Novel AAV capsids and compositions containing the same

Abstract

Provided herein are novel AAV capsids and rAAVs comprising the same. In one embodiment, vectors employing novel AAV capsids exhibit increased transduction of selected target tissues compared to prior art AAVs.

Description

Background Art

[0001] Adeno-associated virus (AAV) holds great promise in human gene therapy and has been widely used in various studies to target liver, muscle, heart, brain, eye, kidney, and other tissues due to its ability to provide long-term gene expression and lack of pathogenicity. AAV belongs to the parvovirus family, and each contains a single strand of DNA flanked by two inverted terminal repeats. Dozens of naturally occurring AAV capsids have been reported; their unique capsid structure enables them to recognize and transduce different cell types and organs.

[0002] Since the first trial in 1981, no vector-related toxicity has been reported in clinical trials of AAV vector-based gene therapy. The accumulating safety record of AAV vectors in clinical trials, combined with the demonstrated efficacy, indicates that AAV is a promising gene delivery platform. Another attractive feature is that AAV is relatively easy to manipulate, as it is a single-stranded DNA virus with a small genome (~4.7 kb) and simple genetic components - inverted terminal repeats (ITRs) and Rep and Cap genes. Only ITRs and AAV capsid proteins are required in AAV vectors, where ITRs serve as replication and packaging signals for vector production, and capsid proteins not only form the capsid to accommodate the vector genomic DNA, but also determine the tissue tropism to deliver the vector genome to target cells and tissues.

[0003] AAV is one of the most potent candidate vectors for gene therapy due to its low immunogenicity and nonpathogenicity. However, despite allowing for efficient gene transfer, AAV vectors currently used in the clinic can be hampered by pre-existing immunity to the virus and restricted tissue tropism. New and more efficient AAV vectors are needed. Summary of the invention

[0004] In one embodiment, the present invention provides a recombinant adeno-associated virus (rAAV) having an AAV capsid comprising a capsid protein, the capsid protein comprising the amino acid sequence of SEQ ID NO: 2 (AAVrh.91), and a vector genome comprising a heterologous nucleic acid sequence is packaged in the capsid. In certain embodiments, the rAAV has a capsid comprising a capsid protein, the capsid protein is produced by expression of an AAV capsid sequence of SEQ ID NO: 1 or 3, or a sequence having at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 1 or 3, and a vector genome comprising a heterologous nucleic acid sequence is packaged in the capsid.

[0005] In certain embodiments, provided herein are rAAVs, wherein the AAV capsid comprises AAV capsid proteins, wherein the AAV capsid proteins comprise: (1) a heterogeneous population of AAVrh.91 vp1 proteins selected from the group consisting of: vp1 proteins produced by expression of a nucleic acid sequence encoding a predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2, vp1 proteins produced by SEQ ID NO: 1 or 3, or vp1 proteins produced by a nucleic acid sequence having at least 70% identity to SEQ ID NO: 1 or 3, wherein the nucleic acid sequence encodes a predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2; and (2) a heterogeneous population of AAVrh.91 vp2 proteins selected from the group consisting of: vp2 proteins produced by expression of a nucleic acid sequence encoding a predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, vp2 proteins produced by a sequence comprising at least nucleotides 412 to 2208 of SEQ ID NO: 1 or 3, or vp2 proteins produced by a nucleic acid sequence having at least 70% identity to SEQ ID NO: 1 or 3. NO:1 or 3, the nucleic acid sequence encoding at least about amino acids 138 to 736 of SEQ ID NO:2; a heterogeneous population of AAVrh.90 vp3 proteins selected from the group consisting of: vp3 proteins produced by expression of a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, vp3 proteins produced by a sequence comprising at least nucleotides 607 to 2208 of SEQ ID NO:1 or 3, or vp3 proteins produced by a nucleic acid sequence having at least 70% identity to at least nucleotides 607 to 2208 of SEQ ID NO:1 or 3, the nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2; and / or (2) a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2, a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, or a nucleic acid sequence having at least 70% identity to at least nucleotides 607 to 2208 of SEQ ID NO:1 or 3, the nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2. A heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence encoding an amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO:2 and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO:2, wherein: the vp1, vp2 and vp3 proteins contain a subpopulation with amino acid modifications comprising at least two highly deamidated asparagines (N) in the asparagine-glycine pairs in SEQ ID NO:2; and optionally further contain a subpopulation comprising other deamidated amino acids, wherein the deamidation causes amino acid changes.

[0006] In another embodiment, a composition is provided herein, comprising at least rAAV and a physiologically compatible carrier, buffer, adjuvant and / or diluent. In certain embodiments, the composition is formulated for intrathecal delivery, and the vector genome comprises a nucleic acid sequence encoding a gene product for delivery to the central nervous system. In another embodiment, the composition is formulated for intravenous delivery, intranasal and / or intramuscular delivery.

[0007] In certain embodiments, a system suitable for producing rAAV is provided. The system comprises: (a) a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2; (b) a nucleic acid molecule suitable for packaging into an AAV capsid, wherein the nucleic acid molecule comprises at least one AAV inverted terminal repeat sequence (ITR) and a non-AAV nucleic acid sequence encoding a gene product, the nucleic acid sequence being operably linked to a sequence directing expression of the product in a host cell; and (c) sufficient AAV rep functions and auxiliary functions to allow the nucleic acid molecule to be packaged into the rAAV capsid.

[0008] In certain embodiments, a method for producing rAAV comprising an AAV capsid is provided. The method comprises the steps of culturing a host cell, the host cell containing: (a) a nucleic acid molecule encoding an AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 2; (b) a functional rep gene; (c) a minigene comprising an AAV 5′ITR, an AAV 3′ITR and a transgene; and (d) sufficient auxiliary functions to allow the minigene to be packaged into an AAV capsid.

[0009] In yet another embodiment, a host cell containing the rAAV, expression cassette or nucleic acid molecule described herein is provided.

[0010] In certain embodiments, a method of delivering a transgene to a cell is provided. The method comprises the step of contacting the cell with a rAAV as described herein, wherein the rAAV comprises a transgene.

[0011] Additional aspects and advantages of these compositions and methods are further described in the detailed description below. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1A diagram showing the workflow for AAV-SGA. Genomic DNA is isolated from rhesus macaque tissue samples and screened for the presence of AAV capsid genes. AAV-positive DNA is endpoint-diluted and subjected to another round of PCR. According to a Poisson distribution, DNA dilutions that produce PCR products in no more than 30% of the wells contain an amplifiable DNA template for each positive PCR 80% of the time. Positive amplicons are sequenced using the Illumina MiSeq 2x150 or 2x250 paired-end sequencing platform, and the resulting reads are assembled de novo using the SPAdes assembler.

[0013] Figure 2 is a diagram showing a neighbor-joining phylogeny of DNA genome sequences of novel AAV natural isolates and representative clade controls.

[0014] Figure 3A-3D An alignment of the nucleic acid sequences of AAVrh.91 (SEQ ID NO: 1), AAVrh.91eng (SEQ ID NO: 3), AAV6.2 (SEQ ID NO: 5), and AAV1 (SEQ ID NO: 7) capsids is shown.

[0015] Figure 4A and Figure 4B An alignment of the amino acid sequences of AAVrh.91 (SEQ ID NO: 2), AAV6.2 (SEQ ID NO: 6), and AAV1 (SEQ ID NO: 8) capsids is shown.

[0016] Figure 5A-5D The biodistribution of the eGFP transgene in mouse tissues 14 days after injection is shown. Figure 5A and Figure 5B ) C57BL / 6 mice were injected IV with AAV capsids containing CB7.CI.eGFP.WPRE.RBG at a dose of 1e12 GC per mouse (n=5). Figure 5C and Figure 5D ) C57BL / 6 mice were injected intracerebroventricularly with various AAV capsids containing CB7.CI.eGFP.WPRE.RBG at a dose of 1e11 GC per mouse (clade A vectors were administered at 6.9e10 GC / mouse) (n=5). Values ​​are expressed as mean ± SD; *p < 0.01, **p < 0.001.

[0017] Fig. 6A and Figure 6BAnalysis of LacZ expression in muscle after IM delivery of AAV vectors is shown. 3e9 GC of vectors with various capsids and expressing LacZ under the CMV promoter were administered to mice. At day 20, muscle tissue was collected and transgene expression was assessed by X-gal staining (darker staining).

[0018] Figure 7 Shown are the levels of mAbs in serum after IM delivery of various AAV vectors. B6 mice were administered 1e11 GC of a vector expressing the 3D6 antibody under the tMCK promoter.

[0019] Figure 8 Shown are the yields of vectors expressing the 3D6 or LacZ transgene (relative to AAV8).

[0020] Fig. 9 The experimental design for the pooled barcoded vector study in NHPs is shown ( Figure 10A-10C Data shown in ). Five novel capsids and five controls (AAVrh.90, AAVrh9.1, AAVrh.92, AAVrh.93, AAVrh.91.93, AAV8, AAV6.2, AAVrh32.33, AAV7, and AAV9) were packaged with a modified ATG-depleted GFP transgene with a unique 6 bp barcode. Vectors were pooled in equal amounts and injected IV or ICM in cynomolgus monkeys (total dose: 2e13 GC / kg IV and 3e13 GC / kg ICM). IV injected animals were seronegative for AAV6, AAV8, and AAVrh32.33 at baseline, and neutralizing antibody titers against AAV7 and AAV9 were 1:5 and 1:10, respectively.

[0021] Figure 10A-10C is shown in IV delivery ( Fig. 10A and Fig. 10B ) and ICM delivery ( Fig. 10C Figure 2. RNA expression analysis of barcoded capsids after IV administration of -2e13 GC / kg total dose, necropsy on day 30 (this animal had low levels of AAV7 and AAV9 nabs at baseline). ICM administration of -3e13 GC / animal, necropsy on day 30. The barcode frequency in each tissue RNA sample was normalized to the frequency in the injected input material so that each barcode had equivalent representation in the mixture (10%). The input amount for the ten vectors ranged from 8.5-12%. Values ​​are expressed as mean ± SEM, **p < 0.001.

[0022] Figure 11A-11CDetection of biodistribution after delivery of AAVrh.91, AAV1, and AAV9 capsids with CB7.CI.eGFP.WPRE.rBG to NHPs is shown. A dose of 1.557e13GC was injected ICM into each animal. Animals were sacrificed 28-31 days after injection, and tissues were collected for analysis (eGFP detection by qPCR). Values ​​are expressed as mean ± SD. Animals: AAVrh.91 (1409201 and 1407088), AAV1 (RA3654 and RA3583), AAV9 (1408266 and 1409029).

[0023] Fig.12 Biodistribution in CNS tissues is shown. Data shown correspond to Figure 11A-11C Tissue GC values ​​shown in .

[0024] Figure 13A-13C The results showed that AAVrh.91, AAV1 and AAV9 vectors were delivered to NHPs (such as for Figure 11A-11C Analysis of neuronal transduction after

[0025] Figure 14A-14B The titers of small-scale preparations for the production of various AAV vectors are shown. Each point represents an individual small-scale preparation. Values ​​are expressed as mean ± SD.

[0026] Figure 15A-15B Shown are the results of mass spectrometry analysis of AAVrh.91 vector preparations. DETAILED DESCRIPTION

[0027] The genetic variation of AAV in its natural mammalian host was explored by using AAV single genome amplification, a technique for accurately isolating a single AAV genome from within a viral population. Figure 1 ). This article describes the isolation of novel AAV sequences from rhesus macaque tissues that can be classified into various clades. We evaluated the biological properties of AAV vectors derived from natural isolates in mice after intravenous (IV) and intracerebroventricular (ICV) delivery, and in NHPs after IV and intracisternal (ICM) delivery. The results determined the clade specificity and variable transduction patterns of the novel AAV variants when compared to prototype clade member controls.

[0028] Provided herein are recombinant AAVrh.91 vectors having an AAVrh.91 capsid and a nucleic acid encoding a transgene under the control of a regulatory sequence that directs expression of the transgene upon delivery to a subject. The rAAVrh.91 capsid contains a protein independently having the amino acid sequence of SEQ ID NO: 2. Compositions containing these vectors are provided. The methods described herein relate to using rAAV to target tissues of interest to treat various conditions.

[0029] In certain embodiments, provided herein are vectors comprising AAVrh.91 capsids that are well suited for delivery to the central nervous system. In certain embodiments, intrathecal delivery is desired, including, for example, delivery to the brain via ICM delivery. In certain embodiments, vectors comprising AAVrh.91 capsids are well suited for delivery to the heart (smooth muscle). In other embodiments, vectors comprising AAVrh.91 capsids are well suited for delivery to skeletal (striated) muscle. rAAVrh.91 vectors can be delivered systemically or targeted by routes of administration suitable for targeting these tissues.

[0030] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the present invention belongs and are generally understood by those skilled in the art and with reference to the disclosed text, and these terms provide a general guide for many of the terms used in this application for those skilled in the art. The following definitions are provided for clarity only and are not intended to limit the claimed invention. As used herein, the term "a / an" refers to one or more, for example, "a host cell" should be understood to mean one or more host cells. Thus, the terms "a / an", "one or more" and "at least one" are used interchangeably herein. As used herein, unless otherwise stated, the term "about" means a variability of 10% relative to a given reference. Although the various embodiments in the specification are presented using "comprising" language, in other cases, it is also intended to use the language of "consisting of..." or "consisting essentially of..." to explain and describe the relevant embodiments.

[0031] With respect to the following description, it is contemplated that in another embodiment, each composition described herein is suitable for use in the methods of the present invention. Additionally, it is contemplated that in another embodiment, each composition described as being suitable for use in the methods is itself an embodiment of the present invention.

[0032] "Recombinant AAV" or "rAAV" is a DNase-resistant viral particle containing two elements, namely the AAV capsid and a vector genome containing at least non-AAV coding sequences packaged in the AAV capsid. Unless otherwise specified, this term can be used interchangeably with the phrase "rAAV vector". rAAV is a "replication-defective virus" or "viral vector" because it lacks any functional AAV rep gene or functional AAV cap gene and cannot produce offspring. In certain embodiments, the only AAV sequence is the AAV inverted terminal repeat (ITR), which is usually located at the 5' and 3' extreme ends of the vector genome to allow genes and regulatory sequences located between the ITRs to be packaged in the AAV capsid.

[0033] As used herein, "vector genome" refers to the nucleic acid sequence packaged inside the rAAV capsid that forms the virus particle. Such nucleic acid sequences contain AAV inverted terminal repeats (ITRs). In the examples herein, the vector genome contains at least AAV 5'ITR, coding sequences and AAV 3'ITRs from 5' to 3'. In certain embodiments, ITR is from AAV2, and a source AAV different from the capsid or different from the full-length ITR can be selected. In certain embodiments, ITR is from the same AAV source as the AAV that provides the rep function during production or trans-supplementation of AAV. In addition, other ITRs can be used. In addition, the vector genome contains regulatory sequences that guide the expression of gene products. The suitable components of the vector genome are discussed in more detail herein. The vector genome is sometimes referred to as a "minigene" herein.

[0034] The term "expression cassette" refers to a nucleic acid molecule comprising a transgenic sequence and its regulatory sequences (e.g., promoters, enhancers, polyA), which can be packaged into the capsid of a viral vector (e.g., viral particles). Typically, such an expression cassette for producing a viral vector contains a transgenic sequence flanked by packaging signals and other expression control sequences of the viral genome, such as those described herein. For example, for AAV viral vectors, the packaging signal is a 5' inverted terminal repeat (ITR) and a 3' ITR. In certain embodiments, the term "transgenic" can be used interchangeably with an "expression cassette". In other embodiments, the term "transgenic" refers only to the coding sequence of a selected gene.

[0035] rAAV is composed of AAV capsid and vector genome. AAV capsid is an assembly of a heterogeneous population of vp1, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins. As used herein, when used to refer to vp capsid proteins, the term "heterologous" or any grammatical variation thereof refers to a population composed of non-identical elements, such as vpl, vp2 or vp3 monomers (proteins) containing different modified amino acid sequences.

[0036] As used herein, the term "heterogeneous population" used in conjunction with vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to differences in the amino acid sequences of the vp1, vp2, and vp3 proteins within the capsid. The AAV capsid contains subpopulations within the vp1 protein, within the vp2 protein, and within the vp3 protein that have modifications from predicted amino acid residues. These subpopulations include at least certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations contain at least one, two, three, or four highly deamidated asparagine (N) positions in asparagine-glycine pairs, and optionally further contain other deamidated amino acids, wherein the deamidation causes amino acid changes and other optional modifications.

[0037] As used herein, unless otherwise specified, a "subgroup" of vp proteins refers to a group of vp proteins that have at least one defined common property and consist of at least one to less than all members of a reference group. For example, a "subgroup" of vp1 proteins can be at least one (1) vp1 protein and less than all vp1 proteins in an assembled AAV capsid, unless otherwise specified. A "subgroup" of vp3 proteins can be one (1) vp3 protein that is less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified. For example, vp1 proteins can be a subgroup of vp proteins; vp2 proteins can be a separate subgroup of vp proteins, and vp3 is yet another subgroup of vp proteins in an assembled AAV capsid. In another example, vp1, vp2, and vp3 proteins can contain subgroups with different modifications, e.g., at least one, two, three, or four highly deamidated asparagines, e.g., at asparagine-glycine pairs. See PCT / US19 / 019804, filed February 27, 2019, and PCT / US19 / 019861, filed February 27, 2019, each of which is incorporated herein by reference.

[0038] Unless otherwise indicated, highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a reference amino acid position compared to the predicted amino acid sequence at the reference amino acid position. Such percentages can be determined using 2D gels, mass spectrometry techniques, or other suitable techniques.

[0039] Without wishing to be bound by theory, deamidation of at least highly deamidated residues in the vp protein in the AAV capsid is thought to be primarily non-enzymatic in nature, resulting from functional groups within the capsid protein that deamidate selected asparagine and, to a lesser extent, glutamine residues. The efficient capsid assembly of the mostly deamidated vp1 protein suggests that these events occur after capsid assembly, or that deamidation in individual monomers (vp1, vp2, or vp3) is structurally well tolerated and does not largely affect assembly kinetics. Extensive deamidation in the VP1 unique (VP1-u) region (approximately aa 1-137) is generally thought to be localized internally prior to cell entry, suggesting that VP deamidation may occur prior to capsid assembly.

[0040] Without wishing to be bound by theory, the deamidation of N can occur by a nucleophilic attack of the side chain amide carbon atom of Asn by the backbone nitrogen atom of its C-terminal residue. It is believed that an intermediate closed-loop succinimide residue is formed. Then, the succinimide residue is rapidly hydrolyzed to produce the final product aspartic acid (Asp) or isoaspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) produces Asp or IsoAsp, which can be mutually converted by a succinimide intermediate, such as shown below.

[0041]

[0042] As provided herein, each deamidated N in VP1, VP2 or VP3 can independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartic acid and / or a blend or combination of Asp and isoAsp interconversions. Any suitable ratio of α- and isoaspartic acid can be present. For example, in certain embodiments, the ratio can be 10:1 to 1:10 aspartic acid: isoaspartic acid, about 50:50 aspartic acid: isoaspartic acid, or about 1:3 aspartic acid: isoaspartic acid, or another selected ratio.

[0043] In certain embodiments, one or more glutamines (Q) can be deamidated to glutamic acid (Glu), i.e., α-glutamic acid, γ-glutamic acid (Glu), or a blend of α- and γ-glutamic acid, which can be interconverted through a common glutarimide intermediate. Any suitable ratio of α- and γ-glutamic acid can be present. For example, in certain embodiments, the ratio can be 10:1 to 1:10 α:γ, about 50:50 α:γ, or about 1:3 α:γ, or another selected ratio.

[0044]

[0045] Thus, rAAV includes a subgroup of deamidated amino acids within the rAAV capsid of the vp1, vp2 and / or vp3 proteins, including at least one subgroup comprising at least one highly deamidated asparagine. Additionally, other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In still other embodiments, the modification may include amidation at the Asp position.

[0046] In certain embodiments, the AAV capsid contains a subset of vp1, vp2, and vp3 having at least 1, at least 2, at least 3, at least 4, at least 5 to at least about 25 deamidated amino acid residue positions, wherein at least 1% to 10%, at least 10% to 25%, at least 25% to 50%, at least 50% to 70%, at least 70% to 100%, at least 75% to 100%, at least 80% to 100%, or at least 90% to 100% of the vp1, vp2, and vp3 are deamidated compared to the encoded amino acid sequence of the vp protein. The majority of these can be N residues. However, Q residues can also be deamidated.

[0047] As used herein, "encoded amino acid sequence" refers to the predicted amino acid based on the translation of known DNA codons of a reference nucleic acid sequence translated into amino acids. The following table shows DNA codons and twenty common amino acids, showing single letter codes (SLC) and three letter codes (3LC), respectively.

[0048]

[0049]

[0050] In certain embodiments, the rAAV has an AAV capsid containing vp1, vp2, and vp3 proteins having a subset comprising a combination of two, three, four, five, or more deamidated residues at the positions set forth in the Tables provided herein and incorporated by reference herein.

[0051] Deamidation in rAAV can be determined using 2D gel electrophoresis and / or mass spectrometry and / or protein modeling techniques.Online chromatography can be performed using an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF and NanoFlex source (Thermo Fisher Scientific). MS data are obtained using the data-dependent top 20 methods for Q Exactive HF, which dynamically select the most abundant precursor ions that have not yet been sequenced from a survey scan (200-2000m / z). Sequencing is performed by high-energy collision dissociation fragments, where the target value determined by predictive automatic gain control is 1e5 ions, and precursor separation is performed with a window of 4m / z. Survey scans are obtained at a resolution of 120,000 at m / z 200. The resolution of the HCD spectrum can be set to 30,000 at m / z 200, where the maximum ion injection time is 50 milliseconds, and the normalized collision energy is 30. The S-lens RF level can be set to 50 to achieve optimal transmission in the m / z region occupied by the digested peptide. Precursor ions with single, unassigned, or six and higher charge states can be excluded from the fragment selection. BioPharma Finder 1.0 software (Thermo Fisher Scientific) can be used to analyze the acquired data. For peptide mapping, a single entry protein FASTA database is used for searching, wherein carbamidomethylation is set as a fixed modification; and oxidation, deamidation, and phosphorylation are set as variable modifications, 10ppm mass accuracy, high protease specificity, and MS / MS spectra with a confidence level of 0.8. Examples of suitable proteases may include, for example, trypsin or chymotrypsin. The mass spectrometric identification of deamidated peptides is relatively simple because deamidation adds +0.984Da (the mass difference between the -OH group and the -NH2 group) to the mass of the intact molecule. The deamidation percentage of a specific peptide is determined by dividing the mass area of ​​the deamidated peptide by the sum of the areas of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species deamidated at different sites can co-migrate in a single peak. Therefore, fragment ions derived from peptides with multiple potential deamidation sites can be used to locate or distinguish multiple deamidation sites. In these cases, the relative intensity in the observed isotope pattern can be used to specifically determine the relative abundance of different deamidated peptide isomers. This method assumes that the fragmentation efficiency of all isomeric species is the same and is independent on the deamidation site. It will be appreciated by those skilled in the art that multiple variations of these illustrative methods can be used.For example, suitable mass spectrometers may include, for example, quadrupole time-of-flight mass spectrometers (QTOF), such as Waters Xevo or Agilent 6530, or Orbitrap instruments, such as Orbitrap Fusion or Orbitrap Velos (Thermo Fisher Scientific). Suitable liquid chromatography systems include, for example, AcquityUPLC systems or Agilent systems (1100 or 1200 series) from Waters (Waters). Suitable data analysis software may include, for example, MassLynx (Waters), Pinpoint and Petfinder (Thermo Fisher Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques may be described in, for example, Hu Gene Therapy Methods, published online on June 16, 2017 by X. Jin et al., Vol. 28, No. 5, pp. 255-267.

[0052] In addition to deamidation, other modifications that do not result in the conversion of one amino acid into a different amino acid residue may occur. Such modifications may include acetylated residues, isomerization, phosphorylation or oxidation.

[0053] Regulation of deamidation: In certain embodiments, AAV is modified to change the glycine in the asparagine-glycine pair to reduce deamidation. In other embodiments, asparagine is changed to a different amino acid, such as glutamine, which is deamidated at a slower rate; or changed to an amino acid lacking an amide group (e.g., glutamine and asparagine containing an amide group); and / or changed to an amino acid lacking an amine group (e.g., lysine, arginine, and histidine containing an amine group). As used herein, amino acids lacking amide or amine side groups refer to, for example, glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan and / or proline. The modifications described can be in one, two, or three asparagine-glycine pairs in the asparagine-glycine pairs present in the encoded AAV amino acid sequence. In certain embodiments, no such modifications are made in all four asparagine-glycine pairs. Therefore, a method for reducing the deamidation of AAV and / or engineered AAV variants having a lower deamidation rate. Additionally or alternatively, one or more other amide amino acids may be changed to non-amide amino acids to reduce the deamidation of AAV. In certain embodiments, the mutant AAV capsid described herein contains a mutation in an asparagine-glycine pair, such that glycine becomes alanine or serine. The mutant AAV capsid may contain one, two or three mutants, wherein the reference AAV naturally contains four NG pairs. In certain embodiments, the AAV capsid may contain one, two, three or four such mutants, wherein the reference AAV naturally contains five NG pairs. In certain embodiments, the mutant AAV capsid contains only a single mutation in the NG pair. In certain embodiments, the mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, the mutant AAV capsid contains mutations in two different NG pairs located in a structurally separated position in the AAV capsid. In certain embodiments, the mutation is not in the VP1 unique region. In certain embodiments, one of the mutations is not in the VP1 unique region. Optionally, the mutant AAV capsid contains no modification in the NG pair, but contains mutations to minimize or eliminate deamidation in one or more asparagine or glutamine located outside of the NG pair.

[0054] In certain embodiments, a method for increasing the efficacy of an rAAV vector is provided, the method comprising engineering an AAV capsid, which eliminates one or more NGs in the NG in the wild-type AAV capsid. In certain embodiments, the coding sequence of "G" of "NG" is engineered to encode another amino acid. In certain examples below, "S" or "A" is substituted. However, other suitable amino acid coding sequences can be selected.

[0055] These amino acid modifications can be carried out by conventional genetic engineering techniques.For example, a nucleic acid sequence containing a modified AAVvp codon can be produced, wherein one to three codons in the codon encoding glycine in the modified asparagine-glycine pair are modified to encode amino acids other than glycine. In certain embodiments, a nucleic acid sequence containing a modified asparagine codon can be engineered at one to three asparagine-glycine pairs in the asparagine-glycine pair so that the modified codon encodes amino acids other than asparagine. Each modified codon can encode different amino acids. Alternatively, one or more codons in the changed codon can encode the same amino acid. In certain embodiments, a modified AAVrh.91 nucleic acid sequence is used to produce a mutant rAAV with a capsid having a lower degree of deamidation than the natural AAVrh.91 capsid. Such mutant rAAV can have reduced immunogenicity and / or increase stability during storage, particularly stability when stored in the form of a suspension.

[0056] Also provided herein is a nucleotide sequence encoding the AAV capsid with reduced deamidation. Designing the nucleotide sequence encoding this AAV capsid, including DNA (genome or cDNA) or RNA (e.g., mRNA) is within the technical scope of the art. Such nucleotide sequences can be codon optimized to be expressed in a selected system (i.e., cell type) and can be designed by a variety of methods. This optimization can be performed using online available methods (e.g., GeneArt), disclosed methods, or companies providing codon optimization services (e.g., DNA2.0) (Menlo Park, California (Menlo Park, CA)). For example, a codon optimization method is described in International Patent Publication No. WO 2015 / 012924, which is incorporated herein by reference in its entirety. Also referring to, for example, U.S. Patent Publication No. 2014 / 0032186 and U.S. Patent Publication No. 2006 / 0136184. Suitably, the total length of the open reading frame (ORF) of the modified product. However, in some embodiments, only the fragment of ORF can be changed. By using a method in these methods, frequency can be applied to any given polypeptide sequence, and produce the nucleic acid fragment of the coding region through codon optimization that polypeptide is encoded.Many options can be used for codon to be actually changed or can be used for synthesizing the codon optimized coding region designed as described herein.Such modification or synthesis can be carried out using standard and conventional molecular biology operations known to those of ordinary skill in the art.In one method, a series of complementary oligonucleotide pairs of the length of 80-90 nucleotide and the length of the sequence of hope are synthesized by standard methods.These oligonucleotide pairs are synthesized so that they form the double-stranded fragment of 80-90 base pairs when annealing, and the double-stranded fragment contains sticky ends, for example, each oligonucleotide in the pair is synthesized to extend beyond 3, 4, 5, 6, 7, 8, 9, 10 or more bases in the region complementary to another oligonucleotide in the pair.Every single-stranded end of oligonucleotide is designed to be bonded with the single-stranded end of another pair of oligonucleotide. These oligonucleotide pairs are allowed to anneal, and then about five to six of these double-stranded fragments are allowed to anneal together via the sticky single-stranded ends, and then they are ligated together and cloned into a standard bacterial cloning vector, such as the one available from Invitrogen Corporation, Carlsbad, Calif. Vector. Then the construct is sequenced by standard methods. Several constructs in these constructs consisting of 5 to 6 fragments of 80 to 90 base pairs (i.e., fragments of about 500 base pairs) linked together are prepared so that the entire desired sequence is represented by a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and linked together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced. Other methods will be immediately clear to the technician. In addition, gene synthesis is easily commercially available.

[0057] In certain embodiments, AAV capsids are provided having a heterogeneous population of AAV capsid isotypes (i.e., VP1, VP2, VP3) containing multiple highly deamidated "NG" positions. In certain embodiments, the highly deamidated positions are in the positions identified below with reference to the predicted full-length VP1 amino acid sequence. In other embodiments, the capsid gene is modified such that the reference "NG" is ablated and the mutant "NG" is engineered into another position.

[0058] As used herein, the terms "target cell" and "target tissue" may refer to any cell or tissue that is intended to be transduced by a subject's AAV vector. The terms may refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eyes (eye cells), or heart. In one embodiment, the target tissue is the liver. In another embodiment, the target tissue is the heart. In another embodiment, the target tissue is the brain. In another embodiment, the target tissue is muscle.

[0059] As used herein, the term "mammalian subject" or "subject" includes any mammal in need of the treatment or prevention methods described herein, especially including humans. Other mammals in need of such treatment or prevention include dogs, cats or other domesticated animals, horses, livestock, laboratory animals, including non-human primates, etc. The subject can be male or female.

[0060] As used herein, the term "host cell" may refer to a packaging cell line in which a recombinant AAV is produced from a plasmid. In an alternative embodiment, the term "host cell" may refer to a target cell in which transgene expression is desired.

[0061] A. AAV capsid

[0062] Provided herein is a novel AAV capsid protein having a vp1 sequence set forth in SEQ ID NO: 2. The AAV capsid consists of three overlapping coding sequences of varying lengths due to the use of alternative start codons. These variable proteins are referred to as VP1, VP2, and VP3, of which VP1 is the longest and VP3 is the shortest. AAV particles consist of all three capsid proteins in a ratio of approximately 1:1:10 (VP1:VP2:VP3). VP3 is contained in VP1 and VP2 at the N-terminus and is the main structural component for building particles. Several different numbering systems can be used to refer to capsid proteins. For convenience, as used herein, VP1 numbering is used to refer to AAV sequences, starting with aa 1 of the first residue of VP1. However, the capsid proteins described herein include VP1, VP2, and VP3 (used interchangeably herein with vp1, vp2, and vp3). The numbering of the variable proteins of the capsid is as follows:

[0063] Nucleotide (nt)

[0064] AAVrh.91: vp1 - nt 1 to 2208; vp2 - nt 412 to 2208; vp3 - nt 607 to 2208 of SEQ ID NO: 1

[0065] AAVrh.91eng: vp1 - nt 1 to 2208; vp2 - nt 412 to 2208; vp3 - nt 607 to 2208 of SEQ ID NO: 3

[0066] The nucleic acid sequences of the capsids described herein are compared in Figure 3A-3D Shown in.

[0067] Amino Acid (aa)

[0068] AAVrh.91 and AAVrh.91eng: aa vp1 - 1 to 736; vp2 - aa 138 to 736; vp3 - aa 203 to 736 of SEQ ID NO:2.

[0069] The amino acid sequences of the capsids described herein are compared in Figure 4A and Figure 4B Shown in.

[0070] Included herein are rAAVs comprising at least one of vp1, vp2, and vp3 of AAVrh.91 (SEQ ID NO: 2). Also provided herein are rAAVs comprising an AAV capsid encoded by at least one of vp1, vp2, and vp3 of AAVrh.91 (SEQ ID NO: 1) or AAVrh.91eng (SEQ ID NO: 3).

[0071] In one embodiment, a composition is provided, which includes a mixed population of recombinant adeno-associated viruses (rAAVs), each of which comprises: (a) an AAV capsid comprising about 60 capsid proteins consisting of vpl proteins, vp2 proteins, and vp3 proteins, wherein the vp1, vp2, and vp3 proteins are: a heterogeneous population of vp1 proteins produced by a nucleic acid sequence encoding a selected AAV vp1 amino acid sequence, a heterogeneous population of vp2 proteins produced by a nucleic acid sequence encoding a selected AAV vp2 amino acid sequence, and a heterogeneous population of vp3 proteins produced by a nucleic acid sequence encoding a selected AAV vp1 amino acid sequence. A heterogeneous population of vp3 proteins produced by a nucleic acid sequence of a vp3 amino acid sequence, wherein: vp1, vp2 and vp3 proteins contain a subpopulation with amino acid modifications, wherein the amino acid modifications include at least two highly deamidated asparagines (N) in the asparagine-glycine pairs in the AAV capsid, and optionally further contain a subpopulation containing other deamidated amino acids, wherein the deamidation causes amino acid changes; and (b) a vector genome in the AAV capsid, wherein the vector genome contains a nucleic acid molecule comprising an AAV inverted terminal repeat sequence and a non-AAV nucleic acid sequence encoding a product, wherein the nucleic acid sequence is operably linked to a sequence that directs the expression of the product in a host cell.

[0072] In certain embodiments, the deamidated asparagine is deamidated to aspartic acid, isoaspartic acid, an interconverted aspartic acid / isoaspartic acid pair, or a combination thereof. In certain embodiments, the capsid further comprises a deamidated glutamine, which is deamidated to (α)-glutamic acid, γ-glutamic acid, an interconverted (α)-glutamic acid / γ-glutamic acid pair, or a combination thereof.

[0073] In certain embodiments, novel isolated AAVrh.91 capsids are provided. The nucleic acid sequence encoding the AAVrh.91 capsid is provided in SEQ ID NO: 1, and the encoded amino acid sequence is provided in SEQ ID NO: 2. Provided herein is an rAAV comprising at least one of vp1, vp2, and vp3 of AAVrh.91 (SEQ ID NO: 2). Also provided herein is an rAAV comprising an AAV capsid encoded by at least one of vp1, vp2, and vp3 of AAVrh.91 (SEQ ID NO: 1). In another embodiment, the nucleic acid sequence encoding the AAVrh.91 amino acid sequence is provided in SEQ ID NO: 3, and the encoded amino acid sequence is provided in SEQ ID NO: 2. Also provided herein is an rAAV comprising an AAV capsid encoded by at least one of vp1, vp2, and vp3 of AAVrh.91eng (SEQ ID NO: 3). In certain embodiments, vp1, vp2 and / or vp3 are full-length capsid proteins of AAVrh.91 (SEQ ID NO: 2). In other embodiments, vp1, vp2 and / or vp3 have N-terminal and / or C-terminal truncations (eg, truncations of about 1 to about 10 amino acids).

[0074] In another aspect, a recombinant adeno-associated virus (rAAV) is provided, the rAAV comprising: (A) an AAVrh.91 capsid comprising one or more of the following: (1) an AAVrh.91 capsid protein comprising: a heterogeneous population of AAVrh.91 vpl proteins selected from the group consisting of: vp1 proteins produced by expression of a nucleic acid sequence encoding a predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2, vp1 proteins produced by SEQ ID NO: 1, or vp1 proteins produced by a nucleic acid sequence having at least 70% identity to SEQ ID NO: 1, the nucleic acid sequence encoding a predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2; and a heterogeneous population of AAVrh.91 vp2 proteins selected from the group consisting of: vp2 proteins produced by expression of a nucleic acid sequence encoding a predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, vp2 proteins produced by a sequence comprising at least nucleotides 412 to 2208 of SEQ ID NO: 1, or vp2 proteins produced by a nucleic acid sequence having at least 70% identity to SEQ ID NO: 1. NO:1, said nucleic acid sequence encoding at least about amino acids 138 to 736 of SEQ ID NO:2; a heterogeneous population of AAVrh.91 vp3 proteins selected from the group consisting of: vp3 proteins produced by expression of a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, vp3 proteins produced by a sequence comprising at least nucleotides 607 to 2208 of SEQ ID NO:1, or vp3 proteins produced by a nucleic acid sequence having at least 70% identity to at least nucleotides 607 to 2208 of SEQ ID NO:1, said nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:1; and / or (2) a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2, a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, A heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence encoding at least about amino acids 138 to 736 of SEQ ID NO:2 and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO:2, wherein: the vp1, vp2 and vp3 proteins contain a subset having amino acid modifications comprising at least two highly deamidated asparagines (N) in the asparagine-glycine pairs in SEQ ID NO:2, and optionally further contain a subset comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) AAVrh.91 A vector genome in a capsid, the vector genome comprising a nucleic acid molecule comprising an AAV inverted terminal repeat sequence and a non-AAV nucleic acid sequence encoding a product, the product being operably linked to a sequence directing expression of the product in a host cell.

[0075] In another aspect, a recombinant adeno-associated virus (rAAV) is provided, the rAAV comprising: (A) an AAVrh.91 capsid comprising one or more of the following: (1) an AAVrh.91 capsid protein comprising: a heterogeneous population of AAVrh.91 vp1 proteins selected from the group consisting of vp1 proteins produced by expression of a nucleic acid sequence encoding a predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2, vp1 proteins produced by SEQ ID NO: 3, or vp1 proteins produced by a nucleic acid sequence having at least 70% identity to SEQ ID NO: 3, wherein the nucleic acid sequence encodes a predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2; and a heterogeneous population of AAVrh.91 vp2 proteins selected from the group consisting of vp2 proteins produced by expression of a nucleic acid sequence encoding a predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, vp2 proteins produced by a sequence comprising at least nucleotides 412 to 2208 of SEQ ID NO: 3, or vp2 proteins produced by a nucleic acid sequence having at least 70% identity to SEQ ID NO: 3. NO:3, which nucleic acid sequence encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO:2; a heterogeneous population of AAVrh.91 vp3 proteins selected from the group consisting of: vp3 proteins produced by expression of a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO:2, vp3 proteins produced by a sequence comprising at least nucleotides 607 to 2208 of SEQ ID NO:3, or vp3 proteins produced by a nucleic acid sequence having at least 70% identity to at least nucleotides 607 to 2208 of SEQ ID NO:3, which nucleic acid sequence encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO:2, and / or (2) a heterogeneous population of AAVrh.91 vp1 proteins that are the product of a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO:2, a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:2, and / or (3) a nucleic acid sequence encoding at least nucleotides 607 to 2208 of SEQ ID NO:3, which nucleic acid sequence encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO:2. A heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence encoding at least about amino acids 138 to 736 of SEQ ID NO:2 and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO:2, wherein: the vp1, vp2 and vp3 proteins contain a subset having amino acid modifications comprising at least two highly deamidated asparagines (N) in the asparagine-glycine pairs in SEQ ID NO:2, and optionally further contain a subset comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) AAVrh.91 A vector genome in a capsid, the vector genome comprising a nucleic acid molecule comprising an AAV inverted terminal repeat sequence and a non-AAV nucleic acid sequence encoding a product, the product being operably linked to a sequence directing expression of the product in a host cell.

[0076] In certain embodiments, the AAVrh.91 vp1, vp2, and vp3 proteins contain a subpopulation with amino acid modifications comprising at least two highly deamidated asparagines (N) in the asparagine-glycine pairs in SEQ ID NO: 2, and optionally further contain a subpopulation comprising other deamidated amino acids, wherein the deamidation results in an amino acid change. Relative to the numbering of SEQ ID NO: 2, high levels of deamidation are observed at NG pairs N57, N383, and / or N512. As shown in the following table and Fig. 15B As shown in , deamidation has been observed in other residues. In certain embodiments, AAVrh.91 may have other deamidated residues, such as typically less than 10% and / or may have other modifications, including phosphorylation (e.g., when present, in the range of about 2 to about 30%, or about 2 to about 20%, or about 2 to about 10%) (e.g., at S149), or oxidation (e.g., at one or more of ~W22, ~M211, W247, M403, M435, M471, W478, W503, ~M537, ~M541, ~M559, ~M599, M635, and / or W695). Optionally, W can be oxidized to kynurenine.

[0077] Table - AAVrh.91 deamidation

[0078] AAVrh.91 deamidation based on VP1 numbering Deamidation% N57+ deamidation 65-90, 70-95, 80-95, 75-100, 80-100 or 90-100 N94+ deamidation 2-15 or 2-5 N303+ deamidation 2-15 or 5-10 N383+deamidation 65-90, 70-95, 80-95, 75-100, 80-100 or 90-100 N497+deamidation 2-15 or 5-10 N512+ deamidation 65-90, 70-95, 80-95, 75-100, 80-100 or 90-100 ~N691+deamidation 2-15, 2-10 or 5-10

[0079] In certain embodiments, the AAVrh.91 capsid is modified in one or more positions identified in the table above within the range provided as determined using trypsin mass spectrometry. In certain embodiments, one or more positions or the glycine after N are modified as described herein. The residue numbers are based on the AAVrh.91 sequence provided herein. See SEQ ID NO: 2.

[0080] In certain embodiments, the AAVrh.91 capsid comprises: a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2, a heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO:2, and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO:2.

[0081] In certain embodiments, the nucleic acid sequence encoding the AAVrh.91 vp1 capsid protein is provided in SEQ ID NO: 1. In other embodiments, a nucleic acid sequence having 70% to 99.9% identity to SEQ ID NO: 1 can be selected to express the AAVrh.91 capsid protein. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 1. However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO: 2 can be selected for use in generating rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1, or a sequence at least 70% to 99.9% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO: 1, which sequence encodes SEQ ID NO: 2. In certain embodiments, the nucleic acid sequence has a nucleic acid sequence of SEQ ID NO: 1, or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 412 to about nt 2208 of SEQ ID NO: 1, which sequence encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 2. In certain embodiments, the nucleic acid sequence has a nucleic acid sequence of about nt 607 to about nt 2208 of SEQ ID NO: 1, or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 607 to about nt 2208 of SEQ ID NO: 1, which sequence encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 2.

[0082] In certain embodiments, the nucleic acid sequence encoding the AAVrh.91 vp1 capsid protein is provided in SEQ ID NO:3. In other embodiments, a nucleic acid sequence having 70% to 99.9% identity to SEQ ID NO:3 can be selected to express the AAVrh.91 capsid protein. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO:3. However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO:2 can be selected for use in generating rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO:3, or a sequence that is at least 70% to 99.9% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO:3, which sequence encodes SEQ ID NO:2. In certain embodiments, the nucleic acid sequence has a nucleic acid sequence of SEQ ID NO: 3, or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 412 to about nt 2208 of SEQ ID NO: 3, which sequence encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 2. In certain embodiments, the nucleic acid sequence has a nucleic acid sequence of about nt 607 to about nt 2208 of SEQ ID NO: 3, or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 607 to about nt 2208 of SEQ ID NO: 3, which sequence encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 2.

[0083] The present invention also encompasses nucleic acid sequences encoding the AAVrh.91 capsid sequence (SEQ ID NO: 2) or mutant AAVrh.91, wherein one or more residues have been altered to reduce deamidation, or other modifications identified herein. Such nucleic acid sequences can be used to generate mutant AAVrh.91 capsids.

[0084] In certain embodiments, provided herein is a nucleic acid molecule having a sequence of SEQ ID NO: 1, or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 1, encoding the vp1 amino acid sequence of SEQ ID NO: 2 with modifications as described herein (e.g., deamidated amino acids). In certain embodiments, provided herein is a nucleic acid molecule having a sequence of SEQ ID NO: 3, or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 3, encoding the vp1 amino acid sequence of SEQ ID NO: 2 with modifications as described herein (e.g., deamidated amino acids). In certain embodiments, the vp1 amino acid sequence is replicated in SEQ ID NO: 2. In certain embodiments, a plasmid having a nucleic acid sequence described herein is provided.

[0085] When referring to nucleic acids or fragments thereof, the term "substantial homology" or "substantial similarity" means that at least about 95 to 99% of the aligned sequences have nucleotide sequence identity when optimally aligned with appropriate nucleotide insertions or deletions of another nucleic acid (or its complementary strand). Preferably, the homology is over the full-length sequence, or its open reading frame or another suitable fragment of at least 15 nucleotides in length. Examples of suitable fragments are described herein.

[0086] In the context of nucleic acid sequences, the terms "percent (%) identity", "sequence identity", "percent sequence identity" or "percent identity" refer to the residues in two sequences that are identical when aligned in correspondence. The length of the expected sequence identity comparison can exceed the full length of a genome, the full length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides. However, identity between smaller fragments can also be expected, for example, at least about nine nucleotides, typically at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides.

[0087] The percent identity of an amino acid sequence over the full length of a protein, a polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof, or a corresponding nucleic acid sequence encoding sequence can be readily determined. Suitable amino acid fragments can be at least about 8 amino acids in length, and can be up to about 700 amino acids. Typically, when referring to "identity," "homology," or "similarity" between two different sequences, "identity," "homology," or "similarity" is determined with reference to an "aligned" sequence. An "aligned" sequence or "alignment" refers to a plurality of nucleic acid sequences or protein (amino acid) sequences that typically contain corrections for missing or additional bases or amino acids compared to a reference sequence.

[0088] The identity can be determined by comparing the sequences and by using various algorithms and / or computer programs known or commercially available in the art [e.g., BLAST, ExPASy; ClustalO; FASTA; using, for example, the Needleman-Wunsch algorithm, the Smith-Waterman algorithm]. The alignment is performed using any of a variety of public or commercially available multiple sequence alignment programs. Sequence alignment programs are available for amino acid sequences, such as "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME" and "Match-Box" programs. Typically, any of these programs is used with the default settings, although those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can utilize another algorithm or computer program that provides at least the same level of identity or alignment as provided by the reference algorithm and program. See, e.g., JD Thomson et al., Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments," 27(13): 2682-2690 (1999).

[0089] Multiple sequence alignment programs can also be used for nucleic acid sequences. Examples of such programs include "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "BLAST", "MAP" and "MEME", which can be accessed through web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, the VectorNTI utility program is also used. There are also a variety of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the above programs. As another example, the GCG 6.1 version of the program FastA TM Compare polynucleotide sequences. Fasta TM The alignment and percent sequence identity of the best overlap region between the query sequence and the search sequence are provided. For example, the percent sequence identity between nucleic acid sequences can be calculated using FastAnalog® as provided in GCG version 6.1 using its default parameters (font size 6 and NOPAM coefficients for the scoring matrix). TM OK, and the procedure is incorporated herein by reference.

[0090] B. rAAV Vectors and Compositions

[0091] On the other hand, the present invention describes molecules that utilize the AAV capsid sequences described herein (including fragments thereof) to produce viral vectors suitable for delivering heterologous genes or other nucleic acid sequences to target cells. In one embodiment, the vectors suitable for the compositions and methods described herein contain at least a sequence encoding an AAV capsid as described herein, such as an AAVrh.91 capsid or a fragment thereof. In another embodiment, the applicable vector contains at least a sequence encoding a selected AAV serotype rep protein or a fragment thereof. Optionally, such vectors may contain AAV cap and rep proteins. In vectors that provide AAV rep and cap, the AAV rep and AAV cap sequences can be derived from a serotype, such as both are derived from AAVrh.91. Alternatively, a vector in which the rep sequence is derived from an AAV different from the wild-type AAV that provides the cap sequence can be used. In one embodiment, the rep and cap sequences are expressed by separate sources (e.g., separate vectors, or host cells and vectors). In another embodiment, these rep sequences are fused in frame with cap sequences of different AAV serotypes to form a chimeric AAV vector, such as AAV2 / 8 described in U.S. Pat. No. 7,282,199, which is incorporated herein by reference. Optionally, the vector further contains a minigene comprising a selected transgene flanked by AAV 5′ITR and AAV 3′ITR. In another embodiment, AAV is a self-complementary AAV (sc-AAV) (see US 2012 / 0141422, which is incorporated herein by reference). The self-complementary vector packages an inverted repeat genome that can be folded into dsDNA without the need for DNA synthesis or base pairing between multiple vector genomes. Since scAAV does not require the conversion of a single-stranded DNA (ssDNA) genome into a double-stranded DNA (dsDNA) prior to expression, it is a more efficient vector. However, the cost of this efficiency is the loss of half of the coding capacity of the vector, and ScAAV is suitable for small protein-coding genes (up to about 55 kd) and any currently available RNA-based therapy.

[0092] Pseudotype vectors are suitable for use herein, wherein the capsid of one AAV is replaced by a heterologous capsid protein. For illustrative purposes, an AAV vector utilizing the AAVrh.91 capsid and AAV2 ITR described herein is used in the examples described below. See Mussolino et al. cited above. Unless otherwise specified, the AAV ITRs and other selected AAV components described herein may be individually selected from any AAV serotype, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes. In an ideal embodiment, the ITR of AAV serotype 2 is used. However, ITRs from other suitable serotypes may be selected. These ITRs or other AAV components may be easily separated from AAV serotypes using techniques available to those skilled in the art. Such AAVs may be separated from academic, commercial or public sources (e.g., American Type Culture Collection, Manassas, VA, Manassas, Virginia). Alternatively, AAV sequences can be obtained by synthesis or other suitable means, by reference to published sequences, such as those available in the literature or in databases such as GenBank, PubMed, and the like.

[0093] The rAAV described herein also comprises a vector genome. The vector genome is composed of at least a non-AAV or heterologous nucleic acid sequence (transgene) and its regulatory sequences as described below and 5' and 3' AAV inverted terminal repeats (ITRs). This minigene is packaged into the capsid protein and delivered to the selected target cell.

[0094] A transgene is a nucleic acid sequence that is heterologous to the vector sequences on either side of the transgene and that encodes a polypeptide, protein, or other product of interest. The nucleic acid coding sequence is operably linked to a regulatory element in a manner that allows the transgene to be transcribed, translated, and / or expressed in a target cell. The heterologous nucleic acid sequence (transgene) can be derived from any organism. AAV can contain one or more transgenes.

[0095] In certain embodiments, provided herein are rAAV.91 vectors comprising a transgene comprising a sequence encoding erythropoietin (EPO). In certain embodiments, the transgene encodes a canine or feline EPO gene. Such recombinant vectors are suitable for use in, for example, treating chronic kidney disease and other conditions characterized by a reduction in the amount of circulating red blood cells in a subject.

[0096] In certain embodiments, provided herein are rAAV.91 vectors comprising a transgene comprising a sequence encoding an anti-nerve growth factor (NGF) antibody. In certain embodiments, the transgene encodes a canine or feline anti-NGF antibody. Such recombinant vectors are suitable for use in, for example, a regimen for treating osteoarthritis pain in a subject.

[0097] In certain embodiments, provided herein are rAAV.91 vectors comprising a transgene comprising a sequence encoding an anti-nerve growth factor (NGF) antibody. In certain embodiments, the transgene encodes a canine or feline anti-NGF antibody. Such recombinant vectors are suitable for use in, for example, a regimen for treating osteoarthritis pain in a subject.

[0098] In certain embodiments, provided herein are rAAV.91 vectors comprising a transgene comprising a sequence encoding glucagon-like peptide 1 (GLP-1). In certain embodiments, the transgene encodes canine or feline GLP-1. Such recombinant vectors are suitable for use, for example, in a regimen for treating type II diabetes in a subject.

[0099] In certain embodiments, provided herein are rAAV.91 vectors comprising a transgene comprising a sequence encoding glucagon-like peptide 1 (GLP-1). In certain embodiments, the transgene encodes canine or feline GLP-1. Such recombinant vectors are suitable for use, for example, in a regimen for treating type II diabetes in a subject.

[0100] In certain embodiments, provided herein are rAAV.91 vectors comprising a transgene comprising a sequence encoding insulin. In certain embodiments, the transgene encodes canine or feline insulin. Such recombinant vectors are suitable for use in, for example, a regimen for treating type I diabetes or type II diabetes in a subject.

[0101] In certain embodiments, provided herein are rAAVrh.90 vectors comprising a transgene comprising a sequence encoding an antagonist of the interleukin-4 receptor alpha (IL-4Rα) subunit of an IgE, IL-32 or IL-4 / IL-13 receptor (including, for example, antibodies and receptor-IgG fusion proteins). In certain embodiments, the transgene encodes an antagonist of a canine or feline IgE, IL-32 or IL-4Rα subunit. Such recombinant vectors are suitable for use, for example, in a regimen for treating atopic dermatitis in a subject.

[0102] The composition of the transgenic sequence will depend on the purpose of the resulting vector. For example, a type of transgenic sequence includes a reporter sequence that produces a detectable signal when expressed. Such reporter sequences include, but are not limited to, DNA sequences encoding the following: beta-lactamase, beta-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), enhanced GFP (EGFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane-bound proteins (including, for example, CD2, CD4, CD8), influenza hemagglutinin protein, and other proteins well known in the art, for which there may be conventional methods to produce high-affinity antibodies, and fusion proteins, including membrane-bound proteins that are suitably fused to antigen tag domains particularly from hemagglutinin or Myc.

[0103] These coding sequences provide signals that can be detected by conventional methods when associated with the regulatory elements that drive their expression, including enzymatic, radiographic, colorimetric, fluorescent or other spectral analysis, fluorescence activated cell sorting analysis and immunoassays, including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry. For example, when the marker sequence is the LacZ gene, the presence of the signal-carrying vector is detected by analysis for beta-galactosidase activity. When the transgenic is green fluorescent protein or luciferase, the signal-carrying vector can be visually measured by color or light generation in a photometer.

[0104] However, ideally, transgenic is a non-marking sequence encoding a product suitable for biology and medicine, such as a protein, peptide, RNA, enzyme, dominant negative mutant or catalytic RNA. Ideal RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNA, siRNA, small hairpin RNA, reverse splicing RNA and antisense RNA. An example of an applicable RNA sequence is a sequence that suppresses or eliminates the expression of a target nucleic acid sequence in a treated animal. Typically, suitable target sequences include tumor targets and viral diseases. For examples of such targets, see the tumor targets and viruses identified in the section related to the immunogen below.

[0105] Transgenes can be used to correct or improve genetic defects, which may include defects in which normal genes are expressed at levels below normal or defects in which functional gene products are not expressed. Alternatively, transgenes can provide cells with products that are not naturally expressed in the cell type or host. Preferred types of transgenic sequences encode therapeutic proteins or polypeptides expressed in host cells. The present invention further includes the use of multiple transgenes. In some cases, different transgenes can be used to encode each subunit of a protein, or to encode different peptides or proteins. This is ideal when the size of the DNA encoding the protein subunit is large, such as for immunoglobulins, platelet-derived growth factors, or dystrophin. In order for cells to produce multi-subunit proteins, cells are infected with recombinant viruses containing each of the different subunits. Alternatively, different subunits of a protein can be encoded by the same transgene. In this case, a single transgene includes DNA encoding each of the subunits, wherein the DNA of each subunit is separated by an internal ribozyme entry site (IRES). This is ideal when the size of the DNA encoding each of the subunits is small, such as when the total size of the DNA encoding the subunits and the IRES is less than five kilobases. As an alternative to IRES, the DNA may be separated by a sequence encoding a 2A peptide that is self-cleaved in a post-translational event. See, e.g., ML Donnelly et al., J. Gen. Virol., 78(Pt 1): 13-21 (January 1997); Furler, S. et al., Gene Therapy, 8(11): 864-873 (June 2001); Klump H. et al., Gene Therapy, 8(10): 811-817 (May 2001). Such 2A peptides are significantly smaller than IRES and are therefore well suited for use when space is a limiting factor. More commonly, when the transgene is large, consists of multiple subunits, or two transgenes are co-delivered, rAAVs carrying the desired transgenes or subunits are co-administered to allow them to be concatenated in vivo to form a single vector genome. In such embodiments, the first AAV may carry an expression cassette expressing a single transgene, and the second AAV may carry an expression cassette expressing a different transgene for co-expression in the host cell. However, the transgene selected may encode any biologically active product or other product, such as a product of research interest.

[0106] Examples of suitable transgenes or gene products include those associated with familial hypercholesterolemia, muscular dystrophy, cystic fibrosis, and rare or orphan diseases. Examples of such rare diseases may include spinal muscular atrophy (SMA), Huntington's Disease, Rett Syndrome (e.g., methyl-CpG binding protein 2 (MeCP2); UniProtKB-P51608), amyotrophic lateral sclerosis (ALS), Duchenne Type Muscular dystrophy, Friedrichs Ataxia (e.g., ataxin), ATXN2 associated with type 2 spinocerebellar ataxia (SCA2) / ALS; TDP-43 associated with ALS, progranulin (PRGN) (associated with non-Alzheimer's brain degeneration, including frontotemporal dementia (FTD), progressive nonfluent aphasia (PNFA), and semantic dementia), etc. See, e.g., www.orpha.net / consor / cgi-bin / Disease_Search_List.php; rarediseases.info.nih.gov / diseases.

[0107] Suitable therapeutic products encoded by the transgene include hormones and growth and differentiation factors, including but not limited to insulin, glucagon, glucagon-like peptide 1 (GLP-1), growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiogenin, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO), connective tissue growth factor (CTGF) basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), transforming growth factor alpha (TGFα), platelet-derived growth factor (PDGF), insulin-like growth factor I and II (IGF-I and IGF-II), and I), any of the transforming growth factor β superfamily (including TGFβ), activins, inhibins, or any of the bone morphogenetic proteins (BMP) BMP1-15, any of the heregulin / neuregulin / ARIA / neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4 / 5, ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF), neurotrophins, agrin, any of the semaphorin / collapsin family, axon guidance factor-1 and axon guidance factor-2, hepatocyte growth factor (HGF), ephrin, noggin, sonic hedgehog, and tyrosine hydroxylase.

[0108] Other applicable transgenic products include proteins that modulate the immune system, including but not limited to cytokines and lymphokines, such as thrombopoietin (TPO), interleukins (IL) IL-1 to IL-25 (including IL-2, IL-4, IL-12 and IL-18), monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factor α and β, interferon (α, β and γ), stem cell factor, flk-2 / flt3 ligand. Gene products produced by the immune system can also be used in the present invention. These include but are not limited to immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single-chain antibodies, T cell receptors, chimeric T cell receptors, single-chain T cell receptors, MHC class I and class II molecules, and engineered immunoglobulins and MHC molecules. Suitable gene products also include complement regulatory proteins, such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2 and CD59.

[0109] Other applicable gene products include any of the receptors for hormones, growth factors, cytokines, lymphokines, regulatory proteins, and immune system proteins. The present invention encompasses receptors for cholesterol regulation, including low-density lipoprotein (LDL) receptors, high-density lipoprotein (HDL) receptors, very low-density lipoprotein (VLDL) receptors, and scavenger receptors. The present invention also encompasses gene products such as members of the steroid hormone receptor superfamily, including glucocorticoid receptors and estrogen receptors, vitamin D receptors, and other nuclear receptors. In addition, suitable gene products include transcription factors, such as jun, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C / EBP, SP1, CCAAT box binding protein, interferon regulatory factor (IRF-1), Wilms tumor protein, ETS binding protein, STAT, GATA box binding protein (e.g., GATA-3) and the forkhead family of winged helix proteins.

[0110] Other applicable gene products include carbamoyl synthetase I, ornithine transcarbamylase, arginine succinate synthetase, arginine succinate lyase, arginase, fumarate acetoacetate hydrolase, phenylalanine hydroxylase, alpha-1 antitrypsin, glucose-6-phosphatase, porphobilinogen deaminase, cystathionine β-synthase, branched-chain ketoacid decarboxylase, albumin, isovaleryl CoA dehydrogenase, propionyl CoA carboxylase, methylmalonyl CoA mutase, glutaryl CoA dehydrogenase, insulin, β-glucosidase, pyruvate carboxylase, liver phosphorylase, phosphorylase kinase, glycine decarboxylase, H protein, T protein, cystic fibrosis transmembrane regulator (CFTR) sequence and dystrophin sequence or its functional fragment. Other applicable gene products include enzymes such as those applicable to enzyme replacement therapy, which are applicable to a variety of conditions caused by insufficient enzyme activity. For example, an enzyme containing mannose-6-phosphate can be used in the treatment of lysosomal storage diseases (e.g., suitable genes include genes encoding β-glucuronidase (GUSB)). In another example, the gene product is ubiquitin protein ligase E3A (UBE3A). Still suitable gene products include UDP glucuronosyltransferase family 1 member A1 (UGT1A1).

[0111] Other applicable gene products include non-natural polypeptides, such as chimeric or hybrid polypeptides having non-natural amino acid sequences containing insertions, deletions or amino acid substitutions. For example, single-chain engineered immunoglobulins may be suitable for certain immunocompromised patients. Other types of non-natural gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which can be used to reduce the overexpression of a target.

[0112] Reducing and / or regulating gene expression is particularly desirable for treating hyperproliferative conditions characterized by hyperproliferative cells (such as cancer and psoriasis). Target polypeptides include those polypeptides produced specifically or at higher levels in hyperproliferative cells compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn and translocation genes bcr / ab1, ras, src, P53, neu, trk and EGRF. In addition to oncogene products as target antigens, target polypeptides for anticancer treatment and protection schemes include variable regions of antibodies produced by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas, and in some embodiments, the variable regions are also used as target antigens for autoimmune diseases. Other tumor-associated polypeptides can be used as target polypeptides, such as polypeptides present at higher levels in tumor cells, including polypeptides identified by monoclonal antibody 17-1A and folic acid binding polypeptides.

[0113] Other suitable therapeutic polypeptides and proteins include polypeptides and proteins that can be used to treat individuals with autoimmune diseases and disorders by conferring a broad-based protective immune response to targets associated with autoimmunity, including cell receptors and cells that produce self-directed antibodies. T cell-mediated autoimmune diseases include rheumatoid arthritis (RA), multiple sclerosis (MS), Sjögren's syndrome, sarcoidosis, insulin-dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, Wegner's granulomatosis, Crohn's disease, and ulcerative colitis. Each of these diseases is characterized by a T cell receptor (TCR) that binds to an endogenous antigen and triggers an inflammatory cascade associated with an autoimmune disease.

[0114] Other useful gene products include gene products for treating hemophilia, including hemophilia B (including factor IX) and hemophilia A (including factor VIII and variants thereof, such as heterodimers and light and heavy chains with B domains deleted; U.S. Pat. No. 6,200,560 and U.S. Pat. No. 6,221,349). In some embodiments, the minigene comprises the first 57 base pairs of the factor VIII heavy chain, which encodes a 10 amino acid signal sequence and a human growth hormone (hGH) polyadenylation sequence. In alternative embodiments, the minigene further comprises the A1 and A2 domains, and 5 amino acids from the N-terminus of the B domain and / or 85 amino acids from the C-terminus of the B domain, and the A3, C1 and C2 domains. In other embodiments, nucleic acids encoding the factor VIII heavy and light chains are provided in a single minigene separated by 42 nucleic acids encoding the 14 amino acids of the B domain [U.S. Pat. No. 6,200,560].

[0115] Other exemplary genes that can be delivered via rAAV include, but are not limited to, glucose-6-phosphatase (GSD1), which is associated with glycogen storage disease or type 1A deficiency; phosphoenolpyruvate carboxykinase (PEPCK), which is associated with PEPCK deficiency; cyclin-dependent kinase-like 5 (CDKL5), also known as serine / threonine kinase 9 (STK9), which is associated with seizures and severe neurodevelopmental disorders; galactose-1 phosphate uridyltransferase, which is associated with galactosemia; phenylalanine hydroxylase (PAH), which is associated with phenylketonuria (PKU); gene products associated with primary hyperoxaluria type 1, including hydroxyacid oxidase 1 (GO / HAO1) ​​and AGX T, branched-chain alpha-ketoacid dehydrogenases, including BCKDH, BCKDH-E2, BAKDH-E1a, and BAKDH-E1b, associated with maple syrup urine disease; fumarylacetoacetate hydrolase associated with tyrosinemia type 1; methylmalonyl-CoA mutase associated with methylmalonic acidemia; medium-chain acyl-CoA dehydrogenase associated with medium-chain acetyl-CoA deficiency; ornithine transcarbamylase (OTC) associated with ornithine transcarbamylase deficiency; argininosuccinate synthetase (ASS1) associated with citrullinemia; lecithin-cholesterol acyltransferase (LCAT) deficiency; amethylmalonic acidemia (MMA); Niemann-Pick disease (Niemann-Pick disease) disease), NPC1 associated with type C1; propionic acidemia (PA); TTR associated with hereditary amyloidosis associated with transthyretin (TTR); low-density lipoprotein receptor (LDLR) proteins associated with familial hypercholesterolemia (FH), LDLR variants, such as those described in WO 2015 / 164778; PCSK9; ApoE and ApoC proteins associated with dementia; UDP-glucuronosyltransferase associated with Crigler-Najjar disease; adenosine deaminase associated with severe combined immunodeficiency; hypoxanthine guanine phosphoribosyltransferase associated with gout and Lesch-Nyan syndrome; biotinidase associated with biotinidase deficiency; alpha-galactosidase A (a-Gal A) associated with Fabry disease; beta-galactosidase (GLB1) associated with GM1 gangliosidosis; Wilson's disease (Wilson's ATP7B associated with Gaucher disease types 2 and 3; β-glucocerebrosidase associated with Gaucher disease types 2 and 3; peroxisomal membrane protein 70 kDa associated with Zellweger syndrome;Arylsulfatase A (ARSA) associated with metachromatic leukodystrophy, galactocerebrosidase (GALC) associated with Krabbe disease, alpha-glucosidase (GAA) associated with Pompe disease; sphingomyelinase (SMPD1) gene associated with Niemann-Pick disease type A; arginine succinate synthase associated with adult-onset citrullinemia type II (CTLN2); carbamoyl phosphate synthase 1 (CPS1) associated with urea cycle disorders; survival motor neuron (SMN) protein associated with spinal muscular atrophy; ceramidase associated with Farber lipogranulomatosis; GM2 gangliosidosis and Tay-Sachs and Sandhoff diseases. disease); aspartylglucosaminidase associated with aspartylglucosamine; alpha-fucosidase associated with fucoside poisoning; alpha-mannosidase associated with alpha-mannoside poisoning; porphobilinogen deaminase associated with acute intermittent porphyria (AIP); alpha-1 antitrypsin for the treatment of alpha-1 antitrypsin deficiency (emphysema); erythropoietin for the treatment of anemia due to thalassemia or renal failure; vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for the treatment of ischemic disease; thrombomodulin and tissue factor pathway inhibitors for the treatment of occluded blood vessels, such as those seen in atherosclerosis, thrombosis, or embolism ; Aromatic amino acid decarboxylase (AADC) and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease; antisense or mutant forms of beta-adrenergic receptors, phosphoproteins, sarcosine (endoplasmic) reticulum adenosine triphosphatase-2 (SERCA2) and cardiac adenylate cyclase for the treatment of congestive heart failure; tumor suppressor genes such as p53 for the treatment of various cancers; cytokines, such as one of the various interleukins for the treatment of inflammatory and immune diseases and cancer; dystrophin or mini-dystrophin for the treatment of muscular dystrophy and dystrophin-related protein or mini-dystrophin for the treatment of muscular dystrophy; and insulin or GLP-1 for the treatment of diabetes. ;

[0116] Alternatively or in addition, the vector of the present invention may contain an AAV sequence of the present invention and a transgene encoding a peptide, polypeptide or protein that induces an immune response to a selected immunogen. For example, the immunogen can be selected from a variety of viral families. Examples of ideal viral families against which an immune response is desired include the Picornaviridae, which includes the genus Rhinovirus, which causes approximately 50% of common cold cases; the genus Enterovirus, including poliovirus, Coxsackievirus, Echovirus and human enterovirus, such as hepatitis A virus; and the genus Foot-and-mouth disease virus, which primarily causes foot-and-mouth disease in non-human animals. Within the Picornaviridae family of viruses, target antigens include VP1, VP2, VP3, VP4 and VPG. Another viral family includes the Calicivirus family, which covers the Norwalk virus group, an important pathogen of epidemic gastroenteritis. Another family of viruses that is expected to be used for targeting antigens to induce immune responses in humans and non-human animals is the Togaviridae, which includes the genus Alphavirus, which includes Sindbis virus, Ross River virus and Venezuelan, Eastern and Western equine encephalitis, and the genus Rubivirus, including Rubella virus. Flaviviridae includes dengue, yellow fever, Japanese encephalitis, St. Louis encephalitis and tick-borne encephalitis viruses. Other target antigens may be produced from hepatitis C or Coronaviridae, including non-human viruses, such as infectious bronchitis virus (poultry), porcine transmissible gastroenterovirus (pigs), porcine hemagglutinating encephalomyelitis virus (pigs), feline infectious peritonitis virus (cats), feline enteric coronavirus (cats), canine coronavirus (dogs) and human respiratory coronavirus, which may cause the common cold and / or non-A, B or C hepatitis. In the Coronaviridae, target antigens include E1 (also known as M or matrix protein), E2 (also known as S or spike protein), E3 (also known as HE or hemagglutinin-elterose) glycoproteins (not present in all coronaviruses) or N (nucleocapsid). Other antigens can target the Rhabdoviridae, which includes the genus Vesicular Virus (e.g., vesicular stomatitis virus) and the general genus Lyssavirus (e.g., rabies). In the Rhabdoviridae, suitable antigens can be derived from the G protein or the N protein. The Filoviridae, which includes hemorrhagic fever viruses such as Marburg virus and Ebola virus, may be a suitable source of antigens. The Paramyxoviridae includes parainfluenza virus type 1, parainfluenza virus type 3, bovine parainfluenza virus type 3, mumps virus genus (mumps virus), parainfluenza virus type 2, parainfluenza virus type 4, Newcastle disease virus (chicken), rinderpest, measles virus (which includes measles and canine distemper) and pneumovirus genus, which includes respiratory syncytial virus. Influenza viruses are classified within the Orthomyxoviridae family and are a suitable source of antigens (eg, HA protein, N1 protein).The Bunyaviridae family includes the genera Bunyavirus (California encephalitis, La Crosse), Phlebovirus (Rift Valley fever), Hantavirus (puremala is a hemorrhagic fever virus), Nairovirus (Nairobi sheep disease), and various unspecified Bunyaviruses. The Arenaviridae family provides a source of antigens against LCM and Lassa fever viruses. The Reovirus family includes the genera Reovirus, Rotavirus (which can cause acute gastroenteritis in children), Rotavirus, and Cultivirus (Colorado tick fever, Lebombo (humans), Equine encephalopathy, Bluetongue).

[0117] Retroviridae includes the oncorivirinal subfamily, which covers human and veterinary diseases, such as feline leukemia virus, HTLVI and HTLVII, lentiviruses (including human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus and foamy virus). Between HIV and SIV, many suitable antigens have been described and can be easily selected. Examples of suitable HIV and SIV antigens include, but are not limited to, gag, pol, Vif, Vpx, VPR, Env, Tat and Rev proteins and various fragments thereof. In addition, a variety of modifications to these antigens have been described. Suitable antigens for this purpose are known to those skilled in the art. For example, sequences encoding gag, pol, Vif and Vpr, Env, Tat and Rev, and other proteins can be selected. See, for example, the modified gag protein described in U.S. Patent No. 5,972,596. See also DH Barouch et al., Journal of Virology, 75(5):2462-2467 (March 2001) and RR Amara et al., Science, 292:69-74 (April 6, 2001) for HIV and SIV proteins. These proteins or their subunits may be delivered alone, or via separate vectors or in combination from a single vector.

[0118] The papovaviridae family includes the subfamily polyomaviruses (BKU and JCU viruses) and the subfamily papillomaviruses (associated with malignant progression of cancer or papilloma). The adenoviridae family includes viruses that cause respiratory diseases and / or enteritis (EX, AD7, ARD, OB). The parvoviridae family includes feline parvovirus (feline enteritis), feline panleukopenia virus, canine parvovirus, and porcine parvovirus. The herpesviridae family includes the subfamily alphaherpesviruses, which encompass the herpes simplex virus genus (HSVI, HSVII), the varicella virus genus (pseudorabies, varicella zoster); and the subfamily betaherpesviruses, which include the cytomegalovirus genus (HCMV, murine cytomegalovirus genus); and the subfamily gammaherpesvirus subfamily, which includes the lymphocytovirus genus, EBV (Burkitt's lymphoma), infectious rhinotracheitis, Marek's disease virus, and the rhadinovirus genus. The Poxviridae family includes the Poxvirinae, which encompasses the Orthopoxvirus genera (Variola (Smallpox) and Vaccinia (Cowpox), Parapoxvirus, Avipox virus, Capripoxvirus, Measles virus, Varicella virus, and Entomopoxvirinae. The Hepaciviridae family includes Hepatitis B virus. An unclassified virus that may be a suitable source of antigens is Hepatitis D virus. Other viral sources may include avian infectious bursal disease virus and porcine respiratory and reproductive syndrome virus. The Alphaviridae family includes equine arteritis virus and various encephalitis viruses.

[0119] The present invention may also encompass immunogens suitable for immunizing humans or non-human animals against other pathogens, including bacteria, fungi, parasitic microorganisms or multicellular parasites that infect humans and non-human vertebrates, or from cancer cells or tumor cells. Examples of bacterial pathogens include pathogenic Gram-positive cocci, including pneumococci; Staphylococci; and Streptococci. Pathogenic Gram-negative cocci include meningococci; gonococci. Pathogenic enteric gram-negative bacilli include Enterobacteriaceae; Pseudomonas, Acinetobacter, and Eikenella; melioidosis; Salmonella; Shigella; Haemophilus; Moraxella; H. ducreyi (causing chancroid); Brucella; Franisella tularensis (causing tularemia); Yersinia (Pasteurella); Streptobacillus moniliformis and Spirochete; Gram-positive bacilli include Listeria monocytogenes; Erysipelothrix rhusiopathiae; Corynebacterium diphtheriae (diphtheria); cholera; B. anthracis (anthrax); donovanosis (inguinal granuloma); and bartonellosis. Diseases caused by pathogenic anaerobic bacteria include tetanus; Clostridium botulinum; other Clostridia; tuberculosis; leprosy; and other mycobacteria. Pathogenic spirochetal diseases include syphilis; treponematoses: yaws, spot disease, and endemic syphilis; and leptospirosis. Other infections caused by highly pathogenic bacteria and pathogenic fungi include actinomycosis; nocardiosis; cryptococcosis, blastomycosis, histoplasmosis, and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichosis; paracoccidioidomycosis, coccidioidomycosis, cyclosporiasis, mycetoma, and chromosomycosis; and dermatophytosis. Rickettsial infections include typhus, Rocky Mountain spotted fever, Q fever, and rickettsial pox. Examples of mycoplasma and chlamydial infections include: Mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal chlamydial infections. Pathogenic eukaryotic organisms encompass pathogenic protozoa and helminths, and infections resulting therefrom include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; Pneumocystis carinii; Trichans; Toxoplasma gondii; babesiosis; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematodes or flukes; and cestode (tapeworm) infections.

[0120] Many of these organisms and / or the toxins they produce have been identified by the Centers for Disease Control [(CDC), U.S. Department of Health and Human Services] as pathogens with the potential to be used in biological attacks. For example, some of these biological agents, including Bacillus anthracis (anthrax), Clostridium botulinum and its toxins (botulism), Yersinia pestis (plague), Variola major (smallpox), Francisella tularensis (tularemia), and viral hemorrhagic fevers, all of which are currently classified as Category A pathogens; Coxiella burnetti (Q fever); Brucella spp. (brucellosis), Burkholderia mallei (glanders), Ricinus communis and its toxins (ricin), Clostridium perfringens and its toxins (epsilon toxins), Staphylococcus spp. and their toxins (enterotoxin B), all of which are currently classified as Category B pathogens; and Nipan virus (Nipan virus). virus and hantavirus, currently classified as a Category C pathogen. In addition, other organisms so classified or differently classified may be identified and / or used for such purposes in the future. It will be readily appreciated that the viral vectors and other constructs described herein can be used to deliver antigens from these organisms, viruses, their toxins or other byproducts, which will prevent and / or treat infections or other adverse reactions associated with these biological agents.

[0121] Administration of the vectors of the invention to deliver immunogens to variable regions of T cells elicits an immune response including CTLs to eliminate those T cells. In rheumatoid arthritis (RA), several specific variable regions of T cell receptors (TCRs) associated with the disease have been characterized. These TCRs include V-3, V-14, V-17, and Va-17. Therefore, delivery of a nucleic acid sequence encoding at least one of these polypeptides will elicit an immune response that will target T cells involved in RA. In multiple sclerosis (MS), several specific variable regions of TCRs involved in the disease have been characterized. These TCRs include V-7 and Va-10. Therefore, delivery of a nucleic acid sequence encoding at least one of these polypeptides will elicit an immune response that will target T cells involved in MS. In scleroderma, several specific variable regions of TCRs involved in the disease have been characterized. These TCRs include V-6, V-8, V-14 and Va-16, Va-3C, Va-7, Va-14, Va-15, Va-16, Va-28 and Va- 12. Thus, delivery of a nucleic acid molecule encoding at least one of these polypeptides will elicit an immune response that will target T cells involved in scleroderma.

[0122] In one embodiment, transgenics are selected to provide optogenetic therapy. In optogenetic therapy, artificial photoreceptors are constructed by delivering light-activated channels or pump genes to surviving cell types in the remaining retinal circuits. This is particularly useful for patients who have lost a large amount of photoreceptor function, but whose bipolar cell circuits to ganglion cells and optic nerves remain intact. In one embodiment, the heterologous nucleic acid sequence (transgenic) is an opsin. The opsin sequence can be derived from any suitable unicellular or multicellular organism, including humans, algae, and bacteria. In one embodiment, the opsin is rhodopsin, photoopsin, L / M wavelength (red / green)-opsin, or short wavelength (S) opsin (blue). In another embodiment, the opsin is channel rhodopsin or halorhodopsin.

[0123] In another embodiment, the transgene is selected for gene enhancement therapy, i.e., providing a replacement copy of a missing or defective gene. In this embodiment, a person skilled in the art can easily select a transgene to provide the necessary replacement gene. In one embodiment, the missing / defective gene is associated with an eye condition. In another embodiment, the transgene is NYX, GRM6, TRPML or GPR179, and the eye condition is congenital stationary night blindness. See, e.g., Zeitz et al., Am J Hum Genet. 2013 Jan 10; 92(1): 67-75. Epub 2012 Dec 13, which is incorporated herein by reference. In another embodiment, the transgene is RPGR.

[0124] In another embodiment, a transgene is selected for gene suppression therapy, i.e., expression of one or more native genes is interrupted or inhibited at the transcriptional or translational level. This can be achieved using short hairpin RNA (shRNA) or other techniques well known in the art. See, e.g., Sun et al., Int J Cancer. 2010 Feb 1;126(3):764-74 and O'Reilly M et al. Am J Human Genetics 2007 Jul;81(1):127-35, which are incorporated herein by reference. In this embodiment, one skilled in the art can easily select a transgene based on the gene to be silenced.

[0125] In another embodiment, the transgenic comprises more than one transgenic. This can be achieved using a single vector carrying two or more heterologous sequences, or using two or more AAVs each carrying one or more heterologous sequences. In one embodiment, AAV is used for gene suppression (or knockdown) and gene enhancement synergistic therapy. In knockdown / enhancement synergistic therapy, the defective copy of the gene of interest is silenced and a non-mutated copy is provided. In one embodiment, this is achieved using two or more co-administered vectors. See Millington-Ward et al., Molecular Therapy, April 2011, 19(4): 642-649, which is incorporated herein by reference. Transgenics can be easily selected by those skilled in the art based on the desired results.

[0126] In another embodiment, a transgene is selected for gene correction therapy. This can be achieved using, for example, zinc finger nuclease (ZFN)-induced DNA double-strand breaks in combination with an exogenous DNA donor substrate. See, for example, Ellis et al., Gene Therapy (Electronic Edition January 2012) 20: 35-42, which is incorporated herein by reference. Transgenes can be easily selected by those skilled in the art based on the desired results.

[0127] In one embodiment, the capsids described herein can be used in the CRISPR-Cas dual vector system described in U.S. Provisional Patent Application Nos. 61 / 153,470, 62 / 183,825, 62 / 254,225, and 62 / 287,511, each of which is incorporated herein by reference. The capsids can also be used to deliver homing endonucleases or other meganucleases.

[0128] In another embodiment, the transgenic suitable for use herein includes a reporter sequence that generates a detectable signal when expressed. Such reporter sequences include, but are not limited to, DNA sequences encoding the following: beta-lactamase, beta-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), red fluorescent protein (RFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane-bound proteins (including, for example, CD2, CD4, CD8), influenza hemagglutinin protein, and other proteins well known in the art, for which there is or can be produced high-affinity antibodies by conventional methods, and fusion proteins, including membrane-bound proteins suitably fused to antigen tag domains, especially from hemagglutinin or Myc.

[0129] These coding sequences provide signals that can be detected by conventional methods when associated with the regulatory elements that drive their expression, including enzymatic, radiographic, colorimetric, fluorescent or other spectral analysis, fluorescence activated cell sorting analysis and immunoassays, including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry. For example, when the marker sequence is the LacZ gene, the presence of the signal-carrying vector is detected by analysis for beta-galactosidase activity. When the transgenic is green fluorescent protein or luciferase, the signal-carrying vector can be visually measured by color or light generation in a photometer.

[0130] Ideally, the transgene encodes a product suitable for use in biology and medicine, such as a protein, peptide, RNA, enzyme, or catalytic RNA. Ideal RNA molecules include shRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNA, and antisense RNA. An example of a suitable RNA sequence is a sequence that eliminates expression of a target nucleic acid sequence in a treated animal.

[0131] Regulatory sequences include conventional control elements that are operably linked to a transgene in a manner that allows transcription, translation, and / or expression of the transgene in cells transfected with the vector or infected with a virus produced as described herein. As used herein, "operably linked" sequences include expression control sequences that are adjacent to a gene of interest and expression control sequences that act in trans or at a distance to control a gene of interest.

[0132] The term "heterologous" when used in conjunction with a protein or nucleic acid indicates that the protein or nucleic acid includes two or more sequences or subsequences that are not found in the same relationship to each other in nature. For example, nucleic acids are typically produced recombinantly, with two or more sequences from unrelated genes arranged to produce a new functional nucleic acid. For example, in one embodiment, a nucleic acid has a promoter from one gene arranged to direct expression of a coding sequence from a different gene. Thus, the promoter is heterologous with respect to the coding sequence.

[0133] Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and sequences that enhance secretion of the encoded product when desired. A large number of expression control sequences (including promoters) are known in the art and can be utilized.

[0134] Regulatory sequences that can be used in constructs provided herein may also contain introns, ideally located between promoter / enhancer sequences and genes. An ideal intron sequence is derived from SV-40 and is a 100 bp mini-intron splice donor / splice acceptor, referred to as SD-SA. Another suitable sequence includes a woodchuck hepatitis virus post-transcriptional element. (See, e.g., L. Wang and I. Verma, 1999 Proc. Natl. Acad. Sci., USA, 96: 3906-3910). The polyA signal can be derived from many suitable species, including but not limited to SV-40, humans, and cattle.

[0135] Another regulatory component of rAAV suitable for the methods described herein is an internal ribosome entry site (IRES). An IRES sequence or other suitable system can be used to produce more than one polypeptide from a single gene transcript. An IRES (or other suitable sequence) is used to produce proteins containing more than one polypeptide chain or to express two different proteins from the same cell or in the same cell. An exemplary IRES is a poliovirus internal ribosome entry sequence that supports transgene expression in photoreceptors, RPE and ganglion cells. Preferably, the IRES is located 3′ of the transgene of the rAAV vector.

[0136] In one embodiment, the expression cassette or vector genome comprises a promoter (or a functional fragment of a promoter). The promoter used in rAAV can be selected from a variety of constitutive or inducible promoters that can express the selected transgene in the desired target cells. In one embodiment, the target cells are eye cells. The promoter can be derived from any species, including humans. Ideally, in one embodiment, the promoter has "cell specificity". The term "cell specificity" means that the specific promoter selected for the recombinant vector can guide the expression of the selected transgene in a specific cell tissue. In one embodiment, the promoter is specific for the expression of the transgene in muscle cells. In another embodiment, the promoter is specific for the expression in the lung. In another embodiment, the promoter is specific for the expression of the transgene in hepatocytes. In another embodiment, the promoter is specific for the expression of the transgene in the airway epithelium. In another embodiment, the promoter is specific for the expression of the transgene in neurons. In another embodiment, the promoter is specific for the expression of the transgene in the heart.

[0137] The expression cassette typically contains a promoter sequence as part of an expression control sequence, for example, between a selected 5′ ITR sequence and an immunoglobulin construct coding sequence. In one embodiment, expression in the liver is desirable. Therefore, in one embodiment, a liver-specific promoter is used. Tissue-specific promoters, constitutive promoters, regulatable promoters [see, e.g., WO 2011 / 126808 and WO 2013 / 04943] or promoters that respond to physiological cues can be used in the vectors described herein. In another embodiment, expression in muscle is desirable. Therefore, in one embodiment, a muscle-specific promoter is used. In one embodiment, the promoter is an MCK-based promoter, such as a dMCK (509-bp) or tMCK (720-bp) promoter (see, e.g., Wang et al., Gene Therapy 2008 Nov; 15(22): 1489-99. doi: 10.1038 / gt.2008.104. Electronic version June 19, 2008, which is incorporated herein by reference). Another suitable promoter is the SPc5-12 promoter (see Rasowo et al., European Scientific Journal, June 2014, Vol. 10, No. 18, which is incorporated herein by reference). In one embodiment, the promoter is a CMV promoter. In another embodiment, the promoter is a TBG promoter. In another embodiment, a CB7 promoter or a CAG promoter is used. CB7 is a chicken β-actin promoter with a cytomegalovirus enhancer element. Alternatively, other liver-specific promoters can be used [see, e.g., The Liver Specific Gene Promoter Database, Cold Spring Harbor, rulai.schl.edu / LSPD, alpha-1 antitrypsin (A1AT); human albumin, Miyatake et al., Journal of Virology, 71:512432 (1997), humAlb; and hepatitis B virus core promoter, Sandig et al., Gene Therapy, 3:10029 (1996)]. TTR minimal enhancer / promoter, alpha-antitrypsin promoter, LSP (845nt) 25 (requires intronless scAAV).

[0138] One or more promoters can be selected from different sources, such as human cytomegalovirus (CMV) immediate early enhancer / promoter, SV40 early enhancer / promoter, JC polyoma virus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoter, herpes simplex virus (HSV-1) latency-associated promoter (LAP), Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet-derived growth factor (PDGF) promoter, hSYN, melanin concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP) and chicken β-actin promoter.

[0139] The expression cassette may contain at least one enhancer, namely the CMV enhancer. Other enhancer elements may include, for example, apolipoprotein enhancers, zebrafish enhancers, GFAP enhancer elements, and brain-specific enhancers (as described in WO 2013 / 1555222), post-transcriptional regulatory elements after woodchuck hepatitis. Additionally or alternatively, others may be selected, such as hybrid human cytomegalovirus (HCMV) immediate early (IE)-PDGR promoter or other promoter-enhancer elements. Other enhancer sequences suitable for use herein include the IRBP enhancer (Nicoud 2007, Journal of Gene Medicine December 2007; 9(12): 1015-23), an immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, a cis-acting element identified in a mouse proximal promoter, and the like.

[0140] In addition to the promoter, the expression cassette and / or vector may also contain one or more other suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and sequences that enhance secretion of the encoded product when desired. A variety of suitable polyA are known. In one example, the polyA is rabbit beta globin, such as the 127 bp rabbit beta globin polyadenylation signal (GenBank No. V00882.1). In other embodiments, the SV40 polyA signal is selected. Other suitable polyA sequences may be selected. In certain embodiments, introns are included. One suitable intron is the chicken beta-actin intron. In one embodiment, the intron is 875 bp (GenBank No. X00182.1). In another embodiment, a chimeric intron available from Promega is used. However, other suitable introns may be selected. In one embodiment, the spacer is included so that the vector genome is approximately the same size as the native AAV vector genome (e.g., between 4.1 and 5.2 kb). In one embodiment, the spacer is included so that the vector genome is about 4.7 kb. See Wu et al., Effect of Genome Size on AAV Vector Packaging, Mol Ther. 2010 Jan; 18(1): 80-86, which is incorporated herein by reference.

[0141] The selection of these and other common vectors and regulatory elements is routine, and many such sequences are available. See, for example, Sambrook et al. and the references cited therein, e.g., pages 3.18-3.26 and 16.17-16.27, and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989. Of course, not all vectors and expression control sequences will work equally well to express all transgenes as described herein. However, one skilled in the art can select among these and other expression control sequences without departing from the scope of the present invention.

[0142] In certain embodiments, the expression cassette contains at least one miRNA target sequence as a miR-183 target sequence. In certain embodiments, the vector genome or expression cassette contains a miR-183 target sequence that includes AGTGAATTCTCACCA GTGCCATA (SEQ ID NO: 13), wherein the sequence complementary to the miR-183 seed sequence is underlined. In certain embodiments, the vector genome or expression cassette contains more than one copy (e.g., two or three copies) of a sequence that is 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence contains a sequence that is partially complementary to SEQ ID NO: 13, and thus when aligned with SEQ ID NO: 13, there are one or more mismatches. In certain embodiments, when aligned with SEQ ID NO: 13, the miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 mismatches, wherein the mismatches may be discontinuous. In certain embodiments, the miR-183 target sequence includes a region with 100% complementarity, which also includes at least 30% of the length of the miR-183 target sequence. In certain embodiments, the region with 100% complementarity includes a sequence with 100% complementarity to a miR-183 seed sequence. In certain embodiments, the remainder of the miR-183 target sequence has at least about 80% to about 99% complementarity with miR-183. In certain embodiments, the expression cassette or vector genome includes a miR-183 target sequence, which includes a truncated SEQ ID NO: 13, i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides at either or both ends of the 5' end or 3' end of SEQ ID NO: 13. In certain embodiments, the expression cassette or vector genome includes a transgene and a miR-183 target sequence. In yet other embodiments, the expression cassette or vector genome includes at least two, three or four miR-183 target sequences.

[0143] In certain embodiments, the expression cassette contains at least one miRNA target sequence as a miR-182 target sequence. In certain embodiments, the vector genome or expression cassette contains a miR-182 target sequence that includes AGTGTGAGTTTCTACCATTGCCAAA (SEQ ID NO: 14). In certain embodiments, the vector genome or expression cassette contains more than one copy (e.g., two or three copies) of a sequence that is 100% complementary to a miR-182 seed sequence. In certain embodiments, the miR-182 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to a miR-182 seed sequence. In certain embodiments, the miR-182 target sequence contains a sequence that is partially complementary to SEQ ID NO: 14, and thus when aligned with SEQ ID NO: 14, there are one or more mismatches. In certain embodiments, when aligned with SEQ ID NO: 14, the miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 mismatches, wherein the mismatches may be discontinuous. In certain embodiments, the miR-182 target sequence comprises a region having 100% complementarity, the region further comprising at least 30% of the length of the miR-182 target sequence. In certain embodiments, the region having 100% complementarity comprises a sequence having 100% complementarity with a miR-182 seed sequence. In certain embodiments, the remainder of the miR-182 target sequence has at least about 80% to about 99% complementarity with miR-182. In certain embodiments, the expression cassette or vector genome comprises a miR-182 target sequence comprising a truncated SEQ ID NO: 14, i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both of the 5' or 3' ends of SEQ ID NO: 14. In certain embodiments, the expression cassette or vector genome comprises a transgene and one miR-182 target sequence. In other embodiments, the expression cassette or vector genome comprises at least two, three, or four miR-182 target sequences.

[0144] As used herein, the term "tandem repeat sequence" refers to the presence of two or more consecutive miRNA target sequences. These miRNA target sequences can be consecutive, i.e., positioned directly one after the other, such that the 3' end of one target sequence is directly upstream of the 5' end of the next target sequence, without an intervening sequence, or vice versa. In another embodiment, two or more miRNA target sequences in a miRNA target sequence are separated by a short spacer sequence.

[0145] As used herein, "spacer" is any selected nucleic acid sequence, for example, a nucleic acid sequence positioned between two or more continuous miRNA target sequences of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length. In certain embodiments, the length of the spacer is 1 to 8 nucleotides, 2 to 7 nucleotides in length, 3 to 6 nucleotides in length, four nucleotides, 4 to 9 nucleotides, 3 to 7 nucleotides or a larger value in length. Suitably, the spacer is a non-coding sequence. In certain embodiments, the spacer can have four (4) nucleotides. In certain embodiments, the spacer is GGAT. In certain embodiments, the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC.

[0146] In certain embodiments, the tandem repeat sequence contains two, three, four or more of the same miRNA target sequence. In certain embodiments, the tandem repeat sequence contains at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, etc. In certain embodiments, the tandem repeat sequence may contain two or three of the same miRNA target sequence and a different fourth miRNA target sequence.

[0147] In certain embodiments, at least two different sets of tandem repeat sequences may be present in the expression cassette. For example, the 3'UTR may contain a tandem repeat sequence immediately downstream of the transgene, a UTR sequence, and two or more tandem repeat sequences closer to the 3' end of the UTR. In another example, the 5'UTR may contain one, two or more miRNA target sequences. In another example, the 3' may contain a tandem repeat sequence and the 5'UTR may contain at least one miRNA target sequence.

[0148] In certain embodiments, the expression cassette contains two, three, four or more tandem repeats that begin within about 0 to 20 nucleotides of the stop codon of the transgene. In other embodiments, the expression cassette contains a miRNA tandem repeat that is at least 100 to about 4000 nucleotides from the stop codon of the transgene.

[0149] See PCT / US19 / 67872, filed December 20, 2019, which is incorporated herein by reference and claims priority to U.S. Provisional Patent Application No. 62 / 783,956, filed December 21, 2018, which is incorporated herein by reference.

[0150] In another embodiment, a method for producing a recombinant adeno-associated virus is provided. Suitable recombinant adeno-associated viruses (AAV) are produced by culturing host cells, which contain nucleic acid sequences encoding AAV capsid proteins or fragments thereof as described herein; functional rep genes; minigenes consisting of at least AAV inverted terminal repeats (ITRs) and heterologous nucleic acid sequences encoding desired transgenes; and sufficient auxiliary functions that allow minigenes to be packaged into AAV capsid proteins. Components required for culturing in host cells to package AAV minigenes into AAV capsids can be provided to host cells in trans form. Alternatively, any one or more of the required components (e.g., minigenes, rep sequences, cap sequences, and / or auxiliary functions) can be provided by stabilizing host cells, which have been engineered to contain one or more of the required components using methods known to those skilled in the art. Thus, methods for producing capsids, their coding sequences, and methods for producing rAAV viral vectors have been described. See, e.g., Gao et al., Proc. Natl. Acad. Sci. USA 100(10), 6081-6086 (2003) and US 2013 / 0045186A1, which are incorporated herein by reference.

[0151] Also provided herein is a host cell transduced with rAAV as described herein. Most preferably, such stable host cells will contain the desired components under the control of an inducible promoter. However, the desired components may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided in the discussion of regulatory elements suitable for transgenes below. In another alternative, the selected stable host cell may contain selected components under the control of a constitutive promoter and other selected components under the control of one or more inducible promoters. For example, a stable host cell can be produced, the host cell being derived from 293 cells (which contain E1 auxiliary functions under the control of a constitutive promoter), but containing rep and / or cap proteins under the control of an inducible promoter. Other stable host cells may be produced by those skilled in the art. In another embodiment, the host cell comprises a nucleic acid molecule as described herein. In certain embodiments, the novel vector has an increased yield (i.e., a higher yield) compared to known capsids. For example, compared to AAV1 and AAV6, the yield of the AAVrh.91 vector indicates an increased yield.

[0152] The minigenes, rep sequences, cap sequences and auxiliary functions required for producing the rAAV described herein can be delivered to the packaging host cell in the form of any genetic element that transfers the sequences carried thereon. The selected genetic elements can be delivered by any suitable method, including the methods described herein. The methods for constructing any embodiment of the present invention are known to nucleic acid manipulation technicians and include genetic engineering, recombinant engineering and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for producing rAAV virions are well known and the selection of suitable methods is not a limitation of the present invention. See, for example, K. Fisher et al., 1993, Journal of Virology (J. Virol.), 70: 520-532 and U.S. Patent No. 5,478,745, etc. These publications are incorporated herein by reference. Plasmids for producing the vectors described herein are also provided herein.

[0153] C. Pharmaceutical Compositions and Administration

[0154] In one embodiment, the contamination of a recombinant AAV containing the desired transgene and promoter for target cells as described in detail above is optionally assessed by conventional methods, and then formulated into a pharmaceutical composition intended to be administered to a subject in need thereof. Such formulations involve the use of pharmaceutically and / or physiologically acceptable vehicles or carriers, such as buffered saline or other buffers, such as HEPES, to maintain pH at an appropriate physiological level, and optionally other agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will generally be a liquid. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free phosphate buffered saline. Various such known carriers are provided in U.S. Patent Publication No. 7,629,322, which is incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is a balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored for a long time, it can be frozen in the presence of glycerol or Tween20. In another embodiment, the pharmaceutically acceptable carrier comprises a surfactant, such as perfluorooctane (Perfluoron liquid). The carrier is formulated in a buffer / carrier suitable for infusion into human subjects. The buffer / carrier should include ingredients that prevent the rAAV from adhering to the infusion tubing but do not interfere with the in vivo binding activity of the rAAV.

[0155] In certain embodiments of the methods described herein, the pharmaceutical composition described above is administered intramuscularly (IM) to the subject. In other embodiments, the pharmaceutical composition is administered intravenously (IV). In other embodiments, the pharmaceutical composition is administered by intracerebroventricular (ICV) injection. In other embodiments, the pharmaceutical composition is administered by intracerebellomedullary (ICM) injection. Other forms of administration that can be used for the methods described herein include, but are not limited to, direct delivery to the desired organ (e.g., eye), including subretinal or intravitreal delivery, oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parenteral administration routes. If necessary, the administration routes can be combined.

[0156] As used herein, the term "intrathecal delivery" or "intrathecal administration" refers to a route of administration by injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF). Intrathecal delivery can include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital / intracisternal and / or C1-2 puncture. For example, the material can be introduced by lumbar puncture to spread throughout the subarachnoid space. In another example, injection can be made into the cisterna magna.

[0157] As used herein, the term "intracisternal delivery" or "intracisternal administration" refers to a route of administration directly into the cerebrospinal fluid of the cisterna magna cerebellomedularis, more specifically by suboccipital puncture or by injection directly into the cisterna magna or by a permanently placed cannula.

[0158] Depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method, the composition can be delivered in a volume of about 0.1 μL to about 10 mL, including all numbers within the range. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 70 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 750 μL. In another embodiment, the volume is about 850 μL. In another embodiment, the volume is about 1000 μL. In another embodiment, the volume is about 1.5 mL. In another embodiment, the volume is about 2 mL. In another embodiment, the volume is about 2.5 mL. In another embodiment, the volume is about 3 mL. In another embodiment, the volume is about 3.5 mL. In another embodiment, the volume is about 4 mL. In another embodiment, the volume is about 5 mL. In another embodiment, the volume is about 5.5 mL. In another embodiment, the volume is about 6 mL. In another embodiment, the volume is about 6.5 mL. In another embodiment, the volume is about 7 mL. In another embodiment, the volume is about 8 mL. In another embodiment, the volume is about 8.5 mL. In another embodiment, the volume is about 9 mL. In another embodiment, the volume is about 9.5 mL. In another embodiment, the volume is about 10 mL.

[0159] The effective concentration of the recombinant adeno-associated virus carrying the nucleic acid sequence encoding the desired transgene under the control of regulatory sequences is ideally about 10 7 Up to 10 14In one embodiment, the rAAV vector genome is measured by real-time PCR. In another embodiment, the rAAV vector genome is measured by digital PCR. See Lock et al., Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR, Hum Gene Ther Methods. 2014 Apr;25(2):115-25. doi:10.1089 / hgtb.2013.131. Epub 2014 Feb 14, which is incorporated herein by reference. In another embodiment, rAAV infectious units are measured as described in SK McLaughlin et al., 1988 J. Virol., 62:1963, which is incorporated herein by reference.

[0160] Preferably, the concentration is about 1.5×10 9 vg / mL to about 1.5×10 13 vg / mL, and more preferably about 1.5×10 9 vg / mL to about 1.5×10 11 In one embodiment, the effective concentration is about 1.4×10 8 In one embodiment, the effective concentration is about 3.5×10 10 In another embodiment, the effective concentration is about 5.6×10 11 In another embodiment, the effective concentration is about 5.3×10 12 In another embodiment, the effective concentration is about 1.5×10 12 In another embodiment, the effective concentration is about 1.5×10 13 vg / mL. All ranges described herein are inclusive.

[0161] In one embodiment, the dose is about 1.5×10 9 vg / kg body weight is about 1.5×10 13 vg / kg, and more preferably about 1.5×10 9 vg / kg to about 1.5×10 11vg / kg. In one embodiment, the dose is about 1.4×10 8 vg / kg. In one embodiment, the dose is about 3.5×10 10 In another embodiment, the dose is about 5.6×10 11 In another embodiment, the dose is about 5.3×10 12 In another embodiment, the dose is about 1.5×10 12 In another embodiment, the dose is about 1.5×10 13 In another embodiment, the dose is about 3.0×10 13 In another embodiment, the dose is about 1.0×10 14 vg / kg. All ranges described herein are inclusive.

[0162] In one embodiment, the effective dose (total genome copies delivered) is about 10 7 Up to 10 13 In one embodiment, the total dose is about 10 8 In one embodiment, the total dose is about 10 9 In one embodiment, the total dose is about 10 10 In one embodiment, the total dose is about 10 11 In one embodiment, the total dose is about 10 12 In one embodiment, the total dose is about 10 13 In one embodiment, the total dose is about 10 14 In one embodiment, the total dose is about 10 15 genome copies.

[0163] It is desirable to utilize the lowest effective viral concentration in order to reduce the risk of undesirable effects (e.g., toxicity). Other doses and administration volumes within these ranges may be selected by the attending physician taking into account the physical state of the subject (preferably a human) being treated, the age of the subject, the particular condition, and the degree of progression of the condition (if progressive). For example, intravenous delivery may require about 1.5×10 13 vg / kg dose.

[0164] D. Method

[0165] On the other hand, a method for transducing a target cell or tissue is provided. In one embodiment, the method includes administering an AAV having an AAVrh.91 capsid as described herein. As shown in the following examples, the inventors have demonstrated that an AAV called AAVrh.91 effectively transduces cardiac (smooth muscle), CNS cells, and skeletal (striated) muscle. In certain embodiments, the method includes systemic administration of an AAVrh.91 vector. In certain embodiments, the AAVrh.91 vector is delivered via an administration route suitable for targeting a specific cell or tissue type.

[0166] In certain embodiments, provided herein is a method for transducing CNS cells (e.g., one or more of neurons, endothelial cells, glial cells, and ependymal cells), comprising administering rAAV with an AAVrh.91 capsid. In one embodiment, intravenous administration is used. In another embodiment, ICV administration is used. In another embodiment, ICM administration is used. In certain embodiments, provided herein is a method for delivering a transgene to a CNS cell, the CNS including but not limited to any one of the spinal cord, hippocampus, motor cortex, cerebellum, and motor neurons. The method comprises contacting a cell with an rAAV with an AAVrh.91 capsid, wherein the rAAV comprises a transgene. On the other hand, a use of an rAAV with an AAVrh.91 capsid is provided for delivering a transgene to the CNS.

[0167] As discussed herein, vectors comprising the AAV capsids described herein are capable of transducing cardiac tissue at high levels. A method for delivering a transgene to a cardiac cell is provided herein. The method comprises contacting a cardiac cell with an rAAV having an AAVrh.91 capsid, wherein the rAAV comprises a transgene. On the other hand, the use of an rAAV having an AAVrh.91 capsid is provided for delivering a transgene to the heart. In certain embodiments, the method for delivering a transgene to a cardiac cell comprises systemic delivery (e.g., IV administration) of a rAVV having an AAVrh.91 capsid.

[0168] In certain embodiments, a method for transducing skeletal muscle is provided herein, comprising administering an rAAV with an AAVrh.91 capsid. In certain embodiments, the method comprises delivering the AAVrh.91 capsid to skeletal (striated) muscle. In certain embodiments, a method for delivering a transgene to skeletal muscle is provided. The method comprises contacting skeletal muscle with an rAAV with an AAVrh.91 capsid, wherein the rAAV comprises a transgene. In certain embodiments, the method for delivering a transgene to skeletal muscle comprises systemic delivery (e.g., IV administration) of an rAVV with an AAVrh.91 capsid.

[0169] Single genome amplification

[0170] The AAV genome is traditionally separated from whole mammalian genomic DNA using a PCR-based method: primers are used to detect conserved regions on both sides of most different VP1 (capsid) genes. The PCR product is then cloned into the plasmid backbone and the individual clones are sequenced using the Sanger method. Traditional viral isolation methods based on PCR and molecular cloning are effective for recovering new AAV genomes, but the recovered genomes may be affected by PCR-mediated recombination and polymerase errors. In addition, compared with the previously used Sanger technology, the currently available next-generation sequencing technology allows us to sequence viral genomes with unprecedented accuracy. This article provides a new, higher throughput, PCR-based and next-generation sequencing method for accurately separating a single AAV genome from a viral population. This method, AAV-single genome amplification (AAV-SGA) can be used to improve our understanding of AAV diversity in mammalian hosts. In addition, it allows us to identify novel capsids suitable for vectors used as gene therapy.

[0171] AAV-SGA has been validated and optimized to efficiently recover single AAV sequences from samples containing a population of genomes. This technique has been previously used to isolate single HIV and HCV genomes from human and non-human primate hosts. End-point dilutions were performed on genomic DNA samples that were AAV-positive by capsid detection PCR. Dilutions that yielded less than 30% positive reactions by PCR amplification contained a single amplifiable AAV genome according to a Poisson distribution (with 80% confidence). This procedure allows for PCR amplification of viral genomes, reducing the chance of PCR-mediated recombination caused by template switching by the polymerase. AAV-SGA PCR amplicons were sequenced using the Illumina MiSeq platform using either 2×150 or 2×250 paired-end sequencing. This approach allows for accurate de novo assembly of full-length AAV VP1 sequences without concern for convergence of sequencing reads from a single sample containing multiple viruses with regions of high homology.

[0172] The AAV-SGA technique has successfully isolated multiple novel AAV capsid sequences from rhesus macaque tissues. Multiple viruses from different AAV clades have been identified from a single sample; this suggests that a population of AAVs can exist in host tissues. For example, capsids with sequence similarity to clade D, E, and peripheral “edge” viruses were isolated from a single liver tissue sample.

[0173] The application of SGA to AAV discovery has not been described previously. The described approach addresses the issues of template switching and polymerase errors that can result in invalid AAV genomic sequences. Furthermore, when identical sequences are recovered repeatedly from the same host sample as a single isolate, the quality of the isolated genome speaks for itself.

[0174] The following examples are provided to illustrate various embodiments of the present invention. The examples are not intended to limit the present invention in any way.

[0175] E. Examples

[0176] Example 1: Materials and Methods

[0177] Detection and isolation of AAV sequences

[0178] Nonhuman primate tissue sources

[0179] Rhesus macaques from the Penn colony were captive-bred and originated from China or India. Rhesus macaque liver tissue samples were kindly provided by the Gene Therapy Program and Timothy H. Lucas Laboratory at the University of Pennsylvania.

[0180] Novel AAV isolation

[0181] Genomic DNA was extracted (QIAmpDNAMiniKit, QIAGEN) and analyzed for the presence of AAV DNA by amplifying a 3.1-kb full-length Cap fragment from NHP liver tissue specimens using a PCR strategy. A 5′ primer (AV1NS, 5′-GCTGCGTCAACTGGACCAATGAGAAC-3′) (SEQ ID NO: 9) within the conserved region of the AAV Rep gene was combined with a 3′ primer (AV2CAS, 5′-CGCAGAGACCAAAGTTCAACTGAAACGA-3′) (SEQ ID NO: 10) located in the conserved region downstream of the AAV Cap to amplify the gene of the full-length AAV Cap amplicon. Q5 High-Fidelity Hot Start DNA polymerase (New England Biolabs) was used to amplify AAV DNA using the following cycling conditions: 98°C for 30 s; 98°C for 10 s, 59°C for 10 s, 72°C for 93 s, 50 cycles; and 72°C extension for 120 s.

[0182] AAV-single genome amplification (AAV-SGA) was performed on template genomic DNA samples that were positive for PCR reactions. Endpoint dilutions were performed on genomic DNA in a 96-well plate so that less than 29 of the 96 PCR reactions using the same primers described above produced amplified products. According to the Poisson distribution, DNA dilutions that produced PCR products in no more than 30% of the wells contained an amplifiable AAV DNA template for each positive PCR more than 80% of the time. AAV DNA amplicons from positive PCR reactions were sequenced using the Illumina MiSeq 2×150 or 2×250 paired-end sequencing platform, and the resulting reads were assembled de novo using the SPAdes assembly program (cab.spbu.ru / software / spades). Sequence analysis was performed using NCBI BLASTn (blast.ncbi.nlm.nih.gov) and Vector NTI AlignX software (Thermo Fisher).

[0183] Vector production using novel AAV capsids

[0184] The AAV capsid gene DNA sequence from the PCR product of interest was TOPO cloned and amplified (Invitrogen). The amplified capsid gene was further cloned into the AAV transplasmid backbone containing the AAV2 Rep gene and other relevant plasmid elements.

[0185] AAV vectors were produced and titrated by Penn Vector Core as described previously (see, e.g., Lock, M. et al. (2010) Hum. Gene Ther. 21: 1259-71). HEK293 cells were transfected three times, and the cell culture supernatant was collected, concentrated, and purified using an iodixanol gradient. The purified vectors were titrated by droplet digital PCR using primers against rabbit β-globin polyA sequences as described previously (see, e.g., Lock, M. et al. (2014) Hum. Gene Ther. Methods 25: 115-125).

[0186] In vivo characterization of novel AAV capsids in rodents

[0187] animal

[0188] All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. C56BL / 6J mice were purchased from Jackson Laboratory. For GFP reporter gene experiments, adult (6-8 weeks old) males were injected. Animals were housed in standard cages with two to five animals per cage. Cages, water bottles, and bedding substrates were autoclaved in a barrier facility, and cages were changed once a week. An automatically controlled 12-hour light-dark cycle was maintained. Each dark period started at 7:00 p.m. (± 30 minutes). Irradiated laboratory rodent food was provided ad libitum.

[0189] Test articles and study design

[0190] Mice received 1×10 12 Each carrier of GC, or 1×10 11 A 5 μL dose of GC was injected intracerebroventricularly (ICV) into the lateral ventricle of the brain. Three or five mice were dosed per group.

[0191] Mice were euthanized by CO2 inhalation 14 days after injection. Tissues were collected and snap-frozen on dry ice for biodistribution analysis or immersion-fixed in 10% neutral formalin, cryopreserved in sucrose, frozen in OCT, and sectioned with a cryostat for direct visualization of GFP. Tissues for endothelial cell transduction analysis were paraffin-embedded after necropsy.

[0192] Vector biodistribution

[0193] Tissue genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN), and the AAV vector genome was quantified by real-time PCR using Taqman reagents (Applied Biosystems, Life Technologies) with primers / probes targeting the EGFP sequence of the vector.

[0194] Reporter gene visualization

[0195] To observe direct GFP fluorescence, tissue samples were fixed in formalin for approximately 24 hours, briefly washed in PBS, equilibrated in PBS containing 15% and 30% sucrose until maximum density was reached, and then frozen in OCT embedding medium to prepare cryosections. Sections were mounted in Fluoromount G containing DAPI (Electron Microscopy Sciences, Hatfield, PA) as a nuclear counterstain.

[0196] GFP immunohistochemistry was performed on paraffin-embedded tissue samples. The sections were dewaxed with ethanol and xylene, boiled in 10 mM citrate buffer (pH 6.0) for 6 minutes for antigen retrieval, treated with 2% H2O2 for 15 minutes, treated with avidin / biotin blocking reagent for 15 minutes each (Vector Laboratories), and treated with blocking buffer (PBS + 0.2% Triton containing 1% donkey serum) for 10 minutes. Then they were incubated with primary antibodies for 1 hour and incubated with biotin-labeled secondary antibodies in blocking buffer for 45 minutes (Jackson Immunoresearch). Endothelial cells were labeled using primary antibodies chicken anti-GFP (Abcam ab13970) and rabbit anti-CD31 (Abcam ab28364). The bound antibodies were visualized as brown precipitates using the VectastainEliteABC kit (Vector Laboratories) according to the manufacturer's instructions, with DAB as the substrate.

[0197] For immunofluorescence, paraffin sections were dewaxed and blocked for 15 min after antigen retrieval with 1% donkey serum in PBS + 0.2% Triton, followed by sequential incubation with primary (1 h) and fluorescently labeled secondary antibodies (45 min, Jackson Immunoresearch) diluted in blocking buffer. The antibodies used were chicken anti-GFP (Abcam ab13970), rabbit anti-CD31 (Abcam ab28364), and mouse anti-NF-200 (clone RT97, Millipore CBL212). The primary antibodies were mixed together, and GFP and NF-200 antibodies were detected by FITC- and TRITC-labeled secondary antibodies, respectively. VectaFluor TM Excel Amplified The 488Anti-Rabbit IgG kit enhances the signal of the rabbit antibody against CD31. Fluorescence and brightfield microscopy images were taken with a Nikon Eclipse TiE microscope.

[0198] Evaluation of transduction of barcoded vectors into non-human primates

[0199] Test articles and study design

[0200] Five novel capsids and five control capsids (AAVrh.90, AAVrh.91, AAVrh.92, AAVrh.93, AAVrh.91.93, AAV8, AAV6.2, AAVrh32.33, AAV7, and AAV9) were used to package the modified ATG-depleted self-complementary eGFP (dGFP) transgene. Each unique capsid preparation contained the dGFP transgene with a corresponding unique 6 bp barcode preceding the polyadenylation sequence of the vector genome. The transgene contained the CB8 promoter and the SV40 polyadenylation sequence (AAVsc.CB8.dGFP.barcode.SV40). AAV vectors were produced and titered by the Penn Vector Core as previously described (see, e.g., Lock, M. et al. (2010) Hum. Gene Ther. 21: 1259-71). HEK293 cells were transfected three times, and then the cell culture supernatant was collected, concentrated, and purified using an iodixanol gradient. The purified vector was titrated by droplet digital PCR using primers targeting the SV40 polyA sequence as described previously (see, e.g., Lock, M. et al. (2014) Hum. Gene Ther. Methods 25: 115-25).

[0201] Ten purified vectors were pooled at equal genomic copy numbers for injection into two different animals: a total dose of 2e13 GC / kg was delivered by IV delivery, and a total dose of 3e13 GC / animal was delivered to the intrathecal space by intracisternal (ICM) delivery. Animals were sacrificed 30 days after injection, and all tissues were collected in RNAlater (QIAGEN) for downstream transgene RNA expression analysis.

[0202] animal

[0203] All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Macaques (Macaca fascicularis) were donated by Bristol Meyers Squibb (USA). Animals were housed in stainless steel squeeze back cages at the Association for Assessment and Accreditation of Laboratory Animal Care-accredited Nonhuman Primate Research Program facility at the Children's Hospital of Philadelphia, Philadelphia, Pennsylvania. Animals received a variety of enrichment activities such as food treats, visual and auditory stimulation, manipulation, and social interaction.

[0204] A 10-year-old male 8 kg animal was used for the ICM study. A 6-year-old male 6.98 kg animal was used for the IV study. This animal was screened for the presence of AAV neutralizing antibodies and was seronegative for AAV6, AAV8, and AAVrh32.33 at baseline. At baseline, this animal had neutralizing antibody titers of 1:5 and 1:10 against AAV7 and AAV9, respectively.

[0205] ICM Injection Procedure

[0206] The anesthetized macaque is placed on an X-ray table in a lateral position, with the head bent forward. Using aseptic technique, 21G-27G, 1 to 1.5 inch Quincke spinal needle (Becton Dickinson, Franklin Lakes, NJ, USA) is advanced to the suboccipital space until CSF flow is observed. Collect 1mL CSF for baseline analysis. The correct placement of the needle is verified by fluoroscopy (OEC9800C-arm; GE Healthcare, Little Chalfont, UK) to avoid potential brainstem damage. After CSF collection, Luer access extension device or small-caliber T-port extension device catheter is connected to the spinal needle to promote the administration of 180mg / mL iohexol contrast agent (GE Healthcare, Little Chalfont, UK). After verifying the needle position, a syringe (volume equal to 1mL plus syringe volume and joint dead zone) equipped with the test article is connected to a flexible joint and injected for 30 ± 5 seconds. Remove the needle, and directly apply pressure to the puncture site.

[0207] IV Injection Procedure

[0208] 10 mL of vehicle test article was administered into a peripheral vein of cynomolgus monkeys at a rate of 1 mL / min via an infusion pump (Harvard Apparatus, Holliston, MA).

[0209] Transgene expression analysis

[0210] Total tissue RNA was extracted from all RNALater treated tissues using TRIzol according to the manufacturer's instructions (Life Technologies). The extracted RNA was treated with DNase I according to the manufacturer's protocol (Roche, Basel, Switzerland). RNA was purified using the RNeasy Mini Kit (QIAGEN). Reverse transcription synthesis of cDNA was performed using the Applied Biosystems High Capacity cDNA Reverse Transcriptase Kit (Life Technologies). Primers targeting regions on both sides of the 6 bp unique barcode were used to PCR amplify the 117 bp amplicon (forward primer: GGCGAACAGCGGACACCGATATGAA (SEQ ID NO: 11), reverse primer: GGCTCTCGTCGCGTGAGAATGAGAA (SEQ ID NO: 12)), and Q5 High-Fidelity Hot Start DNA polymerase (New England Biolabs) was used to react using the following cycling conditions: 98°C for 30 s; 98°C for 10 s, 72°C for 17 s, 25 cycles; and 72°C extension for 120 s. The amplicons were sequenced using the MiSeq Standard 2×150 bp sequencing platform (Illumina).

[0211] Barcode reads were analyzed using the fastq-join program from the Expression Analysis package (github.com / ExpressionAnalysis / ea-utils), cutadapt (cutadapt.readthedocs.io / en / stable / ), the fastx toolkit (hannonlab.cshl.edu / fastx_toolkit / ), and R version 3.3.1. (cran.r-project.org / bin / windows / base / old / 3.3.1 / ). Barcode expression count data from tissue samples were normalized to barcode counts from sequenced injected vector material from each animal, and the barcode ratio from each tissue sample was plotted using GraphPad Prism version 7.04.

[0212] Characterization of ICMAAVrh91 transduction in NHPs

[0213] Animals and study design

[0214] All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Six adult rhesus monkeys (Macaca mulatta) were obtained from OrientBiolosources (Alice, TX) through PreLabs. Animals were housed in stainless steel squeeze-back cages at the Association for Assessment and Accreditation of Laboratory Animal Care-accredited Nonhuman Primate Research Program facility at the Children's Hospital of Philadelphia in Philadelphia, Pennsylvania. Animals received a variety of enrichment activities such as food treats, visual and auditory stimulation, manipulation, and social interaction.

[0215] AAVrh91, AAV1, and AAV9 capsids were packaged with the AAV.CB7.CI.eGFP.WPRE.rBG transgene using previously described methods (see, e.g., Lock, M. et al. (2010) Hum. Gene Ther. 21: 1259-71 and Lock, M. et al. (2014) Hum. Gene Ther. Methods 25: 115-25). A dose of 1.557e13 GC was injected ICM into each animal. The ICM injection method is described above. Animals were sacrificed 28-31 days after injection and tissues were collected on dry ice for DNA vector biodistribution studies. During nonclinical general toxicity studies, whole brains were collected, trimmed, and sliced ​​using brain molds according to recommended practices for sampling and processing of the nervous system (brain, spinal cord, nerves, and eyes). Pardo et al. (2012). STP Position Paper. Tissues were also collected, fixed in formalin, and embedded in paraffin for histopathological analysis.

[0216] Histological analysis of vector transduction

[0217] For GFP immunohistochemistry (IHC), sections were dewaxed with ethanol and xylene, boiled in 10 mM citrate buffer (pH 6.0) for 6 minutes for antigen retrieval, treated with 2% H2O2 for 15 minutes, treated with avidin / biotin blocking reagent for 15 minutes each (Vector Laboratories), and treated with blocking buffer (PBS + 0.2% Triton containing 1% donkey serum) for 10 minutes. They were then incubated with anti-GFP goat antibody (Novus Biologicals, NB100-1770, 1:500) at 4°C in blocking buffer overnight, and after washing in PBS, incubated with biotin-labeled secondary anti-goat antibody in blocking buffer for 45 minutes (Jackson ImmunoResearch, 1:500). After washing in PBS, the bound antibody was visualized as a brown precipitate using the Vectastain Elite ABC kit (Vector Laboratories) according to the manufacturer's instructions with DAB as substrate.

[0218] For immunofluorescence (IF), paraffin sections were similarly pretreated, but without H2O2 and avidin / biotin blocking. The following primary antibodies were combined and sections were incubated for 1 hour at 37°C: goat anti-GFP (Novus Biologicals, NB100-1770; 1:300-500), guinea pig anti-NeuN (Millipore, ABN90; 1:500), chicken anti-GFAP (Abcam, ab4674; 1:1000). After washing in PBS, sections were incubated with fluorescent dye-labeled secondary antibodies (FITC anti-goat, Cy5 anti-guinea pig, TRITC anti-GFAP; Jackson ImmunoResearch, 1 hour at room temperature, 1:200). After washing in PBS, sections were mounted in Fluoromount G containing DAPI (Electron Microscopy Sciences) to counterstain nuclei.

[0219] Vector biodistribution analysis

[0220] Tissue genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN), and the AAV vector genome was quantified by real-time PCR using Taqman reagents (Applied Biosystems, Life Technologies) with primers / probes targeting the EGFP sequence of the vector.

[0221] Quantitative analysis of cell transduction in central nervous system tissue (CNS)

[0222] IF slides were prepared as described above and scanned using the Aperio VERSA scanning system. The entire slide was first scanned at low magnification (1.25×) to identify the region of interest. After the initial 1.25× scan, the slide was scanned at 20× magnification using four different channels, DAPI, FITC, TRITC, and Cy5. Transduced neurons and astrocytes were quantified from the final 20× scan using the co-staining detection algorithm developed with Visiopharm Image Analysis Software v.2019.07.

[0223] Mass spectrometry (MS) analysis of amino acid modifications on AAV capsid

[0224] Reagents

[0225] Ammonium bicarbonate, dithiothreitol (DTT), and iodoacetamide (IAM) were purchased from Sigma (St. Louis, MO). Acetonitrile, formic acid and trifluoroacetic acid (TFA), 8 M guanidine hydrochloride (GndHCl), and trypsin were purchased from Thermo Fisher Scientific (Rockford, IL).

[0226] Trypsin digestion

[0227] Prepare a stock solution of 1M DTT and 1.0M iodoacetamide. Denature the capsid protein and reduce it at 90°C for 10 minutes in the presence of 10mM DTT and 2M GndHCl. Allow the sample to cool to room temperature and then alkylate it with 30mM IAM for 30 minutes at room temperature in the dark. Quench the alkylation reaction by adding 1mL DTT. Add 20mM ammonium bicarbonate, pH 7.5-8, to the denatured protein solution in a volume that dilutes the final GndHCl concentration to 200mM. Add trypsin solution to a ratio of 1:20 trypsin to protein and incubate at 37°C for 4 hours. After digestion, add TFA to the final 0.5% to quench the digestion reaction.

[0228] LC-MS / MS

[0229] Online chromatography was performed using an Acclaim PepMap column (15 cm long, 300 μm inner diameter) and a Thermo UltiMate 3000RSLC system (Thermo Fisher Scientific) coupled to a Q ExactiveHF (Thermo Fisher Scientific) with a NanoFlex source. During online analysis, the column temperature was adjusted to 35°C. Peptides were separated using a gradient of mobile phase A (MilliQ water containing 0.1% formic acid) and mobile phase B (acetonitrile containing 0.1% formic acid). The gradient ran from 4% B to 6% B in 15 minutes, followed by 10% B in 25 minutes (40 minutes total), followed by 30% B in 46 minutes (86 minutes total). The sample was loaded directly onto the column. The column dimensions were 75 cm×15 um ID and were loaded with 2 microns of C18 medium (Acclaim PepMap). The total time for the LC-MS / MS run was approximately 2 hours due to the loading, introduction, and wash steps.

[0230] MS data were acquired using a data-dependent top 20 method for Q Exactive HF that dynamically selected the most abundant precursor ions that had not yet been sequenced from survey scans (200-2000 m / z). Sequencing was performed by high-energy collisional dissociation fragmentation with a target value of 1e5 ions determined by predictive automatic gain control and precursor separation with a window of 4 m / z. Survey scans were acquired at a resolution of 120,000 at m / z 200. The resolution of the HCD spectrum was set to 30,000 at m / z 200 with a maximum ion injection time of 50 milliseconds and a normalized collision energy of 30. The S-lens RF level was set to 50 to achieve optimal transmission in the m / z region occupied by the peptides from our digestion. Precursor ions with single, unassigned, or six and higher charge states were excluded from the fragmentation selection.

[0231] Data processing

[0232] BioPharma Finder 1.0 software (Thermo Fisher Scientific) is used to analyze all the data obtained. For peptide mapping, a single entry protein FASTA database is used for searching, wherein carbamidomethylation is set as a fixed modification; and oxidation, deamidation, and phosphorylation are set as variable modifications, 10ppm mass accuracy, high protease specificity, and MS / MS spectra with a confidence level of 0.8. The percentage modification of the peptide is determined by dividing the mass area of ​​the modified peptide by the sum of the areas of the modified peptide and the native peptide. Considering the number of possible modification sites, isobaric substances modified at different sites can co-migrate in a single peak. Therefore, fragment ions derived from peptides with multiple potential modification sites can be used to locate or distinguish multiple modification sites. In these cases, the relative intensity within the observed isotope pattern can be used to specifically determine the relative abundance of different modified peptide isomers. This method assumes that the fragmentation efficiency of all isomeric species is the same and is independent on the modification site. This method allows the definition of specific modification sites and the potential combinations involved.

[0233] Example 2: AAV-SGA

[0234] Adeno-associated virus (AAV) is a small, single-stranded DNA virus that is non-pathogenic and poorly immunogenic, making it an attractive candidate vector for gene therapy. Since the discovery of the first generation of AAVs (AAV1-6), our laboratory has worked to isolate large quantities of the virus from a variety of higher primate species. The second generation AAVs identified here were isolated using a bulk PCR-based technique that employs primers targeting conserved regions of the primate-derived AAV genome. We used AAV-SGA to explore the genetic variation of AAV in its natural mammalian hosts ( Figure 1 ).

[0235] AAV-SGA is a powerful technique that can be used to isolate single viral genomes from mixed populations with high precision. In this study, we used AAV-SGA to identify novel AAV genomes from rhesus macaque tissue specimens. The novel viral isolates were genetically diverse and could be classified into clades D, E, and marginal clades ( Figure 2 ).

[0236] The novel capsid and previously identified capsids were used to generate vectors containing the enhanced GFP (eGFP) gene. Figure 5A ) and intracerebroventricular (ICV) ( Figure 5C ) Delivery route Vectors with various capsids were tested in mice. The biodistribution of the vector genome was analyzed in heart, skeletal muscle, liver, and brain tissues ( Figure 5B and Figure 5D). Our mouse studies showed that novel capsids generally exhibited clade-specific transduction patterns (with the exception of clade D capsids). For AAV6.2 and AAVrh.91, analysis of the cerebellum and ventricles / choroid plexus revealed transduction after ICV delivery, although the eGFP detection patterns differed. IV delivery of clade A members resulted in high levels of transduction in heart, brain, and muscle tissues.

[0237] Additional studies were performed to evaluate transduction of muscle tissue following IM delivery. Fig. 6A ) or mAb were delivered IM and transgene expression was analyzed by myofiber staining (for LacZ) or detection in serum (for mAb). Figure 6B Comparison of muscle transduction by detection of LacZ is shown. Clade A vector AAVrh.91 efficiently transduced myofibers (darker staining). IM delivery by AAVrh.91 also resulted in high levels of detectable mAbs in serum ( Figure 7 ). Figure 8 Yields of various preparations of mAb and LacZ vector are shown. For both transgenes, AAVrh.91 had higher yields compared to AAV1 and AAV6.

[0238] Example 3: Transduction evaluation of novel AAV natural isolates in non-human primates using a barcoded transgenic system

[0239] Adeno-associated virus (AAV) vectors have proven to be safe and effective gene transfer vehicles for clinical applications, but they can be hampered by pre-existing immunity to the virus and can have restricted tissue tropism. We demonstrate that a barcoded transgenesis approach can efficiently compare transduction of various tissues in a single animal by multiple AAV serotypes simultaneously. This technique reduces the number of animals used and prevents immune responses associated with foreign transgenes. Therefore, novel capsids and their respective prototype clade member controls (AAV6.2, AAV7, AAV8, AAVrh32.33, and AAV9) were made into vectors containing a modified eGFP transgene and a unique six-base pair barcode prior to the polyA signal of the transcript ( Fig. 9 ). The transgene was modified by deleting the ATG sequence motif to prevent polypeptide translation and subsequent immune response to the foreign protein. The vectors were pooled in equal amounts and injected IV or ICM in cynomolgus monkeys (total dose: 2e13 GC / kg IV and 3e13 GC ICM) to evaluate the systemic and CNS transduction patterns of the novel capsids. IV-injected animals were seronegative for AAV6, AAV8, and AAVrh32.33 at baseline, and had neutralizing antibody titers of 1:5 and 1:10 against AAV7 and AAV9, respectively.

[0240] like Fig. 10A As shown in , IV delivery of the clade A vector AAVrh.91 transduced peripheral organs, including lung, muscle, and heart, with higher efficiency than other capsids tested. AAVrh.91 also showed high transduction levels in NHP CNS tissues after ICM delivery ( Fig. 10C ).

[0241] Subsequent studies evaluating ICM delivery also showed improved transduction of NHP brain and spinal cord by AAVrh.91 (1409201, 1407088) compared with AAV1 (RA3654, RA3583) and AAV9 (1408266, 1409029) ( Figures 11A-11C , Fig.12 ). AAVrh.91 effectively transduced the frontal, temporal, and occipital cortices after ICM delivery. AAVrh.91 also transduced neurons and astrocytes at high levels compared to AAV9 ( Figure 13A-13C ). AAVrh.91 showed robust motor neuron transduction in the spinal cord. Interestingly, IHC staining revealed that both AAVrh.91 and AAV1 showed efficient transduction of ependymal cells lining the ventricles. Liver transduction levels of AAVrh.91 correlated with neurocortical transduction levels in each animal after ICM delivery. All vectors tested showed varying levels of vector transduction in the heart after ICM delivery. Notably, GFP expression in the heart was not associated with higher levels of brain (cortex) expression after ICM delivery, whereas high levels of liver expression were observed. Taken together, these results indicate that AAVrh.91 is an effective gene therapy vector that can be efficiently generated and effectively transduce multiple cell types in the brain and spinal cord after ICM delivery in primates.

[0242] When manufactured by a triple transfection method in HEK293 cells, AAVrh.91 produced 2-3 times more vector than its clade counterpart, AAV1 ( Fig.14A and Fig. 14B Deamidation and other modifications of the AAVrh.91 capsid were analyzed as previously described (see PCT / US19 / 019804 and PCT / US19 / 2019 / 019861). Fig.15A and Fig. 15B As shown in, the results indicate that AAVrh.91 has three highly deamidated amino acids (N57, N383, and N512), which correspond to asparagine in an asparagine-glycine pair (numbering of AAVrh.91 of SEQ ID NO: 2). Lower deamidation percentages were consistently observed in phosphorylation at residues N303, N497, and N691, as well as S149.

[0243] (Sequence Listing Free Text)

[0244] The following information is provided for sequences containing free text under the numeric identifier <223>.

[0245]

[0246] All documents cited in this specification are incorporated herein by reference. U.S. Provisional Patent Application No. 62 / 924,095 filed on October 21, 2019, U.S. Provisional Patent Application No. 62 / 913,314 filed on October 10, 2019, and U.S. Provisional Patent Application No. 62 / 840,184 filed on April 29, 2019 are incorporated by reference in their entirety together with their sequence listings. The sequence listing and the sequences and texts therein of the name "19-8901PCT2_ST25.txt" submitted herewith are incorporated by reference. Although the present invention has been described with reference to specific embodiments, it should be understood that modifications can be made without departing from the spirit of the present invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

1. A recombinant adenovirus-associated virus AAV, which has an AAV.rh91 capsid and contains a vector genome in the AAV.rh91 capsid, wherein the AAV.rh91 capsid contains a heterogeneous population of AAV.rh91 vp1 proteins represented by amino acids 1 to 736 of SEQ ID NO: 2 comprising at least 50% deamidated asparagines at positions N57, N383 and N512, a heterogeneous population of AAV.rh91 vp2 proteins represented by amino acids 138 to 736 of SEQ ID NO: 2 comprising at least 50% deamidated asparagines at positions N383 and N512, and a heterogeneous population of AAV.rh91 vp3 proteins represented by amino acids 203 to 736 of SEQ ID NO: 2 comprising at least 50% deamidated asparagines at positions N383 and N512, The percentage of deamidation was determined by mass spectrometry. The vector genome comprises a heterologous nucleic acid sequence operably linked to a regulatory sequence that directs the expression of a gene product encoded by the heterologous nucleic acid sequence in a target cell. The deamidated asparagine is aspartic acid, isoaspartic acid or a combination thereof.

2. A recombinant adeno-associated virus AAV, which has a vector genome in an AAV.rh91 capsid, wherein the AAV.rh91 capsid is composed of AAV.rh91 vp1, AAV.rh91vp2 and AAV.rh91 vp3 capsid proteins produced by a nucleotide sequence encoding amino acids 1 to 736 of SEQ ID NO: 2, and the vector genome contains a heterologous nucleic acid sequence operably linked to a regulatory sequence, wherein the regulatory sequence directs the expression of a gene product encoded by the heterologous nucleic acid sequence in a target cell.

3. The recombinant AAV according to claim 1 or 2, wherein the AAV.rh91 vp1, AAV.rh91 vp2 and AAV.rh91 vp3 capsid proteins are encoded by SEQ ID NO: 1 or 3 or a nucleotide sequence that is at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1 or 3.

4. The recombinant AAV according to claim 1 or 2, wherein the vector genome further comprises a 5'AAV ITR and a 3'AAV ITR.

5. The recombinant AAV of claim 4, wherein the 5' AAV ITR and the 3' AAV ITR are from AAV2.

6. The recombinant AAV according to claim 1 or 2, wherein (a) AAV.rh91 vp1 protein contains 65% to 90% deamidated asparagine at position N57, as determined by mass spectrometry; (b) the AAVrh.91 vp1, AAV.rh91 vp2 protein and / or AAV.rh91 vp3 protein comprises 80% to 100% deamidated asparagine at position N383 and / or N512 as determined by mass spectrometry; and / or (c) the AAVrh.91 vp1 protein, AAV.rh91 vp2 protein, and / or AAV.rh91 vp3 protein further comprises a 2% to 15% deamidated asparagine at position N94, a 2% to 15% deamidated asparagine at position N303, a 2% to 15% deamidated asparagine at position N497, or a 2% to 15% deamidated asparagine at position N691, as determined by mass spectrometry.

7. The recombinant AAV of claim 1, wherein the AAV.rh91 capsid comprises: (1) a heterogeneous population of AAVrh.91 vp1 proteins selected from the group consisting of: vp1 proteins produced by a nucleic acid sequence encoding amino acids 1 to 736 of SEQ ID NO: 2, vp1 proteins produced by SEQ ID NO: 1 or 3, or vp1 proteins produced by a nucleic acid sequence having at least 70% identity to nucleotides 1 to 2208 of SEQ ID NO: 1 or 3, wherein the nucleic acid sequence encodes amino acids 1 to 736 of SEQ ID NO: 2; A heterogeneous population of AAVrh.91 vp2 proteins selected from the group consisting of: vp2 proteins produced from a nucleic acid sequence encoding amino acids 138 to 736 of SEQ ID NO:2, vp2 proteins produced from a nucleic acid sequence comprising nucleotides 412 to 2208 of SEQ ID NO:1 or 3, or vp2 proteins produced from a nucleic acid sequence having at least 70% identity to nucleotides 412 to 2208 of SEQ ID NO:1 or 3, wherein the nucleic acid sequence encodes amino acids 138 to 736 of SEQ ID NO:2; and A heterogeneous population of AAVrh.91 vp3 proteins selected from the group consisting of: vp3 proteins produced by a nucleic acid sequence encoding amino acids 203 to 736 of SEQ ID NO:2, vp3 proteins produced by a nucleic acid sequence comprising nucleotides 607 to 2208 of SEQ ID NO:1 or 3, or vp3 proteins produced by a nucleic acid sequence having at least 70% identity to nucleotides 607 to 2208 of SEQ ID NO:1 or 3, wherein the nucleic acid sequence encodes amino acids 203 to 736 of SEQ ID NO:2; or (2) a heterogeneous population of vp1 proteins that are products of a nucleic acid sequence encoding amino acids 1 to 738 of SEQ ID NO:2, a heterogeneous population of vp2 proteins that are products of a nucleic acid sequence encoding amino acids 138 to 736 of SEQ ID NO:2, and a heterogeneous population of vp3 proteins that are products of a nucleic acid sequence encoding amino acids 203 to 736 of SEQ ID NO:2, in: The vp1, vp2 and vp3 proteins contain a subpopulation with amino acid modifications comprising at least two highly deamidated asparagines (N) in the asparagine-glycine pairs in SEQ ID NO: 2, as determined by mass spectrometry, wherein the deamidation results in an amino acid change.

8. The recombinant AAV according to claim 7, wherein the nucleic acid sequence encoding the vp1, the vp2 and the vp3 proteins is SEQ ID NO: 1 or 3, or a sequence having at least 80% identity with nucleotides 1 to 2208 of SEQ ID NO: 1 or 3, and the sequence encodes the amino acid sequence of SEQ ID NO:

2.

9. A composition comprising at least the recombinant AAV according to any one of claims 1 to 8 and a physiologically compatible carrier, buffer, adjuvant and / or diluent.

10. The composition of claim 9, wherein the composition is formulated for intrathecal delivery and the heterologous nucleic acid sequence encodes a gene product for delivery to the central nervous system.

11. The composition of claim 9, wherein the composition is formulated for intravenous delivery.

12. The composition of claim 9, wherein the composition is formulated for intranasal or intramuscular delivery.

13. The recombinant AAV according to any one of claims 1 to 8, for use in delivering a desired gene product to a subject in need thereof.

14. Use of the recombinant AAV according to any one of claims 1 to 8 or the composition according to any one of claims 9 to 12 in the preparation of a medicament.

15. A recombinant AAV production system for producing the recombinant AAV according to any one of claims 1 to 8, wherein the production system is a cell culture comprising: (a) a nucleic acid sequence encoding amino acids 1 to 736 of SEQ ID NO: 2; (b) a nucleic acid molecule suitable for packaging into said AAV capsid, said nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence encoding a gene product operably linked to a sequence directing expression of said gene product in a host cell; and (c) sufficient AAV rep and helper functions to allow packaging of the nucleic acid molecule into the recombinant AAV capsid.

16. A recombinant AAV production system according to claim 15, wherein the nucleic acid sequence of (a) comprises at least SEQ ID NO: 1 or 3, or a sequence having at least 70% identity with nucleotides 1 to 2208 of SEQ ID NO: 1 or 3, and the sequence encodes the amino acid sequence of SEQ ID NO:

2.

17. A recombinant AAV production system according to claim 15 or 16, wherein the cell culture comprises human embryonic kidney 293 cells.

18. A method for producing a recombinant AAV, comprising the steps of culturing a host cell, wherein the host cell contains: (a) a nucleic acid molecule encoding amino acids 1 to 736 of SEQ ID NO:2; (b) a functional rep gene; (c) a minigene comprising an AAV 5'ITR, an AAV 3'ITR and a transgene; and (d) sufficient helper functions to allow the minigene to be packaged into an AAV capsid.

19. A plasmid comprising a nucleic acid sequence encoding amino acids 1 to 736 of SEQ ID NO: 2 and a heterologous nucleic acid sequence.

20. The plasmid of claim 19, wherein the nucleic acid sequence encoding amino acids 1 to 736 of SEQ ID NO: 2 comprises SEQ ID NO: 1 or 3, or a sequence having at least 70% identity to nucleotides 1 to 2208 of SEQ ID NO: 1 or 3, which sequence encodes the amino acid sequence of SEQ ID NO:

2.

21. A packaging cell comprising the plasmid of claim 19 or 20.

Images