anabolism and cell survival. To assess this possibility, retinal sections were immunostained with antibodies against typical downstream markers indicative of mTOR activation ( Figure 5A-5H Regions of the retina specifically transduced with AAV.AKT3 demonstrated enhanced expression of phosphorylated ribosomal protein S6 (pS6) compared to unexposed or untreated retina ( Figure 5E-5H Interestingly, mTORC2 markers (pAKT S473 ), suggesting stimulation of additional functions associated with cell survival and stress resistance ( Figure 5A-5D ). Retinal sections obtained from the untreated group and the AAV.GFP control group did not show enhanced expression of these markers, implying that AKT3-induced neuroprotection is at least partially driven by the mTORC1 and mTORC2 pathways ( Figure 5D and Figure 5H ).

[0148] AKT3 overexpression does not disrupt photoreceptor quiescence but stimulates Müller cell activation

[0149] Dysregulated AKT signaling is a common hallmark of many human cancers. The effects of AKT3 gene transfer on retinal quiescence were examined by immunostaining with typical markers of cell proliferation. Expression of Ki67 was restricted to cells occupying the ganglion cell layer in untreated and AAV.eGFP-treated Pde6brd10 retinas.

[0150] Co-staining with an antibody against GFAP identified this Ki67+ cell population as Müller glia. Under homeostatic conditions, these cells provide structural and metabolic support to other retinal cell types by mediating the release of neurotrophic factors, regulating extracellular ion balance, and clearing debris. Importantly, cells occupying the ONL did not show positive immunoreactivity for the Ki67 marker, suggesting that the protective response induced by AKT3 is not an unexpected consequence of quiescent photoreceptor withdrawal ( Figure 6H and Fig.6I Interestingly, Müller cells within retinal regions specifically transduced with AAV.AKT3 demonstrated morphological changes indicative of astrogliosis, such as upregulation of GFAP expression and extension of neural processes in different retinal layers ( Figure 6G-Figure 6I Similarly, the expression of these markers was examined in wild-type animals injected with the vector plaques. Wild-type animals received subretinal injections at PN13 and were followed up at PN125 for histological analysis. No structural or cellular changes were observed in animals chronically overexpressing the reporter plaques alone ( Figure 11A-11B In contrast, animals treated with the ubiquitous AAV.AKT3 vector showed extensive retinal disintegration and loss of photoreceptor structural markers (Figure 11- Fig.11D ). In addition, areas specifically transduced with the AAV.AKT3 vector also showed chronic activation of Müller cells compared to untreated and AAV.eGFP-treated retinas ( Figure 7A-7K ).

[0151] Photoreceptor-restricted expression of AKT3 mediates Pde6b rd10 Neuroprotective effects in the retina

[0152] We examined AKT3-mediated neuroprotection specifically within photoreceptors by generating an AAV vector driven by the previously described GRK1 promoter ( Fig. 8A ). These vectors are in Pde6b rd10 Intraretinal application produced effects on retinal function similar to those previously described for vectors driven by the ubiquitous CAG promoter ( Figure 8B-Figure 8D ). Specifically, treatment with AAV.GRK1.AKT3 preserved mixed a- and b-wave amplitudes at PN30, but not in advanced degeneration at PN45. Similar to previous findings, these vectors did not mediate preservation of cone-specific b-wave amplitudes compared to control treatments. At the histological level, these vectors demonstrated specific transgene expression within photoreceptors ( Fig. 8E). In addition, AAV.GRK1.AKT3 also improved photoreceptor survival compared to untreated and AAV.eGFP-treated control eyes ( Fig.8F ).

[0153] AKT3 vector regulated by a photoreceptor-specific promoter does not stimulate

[0154] P6b rd10 Reactive gliosis in the retina

[0155] Hypothesized that restricting AKT3 transgene expression to the photoreceptor layer with a GRK1-driven vector would alleviate the chronic Müller cell activation previously observed with AKT3 vectors regulated by the ubiquitous CAG promoter. Again, retinal sections derived from PN45 Pde6brd10 mice co-injected with AAV.GRK1.AKT3 and the tracer vector were immunostained with antibodies against GFAP and Ki67 ( Figure 9A-9H ). Compared with untreated samples, treatment with AAV.GRK1.AKT3 did not reveal Pde6b rd10 Abnormal activation and migration of Müller cells in Figure 9A-9F ).

[0156] Furthermore, the transition zone between untreated retinal areas and subretinal injection sites revealed similar histological findings, further suggesting that photoreceptor-restricted AKT3 gene transfer mitigates the chronic activation of Müller cells previously observed with ubiquitous vector systems ( Figure 9G and Figure 9H ). These results highlight the importance of cell- and tissue-specific promoters to circumvent potentially deleterious off-target effects associated with neuroprotective gene transfer strategies.

[0157] Example 3: Stimulation of the mTOR pathway by AAV-mediated gene transfer

[0158] The studies described in Example 2 above demonstrate the therapeutic potential of reprogramming cellular metabolism in an animal model of RP following stimulation of the mTOR pathway with AAV-mediated gene transfer. The exact role of mTOR signaling in the context of neurodegenerative diseases remains a controversial topic. Downregulating mTOR activity through treatment with the typical mTOR inhibitor rapamycin can attenuate the pathological mechanisms of a variety of neurodegenerative models, including Parkinson's disease, Huntington's disease, and Alzheimer's disease. In contrast, other studies have shown that stimulation of the insulin / AKT / mTOR axis can mediate beneficial outcomes in related neurodegenerative disease models. In the studies described above, targeting the mTOR pathway at two different regulatory points resulted in different effects on photoreceptor survival, structural integrity, and retinal function.

[0159] Several previous studies have highlighted the protective potential of targeting Rheb activation in the context of neurodegenerative disease models to improve therapeutic outcomes. However, stimulation of the mTOR pathway with caRheb gene transfer at this downstream regulatory point did not mediate the protective effects of Pde6brd10 retina. Interestingly, the AAV.caRheb vector demonstrated robust stimulation of mTORC1 activity in vitro, as demonstrated by enhanced expression of pS6, a typical mTORC1 activation marker. This activity was not translated in vivo, as shown by negative immunostaining for pS6 in retinal sections overexpressing the caRheb transgene. This suggests that there is an intrinsic mechanism that inhibits the ability of caRheb to stimulate mTORC1 within photoreceptors ( Fig. 10A and Fig. 10B ). These observations differ from those reported in previous studies in which caRheb gene transfer stimulated mTORC1 activity in various neuronal populations and conferred stress resistance in models of Parkinson's disease, Huntington's disease, and optic nerve trauma. Other lines of evidence suggest that Rheb may play a competitive role in promoting cell death signaling programs in response to different forms of cellular stress. UV or TNFα-induced cellular stress combined with Rheb overexpression enhanced apoptotic signaling in vitro, while Rheb knockdown or treatment with rapamycin provided partial protection from the effects of these cytotoxic agents. In the context of retinal degeneration, light-induced damage to retinal ganglion cells (RGCs) resulted in upregulation of Rheb expression, which was associated with an increase in pro-degeneration apoptotic markers. In summary, the protective or pro-apoptotic function of Rheb is likely determined by the mechanisms caused by the specific pathology in question. In addition, amplification of Rheb activity by gene transfer may modulate different effects on cell biology depending on the specific disease context.

[0160] Further, AAV-mediated AKT3 gene transfer stimulated a strong neuroprotective effect on photoreceptor survival and morphological preservation. This protective effect was associated with the stimulation of mTORC1 and mTORC2 in areas of the retina specifically transduced with the AAV.AKT3 vector. Our findings are the first to report upregulation of mTORC2 signaling activity associated with photoreceptor neuroprotection. This data is different from previous observations by Venkatesh et al. (2015) in which mTORC2 activity was attenuated following transgenic ablation of Pten and enhanced cone survival in the retina of Pde6brd1 mice.

[0161] Despite the significant cell retention mediated by AKT3 gene transfer, different effects on functional retention were observed after assessment by electroretinography and OKR. Statistically significant retention of mixed rod-cone a-wave responses and b-wave responses in some cases in eyes treated with AKT3 vectors driven by CAG or GRK1 promoters was observed when measured at PN30 rather than during late degeneration. Although the cone structure with AKT3 transgenic expression was morphologically preserved, no improvement in cone-specific light responses was observed compared to controls at any time point tested. This finding differs from previous studies that examined strategies for cone photoreceptor neuroprotection in similar disease models. These differences can be explained by changes in study design, which involve not only the transgenic box, but also the vector dose, injection route, degeneration kinetics associated with the model system, and timing of vector delivery. In the present study, the vector was injected at a time point just before the onset of photoreceptor death, while previous studies administered experimental interventions immediately after birth and before retinal maturation and the onset of disease mechanisms. These differences in experimental design may have important downstream effects related to retinal coverage, vector recruitment kinetics, and expression associated with the onset of neurodegenerative mechanisms, as well as ultimate treatment outcome measures.

[0162] Advancement of gene therapies based on strategies to reprogram cellular metabolism must meet highly stringent safety standards before clinical translation. Although no evidence of tumor formation was observed, long-term overexpression of AKT3 regulated by a ubiquitous promoter in wild-type animals led to widespread retinal disintegration and eventual loss of photoreceptors. This phenotype corresponds specifically to the effects of AKT3 on the retinal epithelium in wild-type and Pde6b cells. rd10Chronic activation of Müller cells in ubiquitous vector-transduced retinal regions observed in animals. Reactive gliosis is a response often associated with tissue damage in which these cells are activated and proliferate to mediate a variety of functions including tissue remodeling, release of neurotrophic factors, and clearance of cellular debris. While this response is intended to inhibit further retinal damage, chronic activation can be detrimental to neighboring cells and disrupt retinal homeostasis. For example, activated Müller cells have been observed to upregulate the expression and secretion of various proinflammatory molecules including tumor necrosis factor (TNF) and monocyte chemoattractant protein (MCP-1).

[0163] Additionally, they are known to secrete excess nitric oxide (NO), which produces free radicals that can cause damage to neighboring cells. 41 This finding is not surprising, as cells need to maintain a delicate balance in these metabolic components to adapt to their precise physiological needs, and excessive stimulation of such pathways may have deleterious effects on cell viability. Determining and achieving this balance through genetic enhancement or silencing strategies will be a major challenge in translating these approaches into the clinic.

[0164] Additional regulatory elements such as cell-specific promoters (as shown here), stress-responsive promoters or inducible systems will likely play a key role in the clinical development of neuroprotective gene transfer strategies that stimulate potent metabolic pathways.

[0165] "Overall, this study demonstrates broad protective effects on photoreceptor viability and structure following genetic enhancement in a model of inherited retinal degeneration. These findings underscore the importance of AKT activity and downstream pathways associated with anabolism in photoreceptor survival and maintenance. Furthermore, the results highlight the complexity and subtlety of reprogramming cellular metabolism, as well as the important safety issues of using a 'universal' gene therapy strategy to halt the progression of complex neurodegenerative diseases."

[0166] (Sequence Listing Free Text)

[0167] For a numeric identifier <223> The following information is provided in the sequence of free text.

[0168]

[0169]

[0170]

[0171] All documents cited in this specification are incorporated herein by reference. U.S. Provisional Patent Application No. 62 / 813,587 filed on March 4, 2019 and U.S. Provisional Patent Application No. 62 / 821,705 filed on March 21, 2019 are incorporated by reference in their entirety together with their sequence listings. The sequence listing marked with "18-8380PCT_ST25.txt" submitted herewith and the sequences and texts therein are incorporated by reference. Although the present invention has been described with reference to specific embodiments, it should be understood that modifications can be made without departing from the spirit of the present invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

1. Use of an adeno-associated virus (AAV) vector in the manufacture of a medicament for treating retinal degeneration in a subject, the AAV vector comprising an AAV capsid, wherein a vector genome is encapsidated, the vector genome comprising an AAV inverted terminal repeat (ITR) sequence, a human protein kinase B3 (AKT3) coding sequence, and an expression control sequence for directing the direct expression of AKT3 in a host cell, wherein the AKT3 coding sequence comprises the nucleotide sequence of SEQ ID NO:

13.

2. The use according to claim 1, wherein the expression control sequence comprises a chicken β-actin promoter with a CMV enhancer.

3. The use according to claim 1, wherein the chicken β-actin promoter with a CMV enhancer sequence comprises nucleotides 1443 to 3104 of SEQ ID NO: 1 or nucleotides 1493 to 2075 of SEQ ID NO:

5.

4. The use according to claim 1, wherein the expression control sequence comprises a bovine growth hormone (bGH) polyA sequence. The use according to claim 1 , wherein the expression control sequence comprises a GRK1 promoter. The use according to claim 5 , wherein the GRK1 promoter comprises nucleotides 1427-1790 of SEQ ID NO:

3.

7. The use according to claim 1, wherein the expression control sequence comprises an hCAR promoter.

8. The use according to claim 1, wherein the expression control sequence comprises an ocular cell-specific promoter.

9. The use according to claim 1, wherein the expression control sequence comprises a promoter selected from the group consisting of a human EF1α promoter, a metabotropic glutamate receptor 6 (mGluR6) promoter, a rhodopsin promoter, a cone opsin promoter, and a transcription factor promoter.

10. The use according to claim 1, wherein the expression control sequence comprises a promoter selected from the group consisting of an inducible promoter, a constitutive promoter and a tissue-specific promoter.

11. Use according to claim 10, wherein the promoter is an inducible promoter selected from the group consisting of a rapamycin / rapamycin analog (rapalog) promoter, an ecdysone promoter, an estrogen-responsive promoter, a tetracycline-responsive promoter and a heterodimeric repressor switch.

12. The use according to claim 1, wherein the expression control sequence further comprises one or more of an intron, a Kozak sequence, a polyA sequence and a post-transcriptional regulatory element.

13. The use according to claim 1, wherein the AAV capsid is an AAV2, AAV5, AAV8, AAV9, AAV8bp or AAV7m8 capsid or a variant thereof.

14. The use according to claim 1, wherein the ITR sequence is from AAV2.

15. The use according to claim 1, wherein the AAV vector or pharmaceutical composition is to be administered subretinal or intravitreally.

16. The use according to claim 1 or 15, wherein the subject is a mammal.

17. The use according to claim 16, wherein the subject is a human.

18. The use according to claim 1 or 15, wherein the AAV vector is to be administered in combination with another therapy.

19. The use according to claim 1 or 15, wherein the AAV vector is to be administered in an amount of about 10 7 To about 10 13 A dose of 1 vector genome (VG) was administered.

20. The use according to claim 1 or 15, wherein the AAV vector is to be administered in a volume of about 100 μL to about 500 μL.

21. The use according to claim 1 or 15, wherein the AAV vector is to be administered more than once.

Images