Novel beta-amylase and its application and preparation method

Abstract

The present invention aims to obtain β-amylase that is heat-resistant even at high temperatures exceeding 60° C. β-amylase-producing bacteria were screened from soil samples to obtain β-amylases derived from new Bacillushalosaccharovorans strains and new B.halosaccharovorans strains that are new β-amylases with heat resistance.

Description

Technical Field

[0001] The present invention relates to novel beta-amylase and application and preparation method thereof. Background Art

[0002] Starch is an important source of nutrition for organisms. Like cellulose, it is one of the polysaccharides that exist in large quantities on the earth. The structure of starch includes amylose, which is obtained by polymerizing glucose into straight chains with α-1,4 bonds, and amylopectin, which is obtained by branching amylose with α-1,6 bonds.

[0003] When natural starch is suspended in water and heated, the molecules of amylose and amylopectin disperse into a starch solution or starch paste. In contrast to such heated gelatinized starch, starch with a natural crystal / granular structure is called raw starch. The crystal structure of raw starch can be destroyed by heating to hydrate it.

[0004] Amylase is a general term for enzymes that hydrolyze the α-1,4 and α-1,6 bonds of amylose and amylopectin in starch.

[0005] Amylase can be roughly divided into two categories based on the mode of action, namely endo-amylase and exo-amylase. α-amylase is called endo-amylase, which is an enzyme that randomly hydrolyzes the glucose chains of starch. β-amylase is called exo-amylase, which acts on polysaccharides such as starch or glycogen, which are polymerized by α-1,4 bonds, and decomposes them in maltose units from the non-reducing end.

[0006] β-amylase is used for maltose preparation and food processing due to its property of generating maltose from starch. β-amylase has been found in sweet potato, wheat, barley, soybean, etc., and is known to be an enzyme widely distributed in higher plants. On the other hand, although it has long been believed that β-amylase from microorganisms does not exist, β-amylase possessed by microorganisms has been discovered one after another since the 1970s (Non-patent Document 1).

[0007] Prior art documents

[0008] Patent Literature

[0009] Patent Document 1: Japanese Patent Publication No. 2011-036237

[0010] Non-patent literature

[0011] Non-patent document 1: Starch and related sugars test method (1989)

[0012] Non-patent document 2: Applied Glycoscience Vol. 1 No. 2 194-200 (2011) Summary of the invention

[0013] Plant-derived β-amylase can be prepared at a relatively low cost, so plant raw materials have been mainly used in the industrial production of β-amylase so far. However, with the global population increase and the increase in demand for biofuels such as bioethanol as a renewable resource in recent years, the demand for grains and grain prices have tended to rise worldwide. In view of this, it is uncertain whether grains, which are the raw materials of plant-derived β-amylase, can be supplied cheaply and stably in the future.

[0014] Although beta-amylases from microorganisms have been discovered one after another, few have been put into practical use. This is because the heat resistance and production volume of beta-amylases from microorganisms reported so far are low, and most of the producing bacteria are classified as pathogens and are not suitable for use as food. Amano Enzyme Co., Ltd. is barely able to sell beta-amylase from Bacillus flexus as an industrial enzyme (Patent Document 1, Non-Patent Document 2).

[0015] Although the heat resistance of the β-amylase derived from Bacillus flexus is relatively high compared with β-amylase derived from other microorganisms, it is lower than the heat resistance of the enzyme derived from soybean, which has the best heat resistance among plants, and cannot be said to have sufficient heat resistance. In addition, it is known that the enzyme derived from soybean, which has excellent heat resistance, also has low decomposition activity for raw starch.

[0016] Generally, when starch is decomposed by amylase in industry, the starch is heated once. However, from the viewpoint of recent energy conservation, it is desired to directly and efficiently subject raw starch to an enzyme reaction without heating for gelatinization.

[0017] Therefore, there is a demand for the development of non-pathogenic β-amylase derived from microorganisms.

[0018] The inventors of the present invention surprisingly found that the non-pathogenic strain Bacillushalosaccharovorans No. 58 newly isolated by the inventors produces a β-amylase with higher heat resistance than strains derived from cereals and from microorganisms.

[0019] Therefore, the present invention provides the bacterium identified by deposit number NITE BP-02937.

[0020] In addition, the present invention provides β-amylase produced by the bacterium identified by the deposit number NITE BP-02937.

[0021] In addition, the present invention provides a β-amylase consisting of the following amino acid sequence,

[0022] (i) the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 12;

[0023] (ii) an amino acid sequence in which one to several amino acid residues are deleted, substituted, inserted and / or added in the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 12; or

[0024] (iii) an amino acid sequence having a sequence identity of 90% or more to the amino acid sequence described in SEQ ID NO: 2 or SEQ ID NO: 12.

[0025] Furthermore, the present invention provides a β-amylase, referring to the amino acid sequence recorded in SEQ ID NO: 2, wherein the β-amylase comprises one or more selected from the group consisting of a substitution of threonine at the position corresponding to amino acid number 4 to proline, a substitution of threonine at the position corresponding to amino acid number 15 to lysine or arginine, and a substitution of glutamine at the position corresponding to amino acid number 306 to aspartic acid.

[0026] Furthermore, the present invention provides a β-amylase consisting of the following amino acid sequence,

[0027] (i) the amino acid sequence of any one of SEQ ID NOs: 18 to 25;

[0028] (ii) an amino acid sequence in which one to several amino acid residues are deleted, substituted, inserted, and / or added in any one of the amino acid sequences set forth in SEQ ID NOs: 18 to 25; or

[0029] (iii) an amino acid sequence having a sequence identity of 90% or more to any one of the amino acid sequences described in SEQ ID NOs: 18 to 25.

[0030] Furthermore, the present invention provides a DNA encoding the above-mentioned β-amylase.

[0031] Furthermore, the present invention provides a DNA encoding a protein having β-amylase activity, wherein the DNA is

[0032] (i) the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 13;

[0033] (ii) a base sequence that is 90% or more identical to the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 13;

[0034] (iii) A DNA that hybridizes under stringent conditions with the DNA represented by the base sequence shown in (i) or (ii).

[0035] Furthermore, the present invention provides a DNA encoding a protein having β-amylase activity, wherein the DNA has any one of (i) and (ii), or is (iii).

[0036] (i) the base sequence described in any one of SEQ ID NOs: 26 to 33;

[0037] (ii) a base sequence having a sequence identity of 90% or more to the base sequence described in any one of SEQ ID NOs: 26 to 33;

[0038] (iii) A DNA that hybridizes under stringent conditions with the DNA represented by the base sequence shown in (i) or (ii).

[0039] Furthermore, the present invention provides a DNA consisting of a degenerate sequence of the base sequences shown in SEQ ID NO: 1, SEQ ID NO: 13, and SEQ ID NOs: 26 to 33.

[0040] Furthermore, the present invention provides a vector comprising the above-mentioned DNA.

[0041] Furthermore, the present invention provides a microorganism comprising a vector having the above-mentioned DNA.

[0042] Furthermore, the present invention provides a method for producing β-amylase, comprising the step of extracting β-amylase from a culture of the above-mentioned bacterium or the above-mentioned microorganism.

[0043] Furthermore, the present invention provides a method for preparing maltose, characterized in that starch is treated with the above-mentioned β-amylase.

[0044] Furthermore, the present invention provides a method for producing maltose, characterized in that starch is treated with the above-mentioned bacteria or the above-mentioned microorganisms.

[0045] Furthermore, the present invention provides a method for producing maltose, characterized in that raw starch is treated with the above-mentioned β-amylase.

[0046] Furthermore, the present invention provides a method for modifying food using the above-mentioned bacteria, the above-mentioned β-amylase, or the above-mentioned microorganism.

[0047] The present invention also provides an enzyme agent using the above-mentioned bacteria, the above-mentioned β-amylase, or the above-mentioned microorganism.

[0048] According to the present invention, a novel β-amylase having no pathogenicity is provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 These are the results of TLC analysis of starch degradation products in the culture supernatant of the candidate strain.

[0050] Figure 2 This is a graph showing the temperature stability of amylase in the culture supernatant of No. 58 strain at 60°C.

[0051] Figure 3This is a graph showing the relationship between the amount of reducing sugar produced by various amylases and the relative KI / I2 value.

[0052] Figure 4 This is the result of subjecting purified β-amylase to SDS-PAGE.

[0053] Figure 5 The present invention provides the base sequence and the deduced amino acid sequence of the β-amylase gene.

[0054] Figure 6 This is a graph showing the optimum pH of β-amylase derived from strain No.58.

[0055] Figure 7 This is a graph showing the pH stability of β-amylase derived from No.58 strain.

[0056] Figure 8 This is a graph showing the optimum temperature of β-amylase derived from strain No.58.

[0057] Fig. 9 The results are compared for the residual enzyme activities of five types of β-amylases including β-amylase derived from strain No. 58 when heat-treated at 60°C.

[0058] Fig.10 The results are compared for the residual enzyme activities of five types of β-amylases including β-amylase derived from strain No. 58 when heat-treated at 65°C.

[0059] Fig.11 This is a graph showing the decomposition rate of raw starch when raw starch derived from wheat is enzymatically treated with three types of β-amylase including β-amylase derived from strain No. 58.

[0060] Fig.12 This is a graph showing the decomposition rate of raw starch when raw starch derived from corn is enzymatically treated with three types of β-amylase including β-amylase derived from strain No. 58.

[0061] Fig.13 This is the result of subjecting the purified β-amylase mutant enzyme to SDS-PAGE.

[0062] Fig.14 This is a graph showing the temperature stability of amylase at 65°C among β-amylase mutant enzymes. DETAILED DESCRIPTION

[0063] Properties of β-amylase

[0064] The enzyme according to the present invention is β-amylase, which is an enzyme that decomposes α-1,4 glycosidic bonds in glucose polysaccharide in starch in maltose units from the non-reducing end.

[0065] The β-amylase produced by strain No. 58 has the following properties.

[0066] (1) The substrate of the β-amylase of the present invention is not limited to starch. The β-amylase of the present invention can react with, for example, amylose, amylopectin, glycogen, and dextrin.

[0067] (2) The molecular weight of the enzyme is approximately 60,000 Da.

[0068] (3) The optimum temperature of the enzyme is about 50°C. When the enzyme is reacted with the substrate at about 37°C to 60°C and pH 7.0 for 10 minutes, it shows an activity that is 70% or more of the activity at 50°C. In addition, the enzyme does not lose its activity even after treatment at 60°C for 75 minutes. Even after treatment at 65°C for 30 minutes, it still has 40% of the activity at 50°C.

[0069] (4) The optimum pH of the enzyme is about 7.0. When the enzyme was reacted with the substrate at pH 6.0-9.0 and 37°C for 10 minutes, it showed a residual activity of more than 80% compared to the activity at pH 7.0. In addition, when the enzyme was left at pH 5.0-9.0 and 4°C for 16 hours, the pH was returned to 7.0 and the enzyme was allowed to react with the substrate at 37°C for 10 minutes, it also showed a residual activity of more than 80% compared to the activity of the sample left at pH 7.0 and 4°C for 16 hours.

[0070] (5) It has activity on raw starch, and can decompose 65% of raw starch from wheat in a 24-hour reaction at 60°C and pH 7.0. It can also decompose 27% of raw starch from corn in an 8-hour reaction at 70°C and pH 7.0.

[0071] (6) The decomposition of starch produces only maltose.

[0072] The beta amylase of the present invention may be an amino acid sequence shown in sequence number 2 or sequence number 12, or an amino acid sequence in which one to several amino acid residues are deleted, substituted, inserted and / or added in the amino acid sequence shown in sequence number 2 or sequence number 12, or a beta amylase consisting of an amino acid sequence having a sequence identity of 90% or more with the amino acid sequence recorded in sequence number 2 or sequence number 12. The identity of the amino acid sequence is preferably 95%, more preferably 99% or more. In addition, as long as the beta amylase of the present invention has beta amylase activity, it may be in the form of a fusion protein added to other proteins, or it may be in the form of being fixed on a resin such as beads. As fusion proteins, for example, proteins bound to debranching enzymes, isoamylases, pullulanases, glucosidases, glucoamylases, α-amylases, proteases, lipases, phosphatases, xylanases, and proteins fused to histidine (His) tags, maltose binding protein (MBP) tags and glutathione S-transferases (GST) for purification may be cited. Substitutions are preferably conservative substitutions. Conservative substitution refers to substitutions in which the properties of the substituted amino acid, such as acidity and alkalinity, do not change. Specifically, it refers to substitutions between Phe, Trp, and Tyr, substitutions between Leu, Ile, and Val, substitutions between Lys, Arg, and His, substitutions between Asp and Glu, and substitutions between Ser and Thr. In particular, regarding the deletion of the N-terminus and / or C-terminus of the amino acid sequence, as long as the enzymatic activity is equivalent to that of the beta amylase having the amino acid sequence shown in sequence number 2, there is no restriction on the number of amino acids deleted at the N-terminus and / or C-terminus of the amino acid sequence, and such deletions can be easily obtained without trial and error. Here, "one to several" can be, for example, 1-9, preferably 1-8, more preferably 1-6, more preferably 1-5, more preferably 1-4, more preferably 1-3, or more preferably 1-2.

[0073] In addition, if the substitution site is one or more selected from the group consisting of a substitution of threonine at amino acid position 4 to proline (SEQ ID NO. 18), a substitution of threonine at amino acid position 15 to lysine (SEQ ID NO. 19), a substitution of threonine at amino acid position 15 to arginine (SEQ ID NO. 20), or a substitution of glutamine at amino acid position 306 to aspartic acid (SEQ ID NO. 21) in the amino acid sequence recorded in SEQ ID NO. 2, or a substitution of threonine at amino acid position 33 to proline (SEQ ID NO. 22), a substitution of threonine at amino acid position 44 to lysine (SEQ ID NO. 23), a substitution of threonine at amino acid position 44 to arginine (SEQ ID NO. 24), or a substitution of glutamine at amino acid position 335 to aspartic acid (SEQ ID NO. 25) in the amino acid sequence recorded in SEQ ID NO. 12, a β-amylase having better heat resistance can be obtained.

[0074] In addition, the β-amylase of the present invention may be a β-amylase consisting of an amino acid sequence recorded in any one of SEQ ID NOs. 18 to SEQ ID NOs. 25, or an amino acid sequence in which one to several amino acid residues are deleted, substituted, inserted and / or added in any one of SEQ ID NOs. 18 to SEQ ID NOs. 25, or an amino acid sequence having a sequence identity of 90% or more with an amino acid sequence recorded in any one of SEQ ID NOs. 18 to SEQ ID NOs. 25. These sequences preferably have the above-mentioned substitutions. The identity of the amino acid sequence is preferably 95%, more preferably 99% or more.

[0075] The identity in the present invention refers to the ratio (percentage) of identical bases or amino acids at corresponding positions between the two sequences when the two sequences as the comparison objects are aligned in a manner of maximum consistency. Identity means that the following function can be used to represent two sequences.

[0076] Identity (%) = (the number of identical bases or amino acids at corresponding positions between the two sequences) / (the total number of bases or amino acids in the reference sequence × 100)

[0077] The analysis of amino acid sequences or the comparison of the identity of two or more amino acid sequences can be performed using an analysis program commonly used by those skilled in the art. For example, the analysis of amino acid sequences can be performed using GENETYX-WIN Ver.7, and the search for the identity of amino acid sequences can be performed using the BLAST search of NCBI (http: / / www.ncbi.nlm.nih.gov / ). As with the amino acid sequences, the base sequences can be analyzed and searched using an analysis program commonly used by those skilled in the art.

[0078] The enzyme activity measurement of the amylase of the present invention is not particularly limited as long as the method can quantitatively measure the enzyme decomposition of the substrate and the sugars obtained after the decomposition. For example, the measurement can be performed using a reducing sugar quantitative method such as the Somogyi-Nelson method.

[0079] The enzymatic reaction product of the amylase of the present invention can be detected by a qualitative detection method when the purpose is only to detect the sugar contained, unlike the quantitative detection method described above. This is not particularly limited as long as the sugars contained in the analyte can be determined, for example, a detection method using thin layer chromatography (TLC) can be considered.

[0080] The β-amylase of the present invention can have an activity of at least 80% compared to the β-amylase that has not been heat-treated even when the β-amylase is heat-treated at 60°C for 10 minutes. Furthermore, the present enzyme can have an activity of at least 80% compared to the β-amylase that has not been heat-treated even when the β-amylase is heat-treated at 60°C for 20, 40, or 80 minutes.

[0081] The β-amylase of the present invention may also have raw starch decomposition activity. Raw starch in the present invention refers to starch in a state that has not been subjected to a heat treatment. Unlike starch that is gelatinized by heating, raw starch has a crystalline / granular structure. The crystalline structure of raw starch can be destroyed by heating to hydrate it. The heating temperature varies depending on the type of raw starch. For example, the gelatinization temperature of starch from wheat or corn is high, and the gelatinization temperature needs to be heated above 80°C.

[0082] The starch used as the substrate of the enzyme does not depend on a specific organism, and for example, soybean, adzuki bean, barley, wheat, corn, rice, potato, sweet potato, kudzu, fern, mung bean, broad bean, lotus root, cassava, sago palm, dogtooth flower, etc. can be used.

[0083] A specific example of the bacteria obtained by the present invention is the bacterium Bacillus halosacchalovorans No. 58 (also referred to as "No. 58 strain" in this specification) deposited in the Patent Microorganism Depository of the Independent Administrative Institution Product Evaluation Technology Foundation (Room 122, 2-5-8, Kazusa Kamashi, Kisarazu City, Chiba Prefecture, Japan) with the deposit number NITE BP-02937 on April 12, 2019. The No. 58 strain is characterized in that it is an aerobic bacterium with a rod-shaped cell morphology and forms cream-colored colonies and spores.

[0084] This strain is non-pathogenic and therefore can be suitably used in food and the like.

[0085] The β-amylase having the amino acids described in SEQ ID NO: 2 according to the present invention is obtained from strain No. 58. Strain No. 58 has the DNA sequence shown in SEQ ID NO: 1 and has a β-amylase as a protein having the amino acid sequence of SEQ ID NO: 2.

[0086] The beta amylase of the present invention, such as strain No. 58, can be obtained by culturing a bacterium having the DNA shown in sequence number 1, or a vector containing the sequence, or a recombinant having the sequence integrated therein. The cultivation of strain No. 58 and the recombinant can generally be carried out by a method for producing amylase by a person skilled in the art. In addition, the microorganism commonly used by a person skilled in the art can also be used as a host microorganism. There is no particular limitation on the host microorganism, and for example, non-pathogenic Escherichia coli, yeast, actinomycetes, algae, lactic acid bacteria, Bacillus subtilis, etc. can be used.

[0087] The culture conditions can be appropriately adjusted to the optimum according to the host and the expression system. There are no particular restrictions on the culture medium, as long as the cultured object can proliferate. The culture medium can be solid or liquid, but preferably liquid.

[0088] As a more specific example, the β-amylase gene is inserted into an E. coli expression vector, and the E. coli is transformed. The obtained transformant is inoculated into 2 ml of 2×TY medium containing antibiotics as required, and shaken and cultured at 30° C. for 24 hours to obtain bacterial cells. After the bacteria are collected, they are ultrasonically disrupted, thereby obtaining β-amylase in the disrupted liquid.

[0089] As the solid culture medium, for example, biomass derived from plant resources such as fruit residues of bananas, apples, oranges, etc., beans such as soybeans, and residues of vegetable oils can be considered.

[0090] In the present invention, culture refers to a mixture containing a substrate or its reactant and cultured bacteria in which microorganisms are added to a culture substrate for culture. The culture includes, but is not limited to, cultured microorganisms (inoculated microorganisms and microorganisms proliferated by the microorganisms), culture medium, culture medium supplements / additives, and substances secreted by the cultured microorganisms. All or part of the culture may be liquid or solid. The liquid culture is also referred to as a culture fluid. The culture preferably contains at least one of the cultured microorganisms and secretions from the cultured microorganisms. The culture is preferably a culture fluid.

[0091] The DNA of the present invention is a DNA encoding the above-mentioned β-amylase.

[0092] In addition, the DNA of the present invention is a DNA encoding a protein having β-amylase activity, wherein the DNA may be a DNA having any one of (i) and (ii),

[0093] (i) the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 13;

[0094] (ii) a base sequence that is 90% or more identical to the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 13;

[0095] Alternatively, it is a DNA that hybridizes with the DNA represented by the base sequence shown in (i) or (ii) under stringent conditions.

[0096] Regarding the base sequence, "identical" is as described above. Stringent conditions are generally known to those skilled in the art, and for example, conditions of hybridization at 68°C in the commercially available hybridization solution ExpressHyb Hybridization Solution (Takara Bio) or conditions of hybridization at about 65°C using a filter immobilized with DNA in the presence of 0.7M to 1.0M NaCl, followed by washing at about 65°C using a 0.1-2 times concentrated SSC solution (1×SSC solution: 150mM NaCl, 15mM sodium citrate, pH 7.0). The base sequence preferably has a base sequence that is 95% or more, more preferably 99% or more identical to the base sequence shown in SEQ ID NO. 1 or SEQ ID NO. 13.

[0097] The substitution site of the DNA sequence can be, for example, selected from the group consisting of a substitution in which the 97th adenine base in sequence number 1 is changed to a cytosine base (sequence number 26), a substitution in which the 131st cytosine base in sequence number 1 is changed to an adenine base (sequence number 27), a substitution in which the 130th adenine base in sequence number 1 is changed to a cytosine base, the 131st cytosine base is changed to a guanine base, and the 132nd adenine base is changed to a cytosine base (sequence number 28), a substitution in which the 1003rd cytosine base in sequence number 1 is changed to a guanine base, and the 1005th adenine base is changed to a cytosine base (sequence number 29), or a substitution in which the 130th adenine base in sequence number 1 is changed to a cytosine base (sequence number 21). By replacing the adenine base at position 10 of sequence number 13 with cytosine (sequence number 30), replacing the cytosine base at position 44 of sequence number 13 with adenine base (sequence number 31), replacing the adenine base at position 43 of sequence number 13 with cytosine base, the cytosine base at position 44 with guanine base, and the adenine base at position 45 with cytosine base (sequence number 32), replacing the cytosine base at position 916 of sequence number 13 with guanine base, and the adenine base at position 918 with cytosine base (sequence number 33), a β-amylase with better heat resistance can be obtained.

[0098] In addition, the DNA of the present invention is a DNA encoding a protein having β-amylase activity, and the DNA may be a DNA having any one of (i) and (ii), or a DNA having (iii).

[0099] (i) a base sequence described in any one of SEQ ID NOs: 26 to 33;

[0100] (ii) a base sequence having a sequence identity of 90% or more, preferably 95% or more, and more preferably 99% or more to any one of the base sequences described in SEQ ID NOs: 26 to 33;

[0101] (iii) A DNA that hybridizes under stringent conditions with a DNA consisting of the base sequence shown in (i) or (ii).

[0102] In addition, the DNA of the present invention may also be a DNA consisting of a degenerate sequence of the base sequences recorded in sequence numbers 1, 13, and 26 to 33. Here, degeneracy means that there are multiple codons encoding one amino acid. Therefore, for example, when one of the amino acids in the degenerate sequence is arginine, the base sequence of the degenerate sequence may be a sequence corresponding to any one of the six codons encoding arginine (CGU, CGC, CGA, CGG, AGA, AGG).

[0103] The DNA of the present invention can be processed using a genetic engineering method commonly performed by those skilled in the art. The DNA sequence shown in SEQ ID NO: 1 can be obtained by PCR treatment using corresponding primers, or by total synthesis based on sequence information.

[0104] The DNA of the present invention can also be provided in the form of a vector having the DNA of the present invention. The vector is not limited as long as it satisfies the purpose of integrating the gene commonly used by those skilled in the art, for example, pBluescriptII SK(+) vector and pBluescriptII SK(-) vector can be used.

[0105] The present invention provides a microorganism comprising a vector having the DNA of the present invention. The microorganism as a host is not particularly limited as long as it is a microorganism commonly used as a host for a vector by those skilled in the art, and for example, non-pathogenic Escherichia coli, yeast, actinomycetes, algae, lactic acid bacteria, Bacillus subtilis, etc. can be used.

[0106] The invention also provides a method for preparing the beta-amylase.

[0107] The β-amylase of the present invention can also be obtained by isolating it from a culture solution of a microorganism containing β-amylase. The isolation method can be carried out by a method commonly used by those skilled in the art. The preparation method includes the steps of culturing the bacterial cells and extracting the β-amylase from the culture or the cultured bacterial cells.

[0108] The step of culturing the cells is to culture the No. 58 strain or the recombinant microorganism containing the DNA of the present invention. The host of the recombinant is not particularly limited as long as it can be cultured and can express protein, for example, non-pathogenic Escherichia coli, yeast, actinomycetes, algae, lactic acid bacteria, Bacillus subtilis, etc. can be used.

[0109] The culture conditions can be appropriately adjusted to the optimum according to the host and the expression system. The culture medium is not particularly limited as long as the cultured object can proliferate. The culture medium can be solid or liquid, but is preferably liquid.

[0110] The culture method is not particularly limited as long as it is a method that allows the culture object to grow, and for example, static culture, shaking culture, anaerobic culture, etc. can be used.

[0111] For example, when No. 58 strain is used, the following conditions can be mentioned: The culture medium used includes liquid culture medium for amylase-producing bacteria, 2×TY medium (described in Tables 1 and 2 in Examples), LB medium, Nutrient Agar medium (Difco), and the like.

[0112] The pH of the culture medium is preferably 6.0-9.0, more preferably pH 7.0.

[0113] The culture temperature is preferably 20-50°C, more preferably 45°C.

[0114] Under aerobic conditions, the culture can be carried out by static culture, shaking culture or rotation culture.

[0115] In the step of recovering beta amylase from a culture or cultured bacterial body, a purification step can be utilized to purify from a culture or cultured bacterial body containing beta amylase to obtain beta amylase. The enzyme purification method is not particularly limited as long as beta amylase can be obtained from a culture or cultured bacterial body. For example, the culture supernatant is supplied to centrifugation or filter filtration, and after removing bacterial bodies or solids, the enzyme can be purified by combining the extraction or concentration of an ultrafiltration filter, salting out, or chromatography using a column, adsorption using activated carbon, etc. As the column used, as long as it is a column that can be separated from other proteins or impurities without inactivating the enzyme, it is not particularly limited, and an anion exchange chromatography column, a cation exchange chromatography column, a hydrophobic interaction chromatography column, a gel filtration chromatography column, an affinity chromatography column, etc. can be cited. For example, a TOYOPEARL Butyl-650M column as a hydrophobic interaction chromatography column and a TOYOPEARLDEAE-650M column as an anion exchange chromatography column are used.

[0116] The detection of the crudely purified or purified protein can be carried out by any method that is not particularly limited as long as the protein contained in the sample can be separated and detected. For example, a method using electrophoresis such as SDS-PAGE can be used.

[0117] The buffer used for enzyme activity determination or enzyme purification described later can be appropriately changed according to the purpose of the experiment. The property of the buffer preferably does not affect the activity and stability of the enzyme. As the buffer, for example, Tris-HCl can be used.

[0118] When cultured bacterial cells are used, the method for producing β-amylase of the present invention further comprises a step of extracting β-amylase from the cultured bacterial cells.

[0119] The method for extracting β-amylase from cultured bacteria is not particularly limited and can be any method known to those skilled in the art. β-amylase can be obtained by, for example, solubilizing the bacteria (ultrasonic disruption) to destroy a part or the whole of the cell surface structure (e.g., cell membrane). The bacteria used for extraction can be live bacteria or dead bacteria.

[0120] Since the β-amylase of the present invention produces only maltose from starch, the production of maltose becomes easy according to the method for producing the β-amylase of the present invention.

[0121] The present invention also provides a method for preparing maltose, characterized in that starch is treated with the beta-amylase of the present invention.

[0122] The enzyme treatment of starch is generally carried out on the starch that heats and gelatinizes the raw starch, so the saccharification process is carried out before the enzyme treatment. The heating temperature varies according to the type of raw starch, but the gelatinization temperature of the starch from wheat or corn is high. At this time, if a beta amylase with low heat resistance is used, the enzyme is inactivated due to the heat of the heated starch, so it is necessary to cool the heated gelatinized starch to a temperature suitable for the enzyme reaction. Thus, during the saccharification treatment of starch, the cooling cost of heating the starch is generated, and cooling time is also generated. In addition, when the substrate is cooled and reacted, the risk of bacterial reproduction also increases.

[0123] Since the beta amylase of the present invention has high heat resistance, it can reduce the cooling cost of starch and / or shorten the cooling time, so that it can be applied to the saccharification treatment of starch. Due to the high heat resistance of the beta amylase, it can be added to the starch after the heat treatment, and then it can also be added to the starch during the heat treatment. The temperature and pH after adding the beta amylase are not particularly limited as long as the enzyme can decompose the starch as described in the above enzyme properties. The beta amylase of the present invention can be added at a temperature below 70°C for the temperature of the starch as a substrate, or it can be added at a temperature above 60°C and below 70°C. Starch as a substrate for the enzyme does not depend on a specific organism, for example, soybeans, adzuki beans, barley, wheat, corn, rice, potatoes, sweet potatoes, kudzu, ferns, mung beans, broad beans, lotus roots, cassava, sago palms, and pig's teeth can be used. The enzyme reaction can be terminated by inactivating the enzyme by reheating or pH adjustment.

[0124] The β-amylase of the present invention can produce maltose from starch. Since the β-amylase of the present invention produces only maltose from starch, the present invention makes it easy to produce maltose.

[0125] The present invention also provides a method for preparing maltose, which is characterized in that starch is treated with the microorganism of the present invention.

[0126] When strain No.58 is cultured, β-amylase is released from the bacteria into the culture solution as an extracellular enzyme. Therefore, when strain No.58 is co-cultured with starch, β-amylase is released outside the bacteria, and the released β-amylase can react with starch to produce maltose. In this way, as long as the β-amylase of the present invention can be released as an extracellular enzyme, the cultured bacteria is not limited to strain No.58, and it can also be a recombinant microorganism having strain No.58 β-amylase. The culture conditions at this time are not particularly limited as long as they are conditions that can culture microorganisms, and substances other than starch necessary for growth may also be contained.

[0127] Even if it is a microorganism that does not release β-amylase outside the bacteria, as long as starch is taken into the bacteria, the starch is converted into maltose by the β-amylase in the bacteria, and the maltose is released outside the bacteria, the recombinant microorganism used is not limited to microorganisms that can release β-amylase as an extracellular enzyme, but microorganisms that release β-amylase outside the bacteria are preferred.

[0128] The microorganism having the β-amylase of the present invention can produce maltose from starch. Since the microorganism having the β-amylase of the present invention produces only maltose from starch, the production of maltose becomes easy.

[0129] The present invention also provides a method for preparing maltose, characterized in that raw starch is treated with the β-amylase of the present invention.

[0130] The previous beta amylase has low activity on raw starch and is not suitable for directly using raw starch as a substrate. The beta amylase of the present invention can be applied to the enzyme treatment of raw starch because it maintains high enzyme activity on raw starch. The state of raw starch is not particularly limited as long as the enzyme can react, and is preferably suspended in an aqueous solution. The temperature and pH after adding beta amylase are not particularly limited as long as the enzyme can decompose starch as described in the above-mentioned enzyme properties. Starch as a substrate for the enzyme does not depend on a specific organism, for example, soybeans, adzuki beans, barley, wheat, corn, rice, potatoes, sweet potatoes, kudzu, ferns, mung beans, broad beans, lotus roots, cassava, sago palms, and dogtooth flowers can be used. The enzyme reaction can be terminated by inactivating the enzyme by heating or pH adjustment.

[0131] By using the β-amylase of the present invention, maltose can be produced from raw starch.

[0132] The present invention also provides a method for modifying food using the β-amylase of the present invention or the microorganism of the present invention.

[0133] Modification of food refers to changing the characteristics of food. In the present invention, it refers to making the properties of foods containing polysaccharides with α-1,4 glycosidic bonds such as starch into a preferred form. For example, by combining the enzyme of the present invention in bread dough before baking, the touch of bread dough can be improved, the bread volume can be increased, the aging of bread products can be prevented (maintaining softness), the baking color of frozen or refrigerated bread dough can be prevented from turning red, and the softness of rice cakes can be maintained. The food that can be used is not particularly limited, and preferably contains starch and other polysaccharides with the above-mentioned α-1,4 glycosidic bonds. For example, dough for bread, rice cakes, donuts, pies, pizzas, steamed buns, etc. As raw materials, it is not limited to raw materials from wheat, and soybeans, red beans, barley, corn, rice, potatoes, sweet potatoes, kudzu, ferns, mung beans, broad beans, lotus roots, cassava, sago palms, pig's teeth, etc. can be used.

[0134] The beta amylase according to the present invention can be preferably used for food modification operations because of its heat resistance and activity on raw starch. In addition, since strain No.58 only has beta amylase as an extracellular enzyme, excessive starch decomposition or Maillard reaction that occurs when alpha amylase or glucoamylase is used in bread dough will not occur. Therefore, strain No.58 is extremely useful as a source of purified beta amylase used therein. In addition, when the product is only maltose, it has the advantage of being able to make the food have a mellow taste. The heat resistance of the enzyme also has the advantage of being easy to control the substrate reaction. Since the optimal pH of most beta amylases from plants is on the acidic side, a pH regulator is mostly required for enzyme treatment. Unlike this, the optimal pH of this enzyme is near neutral 7, so a pH regulator may not be required. Since the activity of the enzyme on raw starch can act on ungelatinized starch, it can also be used for a wide range of starch products and substrates containing starch.

[0135] In addition, although the enzyme has excellent heat resistance, it does not have enzymatic activity at high temperatures above 80°C, and the enzyme activity is lost at high temperatures above 80°C. Due to this property, when the enzyme is mixed with bread dough and baked, the enzyme activity can be lost during the baking process. This can be easily prepared by allowing the enzyme to react with the substrate only during the time from the start of baking to the middle of the baking process when the enzyme is desired to react, and finally the enzyme activity is lost.

[0136] The present invention also provides the form of an enzyme preparation containing the beta amylase of the present invention or the microorganism of the present invention. The enzyme in the enzyme preparation can be a purified enzyme or a crude enzyme stage such as a culture supernatant. The enzyme agent can be composed of only a beta amylase monomer or can be appropriately formulated with additives within the range that does not significantly damage its enzyme properties. As the form of the enzyme preparation, tablets, pills, powders, granules, capsules, liquids, etc. can be cited. The enzyme preparation can be encapsulated in a sprayer (such as a sprayer) and can also contain other enzymes in addition to beta amylase.

[0137] Examples of the enzyme contained together with the present enzyme include debranching enzyme, isoamylase, pullulanase, glucosidase, glucoamylase, α-amylase, protease, lipase, phosphatase, xylanase, and the like, and one or more of these enzymes may be used in combination.

[0138] Examples of additives include binders (gum arabic, gelatin, sorbitol, tragacanth gum, polyvinyl pyrrolidone, etc.), fillers (lactose, sugar, calcium phosphate, sorbitol, glycine, etc.), disintegrants (crystalline cellulose, etc.), non-aqueous excipients (almond oil, fractionated coconut oil, or oily esters such as glycerol, propylene glycol, polyethylene glycol, ethanol, etc.), preservatives (methyl or propyl paraben, sorbic acid, tocopherol, etc.), pH adjusters (sodium bicarbonate, potassium carbonate, citrate, acetate, etc.), thickeners (methyl cellulose, etc.), antioxidants (vitamin C, vitamin E, etc.), flavors (synthetic flavors, natural flavors, esters, etc.), emulsifiers (lecithin, sorbitan monooleate, sucrose fatty acid esters, etc.), swelling agents (ammonium carbonate, etc.), suspending agents (syrup, gelatin, hydrogenated edible fats, etc.), and the like.

[0139] This enzyme agent can be widely used for the purpose of decomposing polysaccharides such as starch having α-1,4 glycosidic bonds into maltose units to produce maltose, and for the purpose of modifying food. For example, the enzyme agent can be added to dough materials such as bread, rice cakes, donuts, pies, pizzas, and steamed buns. In addition, it can be added to cereals such as wheat, soybeans, adzuki beans, barley, corn, rice, potatoes, sweet potatoes, kudzu, ferns, mung beans, broad beans, lotus roots, cassava, sago palms, and dogtooth flowers, or their crushed products. Before adding the enzyme agent, pre-treatments such as crushing or heating, and drug treatment can be performed. The treatment conditions after adding the enzyme agent can be appropriately determined by a person skilled in the art.

[0140] Hereinafter, the present invention will be described in detail by way of examples, but the present invention is not limited to these examples.

[0141] Experiment 1: Screening and identification of bacteria with thermostable β-amylase

[0142] Thermotolerant bacteria producing β-amylase were isolated and purified from soil samples. The soil used as the screening source was obtained from soil in Osaka Prefecture. Starch-assimilating strains were isolated from the soil. The isolated strains were cultured in a medium for amylase-producing bacteria (Table 1).

[0143] [Table 1]

[0144]

[0145] The basic pH is 7.0, and the medium composition and pH are changed according to the experiment. When used for screening, adjust the pH to 7.0, add 1.0% gellan gum to the above composition, and use it after solidification on the plate.

[0146] Take 1 platinum loop of the isolated starch assimilating strain and inoculate it into a test tube containing 6 ml of liquid culture medium for amylase production bacteria, and shake culture at 60°C for 3 days. After the culture is completed, the culture supernatant is recovered by centrifugation of the culture solution (3200 rpm, 10 minutes, 4°C) and used as a crude enzyme sample. Add 100 μl of substrate solution (1.5% soluble starch (Merck), 100 mM pH7.0 Tris-HCl, 5 mM CaCl2) to 100 μl of this crude enzyme sample and react overnight at 37°C. 5 μl of the reaction solution after the reaction is subjected to thin layer chromatography.

[0147] Thin layer chromatography (TLC)

[0148] Silica gel 60F254 (manufactured by Merck) was used as the silica gel plate used for thin layer chromatography.

[0149] The developing solvent used was 1-butanol / ethanol / chloroform / 25% (w / w) ammonia solution: (4 / 5 / 2 / 8, v / v / v / v).

[0150] Maltose was detected by spraying a detection solution (concentrated sulfuric acid containing 1% vanillin) three times onto the developed silica gel plate and heating it at 120°C for several minutes to cause color development.

[0151] The results of TLC are as follows Figure 1 As shown. The screening results obtained several maltose-producing strains. Through detailed investigation of these strains, it was confirmed that one strain only produced maltose from soluble starch ( Figure 1 : No. 58 in the frame. (c is a control). Thus, strain No. 58 with a high maltose production ability was obtained.

[0152] Amylase activity determination (reducing sugar quantitative method)

[0153] Place 100 μl of enzyme sample (culture supernatant or crude purified or purified enzyme described later) in a test tube and pre-incubate at 37°C for 10 minutes. Add 100 μl of substrate solution (1.5% soluble starch, 100 mM Tris-HCl, 5 mM CaCl2, pH 7.0, 37°C) and react at 37°C for 10 minutes. The enzyme reaction is stopped by adding 400 μl of DNS solution (0.5% dinitrosalicylic acid, 0.4 N NaOH, 30% potassium sodium tartrate tetrahydrate). Next, boil the mixed solution at 100°C for 5 minutes, cool it with cold water for 5 minutes, add 1.8 ml of distilled water and stir. For the stirred solution, measure the absorption at 480 nm using a spectrophotometer. The product of the reaction with distilled water instead of the enzyme sample is used as a blank, and the measured value of the blank is subtracted from the measured value of the enzyme sample. One unit (U) of enzyme activity is defined as the amount of enzyme that generates 1 μmol of maltose in 1 minute. The enzyme reactions in the following experiments were performed using this method unless otherwise specified.

[0154] The protein concentration was determined by measuring the absorbance at 280 nm using a spectrophotometer.

[0155] Confirmation of β-amylase

[0156] The temperature stability of the amylase possessed by the obtained No.58 strain was evaluated. The obtained No.58 strain was cultured, and the culture supernatant was recovered as a culture supernatant sample. The appropriately diluted culture supernatant sample was added to a microtube, and after being kept warm at 60°C, samples were taken after 10, 20, 40, and 80 minutes, and cooled on ice. The residual enzyme activity of the cooled sample was measured by quantifying the amount of reducing sugar produced, and the temperature stability of the obtained amylase at 60°C was evaluated. In addition, as a control, a sample was treated in the same manner using β-amylase from Brevibacillus sp.TMK-672 strain (TBA strain). The results are as follows Figure 2 The data are expressed as relative values, with the value at treatment time of 0 min being 100%. Figure 2 No. 58 represents the strain of the present invention, and TBA represents a comparative object. Furthermore, whether the obtained amylase is β-amylase was confirmed by determining the relationship between the amount of reducing sugar produced and the relative KI / I2 value.

[0157] The relative KI / I2 value was determined as follows.

[0158] Place 200μl of the enzyme solution in a test tube, pre-incubate at 37°C for 10 minutes, add 400μl of the substrate solution that was also pre-incubated, react at 37°C for 10 minutes, and stop the reaction by adding 1ml of the reaction stop solution (a mixture of 0.5N acetic acid and 0.5N HCl in a ratio of 5:1). Place 200μl of the reaction solution after the reaction is stopped in another test tube, add 5ml of iodine solution (0.005% I2, 0.05% KI), and measure the absorption at 660nm with a spectrophotometer after 20 minutes. The relative KI / I2 value when the reducing sugar amount is 0 is taken as 100%. Appropriately change the concentration of the measured sample, and plot the value relative to the value obtained by the aforementioned reducing sugar quantification method. As a positive control for α-amylase, α-amylase from human saliva is used, and as a positive control for β-amylase, β-amylase from the TMK-672 strain is used for comparison to determine whether the amylase from the obtained strain is β-amylase. The results are as follows. Figure 3 shown. Figure 3 HSA stands for alpha amylase from human saliva.

[0159] from Figure 2 The results show that the enzyme from strain No. 58 had no activity reduction at all during the period of investigation and was an enzyme with very high temperature stability. Figure 3 The results showed that the enzyme from strain No. 58 had the same pattern as the β-amylase from strain TMK-672, and thus the enzyme was a β-amylase that cleaved the starch chain in maltose units from the non-reducing end of the starch chain.

[0160] Preparation of chromosomal DNA

[0161] Strain No.58 was inoculated into 100 ml of 2×TY liquid medium (Table 2), cultured at 37°C for 2 days, and the cells were recovered by centrifugation (6,000 rpm, 10 minutes, 4°C). Then, the cells were suspended in 9 ml of Solution I (50 mM glucose, 25 mM Tris-HCl, EDTA, pH 8.0), and several mg of lysozyme were added and incubated at 37°C for more than 2 hours.

[0162] [Table 2]

[0163]

[0164] The pH was adjusted to 7.0.

[0165] According to the experiment, 100 μg / ml of ampicillin was added to the culture medium.

[0166] Then, add 10% SDS solution to Solution I containing cultured bacteria to a final concentration of 0.5%, and shake for 10 minutes. Furthermore, add 5M NaCl solution to the mixed solution to a final concentration of NaCl of 0.7M or more, and shake for 10 minutes. Then, perform phenol / chloroform extraction, centrifuge the obtained phenol / chloroform-added solution (13,500rpm, 10 minutes, 4°C), separate it into an aqueous layer and an oil layer, and recover the aqueous layer. Add 12ml of ice-cold 2-propanol to the obtained recovery, invert and mix, and then use a Pasteur pipette to absorb and recover the DNA precipitate. Wash the DNA twice with 30ml of 70% ethanol, transfer it to a new tube, dry it under reduced pressure, and then suspend it in 500μl of TE buffer (10mM Tris-HCl, 1mM EDTA, ph8.0). Add 5 μl of RNase A solution (10 mg / ml) to the suspension, incubate at 37°C for 30 minutes, and then perform phenol / chloroform extraction again. Add 50 μl of 3M sodium acetate and 500 μl of ice-cold 2-propanol and place on ice for 10 minutes. Use a Pasteur pipette to absorb the DNA precipitate and recover it, wash it twice with 1 ml of 70% ethanol, then transfer it to an empty tube, dry it under reduced pressure and dissolve it in 300 μl of TE buffer.

[0167] Acquisition and analysis of 16S rRNA

[0168] The 16S rRNA gene was amplified by PCR. The extracted chromosomal DNA was used as the template, and the forward primer (5'-AGRRTTTGATYHTGGYTCAG3', sequence number 3) and the reverse primer (5'-TGACGGGCGGTGTGTACAAG-3', sequence number 4) designed based on the highly conserved region in the bacterial 16S rRNA gene were used as the primers. The PCR amplification of the 16S rRNA region was performed using PrimeSTAR HS DNA polymerase (manufactured by Takara Bio), and the temperature cycle was performed for 30 cycles with 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 90 seconds. The obtained PCR product was inserted into pBluescript II SK(+) (manufactured by Stratagene) digested with EcoR V, and after transformation in Escherichia coli, the plasmid was extracted. Sequencing analysis was entrusted to Eurofins Genomics. The base sequence was analyzed using GENETYX-WIN Ver. 7 (GENETYX), and the base sequence identity was searched using BLAST search of NCBI (http: / / www.ncbi.nlm.nih.gov / ).

[0169] Through these analyses, the strain No. 58 of the present invention was identified as Bacillus halosaccharovorans No. 58 strain (No. 58 strain). The strain was deposited in the Patent Microorganism Collection Center of the Independent Administrative Institution for Product Evaluation and Technology Foundation (Room 122, 2-5-8, Kazusa Kamashi, Kisarazu City, Chiba Prefecture, Japan) on April 12, 2019. The deposit number is NITE BP-02937.

[0170] Experiment 2 Purification of β-amylase

[0171] Large-scale cultivation of No.58 strain and preparation of crude enzyme solution

[0172] 6.5 ml of the No. 58 strain solution cultured at 45° C. for 48 hours was inoculated into 8 2.0 L conical flasks filled with 650 ml of a medium in which the composition of the medium for amylase production bacteria was changed to 1.5% dextrin, 0.3% peptone, 0.3% yeast extract, and 0.3% CaCl2, and cultured at 45° C. for 48 hours. The culture solution of No. 58 strain was centrifuged (9,000 rpm, 60 minutes, 4° C.), and the culture supernatant was recovered as a crude enzyme solution.

[0173] The protein concentration was determined by measuring the absorbance at 280 nm using a spectrophotometer.

[0174] Purification by TOYOPEARL Butyl-650M column

[0175] To 5.0 L of the obtained culture supernatant, 570 g of ammonium sulfate was added little by little while stirring to dissolve until 20% saturation. After dissolution, the supernatant was recovered by centrifugation (10,800 rpm, 60 minutes, 4°C). The recovered supernatant was injected into 100 ml of TOYOPEARL Butyl-650M equilibrated with 20 mM Tris-HCl buffer (pH 7.0) containing 20% ​​saturated ammonium sulfate, and washed with 2.0 L of the buffer. The adsorbed material was eluted with a reverse linear gradient (1.0 L) of 20 mM Tris-HCl buffer (pH 7.0) containing 20-0% saturated ammonium sulfate, and fractionated every 10 ml. The activity of each fraction was measured, and the fraction showing β-amylase activity was recovered, and ammonium sulfate was added and dissolved to 80% saturation concentration, and precipitated at 4°C overnight. It was centrifuged (10,800 rpm, 30 minutes, 4°C), and the precipitate was recovered. The recovered precipitate was dissolved in a small amount of 20 mM Tris-HCl buffer (pH 7.0), and dialyzed against a large excess of 20 mM Tris-HCl buffer (pH 7.0) using a dialysis membrane.

[0176] Purification by TOYOPEARL DEAE-650M column

[0177] The obtained dialyzed sample was injected into TOYOPEARL DEAE-650M (100 ml) equilibrated with 20 mM Tris-HCl buffer (pH 7.0), washed with 500 ml of the buffer, and then eluted with a linear gradient (1.0 L) of 20 mM Tris-HCl buffer (pH 7.0) containing 0-300 mM NaCl, and separated in 10 ml fractions. The activity of each fraction was measured, and the fraction showing β-amylase activity was recovered, and after ammonium sulfate precipitation, dialyzed against a large excess of 20 mM Tris-HCl buffer (pH 7.0).

[0178] SDS-PAGE

[0179] SDS-PAGE was performed according to the method of Laemmli (Laemmli UK, Nature, 227, 680-685, 1970).

[0180] A polyacrylamide gel (acrylamide: N,N'-methylenebisacrylamide = 29.2:0.8) consisting of a separation gel of 12.5% ​​and a concentration gel of 5.0% was prepared. A 6× sample buffer (0.375M Tris-HCl, 60% glycerol, 6% 2-mercaptoethanol, 0.003% bromophenol blue, pH 6.8) was added to the sample and treated at 100°C for 10 minutes. Using a vertical plate electrophoresis apparatus (manufactured by ATTO), the sample after adding 6× sample buffer and heating was added to the polyacrylamide gel and electrophoresed at a constant current of 20 mA in a running buffer (0.1% SDS, 25mM Tris, 192mM glycine). After electrophoresis, staining was performed in a CBB solution (0.2% Coomassie Brilliant Blue R-250, 50% ethanol, 10% acetic acid) and decolorization was performed with a decolorizing solution (10% methanol, 7.5% acetic acid). Protein Molecular Weight Marker (Broad) (manufactured by Takara Bio) was used as a protein molecular weight marker.

[0181] The results of this series of purification experiments are shown in Table 3.

[0182] [Table 3]

[0183]

[0184] The results of SDS-PAGE of the purified enzyme obtained from a series of purification experiments are shown in Figure 4 shown. Figure 4It was shown that a single band showing a molecular weight of 59.4 kDa was obtained by purification, and the enzyme could be purified as a single enzyme. The purified enzyme was then used.

[0185] β-Amylase Sequence Analysis

[0186] N-terminal amino acid sequence analysis

[0187] After using the purified sample for SDS-PAGE, gently shake the gel in blotting solution C (0.02% SDS, 25mM Tris, 20% methanol, 25mM boric acid) for 5 minutes. Prepare 6 filter papers cut to the size of the gel, immerse 2 sheets each in blotting solution A (0.02% SDS, 300mM Tris, 20% methanol), blotting solution B (0.02% SDS, 25mM Tris, 20% methanol), and blotting solution C, and shake for 15 minutes. In addition, cut the PVDF membrane (manufactured by MILLIPORE) into the size of the gel, shake it in methanol for 10 minutes, and then immerse it in blotting solution C for 15 minutes. Next, from the negative electrode side of the semi-dry blotting apparatus (manufactured by Bio-Rad), overlap 2 filter papers (blotting solution C), gel, PVDF membrane, 2 filter papers (blotting solution B), and 2 filter papers (blotting solution A) in this order, with 1 cm per column. 2 The gel was electrophoresed at a constant current of 2 mA for 50 minutes to transfer the protein to the PVDF membrane. The transferred PVDF membrane was gently washed with ultrapure water, stained with Ponceau S staining solution (0.1% Ponceau S, 5% acetic acid) for 5 minutes, and then decolorized with ultrapure water. The target band was cut off, recovered in a tube and dried. Sequence analysis was entrusted to the analysis entrustment service of the Global Equipment Center of Hokkaido University.

[0188] The analysis results of the N-terminal amino acid sequence show that it is H2N-Glu-Ile-Lys-Thr-Asp-Tyr-Lys-Ala-Ser-Val-.

[0189] Cloning of β-amylase gene

[0190] The β-amylase gene was amplified by PCR. The chromosomal DNA of strain No. 58 prepared by the method described in Experiment 1 was used as a template, and the forward primer (5'-GTNTGGTGGGGNTAYGTNGA-3': sequence number 5) and the reverse primer (5'-GGRTTRTTCATYTGCCARTG-3': sequence number 6) designed based on the highly conserved region in bacterial β-amylase were used as primers. PCR amplification was performed using PrimeSTAR HS DNA polymerase (manufactured by Takara Bio), and the temperature cycle was performed for 30 cycles of 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 50 seconds. The obtained PCR product was ligated to pBluescript II SK(-) digested with restriction enzyme EcoRV and transformed into Escherichia coli. It was inoculated into 2 ml of 2×TY medium (supplemented with 100 μg / ml ampicillin) and cultured at 30°C with shaking for 24 hours. The plasmid was extracted from the transformed Escherichia coli, and the plasmid was confirmed to contain the β-amylase sequence by sequence analysis. Using the obtained gene-containing plasmid as a template, primers PS-F (5'-GGCAGCCCAGGTAATTTCTAC-3': sequence number 7) and PS-R (5'-GGAGGGTTGACTTCACTCCA-3': sequence number 8) designed from the determined β-amylase gene sequence were used to synthesize a DIG (digoxigenin) labeled probe. The genomic DNA of strain No. 58 was digested overnight with 10 restriction enzymes (Sac I, BamH I, Xba I, Sal I, Sph I, Hind III, Bgl II, Spe I, Nhe I, Xho I) and EcoR I and Kpn I, which have cleavage sites in the obtained gene, respectively, and Southern blot analysis was performed using the synthesized probe. Thus, owing to estimate in the gene fragment of about 6.3kb Bgl II digestion, comprise the target gene full length, collect the gene fragment of about 6.3kb suitable Bgl II digestion, it is connected on the pBluescript II SK (-) with BamH I restriction enzyme digestion, and be transformed in the intestinal bacteria.Screen by the PCR method of the primer that uses when probe preparation, obtain the plasmid that contains the target gene.After subclone into pBluescript II SK (-) with various restriction enzyme digestion, carry out sequence analysis.

[0191] The results of sequence analysis are as follows Figure 5As shown. It can be seen that the obtained sequence consists of 2536bp (sequence number 11), of which this gene consists of an open reading frame (ORF) consisting of 1,659bp (sequence number 1), and there is a promoter region consisting of a ribosome binding site (RBS) 6bp upstream of the start codon, a -10 region near 56bp upstream, and a -35 region near 82bp upstream.

[0192] As a result of analyzing the deduced amino acid sequence, it was found that the gene is synthesized as a precursor protein consisting of 552 amino acids (sequence number 12, the corresponding base sequence is sequence number 1). There is a sequence that is completely consistent with the amino acid sequence of the determined N-terminal region, in which there is a signal sequence consisting of 29 amino acids (underlined in the figure), and the mature protein is composed of 523 amino acids. The molecular weight calculated from the amino acid sequence is 59,403 (sequence number 2, the corresponding base sequence is sequence number 13). It has been found that the mature protein is composed of a catalytic domain classified as Glycoside hydrolasefamily 14 (GH14) in the N-terminal region and a substrate binding domain classified as Carbohydrate-binding module 20 (CBM20) in the C-terminal region.

[0193] Study on the properties of β-amylase

[0194] Optimum pH and pH stability

[0195] In order to determine the optimum pH of β-amylase, the purified enzyme was reacted with the substrate in a 50 mM universal buffer (McIlvaine buffer) at pH 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.2, 8.5, 9.0, 9.5, 10.0, and 10.75, except for the pH, and the enzyme activity was measured by the same method as the above-mentioned amylase activity measurement. In addition, in order to confirm the pH stability, the enzyme solution was added to a 50 mM universal buffer at pH 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.2, 8.5, 9.0, 9.5, 10.0, and 10.75, and each mixed solution was left to stand at 4° C. for 16 hours. The mixed solution was diluted 10 times with 100 mM Tris-HCl buffer (pH 7.0) to return its pH to 7.0. The diluted mixed solution was reacted at 37°C for 10 minutes in the same manner as the above amylase activity determination, and the residual activity was determined. Figure 6 The results of the tests related to pH stability are shown in Figure 7 As shown. Figure 6 , Figure 7In the figure, the vertical axis is the relative activity value with the maximum activity value measured as 100%. Figure 6 It can be seen that the enzyme exhibits maximum activity around pH 7.0. Figure 7 It can be seen that the enzyme exhibits a residual activity of more than 80% in the pH range of 5.0-9.0.

[0196] Optimum temperature and temperature stability

[0197] In order to determine the optimum temperature of β-amylase, the enzyme solution was allowed to react with the substrate for 10 minutes at various temperatures of 37-70°C, and the enzyme activity was measured using the same method as the above-mentioned amylase activity measurement except for the temperature. In addition, the temperature stability was measured by treating the enzyme solution (20mM Tris-HCl buffer, pH7.0) at 37, 45, 50, 55, 60, 65, and 70°C for 30 minutes, cooling it, and reacting it at 37°C for 10 minutes using the same method as the above-mentioned amylase activity measurement. In addition, for 60°C and 65°C, the residual activity was measured using a time course of treatment time (15, 30, 45, 60, and 75 minutes), and the same measurement was performed on soybean β-amylase, β-amylase from Brevibacillus sp.TMK-672, β-amylase from Bacillus cereus, and β-amylase from barley, and the results were compared. The results of the optimum temperature measurement are shown in the figure below. Figure 8 As shown in Figure 2, the residual activity of each β-amylase at 60°C is as follows Fig. 9 As shown in Figure 2, the residual activity of each β-amylase at 65°C is as follows Fig.10 shown. Figure 8 The relative activity values ​​were expressed relative to each temperature, with the maximum activity value measured being 100%. Fig. 9 , Fig.10 In the graph of the treatment time, the relative values ​​are shown with the value of the treatment time of 0 minutes being 100%. Figure 8 It can be seen that the optimum temperature of the enzyme is close to 50°C. Fig. 9 It can be seen that the activity decreases in the order of β-amylase from barley, β-amylase from Bacillus, and β-amylase from Brevibacillus sp.TMK-672, and about 80% of residual activity is shown after treatment with β-amylase from soybean, which is known to have heat resistance, for 60-80 minutes. On the other hand, β-amylase from No. 58 strain shows better heat resistance than β-amylase from soybean, and 100% of residual activity is maintained after heat treatment in this experiment. Fig.10It can be seen that the residual activity after heat treatment at 65°C for 30 minutes is about 25% for the soybean-derived enzyme and about 40% for the enzyme derived from strain No. 58. From these values, it can be seen that the β-amylase of the present invention exhibits superior heat resistance to that of β-amylase derived from soybean and the like even at 65°C.

[0198] Amylolytic activity

[0199] An experiment was conducted to compare the decomposition activity of β-amylase on raw starch. As raw starch, raw starch from corn and raw starch from wheat were used. 1.0 mg / ml of each raw starch was reacted in the presence of 20 mM Tris-HCl buffer (pH 7.0), 5 mM CaCl2, and 0.1 μg / ml of enzyme, and the reaction was stopped by adding an appropriate amount of the reaction solution to a test tube containing 0.4 ml of DNS solution, and the raw starch decomposition activity was evaluated by the reducing sugar quantitative method described in Experiment 1. As β-amylase, the β-amylase of the present invention, the β-amylase from barley, and the β-amylase from soybean were used respectively. It is known that the β-amylase from barley has the activity of decomposing raw starch, and the β-amylase from soybean has a weak activity on raw starch, but has high heat resistance. The starch from wheat reacted at 60°C, and the starch from corn reacted at 70°C. The reaction results for the starch from wheat are as follows. Fig.11 The results of the reaction to corn starch are shown in Fig.12 As shown. Fig.11 It was found that barley-derived β-amylase and soybean-derived β-amylase had almost no decomposition activity on raw starch derived from wheat, whereas the β-amylase of the present invention decomposed raw starch by 65% ​​within 24 hours. Fig.12 The results are similar. The β-amylase from barley and the β-amylase from soybeans showed almost no decomposition activity against corn raw starch, while the β-amylase of the present invention decomposed raw starch by 27% in 8 hours. From these results, it can be seen that the enzyme decomposes raw starch well under high temperature conditions, while the enzyme from barley, which has relatively high raw starch decomposition activity, cannot react. In addition, the enzyme from soybeans, which has high temperature stability but weak raw starch decomposition activity, did not decompose raw starch. From these results, it can be seen that the β-amylase of strain No. 58 has a high ability to decompose raw starch, and its activity is also highly heat-resistant.

[0200] Experiment 5

[0201] Expression of β-amylase gene in Escherichia coli

[0202] Heterologous expression of the β-amylase gene from strain No. 58 in E. coli. To express the β-amylase gene in E. coli, first, a DNA fragment containing the coding region and ribosome binding site of the β-amylase gene was amplified by PCR using the plasmid containing the β-amylase gene as a template and primers RBS-F (5'-CCGAGCTCCTCGAGGCGTTTGCTTAGGTTTACGTA-3': sequence number 9) and exp-R (5'-CCCTGCAGGATCCTACCACTGTATTGTATAAC TTG-3': sequence number 10). The amplified DNA fragment was cut with Xho I and Pst I, inserted into pBluescriptSK(-) cut with the same restriction enzymes, and transformed into E. coli BL21(DE3). The PCR conditions were the same as those in Experiment 3. The obtained transformant was inoculated into 2 ml of 2×TY medium (supplemented with 100 μg / ml ampicillin) and cultured at 30°C with shaking for 24 hours. The cells were recovered by centrifugation (10,000 rpm, 2 minutes, 4°C), suspended in 1 ml of 20 mM Tris-HCl buffer pH 7.0, 5 mM CaCl2, and ultrasonically disrupted using Handy sonic disruptor UD1 (Tomys Seiko Co., Ltd.) for 30 seconds × 4 cycles. The supernatant after centrifugation of the disrupted liquid (15,000 rpm, 10 minutes, 4°C) was used as a crude enzyme to measure the amylase activity. The results confirmed the formation of reducing sugars using soluble starch as a substrate. The reaction product was detected by TLC and was only maltose. The enzyme activity was 55.1 U / ml per 1 ml of culture solution.

[0203] Experiment 6: Introducing site-specific mutations into the β-amylase gene

[0204] A site-specific mutation was introduced into the β-amylase gene from strain No. 58 to produce a mutant enzyme, and its enzyme activity was measured.

[0205] The site-specific mutation of the β-amylase gene was introduced by the PCR-mega primer method. First, a plasmid containing the coding region and ribosome binding site of the β-amylase gene was used as a template, and PCR was performed in the same manner as in "Cloning of the β-amylase gene" using the four mutation introduction primers (sequence numbers 14-17) and the exp-R primer (sequence number 10) shown in Table 4 below to obtain a mega primer.

[0206] Next, the obtained mega primer and RBS-F primer (sequence number 9) and the plasmid containing the coding region and ribosome binding site of the above-mentioned β-amylase gene were used as templates, and PCR was performed in the same manner to obtain the full-length β-amylase gene with introduced mutations. The gene fragment was constructed into an expression plasmid using the same method as in Experiment 5, and the plasmid was transformed into the E. coli BL21 (DE3) strain to obtain a transformant producing a β-amylase mutant enzyme.

[0207] [Table 4]

[0208] Primers for mutation introduction

[0209] Primers Sequence (5'→3') Sequence number T4P-F AATGCCGAAATCAAGCCAGATTATAAAGCATC Serial number 14 T15K-F GTTATGGCACCATTAAAAAAGATTACGAACTGG Sequence number 15 T15R-F GTTATGGCACCATTACGCAAGATTACGAACTGG Sequence number 16 Q306D-F ATAGATCAATTCAAGGASAGTAATTTACACCTT Serial number 17

[0210] Each of the obtained transformants was cultured in the same manner as in Experiment 5, and the crude enzyme was obtained by disrupting the cells. The crude enzyme was purified in the same manner as in Experiment 2. The purification results of each mutant enzyme are shown in Fig.13 .

[0211] For these purified enzymes, the temperature stability was evaluated in the same manner as in "Confirmation of β-amylase". Each enzyme sample was placed in a microtube, kept at 65°C, and then sampled after 15, 30, and 60 minutes and cooled on ice. The residual enzyme activity of the cooled sample was measured by measuring the amount of reducing sugar produced, and the temperature stability of the obtained amylase at 65°C was evaluated. In addition, as a control, the purified enzyme without mutation was treated in the same manner to evaluate the temperature stability. The results are shown in Fig.14 The data are expressed as relative values, with the value at treatment time of 0 min being 100%. Fig.14 wt represents the β-amylase of strain No. 58 of the present invention, and T4P, T15K, T15R, and Q306D represent mutant enzymes (for example, T4P means that the 4th amino acid residue T in SEQ ID NO: 2 is mutated to P).

[0212] The residual activity after 60 minutes was 37.7% of the β-amylase before mutation, compared with 80.9% for T4P, 50.1% for Q306DE, 44.4% for T15K, and 44.2% for T15R. It can be seen that the obtained mutant enzyme has improved thermal stability compared with the β-amylase before mutation.

[0213] Furthermore, the β-amylase mutants possessed by the four transformants obtained each had a mutation in which the threonine at position 4 of the amino acid sequence described in SEQ ID NO: 2 was changed to proline (SEQ ID NO: 18: Fig.14 T4P), mutation of threonine at amino acid position 15 to lysine (SEQ ID NO. 19: Fig.14 T15K), a mutation in which the threonine at amino acid position 15 is changed to arginine (SEQ ID NO: 20: Fig.14T15R), or a mutation in which glutamine at amino acid position 306 is changed to aspartic acid (SEQ ID NO: 21: Fig.14 Q306D).

Claims

1. A β-amylase consisting of the following amino acid sequence: (i) the amino acid sequence set forth in SEQ ID NO: 2; or (ii) The amino acid sequence described in any one of SEQ ID NOs: 18 to 21.

2. The β-amylase according to claim 1, wherein The β-amylase has raw starch decomposing activity.

3. The β-amylase according to claim 1, wherein The β-amylase has raw starch decomposing activity at 60°C. A DNA encoding the β-amylase according to claim 1.

5. The DNA according to claim 4, wherein The DNA is represented by (i) or (ii), (i) the base sequence shown in SEQ ID NO: 13; (ii) A base sequence described in any one of SEQ ID NOs: 30 to 33. 6 . A DNA, which is the DNA according to claim 4 further comprising a signal sequence, and which consists of the base sequence described in SEQ ID NO: 1 or any one of SEQ ID NOs: 26 to 29.

7. A vector comprising the DNA according to any one of claims 4 to 6. A microorganism comprising the vector according to claim 7.

9. A bacterium identified by the deposit number NITE BP-02937.

10. A method for producing β-amylase, comprising the steps of culturing the microorganism according to claim 8 or 9, and extracting β-amylase from the culture.

11. A method for preparing maltose, characterized in that: The starch is treated with the beta-amylase according to any one of claims 1 to 3.

12. The method for preparing maltose according to claim 11, wherein: The β-amylase according to any one of claims 1 to 3 is added at a starch temperature of 60°C to 70°C.

13. A method for preparing maltose, characterized in that: The starch is treated with the microorganism according to claim 8 or 9.

14. A method for preparing maltose, characterized in that: The raw starch is treated with the β-amylase according to claim 2 or 3.

15. A method for modifying food, using the β-amylase according to any one of claims 1 to 3 or the microorganism according to claim 8 or 9. 16 . An enzyme agent comprising the β-amylase according to claim 1 , or the microorganism according to claim 8 or 9 .

Images