COVID-19 composite vaccine based on DNA vector and replicating vaccinia virus vector

Abstract

The present invention provides a recombinant vaccinia virus that simultaneously expresses the extracellular segment of the S gene of the new coronavirus and the full-length segment of the N gene. The present invention also provides an immunization kit containing the recombinant vaccinia virus, and a DNA vector expressing the extracellular segment of the S gene of the new coronavirus and a DNA vector expressing the full-length segment of the N gene of the new coronavirus as a composite vaccine. By using the three vaccines in the composite vaccine provided by the present invention, the sequential inoculation at 0, 2, and 4 weeks can induce experimental animals to produce CD4, CD8 cell responses specific to the N, S1, and S2 proteins of the new coronavirus, and the CD8T cell response is higher than the CD4T cell response, the induced T cell immunity can last for at least 3 months, and the binding antibody lasts for 6 months without a significant decrease, indicating that the composite vaccine can induce a lasting immune response to SARS-CoV-2, and the neutralizing antibodies induced by the vaccine have cross-reactive activity, which can prevent infection of multiple variants of the new coronavirus to a certain extent.

Description

Technical Field

[0001] The present invention relates to the field of medical biotechnology, and specifically to a DNA-vaccinia virus vector composite COVID-19 vaccine, which can induce a high level of humoral and cellular immune response against the novel coronavirus and prevent novel coronavirus infection. Background Art

[0002] The pathogen of the new coronavirus is the novel coronavirus-2 (SARS-CoV-2), which is also referred to as the new coronavirus in this invention. SARS-CoV-2 belongs to the genus β-coronavirus of the family Coronaviridae. It is a type of enveloped single-stranded positive-strand RNA virus with a high mutation rate and a genome length of about 30 kb. The first 2 / 3 of the genome is the non-structural gene ORF1a / b, which mainly encodes enzymes related to viral replication (RNA-dependent RNA polymerase, RdRp), and the last 1 / 3 encodes four structural proteins in sequence: spike protein (S), envelope protein (E), membrane protein (M) and nucleocapsid protein (N). Since the first discovery of the B.1.1.7 (alpha) variant in January 2021, variants such as B.1.351 (beta), P.1 (gamma) and B.1.617.2 (Delta) have been reported around the world. The mutation sites of the mutant strains are mostly concentrated in the receptor binding region and splicing site of the spike protein. The mutations increase the virus's replication ability and affinity for binding to the receptor, thereby enhancing the virus's infectivity and ultimately reducing the protective effect of the existing COVID-19 vaccine.

[0003] The spike protein (S protein) on the surface of coronavirus is a key protein that determines the virus's tropism and entry into host cells. It is composed of two subunits, S1 and S2. The RBD (receptor-binding domain) of the S1 subunit binds to the receptor ACE2 protein, and S2 mediates the fusion of the viral envelope and the cell membrane. The existing COVID-19 vaccines on the market include inactivated vaccines, subunit vaccines, mRNA vaccines, and adenovirus vaccines. Except for the inactivated vaccines that contain multiple viral antigens, other vaccines only contain S protein or S gene. The S gene mutations of SARS-COV-2 discovered so far have greatly reduced the protective effect of existing vaccines. Therefore, to induce a stronger immune response, the vaccine needs to contain more structural proteins in addition to the S protein.

[0004] During the natural infection process of SARS-CoV-2, previous infection can only alleviate the clinical symptoms of NHP and ferrets, but cannot prevent reinfection. After most people are infected with SARS-CoV-2, the antibodies that appear in their bodies gradually disappear after half a year, while the T cell response lasts relatively long. Studies have shown that the T cell response of SARS-infected people can last for 17 years. Since the specific neutralizing antibodies of the new coronavirus may persist for a short time, inducing a lasting T cell immune response is the key to a broad-spectrum and effective vaccine.

[0005] N protein (nucleocapsid protein) is the nucleocapsid protein of coronavirus, which can not only induce specific antibodies, but also induce specific cytotoxic T cell activity. Nucleocapsid protein (N) has strong immunogenicity in mice and rabbits, and the induced T cell immunity has cross-reactivity with animal-derived coronaviruses. The fact that N-specific T cells in SARS-infected people cross-react with the N protein of SARS-CoV-2 further supports this view. Therefore, the N gene can induce long-lasting and cross-reactive cellular immunity and can be used as an important antigen for the composite COVID-19 vaccine.

[0006] In view of the fact that the existing coronavirus vaccines still have the problems of short duration of immune protection, low protection strength, and lack of broad-spectrum protection against mutant strains, the purpose of the present invention is to provide a coronavirus compound vaccine based on DNA vectors and replicating vaccinia virus vectors for coronavirus infection, so as to solve the problems existing in the prior art. Summary of the invention

[0007] Based on the above purpose, the present invention first provides a recombinant vaccinia virus that simultaneously expresses the extracellular segment of the S gene and the full-length segment of the N gene of the new coronavirus, and integrates the extracellular segment of the S gene of the new coronavirus and the full-length segment of the N gene at the position of the thymidine kinase coding region in the genome of the Tiantan strain of the vaccinia virus, wherein the extracellular segment of the S gene and the full-length segment of the N gene are connected in a 5' end-to-end manner and are respectively connected downstream of different promoters. The vaccinia virus Tiantan strain (VTT), deposit number: CCTCC: V200416. The Tiantan strain of vaccinia virus has played an important role as a vaccine in the campaign to eradicate smallpox in China, and is currently very active in the research and application of live vector vaccines. Vaccinia virus has the advantages of large vector capacity, strong immunogenicity, and high safety. In the present invention, the Tiantan strain of vaccinia virus is selected as a carrier of the new crown composite vaccine.

[0008] In a preferred embodiment, the extracellular segment of the S gene is located downstream of the vaccinia virus promoter pE / L, and the full-length segment of the N gene is located downstream of the vaccinia virus promoter p7.5.

[0009] More preferably, the extracellular segment of the S gene, the promoter pE / L, the full-length segment of the N gene and the promoter p7.5 are connected in series, and the sequence after the series connection is shown in SEQ ID NO. 3. A preferred recombinant vaccinia virus technical scheme in the present invention is named VTT-2019nCoV-SN.

[0010] In a specific optional embodiment of the present invention, the recombinant vaccinia virus that simultaneously expresses the extracellular segment of the S gene and the full-length segment of the N gene of the new coronavirus is classified and named "VTT-2019nCoV-SN", with the deposit number CGMCC 21955, the deposit date is September 28, 2021, and the depositor is the General Microbiology Center of the China Culture Collection Administration, with the address of the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0011] Secondly, the present invention also provides the use of the above-mentioned recombinant vaccinia virus in the preparation of a new coronavirus vaccine.

[0012] The recombinant vaccinia virus provided by the present invention as a new coronavirus vaccine comprises a shuttle vector, wherein the vector comprises a polynucleotide encoding the nucleocapsid protein (N) of SARS-CoV-2 and a polynucleotide encoding the extracellular segment of the spike protein (S) of SARS-CoV-2 operably linked to a promoter. In a specific embodiment, the DNA vector is recombined with the thymidine kinase (TK) region of the Tiantan strain of vaccinia virus, and the replication-competent vaccinia virus genome is inserted with polynucleotides encoding the nucleocapsid protein and spike protein of the new coronavirus.

[0013] Third, the present invention also provides an immunization kit containing the above-mentioned recombinant vaccinia virus, which also contains a DNA vaccine expressing the extracellular segment of the S gene of the new coronavirus, and a DNA vaccine expressing the full-length segment of the N gene of the new coronavirus.

[0014] In a preferred embodiment, the nucleotide sequence of the full-length segment of the N gene in the DNA vaccine expressing the full-length segment of the N gene of the new coronavirus is shown in SEQ ID NO.1, and the nucleotide sequence of the extracellular segment of the S gene in the DNA vaccine expressing the extracellular segment of the S gene of the new coronavirus is shown in SEQ ID NO.2. In a specific embodiment of the present invention, the DNA vaccine expressing the extracellular segment of the S gene of the new coronavirus is named p3.0-Sa, the DNA vaccine expressing the full-length segment of the N gene of the new coronavirus is named p3.0-N, and the recombinant vaccinia virus is named VTT-2019nCoV-SN.

[0015] In a more preferred embodiment, the DNA vector pDRVI 3.0 for constructing the DNA vaccines p3.0-Sa and p3.0-N contains a DNA sequence such as SEQ ID NO.4 that can be transcribed to produce ssRNA with immune activation function.

[0016] More preferably, the DNA vaccine expressing the extracellular segment of the S gene of the new coronavirus and the DNA vaccine expressing the full-length segment of the N gene of the new coronavirus are prepared as injections, and the recombinant vaccinia virus is prepared as injections or nasal drops.

[0017] Fourth, the present invention also provides a method for preparing the above-mentioned recombinant vaccinia virus, the method comprising the step of integrating the extracellular segment of the S gene of the new coronavirus and the full-length segment of the N gene into the vaccinia virus genome by homologous recombination, in which a shuttle plasmid carrying the homologous recombination sequences tkL and tkR of the vaccinia virus is used as a DNA vector for the extracellular segment of the S gene of the new coronavirus and the full-length segment of the N gene, and the shuttle plasmid carries a selection marker neo Genes and gfp The tkR repeat sequence can cause the recombinant vaccinia virus to undergo secondary intramolecular homologous recombination to remove the selection marker. neo Genes and gfp Therefore, the recombinant vaccinia virus provided by the present invention as a new coronavirus vaccine does not contain a selection marker gene.

[0018] In one embodiment of the present invention, the tkL and tkR regions of the selected shuttle plasmid pVI75-GFPDR-SN undergo homologous recombination with vaccinia virus to make the target gene S and N With marker gene neo and GFP In the presence of G418, homologous recombination did not occur within the molecule due to selection pressure, and the marker gene neo and GFP Temporarily retained in the genome, under a fluorescent microscope, recombinant vaccinia viruses containing both the target gene and expressing GFP can be picked up (vaccinia viruses that have not undergone recombination are inhibited from growing due to the presence of G418). Then, under the condition of no G418, GFP+ recombinant vaccinia viruses are screened because they carry a short fragment of about 200bp. ikB Repeated fragments, and complete ikB Secondary homologous recombination occurs within the molecule, resulting in loss of neo Genes and gfpA recombinant vaccinia virus containing only the target gene is obtained by using other shuttle plasmids known in the art, according to the gene sequence and design provided by the present invention, combined with the technical common sense in the art, to achieve the goal of the present invention, that is, to obtain a recombinant vaccinia virus that integrates the extracellular segment of the S gene of the novel coronavirus and the full-length segment of the N gene at the position of the thymidine kinase (TK) coding region in the vaccinia virus genome and can express them simultaneously.

[0019] Fifth, the present invention provides a polynucleotide molecule for preparing the full-length segment of the N gene in the DNA vector expressing the full-length segment of the new coronavirus N gene in the above-mentioned vaccination kit, and the sequence of the polynucleotide molecule is shown in SEQ ID NO.1.

[0020] Sixth, the present invention provides a polynucleotide molecule of the extracellular segment of the S gene in the DNA vector expressing the extracellular segment of the new coronavirus S gene in the above-mentioned vaccination kit, and the sequence of the polynucleotide molecule is shown in SEQ ID NO.2.

[0021] Finally, the present invention provides a polynucleotide molecule for preparing the extracellular segment of the S gene and the full-length segment of the N gene encoding the new coronavirus that are integrated into the genome of the recombinant vaccinia virus Tiantan strain, and the sequence of the polynucleotide molecule is shown in SEQ ID NO.3.

[0022] The immunization kit provided by the present invention can be used as a composite vaccine for preventing novel coronavirus infection. By inoculating experimental animals with p3.0-Sa+p3.0-N, p3.0-Sa+p3.0-N and VTT-2019nCoV-SN in the order of 0, 2 and 4 weeks, respectively, the experimental animals can be induced to produce CD4 and CD8 T cell responses specific to novel coronavirus N, S1 and S2 proteins, and the CD8 T cell response is higher than the CD4 T cell response. The induced T cell immunity can last for at least 3 months, and the binding antibody lasts for 6 months without a significant decrease, indicating that the composite vaccine can induce a lasting immune response against SARS-CoV-2. The neutralizing antibodies induced by the vaccine have cross-reactivity and can prevent infection by multiple variants of the novel coronavirus to a certain extent.

[0023] The composite new crown vaccine provided by the present invention uses a polynucleotide encoding an antigen that has been codon-optimized and modified, is suitable for high-efficiency expression in mammalian cells, is easy to industrialize, and has industrial applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 . Schematic diagram of the structure of DNA vaccine vector pDRVI3.0;

[0025] Figure 2 . Schematic diagram of the structure of DNA vaccine plasmid p3.0-Sa;

[0026] Figure 3 . p3.0-Sa enzyme digestion identification electrophoresis pattern;

[0027] Figure 4 . Schematic diagram of the structure of DNA vaccine plasmid p3.0-N;

[0028] Figure 5 . p3.0-N enzyme digestion identification electrophoresis pattern;

[0029] Figure 6 . DNA vaccine Western Blotting identification map;

[0030] Figure 7 . Schematic diagram of S and N gene synthesis;

[0031] Figure 8 . Schematic diagram of the shuttle vector pVI75-GFPDR structure;

[0032] Fig. 9 . Schematic diagram of the shuttle plasmid pVI75-GFPDR-SN structure;

[0033] Fig.10 . Identification map of shuttle plasmid pVI75-GFPDR-SN;

[0034] Fig.11 . Virus screening flow chart;

[0035] Fig.12 . PCR identification map of the recombinant virus VTT-2019nCoV-SN;

[0036] Fig.13 . Western Blotting identification of recombinant virus VTT-2019nCoV-SN;

[0037] Fig.14 . Cellular immune response (ELISPOT) induced by immunization of mice with the new coronavirus compound vaccine;

[0038] Fig.15 . Cellular immune response induced by COVID-19 compound vaccine in mice (intracytic factor staining);

[0039] Fig.16 . RBD IgG antibodies induced by mice immunized with the new coronavirus compound vaccine;

[0040] Fig.17 Neutralizing antibodies induced by mice immunized with the COVID-19 composite vaccine (competitive ELISA);

[0041] Fig.18 . Results of immune durability of the new coronavirus combination vaccine. DETAILED DESCRIPTION

[0042] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0043] Example 1: Construction of a DNA vaccine expressing the S and N genes of the new coronavirus

[0044] 1.1 DNA vaccine vector pDRVI3.0 and its characteristics

[0045] The DNA vaccine vector pDRVI3.0 was constructed by the Chinese Center for Disease Control and Prevention. In addition to carrying optimized gene expression regulatory elements, the vector also contains a DNA sequence that can transcribe and produce ssRNA (single-stranded RNA) with immune activation function (the sequence is shown in SEQ ID NO.4). The vector is disclosed in Chinese invention patent CN101270363A, and the plasmid map is shown in Figure 1 , the present invention is incorporated herein by reference as an integral part of this specification.

[0046] 1.2 Target gene

[0047] DNA vaccines express the Sa and N antigens of the new coronavirus. The Sa antigen is the extracellular region of the S gene of SARS-COV-2, without the transmembrane region and the intracellular region, and the N antigen is the full-length N gene of SARS-COV-2. S Genes and N The amino acid sequence of the gene was used as a template, and gene optimization synthesis was performed according to the codon preference of mammalian cells.

[0048] In this application, the S gene was optimized, and then on this basis, the Sa gene without transmembrane and intracellular regions was constructed. The optimization of the S gene took into account GC content, CpG content, mRNA secondary structure, repeat sequences, etc. The S gene synthesis process removed two direct repeat sequences longer than 14bp, removed the GC peak within 60bp, and adjusted the GC to be evenly distributed throughout the gene. The GC content was 37.31 before optimization and 55.17 after optimization. The CAI value was 0.646 (EMBOSS online prediction) before optimization and 0.935 after optimization; the ENC value was 44.159 before optimization and 29.365 after optimization. SD sequence and Kozak sequence were added before the gene start codon, and an additional terminator was added after the terminator. A SalI restriction site was added to the 5' end of the synthetic gene, and an EcoRV restriction site was added to the 3' end.

[0049] The N gene has been optimized in this application. The optimization of the N gene takes into account GC content, CpG content, mRNA secondary structure, repeat sequences, etc. The N gene synthesis process removes two forward repeat sequences of more than 12bp in length, and two reverse repeat sequences of 14bp, removes the GC peak within 60bp, and adjusts the GC to be evenly distributed throughout the gene. The GC content was 47.22 before optimization and 59.44 after optimization. The CAI value was 0.688 (EMBOSS online prediction) before optimization and 0.93 after optimization; the ENC value was 53.253 before optimization and 30.354 after optimization. Add SD sequence and Kozak sequence before the start codon of the gene reading region, and add a terminator at the end. Add a SalI restriction site to the 5' end of the synthetic gene and an EcoRV restriction site to the 3' end.

[0050] The synthetic gene sequence N full-length gene is shown in SEQ ID NO: 1, and the extracellular region of the S gene is shown in SEQ ID NO: 2.

[0051] 1.3 Construction of p3.0-Sa vaccine

[0052] by Sal I and Eco The gene Sa was synthesized by double digestion with RV and inserted into the vector pDRVI3.0. The resulting plasmid was named p3.0-Sa. 8.1kb and 1.2kb fragments were obtained by digestion with NcoI ( Figure 2 , Figure 3 ). After sequencing verification, the gene insertion was correct.

[0053] 1.4 Construction of p3.0-N

[0054] by Sal I and EcoThe N fragment of the gene was synthesized by double digestion with RV and inserted into the vector pDRVI3.0. The resulting plasmid was named p3.0-N. Eco R V+ Sal I digestion can obtain 5.7kb and 3.6kb fragments ( Figure 4 , Figure 5 ). After sequencing verification, the gene insertion was correct.

[0055] 1.5 DNA vaccine antigen expression verification

[0056] 50 μg of p3.0-Sa and p3.0-N plasmids were transfected into 50 ml of 293F cells, and the cells were lysed after 72 hours. Western blotting was performed with anti-S protein polyclonal antibody and N protein monoclonal antibody. The results showed that the antigen proteins expressed by p3.0-Sa and p3.0-N could specifically bind to the antibodies, and the molecular weight of the expression products was 134 KDa and 45 KDa, which was consistent with the expected results ( Figure 6 ).

[0057] Example 2: Construction and identification of recombinant vaccinia virus vaccine

[0058] The vector used in this study is the Tiantan strain of vaccinia virus (accession number: (CCTCC: V200416)). Vaccinia virus has the advantages of large vector capacity, strong immunogenicity, and high safety, so we chose it as the vector of the new crown compound vaccine.

[0059] 2.1 Synthetic genes

[0060] The antigen genes expressed by the recombinant vaccinia virus vaccine are S and N. The S gene only contains the extracellular region of the SARS-COV-2 S gene, without the transmembrane region and the intracellular region. The N antigen is the full-length N gene of SARS-COV-2. S Genes and N The amino acid sequence of the gene was used as a template, and the gene was adjusted and synthesized according to the mammalian cell codon preference. The gene optimization performed simultaneously included: GC content, CpG content, mRNA secondary structure, cryptic splicing site, polA pre-maturation site, internal chi site, ribosome binding site, CpG negative island, RNA unstable motif, repeat sequence and restriction site. The KOZAK sequence was added in front of the gene to eliminate the premature termination signal of the vaccinia virus early promoter. The S and N genes were placed downstream of the vaccinia virus promoter pE / L and p7.5 in a "back-to-back" manner. The schematic diagram of the synthetic gene SPPN structure is shown in the figure. Figure 7 As shown, the sequence is shown in SEQ ID NO.3.

[0061] 2.2 Construction and identification of shuttle plasmids

[0062] The antigen gene of SARS-CoV-2 was cloned into the shuttle vector to construct the shuttle plasmid. The shuttle vector pVI75GFP-DR was constructed by the Virus Immunity Laboratory of the STD and AIDS Prevention and Control Center of the Chinese Center for Disease Control and Prevention. The schematic diagram of the structure is shown in Figure 8 As shown. This vector can be recombined with vaccinia virus to construct a recombinant vaccinia virus vaccine strain without a selection marker. The sequence of pVI75GFP-DR is shown in SEQ ID NO.5, which mainly contains the following elements: ① Two selection markers: gfp Genes and neo Gene; ②Homologous recombination sequences tkL and tkR: tkL and tkR are partial fragments of vaccinia virus thymidine kinase (TK); ③DR sequence: The 200bp repeated sequence at the end of tkR can cause the recombinant vaccinia virus to undergo secondary intramolecular homologous recombination, thereby losing the selection marker; ④Multiple cloning site.

[0063] The synthesized SPPN gene fragment was cloned into the shuttle vector pVI75-GFPDR through the KpnI and SalI restriction endonuclease sites to obtain the shuttle plasmid pVI75-GFPDR-SN ( Fig. 9 ).

[0064] 2.3 Screening and identification of recombinant viruses

[0065] Transfection

[0066] Vaccinia virus Tiantan strain infected 80-90% chicken embryo fibroblasts (CEF) at MOI = 0.01~0.1, adsorbed at 37℃ for 1 hour, discarded the culture supernatant, and washed the cells twice with serum-free MEM medium. The shuttle plasmid pVI75-GFPDR-SN was transfected into virus-infected CEF cells. The method is shown in the kit manual (Invitrogen Lipofectamine 2000). Incubated in a 37℃ CO2 incubator for 24 hours, the transfected virus solution was harvested after freezing and thawing three times.

[0067] 2.3.2 Recombinant virus screening

[0068] Shuttle plasmid pVI75-GFPDR-SN (identification map see Fig.10 ) undergoes homologous recombination with vaccinia virus to make the target gene S and N With marker gene neo and GFP In the presence of G418, homologous recombination did not occur within the molecule due to selection pressure, and the marker gene neo and GFP Temporarily retained in the genome, under a fluorescent microscope, recombinant vaccinia viruses containing both the target gene and expressing GFP can be picked up (vaccinia viruses that have not undergone recombination are inhibited from growing due to the presence of G418). Then, under the condition of no G418, GFP+ recombinant vaccinia viruses are screened because they carry a short fragment of about 200bp. ikB Repeated fragments, and complete ikB Secondary homologous recombination occurs within the molecule, resulting in loss of neo Genes and gfp The recombinant vaccinia virus containing only the target gene was obtained.

[0069] See the virus screening process Fig.11 . The CEF cells in sheets were first pre-cultured with MEM medium containing 0.4 mg / ml G418 for 24 hours. The harvested transfection virus solution was diluted 5-fold in series and inoculated into G418-pretreated CEF cells. After 2 hours, the virus infection solution was aspirated and cultured at 37°C for 48 hours (MEM medium contained 0.4 mg / mL G418 and 1% low-melting point agarose). Pick 5 GFP-positive plaques and add them to 1 ml MEM maintenance solution. Repeated freezing and thawing 3 times, inoculated into G418-pretreated CEF cells after 5-fold serial dilution. Repeated the above process, and the single plaque was purified for 4 generations to obtain a total of 7 fourth-generation GFP+ plaques. The virus picked at this time contains SARS-CoV-2 N and S Target gene, marker gene GFP and neo The 7 fourth-generation GFP+ plaques were all positive by immunohistochemical detection.

[0070] Two strains (SNG1-4-1-1, SNG5-3-1-1) of GFP+ recombinant viruses with strong immunohistochemical signals and large plaques were selected for white spot screening. After repeated freezing and thawing of the plaque-picking solution for 3 times, the CEF cells cultured in six-well plates were infected after serial dilution. After 2 hours, the virus solution was aspirated and discarded, and the cells were cultured at 37°C in low-melting-point agarose MEM medium for 72 hours. 54 non-fluorescent plaques were picked from SNG1-4-1-1, and 63 non-fluorescent plaques were picked from SNG5-3-1-1, which were the first generation of white spot viruses. Immunohistochemical detection of the first generation of white spot virus cells showed that SNW18, SNW31, SNW49, and SNW78 were obviously positive. The positive recombinant virus single plaques were purified for 6 generations, and a total of 15 strains of the 6th generation of white plaques were obtained.

[0071] Immunohistochemistry showed that all 15 recombinant viruses expressed the target gene, among which SNW31-3-1-1-1-1; SNW31-5-1-1-1-3 had significantly higher number of lesions than other strains. The viral genomic DNA of SNW31-3-1-1-1-1; SNW31-5-1-1-1-3 was extracted, and the S and N genes of SARS-COV-2 were amplified. The sequencing results showed that the S and N gene sequences were completely consistent with the expected sequences. The recombinant virus SNW31-3-1-1-1-1 was named VTT-2019nCoV-SN.

[0072] The immunohistochemical method for detecting antigen expression is as follows:

[0073] a) The recombinant virus was used to infect CEF and the culture supernatant was removed after 48 hours of culture.

[0074] b) Fix the cells with methanol:acetone (1:1) solution for 2 min;

[0075] c) Rinse twice with PBS;

[0076] d) Dilute 2019-nCoV NP Antibody (FB-Bio, Cat. No. FB2019NR) 1:1000 with PBS containing 3% fetal bovine serum;

[0077] e) Add 0.1 ml to each well and incubate at room temperature on a rocking platform for 1 hour;

[0078] f) Rinse twice with PBS; 2 min each time.

[0079] g) 3% fetal bovine serum PBS 1:5000 dilution of Goat-Anti-Rabbit IgG-HRP (Cat. No. 4030-05);

[0080] h) Add 0.1 ml to each well and incubate at room temperature on a rocking platform for 30-45 minutes;

[0081] i) Rinse twice with PBS; 2 min each time.

[0082] j) Add colorimetric substrate DAB and incubate at room temperature for 5-10 minutes. Terminate the reaction after plaque coloration.

[0083] 2.3.3. Identification of recombinant viruses

[0084] The identification of the recombinant virus includes detection of the SARS-CoV-2 target gene by PCR, sequencing, and detection of target gene expression by Western Blot.

[0085] (1) PCR detection of SARS-CoV-2 target genes

[0086] The genomic DNA of the recombinant virus VTT-2019nCoV-SN and Tiantan strain was extracted using the QIAamp DNA Blood Mini Kit (250 (51106) kit, and the target gene was amplified by PCR. S and N. The primer sequences are as follows:

[0087] S gene amplification primers:

[0088] 2020CoSF: 5'ATGGACCGGGCCAAGTTATTACTG 3';

[0089] 2020CoSR: 5'TCACTCCTGCAGATCGATCAGGCT 3'.

[0090] N gene amplification primers:

[0091] 2020CoNF: 5'ATGTCTGACAACGGCCCTCAGAAC 3'.

[0092] 2020CoNR: 5'TCAGGCCTGGGTGCTATCGGCGC 3'.

[0093] The results showed that VTT-2019nCoV-SN could specifically amplify 3.6kb and 1.3kb fragments, confirming that the recombinant virus VTT-2019nCoV-SN contained the target gene. S and N, such as Fig.12 shown.

[0094] (2) Sequencing

[0095] PCR primers were designed outside the homologous recombination region of the recombinant poxvirus to amplify the S, N genes and promoter fragments, which were then purified and sent to the company for sequencing.

[0096] The amplified sequence is:

[0097] 2020TKLF: 5'AGCTTTTGGGATCAATAAATGGATC 3'

[0098] 2020TKRR2: 5' GTCACTAGAGTCACATCACGCAATC 3'

[0099] The sequencing results were consistent with the designed sequence, confirming that the S and N genes had not mutated and the promoter sequence was intact.

[0100] (3) Western Blot detection of the expression of the target gene of the recombinant virus VTT-2019nCoV-SN

[0101] VTT-2019nCoV-SN infected CEF cells at a dose of 1PFU / cell. After 24 hours of culture, the cells were harvested and 1ml of protein extraction buffer (1% SDS, 1mmol / L PMSF, 20mmol / L Tris-Cl pH7.0, 1% β-mercaptoethanol) was added. Mix immediately and freeze-thaw three times. Add an equal volume of 2× loading buffer, mix well and boil for 10 minutes. PAGE electrophoresis and transfer to the membrane, block with 5% skim milk at room temperature for 2 hours. 5% skim milk diluted 1:1000 with anti-new crown S protein rabbit serum (Wantai, 6mg / ml), or FB-Bio's 2019-nCoV NP rabbit monoclonal antibody (Cat. No. FB2019NR), 1:1000, incubate at room temperature for 2 hours. Wash the membrane 3 times with PBS, 10 minutes each time. Add the corresponding horseradish peroxidase-labeled rabbit secondary antibody, diluted 1:1000 with 5% skim milk, and incubate at room temperature for 1 hour. Wash the membrane 3 times with PBS, 10 min each time. Add the color developing substrate DAB. After color development, rinse with distilled water to terminate the reaction.

[0102] The results are as follows Fig.13 As shown, the molecular weight of the S protein expressed by VTT-2019nCoV-SN is 134KDa. ( Fig.13 Left), the molecular weight of N protein is 45 KDa ( Fig.13 right).

[0103] Example 3: Study on the immunogenicity of DNA-vaccinia virus vector composite COVID-19 vaccine

[0104] 3.1 Mouse experiments

[0105] Female Balb / c mice aged 6-8 weeks were divided into 3 groups. The immunization schedule is shown in Table 1. DNA vaccines p3.0-Sa and p3.0-N (50ug / dose / plasmid) were injected intramuscularly at 0 and 2 weeks, and recombinant poxvirus vector vaccine VTT-2019nCoV-SN (10 7 PFU / dose). The control group was injected with an equal volume of saline at the corresponding time points. Nine days after the last immunization, blood was collected from the eye sockets, and the mice were killed by cervical dislocation. The spleens of the mice were taken to prepare spleen cell suspensions to detect the specific humoral immunity and cellular immunity of the mice.

[0106] Table 1. Mouse immunization schedule

[0107]

[0108] 3.1.1 Cellular Immunoassay (ELISPOT)

[0109] The concentration of the overlapping peptide library of SARS-CoV-2 S1, S2, and N antigens was 50ug / peptide / ml. The concentration of the freshly prepared spleen cell suspension was adjusted to 2.5×10 6 cells / ml, 100ul of S1, S2 or N peptide library at a concentration of 2ug / ml was added to each well, and then 100ul of spleen cell suspension was added to make the number of cells in each well 2.5×10 5 The cells were cultured in a 37°C CO2 incubator for 16-18 hours and tested according to the instructions of the mouse IFN-γ ELISPOT kit (cat: 551083, BD Company).

[0110] The COVID-19 vaccine induced a strong cellular immune response against S1, S2, and N in mice, with a positive response rate of 100% in the experimental group. DNA vaccine was used for primary immunization, and VTT-2019nCoV-SN was used for booster immunization via the intramuscular route. The average number of spleen cells secreting IFN-γ reached 2793 SFC / 10 6 cells, significantly higher than VTT-2019nCoV-SN immunization via nasal route (681 SFC / 10 6 cells)induced immune response (p<0.0)( Fig.14 ).

[0111] 3.1.2 Cellular Immunity (ICS)

[0112] We also used the ICS method to detect the cellular immunity of mice. The fluorescently labeled antibodies are shown in Table 2.

[0113] Table 2. Mouse ICS detection antibodies

[0114]

[0115] The experimental results showed that the COVID-19 vaccine can induce specific CD4 and CD8 immune responses at the same time, and the intensity of CD8 response is higher than that of CD4. The percentages of CD8+ T cells secreting IFN-γ and TNF-α induced by the muscle group were 1.57% and 0.57%, respectively, and the percentage of CD8+ T cells double positive for IFN-γ and TNF-α was 0.5%. The intensity of the response in the nasal drop group was lower than that in the muscle group ( Fig.15 ).

[0116] 3.1.3 Humoral immunity

[0117] The purified RBD protein and N protein were coated on ELISA plates (coating concentration 1ug / ml), and the specific antibodies in mouse serum (1:100) were detected. The new crown compound vaccine induced RBD and N-specific IgG antibodies in mice. The antibody response of mice in the muscle group was uniform and the reaction intensity was high (anti-RBD average OD 2.15, anti-N average OD 1.83). There were large differences within the nasal drop group, and the reaction intensity (anti-RBD average OD 1.03, anti-N average OD 1.50) was significantly lower than that in the muscle group ( Fig.16 ).

[0118] We then used the new coronavirus neutralizing antibody detection kit (Rejing Bio) to detect neutralizing antibodies in mouse serum according to the instructions. The kit is based on magnetic microparticle chemiluminescent immunoassay technology and uses a competitive method to detect new coronavirus neutralizing antibodies in blood samples. The results were interpreted by calculating the S / CO value, and an S / CO value <1 was positive. The experimental results showed that the positive rate of RBD neutralizing antibodies in the muscle group was 100%, and 40% of the animals in the nasal drop group produced neutralizing antibodies ( Fig.17 ).

[0119] 3.1.4 Study on persistence of immunity

[0120] Female Balb / c mice aged 6-8 weeks were injected intramuscularly with DNA vaccines p3.0-Sa and p3.0-N (50ug / dose / plasmid) at 0 and 2 weeks, and intramuscularly with recombinant poxvirus vector vaccine VTT-2019nCoV-SN (10 7 PFU / dose). The control group was injected with an equal volume of normal saline at the corresponding time points. After blood was collected from the eye sockets 2 weeks, 1 month, 3 months and 6 months after the last immunization, the mice were killed by cervical dislocation, and the spleens of the mice were taken to prepare spleen cell suspensions to detect the specific humoral immunity and cellular immunity of the mice to the new coronavirus. The detection method was the same as before. The T cell immunity induced by the DNA-recombinant vaccinia vector composite vaccine can last for at least 3 months, and the binding antibodies can last for 6 months without a significant decrease, indicating that the composite vaccine can induce a long-lasting immune response against SARS-CoV-2 ( Fig.18 ).

[0121] 3.2 Rabbit immunization experiment

[0122] Two 1.5-2 kg Japanese white rabbits were injected intramuscularly with DNA vaccines p3.0-Sa and p3.0-N (200 ug / dose / plasmid) at 0 and 3 weeks, and with recombinant poxvirus vector vaccine VTT-2019nCoV-SN (10 8 PFU / dose). Blood was collected from the ear vein at 10 weeks to detect specific neutralizing antibodies against COVID-19.

[0123] Live virus neutralization experiment: Rabbit serum collected in 10 weeks was serially diluted and incubated with SARS-CoV-2 live virus strain (NC_045512.2), B.1.351 (Beta strain), P.1 (Gamma strain) or B.1.617.2 (Delta strain) at 37°C for 2 hours, and then the digested Vero cell suspension was added and incubated in a 37°C, 5% CO2 incubator for 7 days to observe the cell lesions. The neutralizing antibody titer was calculated based on the highest serum dilution that could neutralize the corresponding virus and prevent the cells from becoming lesions.

[0124] Table 3. Neutralizing activity of rabbit immune sera

[0125]

[0126] The experimental results show that the serum induced by the composite vaccine can neutralize the original strain of the new coronavirus and multiple mutant strains, with the highest titer against the original strain being 1:192. Although the titer against the mutant strain has decreased, it can still effectively neutralize the Beta, Gamma and Delta strains, indicating that the neutralizing antibodies induced by the vaccine have cross-reactivity and can cope with the mutation of the new coronavirus to a certain extent. Sequence Listing <110> Chinese Center for Disease Control and Prevention STD and AIDS Prevention and Control <120> COVID-19 composite vaccine based on DNA vector and replicating vaccinia virus vector <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1272 <212> DNA <213> SARS-CoV-2 <400> 1 gtcgacatgt ctgacaacgg ccctcagaac cagcggaatg ccccaagaat caccttcggc 60 ggcccctccg attctacagg ctccaaccag aatggagaga ggtccggagc acgctctaag 120 cagcggagac cacagggcct gcccaacaat accgccagct ggttcaccgc cctgacacag 180 cacggcaagg aggacctgaa gtttcccagg ggccagggcg tgcctatcaa caccaatagc 240 tcccctgacg atcagatcgg ctactatagg agggcaacaa ggagaatccg gggaggcgac 300 ggcaagatga aggatctgtc ccccagatgg tacttctact atctgggcac cggacctgag 360 gcaggactgc catatggcgc caataaggac ggaatcatct gggtggcaac cgagggcgcc 420 ctgaacacac caaaggatca catcggcaca cgcaatcccg ccaacaatgc agcaatcgtg 480 ctgcagctgc cacagggcac cacactgccc aagggctttt acgcagaggg cagcagggga 540 ggctcccagg cctctagccg ctcctctagc cggtccagaa actcctctcg gaacagcacc 600 ccaggcagct ccaggggcac aagccctgca agaatggcag gaaacggagg cgacgccgcc 660 ctggccctgc tgctgctgga tagactgaat cagctggagt ctaagatgag cggcaaggga 720 cagcagcagc agggacagac cgtgacaaag aagtctgccg ccgaggccag caagaagcca 780 aggcagaagc gcaccgccac aaaggcctac aacgtgaccc aggccttcgg caggcgcgga 840 ccagagcaga cacagggcaa ttttggcgac caggagctga tcaggcaggg caccgattat 900 aagcactggc ctcagatcgc acagttcgca ccaagcgcct ccgccttctt tggcatgagc 960 aggatcggaa tggaggtgac cccatccggc acatggctga cctacacagg cgccatcaag 1020 ctggacgata aggaccctaa cttcaaggat caggtcatcc tgctgaacaa gcacatcgat 1080 gcctataaga cctttccccc tacagagccc aagaaggaca agaagaagaa ggccgatgag 1140 acccaggccc tgcctcagag acagaagaag cagcagaccg tgacactgct gccagcagca 1200 gacctggacg atttttccaa gcagctgcag cagtctatgt ctagcgccga tagcacccag 1260 gcctgagata tc 1272 <210> 2 <211> 3630 <212> DNA <213> SARS-CoV-2 <400> 2 gtcgacgcca ccatgttcgt gttctggtg ctgctgcctc tggtgagctc cagtgcgtg 60 aacctgacca caaggaccca gctgccccct gcctatacca attccttcac acggggcgtg 120 tactatcccg acaaggtgtt tagatctagc gtgctgcaca gcacacagga tctgtttctg 180 cctttcttt ccaacgtgac ctggttccac gccatccacg tgagcggcac caatggcaca 240 aagcggttcg acaatccagt gctgcccttt aacgatggcg tgtacttcgc cagcaccgag 300 aagtccaaca tcatcagagg ctggatcttt ggcaccacac tggactctaa gacacagagc 360 ctgctgatcg tgaacaatgc caccaacgtg gtcatcaagg tgtgcgagtt ccagttttgt 420 aatgatccat tcctgggcgt gtactatcac aagaacaata agtcctggat ggagtctgag 480 tttcgcgtgt attcctctgc caacaattgt acatttgagt acgtgtccca gcccttcctg 540 atggacctgg agggcaagca gggcaatttc aagaacctga gggagttcgt gtttaagaat 600 atcgatggct acttcaagat ctacagcaag cacaccccaa tcaacctggt gcgcgacctg 660 ccacagggct tctccgccct ggagccactg gtggatctgc ccatcggcat caacatcacc 720 cggtttcaga cactgctggc cctgcacaga agctacctga caccaggcga cagctcctct 780 ggatggaccg caggagcagc agcctactat gtgggctatc tgcagcccag gaccttcctg 840 ctgaagtaca acgagaatgg caccatcaca gacgccgtgg attgcgccct ggatcccctg 900 tccgagacca agtgtacact gaagtctttt accgtggaga agggcatcta tcagacatct 960 aatttcaggg tgcagcctac cgagagcatc gtgcgctttc ccaatatcac aaacctgtgc 1020 ccttttggcg aggtgttcaa cgcaaccagg ttcgcaagcg tgtacgcatg gaataggaag 1080 cgcatcagca actgcgtggc cgactattcc gtgctgtaca acagcgcctc cttctctacc 1140 tttaagtgct atggcgtgtc tcccacaaag ctgaatgacc tgtgctttac caacgtgtac 1200 gccgatagct tcgtgatcag gggcgacgag gtgcgccaga tcgcaccagg acagacaggc 1260 aagatcgcag actacaatta taagctgcct gacgatttca ccggctgcgt gatcgcctgg 1320 aactccaaca atctggattc taaagtgggc ggcaactaca attatctgta ccggctgttt 1380 agaaagtcca atctgaagcc attcgagagg gacatcagca cagagatcta ccaggcaggc 1440 tccaccccat gcaatggagt ggagggcttt aactgttatt tccctctgca gtcttacggc 1500 ttccagccaa caaacggcgt gggctatcag ccctaccgcg tggtggtgct gtcctttgag 1560 ctgctgcacg cacctgcaac agtgtgcgga ccaaagaagt ctaccaatct ggtgaagaac 1620 aagtgcgtga acttcaactt caacggactg accggaacag gcgtgctgac cgagtccaac 1680 aagaagttcc tgccttttca gcagttcggc agggacatcg cagataccac agacgccgtg 1740 cgcgaccctc agaccctgga gatcctggac atcacaccat gcagcttcgg cggcgtgtcc 1800 gtgatcacac caggcaccaa tacaagcaac caggtggccg tgctgtatca ggacgtgaat 1860 tgcaccgagg tgccagtggc aatccacgca gatcagctga cccctacatg gcgggtgtac 1920 tctaccggca gcaacgtgtt ccagacaaga gcaggatgcc tgatcggagc agagcacgtg 1980 aacaattctt atgagtgcga catccctatc ggcgccggca tctgtgccag ctaccagacc 2040 cagacaaaca gcccaaggag agcacggtcc gtggcaagcc agtccatcat cgcctatacc 2100 atgtctctgg gcgccgagaa tagcgtggcc tactccaaca attctatcgc catccctacc 2160 aacttcacaa tctccgtgac cacagagatc ctgccagtgt ctatgaccaa gacaagcgtg 2220 gactgcacaa tgtatatctg tggcgatagc accgagtgct ccaacctgct gctgcagtac 2280 ggcagcttt gtacccagct gaatagagcc ctgacaggca tcgccgtgga gcaggataag 2340 aacacacagg aggtgttcgc ccaggtgaag cagatctaca agaccccacc catcaaggac 2400 tttggcggct tcaacttcag ccagatcctg cccgatccta gcaagccatc caagcggtct 2460 tttatcgagg acctgctgtt caacaaggtg accctggccg atgccggctt catcaagcag 2520 tatggcgatt gcctgggcga catcgccgcc agagacctga tctgtgccca gaagtttaat 2580 ggcctgaccg tgctgcctcc actgctgaca gatgagatga tcgcacagta cacatccgcc 2640 ctgctggcag gcaccatcac atctggatgg accttcggcg caggagccgc cctgcagatc 2700 ccctttgcca tgcagatggc ctatcggttc aacggcatcg gcgtgaccca gaatgtgctg 2760 tacgagaacc agaagctgat cgccaatcag tttaactccg ccatcggcaa gatccaggac 2820 tccctgagct ccacagcctc tgccctgggc aagctgcagg atgtggtgaa tcagaacgcc 2880 caggccctga ataccctggt gaagcagctg tctagcaact tcggcgccat ctcctctgtg 2940 ctgaatgaca tcctgagccg gctggacaag gtggaggcag aggtgcagat cgaccggctg 3000 atcacaggca gactgcagag cctgcagacc tatgtgacac agcagctgat cagggcagca 3060 gagatcaggg catccgccaa tctggcagca accaagatgt ctgagtgcgt gctgggccag 3120 agcaagagag tggacttttg tggcaagggc tatcacctga tgtctttccc acagagcgcc 3180 cctcacggag tggtgtttct gcacgtgacc tacgtgccag cccaggagaa gaacttcacc 3240 acagcaccag caatctgcca cgatggcaag gcacactttc ctagggaggg cgtgttcgtg 3300 tctaacggca cccactggtt tgtgacacag cgcaatttct acgagccaca gatcatcacc 3360 acagacaata catttgtgag cggcaactgt gacgtggtca tcggcatcgt gaacaatacc 3420 gtgtatgatc ctctgcagcc agagctggac tcctttaagg aggagctgga taagtacttc 3480 aagaatcaca cctctcccga cgtggatctg ggcgacatct ccggcatcaa tgcctctgtg 3540 gtgaacatcc agaaggagat cgacaggctg aacgaggtgg ccaagaatct gaacgagagc 3600 ctgatcgatc tgcaggagtg atgagatatc 3630 <210> 3 <211> 5081 <212> DNA <213> Artificial Sequence <400> 3 tcactcctgc agatcgatca ggctctcgtt cagattcttg gccacctcgt tcagtctgtc 60 gatctccttc tggatgttca ccacgctggc attgatgcca gagatgtcgc ccagatccac 120 gtcggggctg gtgtgattct tgaagtactt atccagctcc tccttaaaag agtccagctc 180 tggctgcaga ggatcataca cggtattgtt cacgatgccg atgaccacgt cacagttgcc 240 gctcacgaag gtattgtctg tggtgatgat ctgtggctcg tagaaattgc gctgtgtcac 300 aaaccagtgg gtgccgttgc tcacgaacac gccctcccta ggaaagtgtg ccttgccatc 360 gtggcagatt gctggtgctg tggtgaagtt cttctcctgg gctggcacgt aggtcacgtg 420 cagaaacacc actccgtgag gggcggactg tgggaagctc atcaggtgat agcccttgcc 480 acaaaagtcc accctcttgg actgtcccag cacgcactcg ctcatcttgg tggcggccag 540 attggcagat gccctgatct ctgctgccct gatcagctgc tgtgtcacgt aggtctgcag 600 ggactgcagt ctgcctgtga tcagccggtc gatctgcacc tcggcctcca ccttgtccag 660 cctgctcagg atgtcattca gcacgctaga gatggcgccg aagttggagc tcagctgctt 720 caccagggta ttcagggcct gggcgttctg attcaccaca tcctgcagct tgcccagggc 780 gctggctgta gaggacagag agtcctggat cttgccgatg gcggagttaa actgattggc 840 gatcagcttc tggttctcgt acagcacatt ctgggtcacg ccgatgccgt tgaaccgata 900 ggccatctgc atggcaaaag ggatctgcag ggcggctcct gcgccgaagg tccatccgct 960 tgtgatggtg cctgccagca gggcagatgt gtactgggcg atcatctcat ctgtcagcag 1020 tggaggcagc acggtcaggc cattaaactt ctgggcacag atcaggtccc ttgctgcgat 1080 gtcgcccagg caatcgccat actgcttgat gaagccggca tcggccaggg tcaccttgtt 1140 gaacagcagg tcctcgataa agctcctctt agagggcttg gaaggatcgg gcaggatctg 1200 ggaaaaattg aagccgccaa agtccttgat gggtggggtc ttgtagatct gcttcacctg 1260 ggcgaacacc tcctgtgtgt tcttatcctg ctccactgcg attcctgtca gggcgcgatt 1320 cagctgggta cagaaagagc cgtactgcag cagcaggtta gagcactcgg tggaatcgcc 1380 acagatatac attgtgcagt ccacggatgt cttggtcatg ctcactggca ggatctctgt 1440 ggtcacggag attgtgaagt tggtagggat ggcgatgcta ttgttagagt aggccacgct 1500 gttctcggcg cccaggctca tggtataggc gatgatagac tgggatgcca cagaccttgc 1560 tctccttggg gagtttgtct gggtctggta ggaggcacag atgccggcgc cgatagggat 1620 gtcgcactca tagctattgt tcacgtgctc tgctccgatc aggcatcctg ctcttgtctg 1680 gaacacgttg gagccggtgc tgtacacccg ccatgtaggg gtcagctgat ctgcgtggat 1740 tgccacgggc acctcggtac aattcacgtc ctgatacagc acggccacct ggttgcttgt 1800 attggtgcct ggtgtgatca cagacacgcc gccgaaggag catggtgtga tgtccaggat 1860 ctccagggtc tgagggtcgc gcacggcgtc tgtggtatct gcgatgtccc tgccgaactg 1920 ctgaaaaggc aggaacttct tgttggactc ggtcagcacg cctgtgccgg tcagtccgtt 1980 gaagttgaag ttcacgcact tgttcttcac cagattggtg ctcttctttg gtccgcacac 2040 tgttgcaggt gcgtgcagca gctcaaaaga cagcaccacc actctgtagg gctgatagcc 2100 cacgccgttg gttggctgga agccgtagct ctgcagaggg aaataacagt taaagccctc 2160 cacgccattg cagggggtag agccggcctg gtagatctct gtggagatgt cccgctcgaa 2220 tggcttcaga ttagactttc taaacagccg gtacagataa ttgtagttgc cgcccacttt 2280 gctatccaga ttgttagagt tccaggcgat cacgcagccg gtgaaatcgt caggcagctt 2340 ataattgtag tctgcgatct tgcctgtctg tcctggtgcg atctggcgca cctcgtcgcc 2400 cctgatcacg aaggaatcgg cgtacacgtt ggtaaagcac aggtcattca gctttgtggg 2460 gctcacgcca tagcacttaa aggtgctgaa agaggcggag ttgtacagca cagaatagtc 2520 ggccacgcag ttggagatgc gcttcctatt ccaggcgtac acgctggcga atctggtggc 2580 gttgaacacc tcgccaaaag ggcacaggtt tgtgatattg ggaaagcgca cgatggactc 2640 ggtaggctgc accctgaaat tgcttgtctg atagatgccc ttctccacgg taaagctctt 2700 cagtgtacac ttggtctcag acagggggtc cagtgcgcaa tccactgcgt ctgtgatggt 2760 gccattctcg ttgtacttca gcaggaaggt ccggggctgc agatagccca catagtaggc 2820 tgctgctcct gcggtccatc cgctagagga gtcgcctggt gtcaggtagc ttctgtgcag 2880 ggccagcagt gtctgaaacc gggtgatgtt gatgccgatg ggcagatcca ccagtggctc 2940 cagggcagag aagccctgtg gcaggtctct caccaggttg attggggtgt gcttggagta 3000 gatcttgaag tagccatcga tattcttaaa cacgaactcc cgcaggttct tgaaattgcc 3060 ctgcttgccc tccaggtcca tcaggaaggg ctgggacacg tactcaaatg tacaattgtt 3120 ggcgctagaa tacacccgaa actcgctctc catccaagac ttattgttct tgtgatagta 3180 cacgcccagg aatggatcat tacaaaactg gaactcgcac accttgatga ccacgttggt 3240 ggcattgttc acgatcagca gggactgtgt cttgctgtcc agtgtggtgc caaagatcca 3300 gccgcggatg atgttagact tctcggtgga ggcgaagtac acgccatcgt taaagggcag 3360 cactggattg tcgaacctct ttgtgccatt ggtgccgctc acgtggatgg cgtggaacca 3420 ggtcacgtta gaaaagaaag gcagaaacag atcctgtgtg gagtgcagca cggagcttct 3480 aaacaccttg tcgggatagt acacgccccg tgtgaaggaa ttggtatagg cagggggcag 3540 ctgggttctt gtggtcaggt tcacgcactg tgcctgtggc agcagcagca gcagtaataa 3600 cagtaataac ttggcccggt ccatggtggc ttcgagctta tttatattcc aaaaaaaaa 3660 aataaaattt caatttttaa gctttacatc attccaaacc cacccgcttt ttatagtaag 3720 3780 ctaatttatt gcacggtaag gaagtagatc ataacgccac catgtctgac aacggccctc 3840 agaaccagcg gaatgcccca agaatcacct tcggcggccc ctccgattct acaggctcca 3900 accagaatgg agagaggtcc ggagcacgct ctaagcagcg gagaccacag ggcctgccca 3960 acaataccgc cagctggttc accgccctga cacagcacgg caaggagc ctgaagtttc 4020 ccaggggcca gggcgtgcct atcaacacca atagctcccc tgacgatcag atcggctact 4080 ataggagggc aacaaggaga atccggggag gcgacggcaa gatgaaggat ctgtccccca 4140 gatggtactt ctactatctg ggcaccggac ctgaggcagg actgccatat ggcgccaata 4200 aggacggaat catctgggtg gcaaccgagg gcgccctgaa cacaccaaag gatcacatcg 4260 gcacacgcaa tcccgccaac aatgcagcaa tcgtgctgca gctgccacag ggcaccacac 4320 tgcccaaggg cttttacgca gagggcagca ggggaggctc ccaggcctct agccgctcct 4380 ctagccggtc cagaaactcc tctcggaaca gcaccccagg cagctccagg ggcacaagcc 4440 ctgcaagaat ggcaggaaac ggaggcgacg ccgccctggc cctgctgctg ctggatagac 4500 tgaatcagct ggagtctaag atgagcggca agggacagca gcagcaggga cagaccgtga 4560 caaagaagtc tgccgccgag gccagcaaga agccaaggca gaagcgcacc gccacaaagg 4620 cctacaacgt gacccaggcc ttcggcaggc gcggaccaga gcagacacag ggcaattttg 4680 gcgaccagga gctgatcagg cagggcaccg attataagca ctggcctcag atcgcacagt 4740 tcgcaccaag cgcctccgcc ttctttggca tgagcaggat cggaatggag gtgaccccat 4800 ccggcacatg gctgacctac acaggcgcca tcaagctgga cgataaggac cctaacttca 4860 aggatcaggt catcctgctg aacaagcaca tcgatgccta taagaccttt ccccctacag 4920 agcccaagaa ggacaagaag aagaaggccg atgagaccca ggccctgcct cagagacaga 4980 agaagcagca gaccgtgaca ctgctgccag cagcagacct ggacgatttt tccaagcagc 5040 tgcagcagtc tatgtctagc gccgatagca cccaggcctg a 5081 <210> 4 <211> 408 <212> DNA <213> Artificial Sequence <400> 4 gatccgacgc cgccatctct aggcccgcgc cggccccctc gcacagactt gtgggagaag 60 ctcggctact cccctgcccc ggttaatttg catataatat ttcctagtaa ctatagaggc 120 ttaatgtgcg ataaaagaca gataatctgt tctttttaat actagctaca ttttacatga 180 taggcttgga tttctataag agatacaaat actaaattat tattttaaaa aacagcacaa 240 aaggaaactc accctaactg taaagtaatt gtgtgttttg agactataaa tatcccttgg 300 agaaaagcct tgtttgggga gagcggaagc gtgctgggcc catgaggtct atcactgcat 360 cgacagctag gcggacaatg cttaagccag aggtcgatgg atcttttt 408 <210> 5 <211> 6487 <212> DNA <213> Artificial Sequence <400> 5 tcgacggtaa tgatatgtat caatcggtgt gtagaaagtg ttacatcgac tcataatatt 60 atatttttta tctaaaaaac taaaaataaa cattgattaa attttaatat aatacttaaa 120 aatggatgtt gtgtcgttag ataaaccgtt tatgtatttt gaggaaattg ataatgagtt 180 agattacgaa ccagaagtg aaatgaggt cgcaaaaaa ctgccgtatc aaggacagtt 240 aaaactatta ctagcatatg gggattggtg gcgacgactc ctggagcccg tcagtatcgg 300 cggaattcca gctgagcgcc ggtcgctacc attack ggtctggcga gaccattacc 360 cacatgataa gagattgtat cagtttcgta gtcttgagta ttggtattac tatatagtat 420 atagatgtct agaggatcga tccccatt acaaacact aggaattgg tttataatgt 480 ataattttt tagtttttat agattcttta ttctatactt aaaaatgaa aaaataca 540 aaggttcttg agggttgtgt taaattgaaa gcgagaaata atcataatt atttcattat 600 cgcgatatcc gttaagtttg tatcgtatag atcgggataa ttcctgcagc caatggga 660 tcggccattg aacaagatgg attgcacgca ggttctccgg ccgcttggtt ggagaggcta 720 ttcggctatg acctgggcaca acagacaatc ggctgctg atgccgccgt gttccggctg 780 tcagcgcagg gggcccggt tctttgtc agaccgacc tgtccggtgc cctgaatgaa 840 ctgcaggacg aggcagcgcg gctatcgtgg ctggccacga cggcgttcc ttgcgcagct 900 gtgctcgacg ttgtcactga agcgggaagg gactggctgc tattgggcga agtgccgggg 960 caggatctcc tgtcatctca ccttgctcct gccgagaaag tatccatcat ggctgatgca 1020 atgcggcggc tgcatacgct tgatccggct acctgcccat tcgaccacca agcgaaacat 1080 cgcatcgagc gagcacgtac tcggatggaa gccggtcttg tcgatcagga tgatctggac 1140 gaagagcatc aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc gcgcatgccc 1200 gacggcgatg atctcgtcgt gacccatggc gatgcctgct tgccgaatat catggtggaa 1260 aatggccgct tttctggatt catcgactgt ggccggctgg gtgtggcgga ccgctatcag 1320 gacatagcgt tggctacccg tgatattgct gaagagcttg gcggcgaatg ggctgaccgc 1380 ttcctcgtgc tttacggtat cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt 1440 cttgacgagt tcttctgagg ggatcaattc tctagagctc gctgatcagc ctcgactgtg 1500 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 1560 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 1620 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 1680 gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 1740 agctggggct cgagcctttc attttgtttt tttctatgct ataaatggtg agcaagggcg 1800 aggagctgtt caccggggtg gtgcccatcc tggtcgagct ggacggcgac gtaaacggcc 1860 acaagttcag cgtgtccggc gagggcgagg gcgatgccac ctacggcaag ctgaccctga 1920 agttcatctg caccaccggc aagctgcccg tgccctggcc caccctcgtg accaccctga 1980 cctacggcgt gcagtgcttc agccgctacc ccgaccacat gaagcagcac gacttcttca 2040 agtccgccat gcccgaaggc tacgtccagg agcgcaccat cttcttcaag gacgacggca 2100 actacaagac ccgcgccgag gtgaagttcg agggcgacac cctggtgaac cgcatcgagc 2160 tgaagggcat cgacttcaag gaggacggca acatcctggg gcacaagctg gagtacaact 2220 acaacagcca caacgtctat atcatggccg acaagcagaa gaacggcatc aaggtgaact 2280 tcaagatccg ccacaacatc gaggacggca gcgtgcagct cgccgaccac taccagcaga 2340 acacccccat cggcgacggc cccgtgctgc tgcccgacaa ccaccctg agcacccagt 2400 ccgccctgag caagacccc aacgagaagc gcgatcacat ggtcctgctg gagttcgtga 2460 ccgccgccgg gatcactctc ggcatgcacg agctgtacaa gtaagagcgg atccttctgt 2520 gagcgtatgg aaacgaagg aaaatagtt atagtagccg cactcgatgg gatattca 2580 cgtaaaccgt ttatatat ttgaatctt attccattat ctgaaatggt ggtaaaacta 2640 actgctgtgt gtatgaatg ctttaaggag gcttcctttt ctaaacgatt gggtgaggaa 2700 accgagatag aaataatagg aggtaatgat atgtatcaat cggtgtgtag aaagtgttac 2760 atcgactcat ttttatcta aaaaactaa aaaacatt gattaaattt 2820 taatataata cttaaaaatg gatgttgtgt cgttagataa accgtttatg tattttgagg 2880 aaattgataa tgagttagat tacgaaccag aaagtgcaaa tgaggtcgca aaaaaactgc 2940 cgtatcagg acagttaaaa ctattactag gagaattatt tttctagt aagttacagc 3000 gandacggtat attagatggt gccaccgtag tgtatatagg atctgctccc ggtacacata 3060 tacgttattt gagagatcat ttctataatt taggagtgat catcaaatgg atgctaattg 3120 acggccgcca tcatgatcct attttaaatg gattgcgtga tgtgactcta gtgactcggt 3180 tcgttgatga ggaatatcta cgatccatca aaaaacaact gcatccttct aagattattt 3240 taatttctga tgtgagatcc aaacgaggag gaaatgaacc tagtacggcg gatttactaa 3300 gtaattacgc tctactaaat gtcatgatta gtattttaaa ccccgtggcg tctagtctta 3360 aatggagatg cccgtttcca gatcaatgga tcaaggactt ttatatccca cacggtaata 3420 aaatgttaca accttttgct ccttcatatt cagctgaaat gagattatta agtatttata 3480 ccggtgagaa catgagactg actcgggccg cgttgctggc gtttttccat aggctccgcc 3540 cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 3600 tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 3660 tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcaat 3720 gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 3780 acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 3840 acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 3900 cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 3960 gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 4020 gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggtttttt gtttgcaagc 4080 agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 4140 ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga tttcaaaaa 4200 ggatcttcac ctagatcctt ttaaattaaa aatgaagtttt taaatcaatc taaagtatat 4260 atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 4320 tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 4380 gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 4440 ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 4500 caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 4560 cgccagttaa tagtttgcgc aacgttgttg ccattgctgc aggcatcgtg gtgtcacgct 4620 cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat 4680 cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 4740 agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca 4800 tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat 4860 agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaac acgggataat accgcgccac 4920 atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 4980 ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt 5040 cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 5100 caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc cttttcaat 5160 attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt 5220 agaaaaataa acaaataggg gttccgcgca cattccccg aaagtgcca cctgacgtct 5280 aagaaaccat tattatcatg acattaacct aaaaatag gcgtatcacg aggcctttc 5340 gtcttcgaat aaatacctgt gacggagat cacttcgcag aaaataa tcctggtgtc 5400 cctgttgata ccgggaagcc ctgggccac tttggcga aatgagacgt tgatcggcac 5460 gtaagaggtt ccaactttca ccataatgaa ataagatcac taccggcgt atttttgag 5520 tttcgagat ttcaggagc taaggagct aaaatggaga aaaaaatcac tggatatacc 5580 accgttgata tatcccaatg gcatcgtaaa gacattttg agcattca gtcagttgct 5640 caatgtacct ataccagac cgttcagagc ttttgggatc aaaatgga tcacaccag 5700 tatctcttaa cgatgttctt cgcagatgat gattcatttt ttaagtattt ggctagtcaa 5760 gatgatgaat cttcattatc tgatatattg caatcactc atatcta ctttctgtta 5820 ttattattga tccaatcaa aaataatta gaagccgtgg gtcattgtta tgaatctctt 5880 tcagaggaat acagacaatt gtcaaatttc acagacttc aagatttta aaaactgttt 5940 aacaaggtcc ctattgttac agatggaagg gtcaaactta ataaaggata tttgttcgac 6000 tttgtgatta gtttgatgcg attcaaaaaa gaatcctctc tagctaccac cgcaatagat 6060 cctgttagat acatagatcc tcgtcgcaat atcgcatttt ctaacgtgat ggatatatta 6120 aagtcgaata aagtgaacaa taattaattc tttattgtca tcatgaacgg cggacatatt 6180 cagttgataa tcggccccat gttttcaggt aaaagtacag aattaattag acgagttaga 6240 cgttatcaaa tagctcaata taaatgcgtg actataaaat attctaacga tatagttac 6300 ggaacgggac tatggacgca tgataagaat aatttgaag cattggaagc aactaaacta 6360 tgtgatctct tggaatcaat tacagatttc tccgtgatag gtatcgatga aggacagttc 6420 tttccagaca ttgttgaatt agatcgataa aaattaatta attacccggg taccaggcct 6480 agtactg 6487

Claims

1. A recombinant vaccinia virus that simultaneously expresses a segment of the S gene and a full-length segment of the N gene of a novel coronavirus, characterized in that: The deposit number of the recombinant vaccinia virus is CGMCC 21955, the deposit date is September 28, 2021, the deposit classification name is VTT-2019nCoV-SN, and the deposit unit is the General Microbiology Center of the China Culture Collection Administration.

2. Use of the recombinant vaccinia virus according to claim 1 in the preparation of a new coronavirus vaccine.

3. An immunization kit containing the recombinant vaccinia virus according to claim 1, characterized in that: The vaccination kit also contains a DNA vector expressing the extracellular segment of the S gene of the new coronavirus, and a DNA vector expressing the full-length segment of the N gene of the new coronavirus. The nucleotide sequence of the full-length segment of the N gene in the DNA vector expressing the full-length segment of the N gene of the new coronavirus is shown as SEQ ID NO.1, and the nucleotide sequence of the extracellular segment of the S gene in the DNA vector expressing the extracellular segment of the S gene of the new coronavirus is shown as SEQ ID NO.

2. The DNA vector expressing the full-length segment of the N gene of the new coronavirus contains a DNA sequence that can be transcribed to produce ssRNA with immune activation function as shown in SEQ ID NO.

4.

4. The immunization kit according to claim 3, characterized in that: The DNA vector expressing the extracellular segment of the S gene of the new coronavirus and the DNA vector expressing the full-length segment of the N gene of the new coronavirus are prepared as injections, and the recombinant vaccinia virus is prepared as injections or nasal drops.

Images