Genetically engineered coenzyme q10-producing bacteria and application thereof

Abstract

The application provides a coenzyme Q10-producing genetically engineered bacterium (Rhodobacter sphaeroides), and the preservation number is CGMCC NO.19600. The application also provides application of the coenzyme Q10-producing genetically engineered bacterium CGMCC NO.19600 in fermentative production of coenzyme Q10. The coenzyme Q10-producing genetically engineered bacterium constructed by the application can greatly improve the yield of coenzyme Q10, and has a wide industrial application prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically, it relates to a genetically engineered bacterium that produces coenzyme Q10 and its applications. Background Technology

[0002] The cell membrane is a semi-permeable membrane on the outer layer of the cell, separating the cell from its external environment. It maintains the relative stability of the intracellular environment and selectively regulates the entry and exit of substances. In addition to the cell membrane, eukaryotic cells also have membrane systems separating various organelles, including the mitochondrial membrane, chloroplast membrane, endoplasmic reticulum membrane, and nuclear membrane. These organelle membranes, along with the cell membrane, are biological membranes and serve as protective barriers for the cell, reducing the impact of external factors such as exogenous substances, temperature, pH, and osmotic pressure on the cell.

[0003] Biological membranes are mainly composed of lipids, proteins, and carbohydrates, among which glycerophospholipids are the main lipid components of cell membranes and form the basic framework of biological membranes. The synthesis of glycerophospholipids involves acyl-CoA and glycerol-3-phosphate reacting with glycerol-3-phosphate acyltransferase to form 1-monoacylglycerol-3-phosphate, which then reacts with 1-monoacylglycerol-3-phosphate acyltransferase to form 1,2-diacylglycerol-3-phosphate (phosphatidic acid). Phosphatidic acid is further catalyzed by various enzymes to synthesize various types of phospholipids. For example, in prokaryotes such as bacteria, phosphatidic acid reacts with phosphatidylcytidine transferase to form CDP-diacylglycerol, which is then further synthesized into phosphatidylglycerol by phosphatidylglycerol phosphate synthase and phosphatidylglycerol phosphatase. Phosphatidylglycerol is an important component of biological membrane phospholipids.There are numerous reports in the field of plant transgenics on improving cell tolerance through overexpression of phospholipid synthesis genes. For example, overexpression of the glycerol-3-phosphate acyltransferase gene LeGPAT in tomato can improve the cold tolerance of tomatoes (Na Sui, Meng Li, ShiJie Zhao, et al. Overexpression of glycerol-3-phosphate acyltransferase gene improves chilling tolerance intomato[J]. Planta, 2007, 226(5):1097-1108.), and overexpression of the glycerol-3-phosphate acyltransferase gene AmGPAT from Ammopiptanthus mongolicus can improve the cold resistance, freeze resistance, and antioxidant stress response of Arabidopsis (Min Xue, Ting Guo, Meiyan Ren, et al. Constitutive expression of chloroplast glycerol-3-phosphate acyltransferase from Ammopiptanthus mongolicus enhances unsaturation of chloroplast lipids and tolerance to chilling, freezing and oxidative stress in transgenic Arabidopsis[J]. Plant Physiology and Biochemistry, 2019, 143: 375-387. Overexpression of Arabidopsis glycerol-3-phosphate acyltransferase (GPAT) gene can improve the cold resistance of rice and enhance the photosynthetic efficiency of rice under low temperature conditions (Yokoi S, Higashi SI, Kishitani S, et al. Introduction of the cDNA for shape Arabidopsis glycerol-3-phosphate acyltransferase (GPAT) confesses unsaturation of fatty acids and chilling tolerance of photosynthesis on rice[J]. Molecular Breeding, 1998, 4(3): 269-275.).

[0004] Coenzyme Q10 is a lipid-soluble quinone compound composed of a quinone ring core and a decaprene side chain. It exists in the cell membranes of prokaryotes and the inner mitochondrial membranes of eukaryotes, responsible for electron transport, participating in energy metabolism and the formation of protein disulfide bonds. It also possesses antioxidant functions, protecting cell lipid membranes from chemical damage. Coenzyme Q10 has wide applications in cosmetics, functional foods, and pharmaceuticals. It can be obtained through extraction from animal and plant tissues, chemical synthesis, and microbial fermentation. However, due to the limited availability of animal and plant raw materials and the complexity of chemical synthesis, microbial fermentation is currently the most important method for the commercial production of coenzyme Q10.

[0005] Current research on coenzyme Q10 producing bacteria mainly focuses on two aspects. First, screening for native coenzyme Q10 bacteria and modifying or optimizing their fermentation to increase coenzyme Q10 production. Reported native coenzyme Q10 bacteria include *Rhodobacter sphaeroides*, *Agrobacterium tumefaciens*, *Sporidiobolus johnsonii*, *Schizosaccharomyces pombe*, *Sporobolomyces roseus*, *Rhizobium radiobacter*, and *Sphingomonas sp. ZUTEO3*. Second, reconstructing the biosynthetic pathway of coenzyme Q10 in non-native bacteria. For example, *Escherichia coli* synthesizes coenzyme Q8, whose side chain is octaprerimene. Introducing a heterologous decanopyrene pyrophosphate synthase gene can endow *Escherichia coli* with the ability to synthesize coenzyme Q10. Currently, the yield of coenzyme Q10 in mutant strains obtained through the reconstructive pathway in non-origin bacteria is still relatively low and cannot meet the needs of commercial production.

[0006] Obtaining superior strains to increase coenzyme Q10 yield is key to achieving efficient coenzyme Q10 fermentation production. Rhodophyta globulae are natural coenzyme Q10 producers, possessing advantages such as high coenzyme Q10 content and ease of cultivation. Currently, the modification of Rhodophyta globulae mainly employs random mutagenesis and genetic engineering. For example, CN101333509 discloses a Rhodophyta globulae strain obtained through spatial mutagenesis, whose coenzyme Q10 yield is 1.3 times higher than the original strain, reaching 0.8 g / L. Patent CN103509728 achieves a coenzyme Q10 yield of 2.85 g / L by knocking out the bchG gene, a 15% increase compared to the starting strain. Patent CN103509816 increases the coenzyme Q10 yield to 2.95 g / L by overexpressing the ubiG gene in the coenzyme Q10 synthesis process. Currently, genetic engineering modifications targeting Rhodopseudomonas aeruginosa mainly focus on the synthesis of coenzyme Q10 and its precursors. There are no reports on increasing coenzyme Q10 production by overexpressing cell membrane phospholipid synthesis genes. Summary of the Invention

[0007] The inventors of this application employed genetic engineering methods to overexpress glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase, involved in phospholipid synthesis, in *Rhodotorula globulus*. Based on this, they then conducted mutagenesis breeding to obtain a *Rhodotorula globulus* mutant strain that produces high levels of coenzyme Q10. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 19600. Therefore, the first objective of this invention is to provide a genetically engineered bacterium that produces coenzyme Q10. The second objective of this invention is to provide an application of this genetically engineered bacterium that produces coenzyme Q10.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] As a first aspect of the present invention, a genetically engineered bacterium (Rhodobactersphaeroides) that produces coenzyme Q10 is disclosed, with accession number CGMCC NO.19600.

[0010] According to the present invention, the coenzyme Q10-producing genetically engineered bacterium CGMCC NO.19600 is obtained by overexpressing glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase in phospholipid synthesis in Rhodococcus spp., followed by mutagenesis breeding.

[0011] According to the present invention, the Rhodotorula globulus is Rhodotorula globulus HCCB20619.

[0012] As a second aspect of the present invention, the application of a genetically engineered strain CGMCCNO.19600, which produces coenzyme Q10 as described above, for the fermentation production of coenzyme Q10.

[0013] As a third aspect of the present invention, the application of a phospholipid synthase encoding gene in the construction of genetically engineered bacteria that produce coenzyme Q10, wherein the phospholipid synthase is a glycerol-3-phosphoacyltransferase, and the amino acid sequence of the glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.2.

[0014] According to the present invention, the genetically engineered bacteria for producing coenzyme Q10 are constructed by overexpressing glycerol-3-phosphate acyltransferase from the starting strain of Rhodopseudomonas aeruginosa.

[0015] Furthermore, the Rhodotorula globulus is Rhodotorula globulus HCCB20619.

[0016] As a fourth aspect of the present invention, the application of a phospholipid synthase encoding gene in the construction of genetically engineered bacteria for producing coenzyme Q10, wherein the phospholipid synthase is glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase, the amino acid sequence of the glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.2, and the encoding gene sequence is shown in SEQ ID NO.3; the amino acid sequence of the 1-monoacylglycerol-3-phosphoacyltransferase is shown in SEQ ID NO.4, and the encoding gene sequence is shown in SEQ ID NO.5.

[0017] According to the present invention, the genetically engineered bacteria for producing coenzyme Q10 is constructed by overexpressing the encoding genes of glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase in the process of phospholipid synthesis, using Rhodopseudomonas aeruginosa as the starting strain, and then obtaining the genetically engineered bacteria LYPBC through mutagenesis breeding.

[0018] Furthermore, the Rhodotorula globulus is Rhodotorula globulus HCCB20619.

[0019] As a fifth aspect of the present invention, a method for constructing the genetically engineered bacterium LYPB includes the following steps:

[0020] Step 1: Using the genome of Rhodopseudomonas spp. as a template, amplify the gene encoding the pG promoter and glycerol-3-phosphoacyltransferase;

[0021] Step 2: Insert the pG promoter and the glycerol-3-phosphoacyltransferase encoding gene into the Rhodotorula globulus vector pBBR1MCS-2 to construct the glycerol-3-phosphoacyltransferase overexpression recombinant plasmid pBMC-PB;

[0022] Step 3: Transform the recombinant plasmid pBMC-PBC into E. coli S17-1;

[0023] Step 4: The recombinant plasmid pBMC-PBC was introduced into Rhodotorula glutinis HCCB20619 via conjugation transfer to obtain the genetically engineered bacterium LYPB overexpressing glycerol-3-phosphoacyltransferase.

[0024] The pG promoter is shown in SEQ ID NO.1, the amino acid sequence of glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.2, and the encoding gene sequence is shown in SEQ ID NO.3.

[0025] As a sixth aspect of the present invention, a method for constructing the genetically engineered bacterium LYPBC includes the following steps:

[0026] Step 1: Using the genome of Rhodopseudomonas spp. as a template, amplify the encoding genes of the pG promoter and glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase;

[0027] Step 2: Link the pG promoter with the encoding genes of glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase and insert it into the Rhodotorula globulus vector pBBR1MCS-2 to construct the overexpression recombinant plasmid pBMC-PBC of glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase.

[0028] Step 3: Transform the recombinant plasmid pBMC-PBC into E. coli S17-1;

[0029] Step 4: The recombinant plasmid pBMC-PBC was introduced into Rhodotorula glutinis HCCB20619 via conjugation transfer to obtain the genetically engineered bacterium LYPBC overexpressing glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase.

[0030] The pG promoter is shown in SEQ ID NO.1, the amino acid sequence of glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.2, the coding gene sequence is shown in SEQ ID NO.3, the amino acid sequence of 1-monoacylglycerol-3-phosphoacyltransferase is shown in SEQ ID NO.4, and the coding gene sequence is shown in SEQ ID NO.5.

[0031] The beneficial effects of this invention are as follows: By overexpressing the encoding genes of glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase in phospholipid synthesis in Rhodococcus globulus using genetic engineering technology, the yield of coenzyme Q10 is increased by 38.5% to 3.2 g / L. Random mutagenesis of the genetically engineered bacteria yielded Rhodococcus globulus CGMCC NO.19600, with a coenzyme Q10 yield of 3.92 g / L. This is an excellent strain with high coenzyme Q10 yield and has broad prospects for industrial application. Attached Figure Description

[0032] Figure 1 This is the map of the recombinant plasmid pMBC-PB.

[0033] Figure 2 This is the map of the recombinant plasmid pBMC-PBC.

[0034] Figure 3 This is a map of the recombinant plasmid pMBC-CDSA.

[0035] Figure 4 This is the spectrum of the recombinant plasmid pMBC-PGSP. Detailed Implementation

[0036] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or conditions provided by the manufacturer.

[0037] 1. The strains and plasmids involved in the following examples are from the following sources:

[0038] (1) Rhodophyta globulinii, HCCB20619, a strain preserved in the laboratory of Shanghai Laiyi Biopharmaceutical Research and Development Center Co., Ltd.

[0039] (2) E. coli S17-1, Simon R, Priefer U, Pühler, AA Broad Host RangeMobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis inGram Negative Bacteria[J]. nature biotechnology, 1983, 1(9): 784-791.

[0040] (3) pMD19-T simple vector, purchased from TAKARA.

[0041] (4) pBBR1MCS-2, broad-host-range cloning vector, Kovac ME, Elzer PH, Hill DS, et al. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes[J]. Gene, 1995, 166(1): 0-176.

[0042] (5) The pG promoter sequence is shown in SEQ ID NO.1.

[0043] (6) The amino acid sequence of glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.2.

[0044] (7) The gene sequence encoding glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.3.

[0045] (8) The amino acid sequence of 1-monoacylglycerol-3-phosphoacyltransferase is shown in SEQ ID NO.4.

[0046] (9) The gene sequence encoding 1-monoacylglycerol-3-phosphoacyltransferase is shown in SEQ ID NO.5.

[0047] (10) The amino acid sequence of phosphatidylcytidine transferase is shown in SEQ ID NO.6.

[0048] (11) The gene sequence encoding phosphatidylcytidine transferase is shown in SEQ ID NO.7.

[0049] (12) The amino acid sequence of phosphatidylglycerol phosphate synthase is shown in SEQ ID NO.8.

[0050] (13) The gene sequence encoding phosphatidylglycerol phosphate synthase is shown in SEQ ID NO.9.

[0051] (14) The amino acid sequence of phosphatidylglycerol phosphatase is shown in SEQ ID NO.10.

[0052] (15) The gene sequence encoding phosphatidylglycerol phosphatase is shown in SEQ ID NO.11.

[0053] (16) The high-yielding coenzyme Q10 strain HCCB20743, classified as Rhodobacter phaeroides, is deposited at the China General Microbiological Culture Collection Center, located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.19600 and deposit date of April 22, 2020.

[0054] 2. Culture medium for coenzyme Q10 production using Rhodophyton floccosum HCCB20743, a high-yield coenzyme Q10-producing bacterium.

[0055] (1) Seed culture medium: glucose 0.4%, yeast powder 0.1%, monosodium glutamate 0.05%, corn steep liquor powder 0.03%, MgSO4 0.2%, NaCl 0.2%, FeSO4 0.01%, CaCO3 0.8%, (NH4)2SO4 0.2%, riboflavin 0.00002%, thiamine 0.002%.

[0056] (2) Fermentation medium: glucose 6.5%, yeast powder 0.5%, monosodium glutamate 1.2%, MgSO4 1.9%, (NH4)2SO4 1%, FeSO4 0.17%, KH2PO4 0.5%, K2HPO4 0.5%, riboflavin 0.00004%, thiamine 0.004%.

[0057] 3. The primer sequence information involved in the following examples is shown in Table 1.

[0058] Table 1 Primer sequences

[0059] Primer Name Sequence SEQ ID GP-F AAGCTTCATCCTCACCGCCCTCCCTTAAC NO.12 GP-R AAAGGCCGCTTTCGATGGCCGGCATAGAGCTCTCCCACAATGGGC NO.13 PB-F ATTGTGGGAGAGCTCTATGCCGGCCATCGAAAGCGGCCTT NO.14 PB-R GGTACCGAGAATTCTTACTTCTTCCCGATCCGCG NO.15 PC-F GAATTCCATCAACGGAGGTACTACCATGCGCACCGCGCTGCAATG NO.16 PC-R GGTACCTTCGGCTTCAATTCCGCCAT NO.17 GCS-R CCTTCGGCTTCCCGGACTTGCTCATAGAGCTCTCCCACAATGGGC NO.18 CDA-F GCCCATTGTGGGAGAGCTCTATGAGCAAGTCCGGGAAGCCG NO.19 CDA-R GGTACCTCAGTTCCCCATAGCCGGCAG NO.20 GPS-R GAATATTCGGGATCGACCAGTTCATAGAGCTCTCCCACAATGGGC NO.21 PGS-F CGCCCATTGTGGGAGAGCTCTATGAACTGGTCGATCCCGAAT NO.22 PGS-R AGTGCAGATCGCGCGGGTGAGCCTCATTTCTCGTCCTTGAGGT NO.23 PGP-F TTCCCTACCTCAAGGACGAGAAATGAGGCTCACCCGCGCGATC NO.24 PGP-R GGTACCTCACATCAGCACCCCGTGCG NO.25

[0060] Example 1: Construction of engineered bacteria overexpressing glycerol-3-phosphate acyltransferase

[0061] The amino acid sequence of glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.2. This enzyme can catalyze the reaction of acyl-CoA and glycerol-3-phosphate to produce 1-monoacylglycerol-3-phosphate.

[0062] 1.1 Construction of recombinant plasmid pBMC-PB

[0063] Map of the recombinant plasmid pBMC-PB overexpressing glycerol-3-phosphoacyltransferase as shown below Figure 1As shown, the construction process involved using the chromosome of *Rhodotorula glutinis* HCCB20619 as a template. The pG promoter (sequence shown in SEQ ID NO. 1) was amplified using primers GP-F / R, and the glycerol-3-phosphoacyltransferase encoding gene plsB (sequence shown in SEQ ID NO. 3) was amplified using primers PB-F / R. The PCR products were recovered and used as templates to amplify the PB fragment using primers GP-F and PB-R. This fragment was then cloned into the pMD19-Tsimple vector to obtain the recombinant plasmid pMD-PB. pMD-PB was digested with HindIII-KpnI, and the PB fragment was recovered and cloned into pBBR1MCS-2 digested with HindIII-KpnI to obtain the glycerol-3-phosphoacyltransferase overexpression recombinant plasmid pBMC-PB.

[0064] 1.2 Recombinant plasmid pBMC-PB was electroporated into Escherichia coli S17-1

[0065] 1) Activate Escherichia coli S17-1, pick a single colony and inoculate it into LB medium (1% tryptone, 0.5% yeast extract, 1% sodium chloride), and incubate overnight at 37°C and 220 rpm.

[0066] 2) Take 200 μL of overnight culture medium and inoculate it into 20 mL of fresh LB medium. Incubate at 37℃ and 220 rpm for 3-4 h until OD600 = 0.4.

[0067] 3) Transfer the culture medium to a centrifuge tube and centrifuge at 4°C and 4000 rpm for 5 minutes.

[0068] 4) Remove the supernatant and add 20 mL of pre-cooled 10% glycerol to resuspend the bacterial cells.

[0069] 5) Centrifuge at 4℃ and 4000rpm for 5 minutes.

[0070] 6) Remove the supernatant and add 10 mL of pre-cooled 10% glycerol to resuspend the bacterial cells.

[0071] 7) Centrifuge at 4℃ and 4000rpm for 5min, remove the supernatant, and add 200μL of 10% glycerol to resuspend the bacterial cells.

[0072] 8) Take 50 μL of competent cells and mix them with an appropriate amount of recombinant plasmid. Transfer the mixture to a pre-cooled 0.1 cm electroporation cuvette and electroporate. The electroporation conditions are 1800 V, 200 Ω, 25 μF, and the electroporation time is about 5.0 ms.

[0073] 9) Immediately after the pulse ends, add 800 μL of pre-cooled LB medium and incubate at 37°C and 150 rpm for 50 min with shaking. Then, take 100 μL and spread it on an LB plate containing kanamycin and incubate at 37°C overnight.

[0074] 1.3 Bonding Transfer

[0075] 1) Activate Rhodotorula foetida and Escherichia coli S17-1 containing recombinant plasmids, pick single colonies and inoculate them into LB cells and culture overnight. Escherichia coli is cultured at 37°C and Rhodotorula foetida is cultured at 32°C.

[0076] 2) Transfer 1% of the inoculum to 10 mL LB and incubate for 3-7 h until OD600 = 0.4-0.6.

[0077] 3) Centrifuge at 4000 rpm for 5 min, remove the supernatant, wash the bacterial cells twice with 10 mL of fresh LB medium, and resuspend the bacterial cells in 10 mL of LB medium.

[0078] 4) Mix Rhodopseudomonas scab HCCB20619 with Escherichia coli at a ratio of 10:1, drop the mixture onto filter paper of an LB agar plate, and incubate at 32°C for 24 hours.

[0079] 5) Transfer the filter paper to fresh LB medium, rinse repeatedly, collect the bacterial cells, spread them on LB plates containing sodium tellurate and kanamycin, and incubate at 32°C.

[0080] 1.4 Identification

[0081] Single colonies after conjugation transfer were picked and transferred to LB agar plates containing kanamycin and incubated at 32°C for 2 days. A small number of colonies were then inoculated into 3 mL LB agar plates and incubated at 32°C with shaking for 24 hours. The bacterial cells were collected, and the genome was extracted (refer to the instructions for the bacterial genome extraction kit from Shanghai Laifeng Biotechnology Co., Ltd.). The genome was then verified using primers GP-F and PB-R. Positive strains amplified a 1088 bp fragment, while negative strains showed no fragment. The positive genetically engineered bacteria were labeled LYPB.

[0082] Example 2: Construction of engineered bacteria for overexpression of glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase

[0083] The amino acid sequence of glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.2, and the amino acid sequence of 1-monoacylglycerol-3-phosphoacyltransferase is shown in SEQ ID NO.4. 1-Monoacylglycerol-3-phosphoacyltransferase can further synthesize 1,2-diacylglycerol-3-phosphate using 1-monoacylglycerol-3-phosphate, the catalytic product of glycerol-3-phosphoacyltransferase, as a substrate.

[0084] The overexpression recombinant plasmid pBMC-PBC of glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase is shown in the image. As shown, the construction process is as follows: using the chromosome of Rhodopseudomonas sc. HCCB20619 as a template, the encoding gene plsC (sequence shown in SEQ ID NO. 5) of 1-monoacylglycerol-3-phosphoacyltransferase was amplified using PC-F / R, and cloned into the pMD19-T simple vector to obtain the recombinant plasmid pMD-C. In Example 1, pMD-PB was digested with HindIII-EcoRI to recover the PB fragment, and pMD-C was digested with EcoRI-KpnI to recover the C fragment. These fragments were then cloned into pBBR1MCS-2 digested with HindIII-KpnI to obtain the recombinant plasmid pBMC-PBC.

[0085] Following the methods described in 1.2-1.4 of Example 1, pBMC-PBC was electroporated into Escherichia coli S17-1 and then introduced into Rhodopseudomonas spp. HCCB20619 via conjugation transfer. Verification was performed using primers GP-F and PC-R. Positive strains amplified a 1891bp fragment, while negative strains showed no fragment. The positive genetically engineered bacteria were labeled LYPBC.

[0086] Example 3 Construction of engineered bacteria overexpressing phosphatidylcytidine transferase

[0087] The amino acid sequence of phosphatidylcytidine transferase is shown in SEQ ID NO.6. This enzyme can catalyze the synthesis of CDP-diacylglycerol using 1,2-diacylglycerol-3-phosphate as a substrate.

[0088] The overexpression plasmid pBMC-CDSA of phosphatidylcytidine transferase is shown in the image. Figure 2 The construction process was as follows: using the chromosome of Rhodopseudomonas HCCB20619 as a template, the pG promoter was amplified using primers GP-F and GCS-R, and the encoding gene cdsA (sequence shown in SEQ ID NO.7) of phosphatidylcytidine transferase was amplified using primers CDA-F / R. The PCR products of both were recovered and used as templates to amplify the PCDA fragment using primers GP-F and CDA-R, and then cloned into the pMD19-T simple vector to obtain the recombinant plasmid pMD-PCDA. pMD-PCDA was cloned into pBBR1MCS-2 digested with HindIII-KpnI to obtain the cdsA overexpression recombinant plasmid pBMC-CDSA.

[0089] Following the methods described in 1.2-1.4 of Example 1, pBMC-CDSA was electroporated into Escherichia coli S17-1 and then introduced into Rhodopseudomonas sc. HCCB20619 via conjugation transfer. Verification was performed using primers GP-F and CDA-R. Positive strains amplified a 1296bp fragment, while negative strains showed no fragment. The positive genetically engineered bacteria were labeled LYCDSA.

[0090] Example 4 Construction of engineered bacteria for phosphatidylglycerol phosphate synthase and phosphatidylglycerol phosphatase overexpression

[0091] The amino acid sequence of phosphatidylglycerol phosphate synthase is shown in SEQ ID NO.8, and the amino acid sequence of phosphatidylglycerol phosphatase is shown in SEQ ID NO.10. Both enzymes use CDP-dacylglycerol as a substrate to generate phosphatidylglycerol, which is an important component of cell membrane phospholipids.

[0092] The overexpression plasmid pBMC-PGSP of phosphatidylglycerol phosphate synthase and phosphatidylglycerol phosphatase is shown in the image. Figure 3 Figure 4 The construction process was as follows: using the chromosome of *Rhodopseudomonas spp.* HCCB20619 as a template, the pG promoter was amplified using primers GP-F and GPS-R; the gene encoding phosphatidylglycerol phosphate synthase, pgsA (sequence shown in SEQ ID NO. 9), was amplified using primers PGS-F / R; and the gene encoding phosphatidylglycerol phosphatase, pgpA (sequence shown in SEQ ID NO. 11), was amplified using primers PGP-F / R. The PCR products of the three genes were recovered and used as a template to amplify the PGSP fragment using primers GP-F and PGP-R. This fragment was then cloned into the pMD19-T simple vector to obtain the recombinant plasmid pMD-PGSP. pMD-PGSP was then cloned into pBBR1MCS-2 digested with HindIII-KpnI to obtain the recombinant plasmid pBMC-PGSP.

[0093] Following the methods described in 1.2-1.4 of Example 1, pBMC-PGSP was electroporated into Escherichia coli S17-1 and then introduced into Rhodopseudomonas spp. HCCB20619 via conjugation transfer. Verification was performed using primers GP-F and PGP-R. Positive strains amplified a 1634bp fragment, while negative strains showed no fragment. The positive genetically engineered bacteria were labeled LYPGSP.

[0094] Example 5 Fermentation

[0095] Rhodopseudomonas spp. HCCB20619, LYPB, LYPBC, LYCDSA, and LYPGSP were streaked onto LB agar plates and incubated at 32°C for 2 days. The resulting fragments were then inoculated into 500 mL shake flasks containing 50 mL of seed culture medium and incubated at 32°C with shaking at 220 rpm for 24 h. The seed culture medium consisted of: 0.4% glucose, 0.1% yeast extract, 0.05% monosodium glutamate, 0.03% corn steep liquor, 0.2% MgSO4, 0.2% NaCl, 0.01% FeSO4, 0.8% CaCO3, 0.2% (NH4)2SO4, 0.00002% riboflavin, and 0.002% thiamine.

[0096] The seed culture was transferred at a 10% inoculum to a 5L fermenter containing 3L of fermentation medium. The fermentation medium composition was: glucose 6.5%, yeast extract 0.5%, monosodium glutamate 1.2%, MgSO4 1.9%, (NH4)2SO4 1%, FeSO4 0.17%, KH2PO4 0.5%, K2HPO4 0.5%, riboflavin 0.00004%, and thiamine 0.004%. The fermentation temperature was 32℃, the aeration rate was 1:1 (vol:vol), the stirring speed was 500rpm, the pH was controlled at around 7.0 with ammonia, and 50% glucose was added during fermentation at a rate of 2mL / h.

[0097] After 5 days of fermentation, the yield of coenzyme Q10 was determined by HPLC. HPLC conditions: Agiletextend C18 column (5 μm, 46 × 150 mm); mobile phase A: anhydrous ethanol, B: methanol, A:B = 68:32; column temperature: 40℃; flow rate: 1 mL / min.

[0098] Table 2 shows the coenzyme Q10 production of the original strain and the genetically engineered strain of Rhodotorula globulus.

[0099] Table 2. Coenzyme Q10 yield of different strains

[0100]

[0101] Table 2 shows that overexpression of enzymes at different stages of phospholipid synthesis has different effects on the yield of coenzyme Q10. Overexpression of glycerol-3-phosphoacyltransferase alone increased the coenzyme Q10 yield from 2.31 g / L to 2.85 g / L. Simultaneous overexpression of both glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase further increased the coenzyme Q10 yield to 3.20 g / L, a 38.5% increase compared to the starting strain HCCB20619, demonstrating the most significant effect.

[0102] Example 6: Ultraviolet mutagenesis and screening of mutant strains, fermentation

[0103] 6.1 Ultraviolet Mutagenesis

[0104] Collect fresh LYPBC culture medium, wash and resuspend the cells with physiological saline, and adjust the cell count to 102. 9 Cells / mL. Take 5 mL of the above cell suspension into a petri dish, stir with a magnetic stirrer, and place under a 15W UV lamp at 30 cm for mutagenesis for 40 s. After mutagenesis, dilute the bacterial suspension appropriately and spread it on LB agar plates, then incubate at 32°C in the dark.

[0105] 6.2 Screening

[0106] The colonies grown after mutagenesis were streaked onto LB agar plates and incubated at 32°C for 2 days. A portion of the culture was then inoculated into a 250 mL shake flask containing 25 mL of seed culture medium and incubated at 32°C with shaking at 220 rpm for 24 hours. A 10% inoculum was then transferred to a 250 mL shake flask containing 25 mL of fermentation medium and incubated at 32°C with shaking at 220 rpm for 5 days. After fermentation, the coenzyme Q10 yield was analyzed by HPLC. Through repeated mutagenesis and screening, a high-yielding coenzyme Q10 strain, HCCB20743, was finally obtained and deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC NO.19600.

[0107] 6.3 Fermentation of mutant strains

[0108] Using the method in Example 5, CGMCC NO.19600 was fermented, and the coenzyme Q10 yield reached 3.92 g / L, which is 22.5% higher than LYPBC and 69.7% higher than the original starting strain.

[0109] The above description is merely an example of the embodiments of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. sequence list <110> Shanghai Laiyi Biopharmaceutical Research and Development Center Co., Ltd. <120> A genetically engineered bacterium producing coenzyme Q10 and its application <130> 201088 <141> 2020-11-02 <160> 25 <170> SIPOSequenceListing 1.0 <210> 1 <211> 462 <212> DNA <213> Artificial Sequence <400> 1 catcctcacc gccctccctt aaccgcgcgt ttcgacggac aggaaccggc ccacaagaaa 60 ccgggccgag ccatcgatgg ctctgcaccc cccctcccag tgcgctttcc ggcagccttg 120 cggcccggag gacagccgac gcgcggcagg tcacgctgcg gacagcgccg tggaaggtgc 180 cctgcgcgca aggccgggcc gcccccgaat ttctcacggg cggcttcggc ctccgcgggc 240 cggagcgatc ccgttcgtcc ggggcccgcc tcccgtcctc tcccgaggcg ggtcgggccg 300 cggcggcaag gcctcggaac cgggcactat cttgccgtcc tgcgccgatt tcctcctttc 360 ttcggttgaa ttgcgctcgg atctggggtc gttaccttgg agaccgtccg cgggcgcgcg 420 actcgatcct cgctgtgcgc ccgcccattg tgggagagct ct 462 <210> 2 <211> 201 <212> PRT <213> Artificial Sequence <400> 2 Met Pro Ala Ile Glu Ser Gly Leu Trp Ala Leu Ile Leu Thr Gly Val 1 5 10 15 Leu Gly Tyr Leu Leu Gly Ser Ile Pro Phe Gly Ile Val Ile Thr Arg 20 25 30 Ala Leu Gly Leu Gly Asp Leu Arg Lys Ile Gly Ser Gly Asn Ile Gly 35 40 45 Ala Thr Asn Val Leu Arg Thr Gly Asn Lys Pro Ala Ala Leu Ala Thr 50 55 60 Leu Leu Leu Asp Ser Gly Lys Gly Ala Ile Ala Val Leu Ile Ala Arg 65 70 75 80 Ala Ala Val Gly Glu Asp Ala Ala Gln Leu Ala Ala Phe Thr Ser Phe 85 90 95 Leu Gly His Leu Phe Pro Val Trp Leu Gly Phe Arg Gly Gly Lys Gly 100 105 110 Val Ala Thr Phe Leu Gly Thr Leu Leu Ala Leu Ala Trp Pro Val Gly 115 120 125 Leu Ala Cys Cys Leu Thr Trp Leu Ala Thr Ala Ala Leu Gly Arg Ile 130 135 140 Ser Ser Leu Ser Ala Leu Val Ala Ala Ala Ser Gly Val Leu Trp Met 145 150 155 160 Ile Leu Leu Gly Tyr Gly Gln Met Ala Ala Leu Gly Ala Val Leu Ala 165 170 175 Val Leu Ile Phe Ile Arg His His Ala Asn Ile Arg Arg Ile Leu Ala 180 185 190 Gly Thr Glu Pro Arg Ile Gly Lys Lys 195 200 <210> 3 <211> 606 <212> Ms <213> Artificial Sequence <400> 3 atgccggcca tcgaaagcgg cctttgggcg ctgatcctga cgggagtgct gggctatctg 60 ctcggctcga tcccgttcgg catcgtcatc acccgcgcgc tggggctggg cgacctgcgc 120 aagatcggct cgggcaatat cggcgcgacc aacgtgctcc ggacgggcaa caagcccgcg 180 gcgctggcca cgctgctcct cgattcgggc aagggcgcca tcgccgtgct gatcgcccgc 240 gccgccgtgg gcgaggatgc agcgcagctt gcggccttca cctcgtttct ggggcacctc 300 ttcccggtct ggctcggctt ccgcggcggc aagggggtcg cgaccttcct cggcacgctc 360 ctcgcgctcg cctggcccgt ggggctcgcc tgctgcctca cctggctcgc gaccgcggcc 420 ctgggccgaa tctcctcgct ctcggccctc gtggctgcgg cgagcggtgt cctctggatg 480 atccttctgg gctacggcca gatggcggcg ctgggggcgg tgctcgcggt gctgatcttc 540 atccgccacc atgcgaacat ccgccggatc ctcgccggca ccgagccgcg gatcgggaag 600 aagtaa 606 <210> 4 <211> 241 <212> PRT <213> Artificial Sequence <400> 4 Met Arg Thr Ala Leu Gln Trp Ile Arg Ser Ile Leu Phe Asn Ile Val 1 5 10 15 Met Tyr Val Ser Met Ile Ala Ile Ala Leu Ala Phe Thr Pro Leu Val 20 25 30 Leu Val Asp Arg Lys Trp Ala Pro Val Trp Met Arg Ile Phe Ala Arg 35 40 45 Trp Thr Arg Phe Thr Leu Arg Trp Ile Ala Gly Leu Arg Thr Glu Val 50 55 60 Arg Gly Glu Ile Pro Thr Thr Gly Ala Leu Ile Ala Ser Lys His Gln 65 70 75 80 Ser Phe Leu Asp Ser Ile Leu Leu Phe Ser Val Leu Pro Ala Pro Arg 85 90 95 Phe Ile Met Lys Lys Gln Leu Ala Trp Ile Pro Leu Met Gly Trp Met 100 105 110 Ala Leu Gln Ala Gly Phe Ile Pro Val Asp Arg Gly Lys Arg Gly Ala 115 120 125 Ala Ile Lys Lys Met Met Ala Asp Val Glu Lys Gly Arg Ala Thr Pro 130 135 140 Gly Gln Leu Ile Ile Tyr Pro Gln Gly Thr Arg Val Ala Pro Gly Ala 145 150 155 160 His Leu Pro Tyr Lys Met Gly Thr Ala Ala Leu Tyr Gly Gln Leu Glu 165 170 175 Gln Pro Cys Tyr Pro Val Ala Ala Asn Val Gly Val Phe Trp Pro Arg 180 185 190 His Gly Ile Tyr Arg Arg Pro Gly Thr Ala Val Val Glu Phe Leu Pro 195 200 205 Pro Ile Gln Pro Gly His Thr Ala Ala Ala Phe Met Val Glu Leu Glu 210 215 220 Thr Ala Ile Glu Gly Ala Ser Asn Arg Leu Ile Ala Glu Ala Arg Gln 225 230 235 240 Gly[[ID=2!]]<0!000381><210> 5 <211> 726<00!0383><212> DNA <213> Artificial Sequence <400> 5 atgcgcaccg cgctgcaatg gatccggtcc atcctcttca acatcgtgat gtatgtctcg 60 atgatcgcca tcgcgctggc cttcacgccg ctcgtgctgg tcgaccgcaa gtgggcgccg 120 gtctggatgc ggatcttcgc gcgctggacg cgcttcacgc tgcgctggat cgcggggctc 180 cggaccgagg tgcgcggcga gatccccacg accggcgcgc ttatcgcctc gaagcaccag 240 agcttcctcg attccatcct gctcttctcg gtgctgcccg cgccgcgctt catcatgaag 300 aagcagctgg cctggatccc gctgatgggc tggatggcgc ttcaggcggg cttcattccg 360 gtggaccgcg gcaagcgggg cgcggccatc aagaagatga tggccgatgt cgagaagggc 420 cgcgcgacgc cgggccagct catcatctat ccgcagggca cccgcgtggc cccgggcgcg 480 cacctgccct acaagatggg cacagccgcc ctctacggcc agctcgagca gccttgctat 540 ccggtggcgg ccaatgtggg cgtcttctgg ccgcggcacg ggatctatcg ccgccccggc 600 accgcggtgg tggagttcct gccgccgatc cagcccggcc acacggccgc ggccttcatg 660 gtcgagctgg agaccgcgat cgagggcgcc tcgaaccggc tgatcgccga ggcccggcag 720 ggctga 726 <210> 6 <211> 273 <212> PRT <213> Artificial Sequence <400> 6 Met Ser Lys Ser Gly Lys Pro Lys Gly Arg Trp Gly Asp Leu Arg Arg 1 5 10 15 Arg Met Ile Ser Ala Ala Ile Met Leu Ser Val Gly Ala Ile Glu Val 20 25 30 Trp Leu Gly Gly Val Pro Phe Ala Leu Leu Val Ile Gly Leu Thr Gly 35 40 45 Leu Met Leu Trp Glu Leu Ala Arg Met Thr Ala Pro Gln Arg Thr Leu 50 55 60 Pro Asn Ile Leu Val Gly Leu Leu Ala Ser Ala Ile Leu Thr Gly Val 65 70 75 80 Leu Ser Phe Val Phe Arg Glu Glu Met Met Leu Ala Leu Ala Ala Leu 85 90 95 Val Leu Ala Pro Ala Ala Gly Leu Leu Gly Pro Arg Arg Asp Arg Arg 100 105 110 Ile Phe Phe Thr Tyr Gly Thr Ala Leu Met Val Ala Gly Ala Gly Leu 115 120 125 Val Met Leu Arg Glu Glu Gly Gly Ser Val Ala Ile Leu Trp Leu Ile 130 135 140 Leu Val Val Val Thr Ser Asp Val Met Gly Tyr Phe Ala Gly Arg Ser 145 150 155 160 Leu Gly Gly Pro Lys Phe Trp Pro Ala Val Ser Pro Asn Lys Thr Trp 165 170 175 Ser Gly Thr Ile Ala Gly Trp Leu Gly Ala Ala Ile Val Gly Leu Gly 180 185 190 Phe Ser Ile Ala Ala Gly Ala Gly Trp Gly Leu Ile Ile Leu Ser Pro 195 200 205 Val Ile Ala Leu Ala Gly Gln Leu Gly Asp Ile Val Glu Ser Trp Ile 210 215 220 Lys Arg Arg Ser Gly Val Lys Asp Ser Ser Ser Leu Ile Pro Gly His 225 230 235 240 Gly Gly Val Leu Asp Arg Phe Asp Ala Leu Thr Gly Ala Val Leu Ala 245 250 255 Val Leu Val Leu Gly Met Leu Gly Asp Leu Pro Leu Pro Ala Met Gly 260 265 270 Asn <210> 7 <211> 822 <212> DNA <213> Artificial Sequence <400> 7 atgagcaagt ccgggaagcc gaaggggcgc tggggcgacc tgcgccgccg gatgatctcg 60 gccgcgatca tgctgtcggt gggggccatc gaggtctggt tgggcggcgt gcccttcgcg 120 cttctcgtga tcgggcttac gggtctcatg ctgtgggaac tggcgcgcat gaccgcgccg 180 cagcggaccc ttccgaacat cctcgtgggc cttctcgcct cggccatcct gacgggcgtg 240 ctgagcttcg tcttccggga ggagatgatg ctggcgctcg cggccctcgt gctggcgccc 300 gcggcgggac ttctgggccc gcgccgcgac cgtcggatct tcttcaccta cggcacggcg 360 ctgatggtgg cgggcgcagg cctcgtcatg ctgcgcgagg agggcgggtc ggtcgcgatc 420 ctgtggctca tcctcgtggt cgtcacttcg gacgtgatgg gctattttgc cggccgcagc 480 ctcggcggcc ccaagttctg gcccgcggtc agccccaaca agacctggtc cggcacgatc 540 gcgggctggc tgggtgcggc aattgtgggt cttggattct ccattgcggc gggtgcaggc 600 tggggcctca tcatcctgtc gcccgtgatc gcgctggcag gacaactcgg ggacattgtc 660 gagagctgga tcaagcggcg ttccggggtc aaggacagct cctcgctgat cccgggccat 720 ggcggcgtgc tggaccggtt cgacgcgctg accggggcgg tgctcgccgt gctcgttctg 780 gggatgctcg gtgaccttcc gctgccggct atggggaact ga 822 <210> 8 <211> 221 <212> PRT <213> Artificial Sequence <400> 8 Met Asn Trp Ser Ile Pro Asn Ile Leu Thr Val Leu Arg Leu Leu Ala 1 5 10 15 Ala Pro Gly Val Ala Val Met Phe Leu Tyr Phe His Arg Pro Trp Ala 20 25 30 Asp Trp Phe Ala Leu Thr Leu Phe Ile Leu Ala Ala Val Thr Asp Phe 35 40 45 Phe Asp Gly Tyr Leu Ala Arg Leu Trp Lys Gln Glu Ser Lys Phe Gly 50 55 60 Ala Met Leu Asp Pro Ile Ala Asp Lys Ala Met Val Val Ile Ala Leu 65 70 75 80 Val Ile Ile Thr Gly Tyr Ser Gly Met Asn Pro Trp Leu Ile Leu Pro 85 90 95 Val Thr Leu Ile Leu Phe Arg Glu Val Phe Val Ser Gly Leu Arg Glu 100 105 110 Phe Leu Gly Ala Lys Ala Ser Leu Leu Lys Val Thr Lys Leu Ala Lys 115 120 125 Trp Lys Thr Thr Ala Gln Met Val Ala Ile Ala Ile Leu Phe Leu Gly 130 135 140 Thr Gly Leu Glu His Leu Glu Gly Ile Ala Arg Gln Gly Met Thr Trp 145 150 155 160 Glu Gln Tyr Ala Arg Ala Val Ser Ala Gly Glu Ala Asp Pro Ile Arg 165 170 175 Ser Cys Gly Met His Gly Cys Ser Ser Tyr Ala Thr Trp Leu Gly Leu 180 185 190 Ala Leu Ile Trp Ile Ala Ala Ala Leu Thr Phe Ile Thr Gly Trp Asp 195 200 205 Tyr Phe Arg Lys Ala Leu Pro Tyr Leu Lys Asp Glu Lys 210 215 220 <210> 9 <211> 666 <212> DNA <213> Artificial Sequence <400> 9 atgaactggt cgatcccgaa tattctcacc gttctgcgcc tgctggccgc gcccggcgtg 60 gcggtgatgt tcctctattt ccacaggccc tgggccgact ggttcgcgct cactctcttc 120 atcctggcgg cggtgacgga cttcttcgac ggctatctcg cccggctgtg gaagcaggaa 180 tcgaagttcg gcgccatgct cgatcccatc gccgacaagg cgatggtggt gatcgcgctg 240 gtcatcatca ccggctattc cggcatgaac ccctggctca tcctgccggt gactctgatt 300 ctcttccgcg aggtcttcgt ctcgggcctg cgcgaattcc tcggcgcaaa ggccagcctc 360<00> ctcaaggtca ccaagctcgc caagtggaag acgacggcgc agatggtggc gatcgccatc 420 cttttcctcg gcaccgggct cgagcatctc gaggggatcg cgcggcaggg catgacctgg 480 gagcaatatg cccgggcggt cagcgccggc gaggccgatc cgatccgcag ctgcgggatg 540 cacggctgct cgtcctatgc aacctggctg gggcttgcgc tgatctggat cgcggcggcc 600 cttaccttca tcaccggctg ggactatttc aggaaggcgc ttccctacct caaggacgag 660 aaatga 666 <210> 10 <211> 165 <212> PRT <213> Artificial Sequence <400> 10 Met Arg Leu Thr Arg Ala Ile Cys Thr Ala Gly Gly Ile Gly Leu Leu 1 5 10 15 Arg Pro Ala Pro Gly Thr Trp Gly Ser Ala Ala Ala Val Gly Ala Gly 20 25 30 Leu Leu Leu His Gly Leu Gly Ser Phe Pro Leu Leu Leu Ala Ala Thr 35 40 45 Leu Ala Ala Cys Gly Leu Gly Leu Trp Ala Val Arg Glu Glu Leu Lys 50 55 60 Leu Arg Pro His Ala Asp Pro Pro Glu Phe Val Ile Asp Glu Val Ala 65 70 75 80 Gly Gln Trp Ile Ala Leu Leu Phe Pro Ser Cys Gly Phe Trp Leu Met 85 90 95 Gly Leu Ala Asn Trp His Phe Pro Tyr Pro Gly Trp Val Gly Ala Phe 100 105 110 Phe Phe Phe Arg Leu Phe Asp Ile Trp Lys Pro Trp Ile Ile Gly Arg 115 120 125 Leu Asp Arg Arg Glu Asp Trp Val Gly Leu Met Ala Asp Asp Leu Met 130 135 140 Ala Gly Leu Phe Ala Gly Val Ala Thr Met Ile Ala Ala Gly Ile Ala 145 150 155 160 His Gly Val Leu Met 165 <210> 11 <211> 498 <212> DNA <213> Artificial Sequence <400> 11 atgaggctca cccgcgcgat ctgcactgcc ggaggcatcg gcctcctccg ccccgcaccg 60 ggcacctggg gctcggccgc ggccgtgggg gcgggcctcc tcctccacgg gctgggcagc 120 ttcccgctcc ttctcgcggc gacgctcgcc gcctgcgggc tgggcctctg ggccgtccgc 180 gaggagctga agctgcgccc ccatgccgat ccgcccgaat tcgtcatcga cgaggtggcg 240 ggccagtgga tcgcgctgct ctttccttcc tgcggcttct ggctgatggg gctcgccaac 300 tggcactttc cctatccggg ctgggtcggc gcgttcttct tcttccggct gttcgacatc 360 tggaagccct ggatcatcgg ccggctcgac cggcgcgagg actgggtggg gctgatggcc 420 gacgatctga tggcgggcct ctttgccggc gtggccacca tgatcgcggc cgggatcgcg 480 cacggggtgc tgatgtga 498 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <400> 12 aagcttcatc ctcaccgccc tcccttaac 29 <210> 13 <211> 45 <212> DNA <213> Artificial Sequence <400> 13 aaaggccgct ttcgatggcc ggcatagagc tctcccacaa tgggc 45 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <400> 14 attgtgggag agctctatgc cggccatcga aagcggcctt 40 <210> 15 <211> 34 <212> DNA <213> Artificial Sequence <400> 15 ggtaccgaga attcttactt cttcccgatc cgcg 34 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <400> 16 gaattccatc aacggaggta ctaccatgcg caccgcgctg caatg 45 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <400> 17 ggtaccttcg gcttcaattc cgccat 26 <210> 18 <211> 45 <212> DNA <213> Artificial Sequence <400> 18 ccttcggctt cccggacttg ctcatagagc tctcccacaa tgggc 45 <210> 19 <211> 41 <212> DNA <213> Artificial Sequence <400> 19 gcccattgtg ggagagctct atgagcaagt ccgggaagcc g 41 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <400> 20 ggtacctcag ttccccatag ccggcag 27 <210> twenty one <211> 45 <212> DNA <213> Artificial Sequence <400> twenty one gaatattcgg gatcgaccag ttcatagagc tctcccacaa tgggc 45 <210> twenty two <211> 42 <212> DNA <213> Artificial Sequence <400> twenty two cgcccattgt gggagagctc tatgaactgg tcgatcccga at 42 <210> twenty three <211> 43 <212> DNA <213> Artificial Sequence <400> twenty three agtgcagatc gcgcgggtga gcctcatttc tcgtccttga ggt 43 <210> twenty four <211> 43 <212> DNA <213> Artificial Sequence <400> twenty four ttccctacct caaggacgag aaatgaggct cacccgcgcg atc 43 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <400> 25 ggtacctcac atcagcaccc cgtgcg 26

Claims

1. The application of a phospholipid synthase encoding gene in the construction of genetically engineered bacteria that produce coenzyme Q10, characterized in that, The phospholipid synthase is a glycerol-3-phosphoacyltransferase, and the amino acid sequence of the glycerol-3-phosphoacyltransferase is shown in SEQ ID NO.2; The application uses Rhodotorula glutinis as the starting strain and constructs a genetically engineered bacterium that produces coenzyme Q10 by overexpressing glycerol-3-phosphoacyltransferase.

2. The application of phospholipid synthase encoding genes in the construction of genetically engineered bacteria that produce coenzyme Q10, characterized in that, The phospholipid synthases are glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase, the amino acid sequence of which is shown in SEQ ID NO.2 and the amino acid sequence of which is shown in SEQ ID NO.

4. The application uses Rhodotorula glutinis as the starting strain and constructs a genetically engineered bacterium that produces coenzyme Q10 by overexpressing glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase.

3. The application as described in claim 1, characterized in that, The method for constructing the genetically engineered bacteria includes the following steps: Step 1: Using the genome of Rhodopseudomonas spp. as a template, amplify the gene encoding the pG promoter and glycerol-3-phosphoacyltransferase; Step 2: Insert the pG promoter and the gene encoding glycerol-3-phosphoacyltransferase into the Rhodotorula globulus vector pBBR1MCS-2 to construct the glycerol-3-phosphoacyltransferase overexpression recombinant plasmid pBMC-PB; Step 3: Transform the recombinant plasmid into E. coli S17-1; Step 4: The recombinant plasmid was introduced into Rhodotorula globulus via conjugation transfer to obtain an engineered bacterium overexpressing glycerol-3-phosphoacyltransferase; The nucleotide sequences of the pG promoter and the gene encoding glycerol-3-phosphoacyltransferase are shown in SEQ ID NO.1 and SEQ ID NO.3, respectively.

4. The application as described in claim 2, characterized in that, The method for constructing the genetically engineered bacteria includes the following steps: Step 1: Using the genome of Rhodopseudomonas spp. as a template, amplify the encoding genes of the pG promoter and glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase; Step 2: Link the pG promoter with the encoding genes of glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase and insert them into the Rhodotorula globulus vector pBBR1MCS-2 to construct the recombinant plasmid pBMC-PBC for overexpression of glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase. Step 3: Transform the recombinant plasmid into E. coli S17-1; Step 4: The recombinant plasmid was introduced into Rhodotorula glutinis via conjugation transfer to obtain genetically engineered bacteria that overexpress glycerol-3-phosphoacyltransferase and 1-monoacylglycerol-3-phosphoacyltransferase; The nucleotide sequences of the pG promoter, the glycerol-3-phosphoacyltransferase encoding gene, and the 1-monoacylglycerol-3-phosphoacyltransferase encoding gene are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively.

Images