A pluripotent stem cell and its derivatives

Abstract

The present invention provides a pluripotent stem cell or a derivative thereof, wherein a first nucleic acid molecule is introduced into the genome of the pluripotent stem cell or the derivative thereof; and a second nucleic acid molecule is introduced into the 3'UTR region of an immune response-related gene in the pluripotent stem cell or the derivative thereof; the first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, and the small nucleic acid molecule can specifically bind to the transcription product of the second nucleic acid molecule, thereby initiating an RNA interference program, degrading or silencing the mRNA of the immune response-related gene, thereby blocking the expression of the immune response-related gene, so that the cell has immune compatibility characteristics and can eliminate or reduce allogeneic immune rejection response reactions.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and relates to an immune-compatible pluripotent stem cell or a derivative thereof. Background Art

[0002] Stem cells are a type of "seed" cell with the ability to self-renew and differentiate into specialized somatic cells. They have the potential to regenerate various tissues, organs, and the human body, and play a core and irreplaceable role in major biological processes such as immune response, aging, and tumorigenesis. Based on the degree of differences in stem cell characteristics, stem cells are primarily divided into: totipotent stem cells, pluripotent stem cells (PSCs), and adult stem cells.

[0003] Among them, pluripotent stem cells (PSCs) have almost unlimited self-renewal ability and the potential to develop and differentiate into organs, tissues, and cells of all germ layers in the embryo under normal developmental conditions. Typical PSCs mainly include embryonic stem cells (ESCs), embryonic germ cells (EGCs), embryonic carcinoma cells (ECCs), and induced pluripotent stem cells (iPSCs). Due to their powerful functions and the ability to pass ethical restrictions to a certain extent, these cells have very far-reaching and broad application prospects.

[0004] Due to the enormous potential of PSCs, research and development efforts, including the development of PSC libraries, are rapidly developing. However, the conception and establishment of both autologous iPSC banks and immune-matched PSC banks require significant financial, material, and human resources. The molecular immunology foundation of organ, tissue, or cell transplantation between allogeneic donors and recipients is primarily based on matching the classical major histocompatibility complex (MHC-I and MHC-II) (also known as HLA-I and HLA-II in humans). As of June 2019, over 20,000 HLA alleles have been identified and named, with the number of classical HLA-A, B, and C alleles alone exceeding 5,000 each. The number of possible random combinations of these classical HLA-I / II alleles is astronomical, and as new alleles are discovered, the number of possible combinations will continue to increase. This presents significant challenges in tissue matching and donor selection prior to organ, tissue, and cell transplantation, and also poses significant challenges in constructing immune-matched PSC banks covering the entire population.

[0005] Therefore, it is urgent to construct universal PSCs that are allogeneic and immune-compatible. In recent years, there have been many reports that by knocking out genes such as B2M and CIITA, the expression of HLA-I and HLA-II cell surface or own genes is lost, thereby making the cells immune-tolerant or escaping T / B cell-specific immune responses, and producing immune-compatible universal PSCs, which has laid an important foundation for the wider application of universal PSCs-derived cells, tissues, and organs. There are also reports that cells overexpress CTLA4-Ig and PD-L1 to inhibit allogeneic immune rejection. Recently, there have been reports that while knocking out B2M and CIITA, CD47 was knocked in, so that the cells can escape not only specific immune responses, but also have immune tolerance or escape the inherent immune response of cells such as NK, thereby making the cells have more comprehensive and stronger immune compatibility characteristics. However, these schemes are either not completely immune compatible and allogeneic immune rejection can still occur through other pathways; or they completely eliminate the allogeneic immune rejection response, but the donor-derived transplant cells themselves lose the ability to present antigens, which brings great risks of tumorigenicity and viral infection to the recipient.

[0006] To this end, there are also reports that instead of directly knocking out B2M, HLA-A, HLA-B, or CIITA are knocked out at the same time, HLA-C is retained, and 12 HLA-C immune matching antigens covering more than 90% of the population are constructed, so that the transplanted cells still have a certain degree of antigen presentation function and at the same time can inhibit the innate immune response of NK cells through HLA-C. However, these cells, firstly, have a reduced repertoire of HLA-I antigens, significantly and irreversibly diminishing the completeness of their antigenic presentation. This leads to a significant bias in the presentation of various tumor, viral, and other disease antigens, and they still retain a considerable risk of tumorigenicity and viral infection. This risk is even higher when CIITA is simultaneously knocked out. Secondly, the 12 highly immunogenic HLA-C antigens vary widely across ethnic groups. Our calculations show that some regions only account for 70% of these antigens, and populous countries like China and India currently lack authoritative, large-scale HLA data. Therefore, the use of universal PSCs generated in this way is still hampered by significant matching gaps. Thirdly, this method requires multiple rounds of gene editing, with at least six rounds of single-cell isolation and culture required for each editing step. These steps inevitably and highly likely result in unpredictable mutations due to multiple off-target gene editing, chromatin instability, or the proliferation of numerous single cells, which can lead to various problems, such as carcinogenesis and metabolic diseases. It can be seen from this that this type of immune compatibility plan is also a stopgap measure for the "transition period" and there are still many problems that have not been better solved.

[0007] In addition, some people have designed to induce suicide genes to kill donor tissues and cells after they become pathogenic. The consequences of doing so will result in unpredictable disease risks such as serious tissue necrosis and cytokine storms. Moreover, after these designed cells are killed, there will no longer be suitable donor cells, tissues and organs, which is another major problem.

[0008] RNA interference (RNAi) is a ubiquitous natural phenomenon in eukaryotes. Double-stranded RNA (dsRNA) is used within organisms to induce the specific degradation of the mRNA of a homologous target gene, leading to gene silencing. During RNAi, the long dsRNA is cleaved by the enzyme Dicer into small interfering RNAs (siRNAs). One strand of the siRNA binds to the RNA-induced silencing complex (RISC), which then binds to the target mRNA through complementary base pairing, leading to its degradation. Because siRNA can inhibit the expression of specific genes, this technology has been widely used in various research fields, including gene therapy.

[0009] Currently, small nucleic acid molecules known to mediate RNA interference include short interfering nucleic acid (siNA), short interfering RNA (siRNA), and double-stranded RNA (dsRNA). Summary of the Invention

[0010] The first object of the present invention is to provide an immune-compatible pluripotent stem cell or a derivative thereof.

[0011] The first object of the present invention is to provide an immune-compatible and reversible pluripotent stem cell or its derivatives.

[0012] The third object of the present invention is to provide the use of the above-mentioned pluripotent stem cells or their derivatives in the preparation of products for cell therapy.

[0013] The fourth object of the present invention is to provide the use of the above-mentioned pluripotent stem cells or their derivatives in the preparation of products for organ transplantation.

[0014] The fifth object of the present invention is to provide the use of the above-mentioned pluripotent stem cells or their derivatives in constructing a universal PSCs cell bank.

[0015] The sixth object of the present invention is to provide the use of the above-mentioned pluripotent stem cells or their derivatives as gene drug carriers.

[0016] The technical solution adopted by the present invention is:

[0017] The first aspect of the present invention provides a pluripotent stem cell or a derivative thereof, wherein a first nucleic acid molecule is introduced into the genome of the pluripotent stem cell or the derivative thereof;

[0018] A second nucleic acid molecule is introduced into the 3'UTR region of the immune response-related gene in the pluripotent stem cell or its derivative;

[0019] The first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, the small nucleic acid molecule specifically targets the transcription product of the second nucleic acid molecule, and the small nucleic acid molecule does not target any other mRNA or lncRNA of the pluripotent stem cell or its derivative.

[0020] In this technical solution, the small nucleic acid molecule encoded by the first nucleic acid molecule can specifically bind to the transcription product of the second nucleic acid molecule introduced into the 3'UTR region of the immune response-related gene, thereby initiating an RNA interference program to degrade or silence the mRNA of the immune response-related gene, thereby blocking the expression of the immune response-related gene, thereby making such cells immune-compatible and eliminating or reducing allogeneic immune rejection responses. Moreover, the RNA interference program only acts on such modified pluripotent stem cells or their derivatives. Therefore, when such cells or derivatives are transplanted into a recipient, the RNA interference of the immune response-related gene mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule introduced at the 3'UTR of the immune response-related gene only acts on the donor cell and does not interfere with the genome of the recipient cell.

[0021] A second aspect of the present invention provides a pluripotent stem cell or a derivative thereof, wherein an inducible gene expression system and a first nucleic acid molecule are introduced into the genome of the pluripotent stem cell or the derivative thereof;

[0022] A second nucleic acid molecule is introduced into the 3'UTR region of the immune response-related gene in the pluripotent stem cell or its derivative;

[0023] The first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, the small nucleic acid molecule specifically targets the transcription product of the second nucleic acid molecule, and the small nucleic acid molecule does not target any other mRNA or lncRNA of the pluripotent stem cell or its derivative;

[0024] The inducible gene expression system regulates the expression of the first nucleic acid molecule.

[0025] In the above technical solution, the inducible gene expression system is regulated by exogenous inducers. The opening and closing of the inducible gene expression system is controlled by adjusting the addition amount, duration of action and type of the exogenous inducers, thereby controlling the expression amount of the small nucleic acid molecule.

[0026] When the inducible gene expression system is activated, the normally expressed small nucleic acid molecules specifically bind to the transcripts of the second nucleic acid molecules introduced into the 3' UTR region of immune response-related genes, initiating an RNA interference program that degrades or silences the mRNA of immune response-related genes, thereby blocking their expression. Therefore, when these cells or derivatives are transplanted into a recipient, they can eliminate or reduce allogeneic immune rejection responses and improve the immune compatibility between the transplant and the recipient.

[0027] When the graft becomes diseased, the inducible gene expression system can be shut down by adding exogenous inducers, thereby shutting down the expression of small nucleic acid molecules, stopping the interference of small molecule nucleic acids on the mRNA of immune response-related genes, restoring the normal expression of immune response-related genes, and then restoring the antigen presentation ability of the graft cells, enabling the recipient to clear the diseased graft, thereby improving the clinical safety of this type of pluripotent stem cells or their derivatives and greatly expanding their value in clinical applications.

[0028] Moreover, the RNA interference program only acts on such modified pluripotent stem cells or their derivatives. Therefore, when such cells or derivatives are transplanted into the recipient, the RNA interference of the immune response-related genes mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the second nucleic acid molecule introduced at the 3'UTR of the immune response-related genes only acts on the donor cells and will not interfere with the genome of the recipient cells.

[0029] The inducible gene expression system can be selected from the Tet-Off system and the dimer inducible expression system.

[0030] When the inducible gene expression system used is the Tet-Off system, the expression of small nucleic acid molecules in cells or their derivatives can be controlled by adding the exogenous inducer tetracycline (Dox). After the pluripotent stem cells or their derivatives are transplanted into the donor, the amount of Dox added can even be adjusted to gradually reduce the expression of small nucleic acid molecules, allowing the cells to gradually express low concentrations of immune-related genes to stimulate the donor, thereby gradually developing tolerance to the transplanted cells or their derivatives, and ultimately achieving stable tolerance. Typically, the amount of Dox added is 0-100uM.

[0031] When the inducible gene expression system used is a dimer inducible expression system, the expression of small nucleic acid molecules in cells or their derivatives can be controlled by adding an exogenous inducer, rapamycin (or an analogue). Similarly, by adjusting the amount of rapamycin (or an analogue) added, the expression of small nucleic acid molecules can be gradually reduced, so that the cells can accordingly express low concentrations of immune-related genes to stimulate the donor, thereby gradually developing tolerance to the transplanted cells or their derivatives, and ultimately achieving stable tolerance. Typically, the amount of rapamycin (or an analogue) added is 0-1000nM.

[0032] Regarding the first and second aspects of the present invention, a CD47 expression sequence is further introduced into the genome of the pluripotent stem cells or their derivatives, so that the pluripotent stem cells or their derivatives can overexpress CD47.

[0033] CD47 is the extracellular ligand of the human inhibitory receptor signal regulatory protein (SIRP). CD47 combines with its specific ligand SIRPα to form the CD7-SIRPα signaling complex, which can send anti-phagocytic signals and inhibit phagocytosis by phagocytes. CD47 can inhibit the activity of macrophages and NK cells, creating vulnerabilities in the immune system and triggering negative regulatory signals. CD47 is a co-stimulatory factor for T cell activation, activating the T cell apoptosis process, inducing T cell anergy, and enhancing the efficiency of TCR signaling. CD47 is a very effective non-HLA ligand that can silence all innate immune responses. Overexpression of CD47 in pluripotent stem cells or their derivatives can further improve the immune compatibility or immune tolerance of pluripotent stem cells or their derivatives.

[0034] Regarding the first and second aspects of the present invention, the immune response-related genes include:

[0035] (1) Major histocompatibility complex-related genes, including at least one of B2M and CIITA, wherein:

[0036] For example, B2M, or β2 microglobulin (B2M), is a subunit of the light chain (β chain) of HLA class I molecules. During cell surface expression of HLA class I molecules, β2-m facilitates the transport of the entire HLA molecule from the endoplasmic reticulum to the cell membrane and maintains the structural stability of the entire HLA molecule. It is essential for its surface expression, assembly, and stability. Numerous studies have reported that knocking out the B2M gene eliminates cell surface expression of HLA class I molecules, leading to the abrogation of allogeneic HLA-mismatched immune responses associated with HLA class I molecules. Consequently, recipients of HLA-mismatched cell, tissue, or organ transplants (referred to as "grafts") will develop immune compatibility / tolerance to the transplanted HLA-mismatched cells, tissues, or organs, thereby achieving the goal of generating immune-compatible pluripotent stem cells or pluripotent stem cell-derived derivatives. However, after completely knocking out B2M, the cells completely lose the ability to present antigens through HLA class I molecules, and there is no way to deal with various cell, tissue or organ diseases (such as cancer) that may occur after transplantation, which greatly affects the safety of application and is not conducive to further clinical application.

[0037] CIITA, or the class II major histocompatibility complex transactivator, is a key gene known for class II HLA gene transcription. It is constitutively expressed in antigen-presenting cells and its expression in other cells can be induced by IFN-γ. Cells primarily regulate the expression levels of HLA class II genes, thereby modulating the intensity of immune responses, by regulating CIITA expression. CIITA, as a co-activator molecule, is recruited to the promoters of HLA class II genes and participates in the regulation of their gene expression. CIITA expression levels are positively correlated with HLA II expression, making it considered the most critical regulator of HLA class II gene expression.

[0038] (2) Major histocompatibility complex genes, including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB1, wherein:

[0039] Class I molecules (A, B, C) are distributed on the surface of all nucleated cells, while class II molecules (DR, DQ, DP) are only expressed on the surface of certain cells in lymphoid tissues, such as professional antigen-presenting cells (including B cells, macrophages, and dendritic cells), thymic epithelial cells, and activated T cells. Major histocompatibility antigens (MHC antigens) are transplant antigens that can elicit a strong array reaction, namely, HLA molecules encoded by the HLA complex (human MHC). Essentially, differences in HLA types between donors and recipients are the primary cause of acute transplant rejection. Classical HLAs are almost always associated with transplant rejection, and class I molecules are particularly important.

[0040] Regarding the first and second aspects of the present invention, the small nucleic acid molecule comprises short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), preferably at least one of miRNA, shRNA, and shRNA-miR.

[0041] Short interfering nucleic acid (siNA): A general term for all small nucleic acid molecules with RNA interference (RNAi) effects, usually referring to small ribonucleic acids composed of more than 20 nucleotides.

[0042] Short interfering RNA (siRNA): Small interfering RNA (siRNA), sometimes called short interfering RNA or silencing RNA, is a double-stranded RNA of 20 to 25 nucleotides in length that has many diverse biological applications. Currently, siRNA is primarily known to participate in the phenomenon of RNA interference (RNAi), regulating gene expression in a specific manner.

[0043] Double-stranded RNA (dsRNA): A type of RNA with a complementary strand, similar to DNA found in cells. dsRNA constitutes the genome of some viruses (double-stranded RNA viruses). Double-stranded RNA, such as viral RNA or siRNA, can trigger RNA interference in eukaryotic cells and elicit an interferon response in vertebrates.

[0044] miRNAs are single-stranded RNA fragments between 21 and 23 nucleotides in length that regulate gene expression. MiRNAs are encoded by genes and transcribed from DNA but not translated into protein. Primary transcripts (pri-miRNAs) shorten their loop structures to produce functional miRNAs. Mature miRNA molecules are partially complementary to one or more mRNA molecules, and their primary function is to downregulate gene expression.

[0045] shRNA: shRNA consists of two short reverse complementary sequences separated by a stem-loop sequence, forming a hairpin structure controlled by the pol III promoter, followed by 5-6 Ts as the transcription terminator of RNA polymerase III. It is often used for RNA interference to silence the expression of target genes.

[0046] shRNA-miR: Based on the double-arm structure of miR-30 or miR-155 and the stem-loop structure of shRNA, the target sequence of microRNA is replaced with the target sequence of shRNA.

[0047] When the pluripotent stem cells or their derivatives are derived from humans, the sequence of the small nucleic acid molecule is a random sequence derived from a non-human species that does not target any human mRNA or lncRNA, preferably derived from Caenorhabditis elegans. For example:

[0048] 5'-TTGTACTACACAAAAGTACTG-3'(SEQ ID NO.1)

[0049] 5'-TCACAACCTCCTAGAAAGAGTAGA-3' (SEQ ID NO. 3).

[0050] The first nucleic acid molecule and the second nucleic acid molecule designed according to the above sequence are any combination of the following:

[0051] Combination 1:

[0052] Small nucleic acid molecule sequence: 5'-TTGTACTACACAAAAGTACTG-3' (SEQ ID NO.1)

[0053] (1) First nucleic acid molecule (i.e., shRNA expression framework or shRNA-miR expression framework of small nucleic acid molecule):

[0054] shRNA expression framework: includes two reverse complementary small nucleic acid molecule sequences, separated by a stem-loop sequence in the middle to form a hairpin structure, followed by 5-6 Ts as the transcription terminator of RNA polymerase III.

[0055] shRNA-miR expression framework: The original target sequence of miR-30 or miR-155 is replaced by a small nucleic acid molecule sequence.

[0056] (2) The second nucleic acid molecule comprises at least 3 repetitions of the reverse complementary sequence of the small nucleic acid molecule sequence, preferably 6 to 10 repetitions of the reverse complementary sequence of the small nucleic acid molecule sequence. The reverse complementary sequence of the small nucleic acid molecule sequence can be connected by a random linker sequence.

[0057] As one embodiment of the present invention, the second nucleic acid molecule is composed of a random sequence of the first 10 nt and a reverse complementary sequence of 8 repeated small nucleic acid molecule sequences connected by a random linker sequence (CGTA): atTCTAGATACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTA (SEQ ID NO. 2)

[0058] Combination 2:

[0059] Small nucleic acid molecule sequence: 5'-TCACAACCTCCTAGAAAGAGTAGA-3' (SEQ ID NO. 3)

[0060] (1) First nucleic acid molecule:

[0061] shRNA expression framework: includes two reverse complementary small nucleic acid molecule sequences, separated by a stem-loop sequence in the middle to form a hairpin structure, followed by 5-6 Ts as the transcription terminator of RNA polymerase III.

[0062] shRNA-miR expression framework: The original target sequence of microRNA mir-30 or mir-155 is replaced by a small nucleic acid molecule sequence.

[0063] (2) The second nucleic acid molecule comprises at least 3 repetitions of the reverse complementary sequence of the small nucleic acid molecule sequence, preferably 6 to 10 repetitions of the reverse complementary sequence of the small nucleic acid molecule sequence. The reverse complementary sequence of the small nucleic acid molecule sequence can be connected by a random linker sequence.

[0064] As one embodiment of the present invention, the second nucleic acid molecule is composed of a random sequence of the first 10 nt and a reverse complementary sequence of 8 repeated small nucleic acid molecule sequences connected by a random linker sequence (CGTA): atTCTAGATATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTATCTACTCTTTCTAGGAGGTTGTGACGTA (SEQ ID NO. 4)

[0065] Regarding the first and second aspects of the present invention, the introduction sites of the first nucleic acid molecule and the inducible gene expression system are genomic safe sites.

[0066] Preferably, the genomic safety site includes at least one of the AAVS1 safety site, the eGSH safety site, and the H11 safety site.

[0067] The AAVS1 site (also known as the "PPP1R2C site"), located on chromosome 19 of the human genome, is a validated "safe harbor" site that ensures the intended function of the transferred DNA fragment. This site is an open chromosomal structure, ensuring normal transcription of the transferred gene, and inserting the exogenous target fragment into this site has no known side effects on cells.

[0068] eGSH safe site: Located on chromosome 1 of the human genome, it is another "safe harbor" site that has been verified in papers and can ensure the intended function of the transferred DNA fragment.

[0069] The H11 safety site (also called Hipp11): Located on human chromosome 22, it lies between the Eif4enif1 and Drg1 genes. Discovered and named by Simon Hippenmeyer in 2010, the H11 site minimizes the risk of exogenous gene insertion interfering with endogenous gene expression due to its location between two genes. The H11 site has been validated as a safe intergenic transcriptional activation region, representing a new "safe harbor" site beyond the AAVS1 and eGSH sites.

[0070] Regarding the first and second aspects of the present invention, the introduction of the first nucleic acid molecule and the inducible gene expression system adopts viral vector interference, non-viral vector transfection or gene editing methods.

[0071] With respect to the first and second aspects of the present invention, the introduction of the second nucleic acid molecule is carried out by gene editing.

[0072] The gene editing is preferably gene knock-in.

[0073] The third aspect of the present invention provides use of the pluripotent stem cells or derivatives thereof according to the first or second aspect in the preparation of products for cell therapy.

[0074] The fourth aspect of the present invention provides use of the pluripotent stem cells or derivatives thereof according to the first or second aspect in preparing products for organ transplantation.

[0075] The fifth aspect of the present invention provides the use of the pluripotent stem cells or their derivatives described in the first or second aspect in constructing a universal PSCs cell bank.

[0076] The sixth aspect of the present invention provides use of the pluripotent stem cells or derivatives thereof described in the first or second aspect as gene drug carriers.

[0077] The beneficial effects of the present invention are:

[0078] The pluripotent stem cells or their derivatives provided by the first aspect of the present invention have immunocompatibility properties and can eliminate or reduce allogeneic immune rejection responses. Moreover, the RNA interference program of the pluripotent stem cells or their derivatives only acts on such modified pluripotent stem cells or their derivatives. Therefore, when such cells or derivatives are transplanted into a recipient, the RNA interference mediated by the small nucleic acid molecule encoded by the first nucleic acid molecule and the transcription product of the second nucleic acid molecule against immune response-related genes only acts on the donor cells and does not interfere with the genome of the recipient cells.

[0079] The second aspect of the present invention provides pluripotent stem cells or their derivatives, which exhibit reversible immune compatibility. When the inducible gene expression system is activated, the normally expressed small molecule nucleic acid specifically binds to the transcription product of the second nucleic acid molecule introduced into the 3' UTR region of the immune response-related gene, thereby initiating an RNA interference program, degrading or silencing the mRNA of the immune response-related gene, thereby blocking the expression of the immune response-related gene. Therefore, when these cells or derivatives are transplanted into a recipient, they can eliminate or reduce allogeneic immune rejection responses and improve the immune compatibility between the transplant and the recipient.

[0080] When the graft becomes diseased, the inducible gene expression system can be shut down by adding exogenous inducers, thereby stopping the expression of small nucleic acid molecules and the interference of small molecule nucleic acids on the mRNA of immune response-related genes, restoring the normal expression of immune-related genes, and then restoring the antigen presentation ability of the graft cells, enabling the recipient to clear the diseased graft, thereby improving the clinical safety of this type of pluripotent stem cells or their derivatives and greatly expanding their value in clinical applications.

[0081] The reversibly immune-compatible pluripotent stem cells or their derivatives of the present invention offer another significant advantage: by adjusting the amount of exogenous inducer added and the duration of action, the expression of small nucleic acid molecules in the pluripotent stem cells or their derivatives can be gradually reduced, allowing the donor cells to gradually express low concentrations of immune-related genes to stimulate the donor, thereby gradually developing tolerance to the transplanted cells or their derivatives, ultimately achieving stable tolerance. In this case, even if the transplanted cells express mismatched HLA class I molecules on their surface, they can still be compatible with the recipient's immune system. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 :Cas9(D10A) plasmid map.

[0083] Figure 2 :sgRNA Clone AAVS1-1 plasmid map.

[0084] Figure 3 :sgRNA Clone AAVS1-2 plasmid map.

[0085] Figure 4 :sgRNA clone B2M-1 plasmid map.

[0086] Figure 5 :sgRNA clone B2M-2 plasmid map.

[0087] Figure 6 :sgRNA clone CIITA-1 plasmid map.

[0088] Figure 7 :sgRNA clone CIITA-2 plasmid map.

[0089] Figure 8 :AAVS1 KI Vector (shRNA, constitutive) plasmid map.

[0090] Figure 9 :AAVS1 KI Vector (shRNA, inducible) plasmid map.

[0091] Figure 10:AAVS1 KI Vector (shRNA-miR, constitutive) plasmid map.

[0092] Figure 11 :AAVS1 KI Vector (shRNA-miR, inducible) plasmid map.

[0093] Figure 12 : B2M KI Vector.

[0094] Figure 13 :CIITA KI Vector. DETAILED DESCRIPTION

[0095] In order to more clearly understand the technical content of the present invention, the following examples are specifically described in detail in conjunction with the accompanying drawings. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0096] 1 Experimental Materials

[0097] 1.1 Starting stem cells or their derivatives

[0098] Pluripotent stem cells or their derivatives can be selected from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) and other forms of pluripotent stem cells, such as hPSCs-MSCs, NSCs, and EBs cells.

[0099] iPSCs: Using our established third-generation, efficient, and safe episomal-iPSC induction system (6F / BM1-4C), pE3.1-OG--KS and pE3.1-L-Myc--hmiR302 cluster were electroporated into somatic cells and cultured for 2 days in RM1, 2 days in BioCISO-BM1 containing 2uM Parnate, and 2 days in BioCISO-BM1 containing 2uM Parnate, 0.25mM sodium butyrate, 3uM CHIR99021, and 0.5uM PD03254901. iPSC clones were picked after approximately 17 days of culture in BioCISO stem cell culture medium. The picked iPSC clones were purified, digested, and passaged to obtain stable iPSCs. For detailed construction methods, see: Stem Cell Res Ther. 2017 Nov 2; 8(1):245.

[0100] hPSCs-MSCs: iPSCs were cultured in stem cell culture medium (BioCISO, containing 10 μM TGFβ inhibitor SB431542) for 25 days. During this period, they were digested and passaged at 80-90% confluence (2 mg / mL Dispase digestion) and subcultured at a 1:3 ratio onto Matrigel-coated culture plates. They were then cultured in ESC-MSC culture medium (knockout DMEM medium containing 10% KSR, NEAA, double-antibody, glutamine, β-mercaptoethanol, 10 ng / mL bFGF, and SB-431542). The medium was changed daily and passaged at 80-90% confluence (1:3 ratio) for 20 consecutive days. For detailed construction methods, please refer to: Proc Natl Acad Sci US A. 2015; 112(2): 530-535.

[0101] NSCs: iPSCs were cultured in an induction medium (knockout DMEM medium containing 10% KSR, a TGF-β inhibitor, and a BMP4 inhibitor) for 14 days. Rosette-shaped neural cells were then selected and cultured in low-adhesion culture plates using a 1:1 ratio of DMEM / F12 (containing 1% N2, Invitrogen) and Neurobasal medium (containing 2% B27, Invitrogen) containing 20 ng / ml bFGF and 20 ng / ml EGF. Accutase was used for digestion and passage. For detailed construction methods, see: FASEB J. 2014; 28(11): 4642-4656.

[0102] EBs: iPSCs reaching 95% confluence were digested with BioC-PDE1 for 6 minutes and then mechanically scraped into clumps. The cell clumps were then transferred to low-adhesion culture plates and cultured with BioCISO-EB1 for 7 days, with the medium changed every other day. After 7 days, the cells were transferred to Matrigel-coated culture plates and continued to adhere to the plates using BioCISO. After 7 days, embryoid bodies (EBs) with endoderm, mesodermal, and ectoderm structures were obtained. For detailed construction methods, see: StemCell Res Ther. 2017 Nov 2; 8(1): 245.

[0103] The pluripotent stem cell derivatives include adult stem cells, cells of various germ layers or tissues differentiated from pluripotent stem cells.

[0104] 1.2 Small Nucleic Acid Molecules and the Corresponding First and Second Nucleic Acid Molecules

[0105] The sequence of the small nucleic acid molecule is: 5'TTGTACTACACAAAAGTACTG 3' (SEQ ID NO.1)

[0106] Those skilled in the art will appreciate that other random sequences of non-human species that do not target any human mRNA or lncRNA can achieve the purpose of the present invention, such as SEQ ID NO.3.

[0107] First nucleic acid molecule (i.e., shRNA expression framework or shRNA-miR expression framework of small nucleic acid molecule):

[0108] (1) shRNA expression framework: From 5' to 3', it includes the small nucleic acid molecule sequence, the stem-loop sequence, the reverse complementary sequence of the small nucleic acid molecule sequence, and Poly T; the two reverse complementary sequences are separated by a stem-loop sequence in the middle to form a hairpin structure, and finally connected to Poly T as the transcription terminator of RNA polymerase III;

[0109] The front end of the expression framework is added with a promoter sequence and matching promoter regulatory elements according to the needs of expression.

[0110] The specific sequence is:

[0111] (SEQ ID NO.5)N1...N 21 TTCAAGAGA (SEQ ID NO. 6) N 22 ...N 42 TTTTTT

[0112] in:

[0113] a、N1...N 21 is the sequence of small nucleic acid molecules, N 22 ...N 42 It is the reverse complementary sequence of the small nucleic acid molecule sequence;

[0114] b. If the plasmid needs to express shRNA of multiple genes, each gene corresponds to an shRNA expression framework, and then they are seamlessly connected;

[0115] c. Constitutive shRNA plasmids with different resistance genes, where only the resistance genes are different and other sequences are the same;

[0116] d, N represents A, T, G, C bases;

[0117] e. SEQ ID NO.5 is the promoter sequence;

[0118] f. SEQ ID NO.6 is a stem-loop sequence.

[0119] (2) shRNA-miR expression framework: The target sequence in microRNA-30 or microRNA-155 is replaced by a small nucleic acid molecule sequence. The specific sequence is as follows:

[0120] GAGGCTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCG(SEQ ID NO.7)M1N1...N 21 TAGTGAAGCCACAGATGTA(SEQ ID NO.8)N 22 ...N 42 M2TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATTCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT(SEQ ID NO.9)

[0121] in:

[0122] a、N1...N 21 is the sequence of small nucleic acid molecules, N 22 ...N 42 It is the reverse complementary sequence of the small nucleic acid molecule sequence;

[0123] b. If the plasmid needs to express shRNA-miR of multiple genes, each gene corresponds to a shRNA-miR expression framework, and then they are seamlessly connected;

[0124] c. Constitutive shRNA-miR plasmids with different resistance genes, where only the resistance genes are different and other sequences are the same;

[0125] d. M bases represent A or C bases, and N represents A, T, G, or C bases;

[0126] e. If N1 is a G base, then M1 is an A base; otherwise, M1 is a C base;

[0127] f. The M1 base is complementary to the M2 base.

[0128] Second nucleic acid molecule (B2M-3'UTR-miRNA-locus / CIITA-3'UTR-miRNA-locus):

[0129] atTCTAGATACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTACAGTACTTTTGTGTAGTACAACGTA(SEQ IDNO.2)

[0130] 1.3 Immune-related genes

[0131] The immune-related genes selected in this example are B2M (NCBI Gene ID: 567) and CIITA (NCBI Gene ID: 4261), and the second nucleic acid sequence is inserted into the 3'UTR of these two genes.

[0132] 1.4 Genome safe sites

[0133] In this embodiment, the genomic safe site for gene knock-in is the AAVS1 safe site. Those skilled in the art will appreciate that knocking in other genomic safe sites, such as the eGSH safe site and the H11 safe site, can also achieve the purpose of the present invention.

[0134] 1.5 Inducible gene expression system

[0135] In this embodiment, the inducible gene expression system is selected from the tet-Off system. Those skilled in the art will appreciate that the purpose of the present invention can also be achieved by using a dimer-off expression system.

[0136] 2 Experimental methods

[0137] 2.1 Gene knock-in

[0138] The inducible gene expression system and the first nucleic acid molecule are knocked into a safe site of the genome of a pluripotent stem cell or its derivative, and the second nucleic acid molecule (SEQ ID NO. 2) is knocked into the 3'UTR of the B2M and CIITA genes.

[0139] (1) sgRNA construction

[0140] 1. Plasmid

[0141] The knock-in of exogenous genes uses the Cas9 (D10A) plasmid and sgRNA plasmid system. The Cas9 (D10A) plasmid map is as follows Figure 1 As shown, the sgRNA plasmid map of the AAVS1 safety site is as follows Figure 2 、 Figure 3 As shown, the sgRNA plasmid map of the B2M gene is as follows Figure 4 、 Figure 5 As shown, the sgRNA plasmid map of the CIITA gene is as follows Figure 6 、 Figure 7 shown.

[0142] 2. Homology arms

[0143] (1) The nucleotide sequences of AAVS1 homology arms AAVS1-HR-L and AAVS1-HR-R are shown in SEQ ID NO. 10 and SEQ ID NO. 11, respectively;

[0144] (2) The nucleotide sequences of the B2M homology arms B2M-HR-L and B2M-HR-R are shown in SEQ ID NO. 12 and SEQ ID NO. 13, respectively;

[0145] (3) The nucleotide sequences of CIITA homology arms CIITA-HR-L and CIITA-HR-R are shown in SEQ ID NO. 14 and SEQ ID NO. 15, respectively;

[0146] 3. sgRNA sequence

[0147] sgRNA-AAVS1-1: 5'-TATAAGGTGGTCCCCAGCTCGGGG-3' (SEQ ID NO. 16);

[0148] sgRNA-AAVS1-2: 5'-AGGGCCGGTTAATGTGGCTCTGG-3' (SEQ ID NO. 17).

[0149] sgRNA-B2M-1:5'-CTCCTGTTATATTCTAGAACAGG-3' (SEQ ID NO. 18);

[0150] sgRNA-B2M-2: 5'-TTTCAGCATCAATGTACCCTGGG-3' (SEQ ID NO. 19).

[0151] sgRNA-CIITA-1:5'-GGCACTCAGAAGACACTGATGGG-3' (SEQ ID NO. 20);

[0152] sgRNA-CIITA-2: 5'-AAGGTGTCTGGTCGGAGAGCAGG-3' (SEQ ID NO. 21).

[0153] 4. Plasmid construction method

[0154] (1) Use the restriction endonuclease BbsI to digest the sgRNA empty vector and then recover it.

[0155] (2) Synthesize sgRNA primers (containing vector sticky ends).

[0156] (3) The primers were diluted with water to 10 μM, and the reaction system was boiled in boiling water for 5 min, and then cooled to room temperature to obtain the annealing product.

[0157] Reaction system: Upstream primer: 2uL, downstream primer: 2uL, water: 12.8uL

[0158] (4) Use a DNA ligation reaction kit (TaKaRa, 6022) to connect the vector and annealing product in the previous step to obtain an sgRNA plasmid containing the gene target sequence.

[0159] (2) Gene Editing Process

[0160] 1. Single cell cloning steps for AAVS1 gene knock-in (1) Electroporation procedure:

[0161] Donor cell preparation: human pluripotent stem cells

[0162] Kit: Human Stem Cell Kit 1

[0163] Instrument: Electroporator

[0164] Culture medium: BioCISO

[0165] Induction plasmids: Cas9D10A, sgRNA clone AAVS1-1, sgRNA clone AAVS1-2, AAVS1 neoVectoⅠ, AAVS1 neo VectorⅡ

[0166] (2) Human pluripotent stem cells after electroporation were screened in a double antibiotic medium containing G418 and puro

[0167] (3) Perform single-cell clone screening and culture to obtain single-cell clone strains.

[0168] 2. AAVS1 gene knock-in single cell clone culture reagent

[0169] (1) Culture medium: BioCISO + 300 μg / ml G418 + 0.5 μg / ml puro

[0170] (It should be placed in room temperature in advance and kept away from light for 30 to 60 minutes until it returns to room temperature. Note: BioCISO should not be preheated at 37°C to avoid reducing the activity of biomolecules.)

[0171] (2) Matrigel: hESC-grade Matrigel

[0172] (Before passaging or thawing cells, add Matrigel working solution to the cell culture flask and shake well to ensure that the Matrigel completely covers the bottom of the culture flask and that no Matrigel dries out before use. To ensure better cell adhesion and survival, place the Matrigel in a 37°C incubator for a minimum of 0.5 hour for 1:100X Matrigel and a minimum of 2 hours for 1:200X Matrigel.)

[0173] (3) Digestion solution: Dissolve EDTA in DPBS to a final concentration of 0.5 mM, pH 7.4

[0174] (Note: EDTA cannot be diluted with water, otherwise the cells will die due to decreased osmotic pressure.)

[0175] (4) Cryopreservation solution: 60% BioCISO + 30% ESCs-grade FBS + 10% DMSO

[0176] 3. Routine maintenance and subculture process

[0177] (1) The optimal time and ratio of cell culture

[0178] a. The optimal time for subculturing is when the overall confluence of cells reaches 80% to 90%.

[0179] b. Optimal ratio for subculturing: 1:4-1:7. The optimal confluence on the next day should be maintained at 20%-30%.

[0180] (2) Subculture process

[0181] a. Remove and discard the Matrigel from the coated cell culture flasks and add an appropriate amount of culture medium (BioCISO + 300 μg / ml G418 + 0.5 μg / ml puro) and incubate in a 37°C, 5% CO2 incubator.

[0182] b. When the cells meet the requirements for subculturing, remove the supernatant from the culture medium and add an appropriate amount of 0.5mM EDTA digestion solution to the cell flask;

[0183] c. Incubate the cells in a 37°C, 5% CO2 incubator for 5-10 minutes (until most cells shrink and become round but not yet floating under the microscope). Gently pipette the cells to detach them from the wall. Pipette the cell suspension into a centrifuge tube and centrifuge at 200g for 5 minutes.

[0184] d. After centrifugation, discard the supernatant, resuspend the cells in culture medium, gently pipette the cells several times to mix, and then transfer the cells to the prepared Matrigel-coated flask;

[0185] e. After transferring the cells to the cell flask, shake them horizontally from front to back and from side to side. After observing under the microscope and finding no abnormalities, shake them and place them in a 37°C, 5% CO2 incubator for culture.

[0186] f. Observe the cell adhesion and survival status the next day, aspirate the culture medium, and replace the medium as usual every day.

[0187] 4. Cell Cryopreservation

[0188] (1) Following the conventional subculturing procedure, use 0.5 mM EDTA to digest the cells until most of the cells shrink and become round but not yet floating. Gently pipette the cells to collect the cell suspension, centrifuge at 200 g for 5 minutes, discard the supernatant, add an appropriate amount of freezing solution to resuspend the cells, and transfer the cells to a cryopreservation tube (it is recommended to freeze one well of a six-well plate at a confluence of 80%, and the volume of freezing solution is 0.5 ml per well);

[0189] (2) Place the cryovial in a programmed cooling box and immediately store at -80°C overnight (ensure the temperature of the cryovial drops by 1°C per minute);

[0190] (3) The next day, immediately transfer the cells into liquid nitrogen.

[0191] 5. Cell Recovery

[0192] (1) Prepare Matrigel-coated cell flasks in advance. Before thawing the cells, remove the Matrigel and add an appropriate amount of BioCISO to the cell flasks. Incubate in a 37°C, 5% CO2 incubator.

[0193] (2) Quickly remove the cryovial from liquid nitrogen and immediately place it in a 37°C water bath and shake rapidly to thaw the cells. Observe carefully until the ice crystals disappear completely and stop shaking. Transfer the cells to a biosafety cabinet.

[0194] (3) Add 10 ml of DMEM / F12 (1:1) basal medium to a 15 ml centrifuge tube in advance and equilibrate to room temperature. Use a Pasteur pipette to draw 1 ml of DMEM / F12 (1:1) and slowly add it to the cryopreservation tube. Mix gently and transfer the cell suspension to the prepared 15 ml centrifuge tube containing DMEM / F12 (1:1). Centrifuge at 200 g for 5 minutes.

[0195] (4) Carefully discard the supernatant, add an appropriate amount of BioCISO, gently mix the cells, and seed them into the cell flask prepared in advance. After shaking horizontally back and forth and left and right, observe under the microscope and find no abnormalities, shake well and place in a 37°C, 5% CO2 incubator for culture;

[0196] (5) Observe the cell adhesion and survival status the next day and change the medium as scheduled daily. If the cell adhesion is good, replace the BioCISO with BioCISO + 300 μg / ml G418 + 0.5 μg / ml Puro.

[0197] (III) Gene knock-in detection method

[0198] 1. Single-cell cloning AAVS1 gene knock-in detection

[0199] (1) AAVS1 gene knock-in assay instructions

[0200] a. Purpose of the experiment: PCR detection of cells that have undergone gene knock-in treatment to test whether the cells are homozygous. Since the two donor fragments only differ in the sequence of the resistance gene, to determine whether the cell is homozygous (donor fragments of different resistance genes are knocked into two chromosomes), it is necessary to test whether the cell genome contains donor fragments of both resistance genes. Only cells with double knock-in are likely to be correctly homozygous;

[0201] b. Test Method: First, design a primer within the resistance gene of the Donor plasmid, and then design another primer in the genome at the insertion site (near the recombination arm). If the Donor fragment is correctly inserted into the genome, the target band will appear; otherwise, no target band will appear.

[0202] c. Experimental Protocol The primer sequences and PCR protocol are shown in Table 1:

[0203] Table 1 Experimental scheme Primer sequences and PCR scheme

[0204]

[0205] The detection method for knocking in a second nucleic acid molecule in the 3'UTR of the B2M and CIITA genes is the same as that for AAVS1. The PCR detection conditions used are as follows:

[0206] Table 2 Experimental Primer Sequences and PCR Protocol (Knock-in Detection of B2M Sites)

[0207]

[0208] Table 3 Experimental protocol primer sequences and PCR protocol (knock-in detection of CIITA locus)

[0209]

[0210] 2.2 Testing of allogeneic immune compatibility of stem cells

[0211] 2.2.1 Preparation of effector cells

[0212] Blood was drawn from volunteers and T cells and NK cells were isolated. Effector cells and immune-compatible pluripotent stem cells were derived from different individuals.

[0213] 1) T cell isolation: Human peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-hypaque density gradient centrifugation and then purified using Dynabeads TM CD3 (Invitrogen TM T cells were isolated using a kit (Cat. No. 11151D). The cells were resuspended in RPMI1640 medium containing 10% FBS, counted by trypan blue staining, and concentrated to 1×10 7 cells / mL.

[0214] 2) NK cell separation: using MagniSort TM Human NK cell Enrichment Kit(Invitrogen TM NK cells were isolated and sorted using a kit (Cat. No. 8804-6819-74). The cells were resuspended in RPMI1640 medium containing 10% FBS, counted by trypan blue staining, and concentrated to 1×10 7 cells / mL.

[0215] 2.2.2 Preparation of target cells

[0216] Embryoid cells prepared from PSCs were digested and resuspended, and the cells were counted by trypan blue staining and prepared into 1×10 7 cells / mL of cell suspension.

[0217] 2.2.3 51 Cr release test

[0218] When normal cells come into contact with T / NK cells (allogeneic), T / NK will attack normal cells and cause cell lysis and death. However, cells with good immune compatibility will not be attacked by T / NK, i.e. immune escape. 51 The amount of Cr can reflect the immune compatibility. 51 The less Cr released into the culture medium, the better the immune compatibility.

[0219] Quantitative detection of cell-mediated cytotoxicity using radioisotopes 51 Cr labeled target cells, incubated with effector molecules or cells, according to the release of target cell lysis 51 The cytotoxic activity was determined by the number of Cr emission pulses (cpm).

[0220] 1) Target cells were treated with 100 μCi (Ci, radioactivity unit) of Na 51 CrO4 was labeled at 37℃ for 120min, shaken every 15min, and then washed 5 times by centrifugation with cleaning solution. Finally, it was resuspended in culture medium and prepared into 1×10 6 cells / mL for later use.

[0221] 2) Add target cells and T / NK cells to a 96-well culture plate, adding 100 μl of target cells (2.5×10 3 100 μl of target cells and 100 μl of effector cells (E / T = 1:2, 1:5, 1:10, where E / T is the target cell to effector cell T / NK ratio). Simultaneously, set up natural release control wells (100 μl target cells + 100 μl culture medium) and maximum release wells (100 μl target cells + 100 μl 2% SDS). Incubate at 37°C, 5% CO2 for 4 hours. After removal, pipette out the supernatant from each well, centrifuge, and collect 100 μl of the supernatant. Measure cpm using a gamma counter.

[0222] Note: General requirements 51 Cr natural release rate <10%

[0223] 3) Result calculation: Calculate according to the formula 51 Cr natural release rate and T / NK cell activity:

[0224]

[0225]

[0226] 2.2.4CFSE test

[0227] The fluorescent dye CFSE, also known as CFDA SE (5,6-carboxyfluorescein diacetate, succinimidyl ester), is a fluorescent dye that can penetrate the cell membrane and can be detected by flow cytometry.

[0228] 1) Add CFSE working solution (final concentration of 5 μmol / L CFSE) to the target cells, incubate at 37°C, 5% CO2 for 10 min, and wash twice. After trypan blue staining and counting, resuspend in culture medium and prepare 1X10 6 cells / mL for later use.

[0229] 2) Add target cells and effector cells to 5 ml flow cytometry tubes, add 100 μl target cells (1X10 5 ml -1 ) and effector cells (E / T = 1:2, 1:5, 1:10, where E / T is the ratio of target cells to effector cells T), and target cells alone were used as a control. Gently mix the effector and target cells in the flow cytometry tube. Add PI and incubate at 37°C, 5% CO2 for 4 hours. Flow cytometry analysis of CFSE + PI + The percentage of cells (dead target cells).

[0230] Target cell death rate (%) = target cell death rate after T cell stimulation (%) - target cell natural death rate (%)

[0231] 2.2.5 Flow cytometry (FCM) analysis of NK cell CD 107a Express

[0232] When NK cells kill target cells, CD 107a The molecules are transported to the cell membrane surface, CD 107a NK cells with positive expression of the molecule may represent NK cells with killing activity.

[0233] 1) Effector cells and target cells were mixed in a certain ratio (E / NK = 3:1, 1:1, 1:3, E / NK is the ratio of target cells to effector cells NK), placed in culture wells, and incubated at 37°C, 5% CO2 for 2 hours. Monensin (2 μmol / L) was added and incubated for another 3.5 hours before adding PE-Cy5-CD 107a , FITC-CD 56 Antibody incubation was performed for 30 minutes. After washing three times with PBS, cells were fixed with 200 μL of 1% paraformaldehyde for flow cytometry analysis. Effector cells were stimulated with phorbol methyl paraformaldehyde (PMA, 2.5 μg / mL) and ionomycin (0.5 μg / mL) alone as a positive control.

[0234] Note: NK cell membrane surface CD 107a The natural expression frequency is very low, about 1.2% to 5.8%

[0235] 2) Result calculation

[0236] NK cell cytotoxicity = CD4+ stimulated by target cells 107a Positive rate (%)-CD 107a Natural expression rate (%)

[0237] 2.2.6 MTT cell activity assay

[0238] After digestion and cell counting, blow the cells evenly with the corresponding culture medium and plate them into a 96-well plate. Seed 3,000 cells in each well and plate 5 replicates. Then add the corresponding culture medium to a final volume of 150uL. Replace the corresponding culture medium every day. Place the cells in a 37°C 5% CO2 incubator and culture for 72 hours before measuring the MTT value.

[0239] 3 Experimental plan

[0240] Experimental plan 1:

[0241] The specific experimental groups are shown in Table 4. “+” indicates that the corresponding project has been knocked into the genome.

[0242] B2M-3'UTR-miRNA-locus or CIITA-3'UTR-miRNA-locus is the second nucleic acid molecule (SEQ ID NO. 2), which is knocked into the 3'UTR region of the B2M and CIITA genes, respectively.

[0243] B2M / CIITA-3'UTR-shRNA is a shRNA expression framework of a small nucleic acid molecule, that is, the first nucleic acid molecule, which specifically targets the transcription product of the second nucleic acid molecule in the 3'UTR region of the B2M gene and the CIITA gene, and the knock-in site is the genomic safe site AAVS1.

[0244] B2M / CIITA-3'UTR-shRNA-miR is a small nucleic acid molecule shRNA-miR expression framework, that is, the first nucleic acid molecule targets the transcription product of the second nucleic acid molecule in the 3'UTR region of the B2M gene and the CIITA gene, and the knock-in site is the genomic safe site AAVS1.

[0245] CD47 represents the CD47 expression sequence, and its knock-in site is the genomic safe site AAVS1.

[0246] Table 4 Constitutive expression experimental plan

[0247]

[0248] Experimental plan 2:

[0249] The specific experimental groups are shown in Table 5. “+” indicates that the corresponding project has been knocked into the genome.

[0250] B2M-3'UTR-miRNA-locus or CIITA-3'UTR-miRNA-locus is the second nucleic acid molecule (SEQ ID NO. 2), which is knocked into the 3'UTR region of the B2M and CIITA genes, respectively.

[0251] B2M / CIITA-3'UTR-shRNA is a shRNA expression framework of a small nucleic acid molecule, that is, the first nucleic acid molecule, which specifically targets the transcription product of the second nucleic acid molecule in the 3'UTR region of the B2M gene and the CIITA gene, and the knock-in site is the genomic safe site AAVS1.

[0252] B2M / CIITA-3'UTR-shRNA-miR is a small nucleic acid molecule shRNA-miR expression framework, that is, the first nucleic acid molecule targets the transcription product of the second nucleic acid molecule in the 3'UTR region of the B2M gene and the CIITA gene, and the knock-in site is the genomic safe site AAVS1.

[0253] CD47 represents the CD47 expression sequence, and its knock-in site is the genomic safe site AAVS1.

[0254] The knock-in site of the Tet-Off system is the genomic safe site AAVS1, which is used to regulate the expression of shRNA or shRNA-miR and CD47.

[0255] Table 5 Inducible expression experimental plan

[0256]

[0257]

[0258] Experimental operations of each experimental group

[0259] 1. Construction of expression plasmid

[0260] KI (Knock-in) plasmid construction method:

[0261] a. Obtaining the basic plasmid skeleton: Design primers and obtain the Amp(R)-pUC origin fragment from the pUC18 (Takara, Code No. 3218) plasmid by PCR, and then recover the product.

[0262] b. Obtaining the recombinant arms: Design primers and use human cell genomic DNA as a template to amplify AAVS1-HR-L (SEQ ID NO.10), AAVS1-HR-R (SEQ ID NO.11), B2M-HR-L (SEQ ID NO.12), B2M-HR-R (SEQ ID NO.13), CIITA-HR-L (SEQ ID NO.14), and CIITA-HR-R (SEQ ID NO.15) fragments, and then recover the products.

[0263] c. Obtaining other plasmid elements: Design primers, directly subclone the plasmid containing the plasmid element, and then recover the product.

[0264] d. Plasmid assembly: The various products obtained in the previous steps were connected into large fragments through overlap PCR. Finally, the large fragments were connected into a circular plasmid through recombination using recombinase (Nanjing Novozymes Biotechnology, C113-01).

[0265] 2. The operation of inserting the molecules of each group into the KI plasmid is as follows:

[0266] (1) Group A1: blank control group, without any treatment.

[0267] (2) Group A2: AAVS1 KI Vector (shRNA, constitutive) plasmid ( Figure 8 ) shRNA expression framework 1 is inserted into the sequence of the small nucleic acid molecule SEQ ID NO.1;

[0268] B2M KI Vector (such as Figure 12 as shown) into B2M-3'UTR-miRNA-locus;

[0269] CIITA KI Vector (such as Figure 13 as shown) into the CIITA-3'UTR-miRNA-locus.

[0270] (3) Group A3: AAVS1 KI Vector (shRNA-miR, constitutive) plasmid ( Figure 10 ) shRNA-miR expression frame 1 is inserted into the sequence of the small nucleic acid molecule SEQ ID NO.1;

[0271] B2M KI Vector was placed into B2M-3'UTR-miRNA-locus;

[0272] CIITA KI Vector puts CIITA-3'UTR-miRNA-locus.

[0273] (4) Group A4: The CD47 gene sequence was inserted into the MCS of the AAVS1 KI Vector (shRNA, constitutive) plasmid, and the small nucleic acid molecule sequence SEQ ID NO. 1 was inserted into the shRNA expression framework 1;

[0274] B2M KI Vector (such as Figure 12 as shown) into B2M-3'UTR-miRNA-locus;

[0275] CIITA KI Vector (such as Figure 13 as shown) into the CIITA-3'UTR-miRNA-locus.

[0276] (5) Group A5: The CD47 gene sequence was inserted into the MCS of the AAVS1 KI Vector (shRNA-miR, constitutive) plasmid, and the small nucleic acid molecule sequence SEQ ID NO. 1 was inserted into the shRNA-miR expression frame 1;

[0277] B2M KI Vector was placed into B2M-3'UTR-miRNA-locus;

[0278] CIITA KI Vector puts CIITA-3'UTR-miRNA-locus.

[0279] (6) Group B1: blank control group, without any treatment.

[0280] (7) Group B2: AAVS1 KI Vector (shRNA, inducible) plasmid ( Figure 9 ) shRNA expression framework 1 is inserted into the sequence of the small nucleic acid molecule SEQ ID NO.1;

[0281] B2M KI Vector was placed into B2M-3'UTR-miRNA-locus;

[0282] CIITA KI Vector puts CIITA-3'UTR-miRNA-locus.

[0283] (8) Group B3: AAVS1 KI Vector (shRNA-miR, inducible) plasmid ( Figure 11 ) shRNA-miR expression framework 1 is inserted into the sequence of the small nucleic acid molecule SEQ ID NO.1;

[0284] B2M KI Vector was placed into B2M-3'UTR-miRNA-locus;

[0285] CIITA KI Vector puts CIITA-3'UTR-miRNA-locus.

[0286] (9) Group B4: The CD47 gene sequence was inserted into the MCS of the AAVS1 KI Vector (shRNA, inducible) plasmid, and the small nucleic acid molecule sequence SEQ ID NO. 1 was inserted into the shRNA expression framework 1;

[0287] B2M KI Vector was placed into B2M-3'UTR-miRNA-locus;

[0288] CIITA KI Vector puts CIITA-3'UTR-miRNA-locus.

[0289] (10) Group B5: The CD47 gene sequence was inserted into the MCS of the AAVS1 KI Vector (shRNA-miR, inducible) plasmid, and the small nucleic acid molecule sequence SEQ ID NO. 1 was inserted into the shRNA-miR expression framework 1;

[0290] B2M KI Vector is placed into B2M-3'UTR-miRNA-locus;)

[0291] CIITA KI Vector puts CIITA-3'UTR-miRNA-locus.

[0292] 4. Experimental results

[0293] 4.1 51 Cr release assay to detect the immune compatibility of modified stem cells or their derivatives

[0294] hPSCs-derived EBs were transformed according to the experimental protocols in Tables 4 and 5. 51 Cr release assay to detect the immune compatibility of modified EB spheres with T cells:

[0295] 1. Digest EB sphere immune-compatible cells into single cells as target cells;

[0296] 2. The Sutra 51 Cr-labeled target cells and T cells were added to 96-well culture plates at a ratio of 1:5 for post-reaction detection;

[0297] 3. According to 51 Detection of cell specificity of EB-cell immune-compatible cells by Cr release assay 51 Cr release rate, the results are shown in Table 6.

[0298] Table 6 Cell specificity of EB sphere immune-compatible cells51 Cr release rate

[0299]

[0300] As can be seen in Table 6, the hPSC-derived EB spheres we prepared exhibited significant immune compatibility. After treating the cells with 6 μM Dox in the culture medium for 48 hours, the inducible expression groups (B2-B5) regained their antigen presentation capacity and exhibited a non-immune-compatible state, thus achieving reversible regulation of cellular immune compatibility.

[0301] Further use 51 Cr release test to detect the immune compatibility effect of modified EB cell immune compatible cells and NK cells:

[0302] 1. Digest EB sphere immune-compatible cells into single cells as target cells;

[0303] 2. The Sutra 51 Cr-labeled target cells and NK cells were added to 96-well culture plates at a ratio of 1:5 for post-reaction detection;

[0304] 3. According to 51 Detection of cell specificity of EB-cell immune-compatible cells by Cr release assay 51 Cr release rate, the results are shown in Table 7.

[0305] Table 7 Cell specificity of EB-globulin immune-compatible cells 51 Cr release rate

[0306]

[0307] As can be seen from Table 7, the hPSC-derived EB spheres we prepared exhibited significant immune compatibility. After treating the cells with 6 μM Dox in the culture medium for 48 hours, the inducible expression groups (B2-B5) regained their antigen presentation capacity and exhibited a non-immune-compatible state, thus achieving reversible regulation of cellular immune compatibility.

[0308] 4.2 CFSE assay to detect the effect of exosomes secreted by EB immune-compatible cells on immune escape of other cells

[0309] 1. hPSC-derived EBs were transformed according to the experimental protocols in Tables 4 and 5, the resulting EB-sphere immune-compatible cells were cultured, and the culture supernatant was collected to extract exosomes;

[0310] 2. Exosomes were added to non-immune compatible EB sphere cells that had not been modified and non-immune compatible EB sphere cells that had been modified with B2M & CIITA-3'UTR-miRNA-locus (modification scheme: only B2M-3'UTR-miRNA-locus or CIITA-3'UTR-miRNA-locus, i.e., the second nucleic acid molecule (SEQ ID NO. 2), was knocked into the 3'UTR region of the B2M and CIITA genes, respectively.) and cultured for 72 hours. The cells were then digested into single cells as target cells.

[0311] 3. Add CFSE-labeled target cells and T cells to a 5 ml flow cytometry tube at a ratio of 1:5 for reaction before detection;

[0312] 4. The percentage of CFSE+PI+ cells (dead target cells) was detected by CFSE test. The results are shown in Table 8.

[0313] Table 8 CFSE test results

[0314]

[0315]

[0316] As can be seen from Table 8, when the B2M / CIITA-3'UTR-shRNA and B2M / CIITA-3'UTR-shRNA-miR produced by the cells reach the recipient cells through exosomes, they will only act on the cells that have been knocked in and transformed with B2M&CIITA-3'UTR-miRNA-locus, thereby producing immune compatibility, and will not cause other non-donor cells to produce immune compatibility effects, that is, the immune compatibility effect produced by the cells can only work in donor cells.

[0317] 4.3 Analysis of NK cell CD4+ expression using flow cytometry (FCM) 107a Expression to detect the effect of exosomes secreted by EB immune-compatible cells on other cells to produce immune escape

[0318] 1. hPSC-derived EBs were transformed according to the experimental protocols in Tables 4 and 5, the resulting EB-sphere immune-compatible cells were cultured, and the culture supernatant was collected to extract exosomes;

[0319] 2. Exosomes were added to non-immune compatible EB sphere cells that had not been modified and non-immune compatible EB sphere cells that had been modified with B2M & CIITA-3'UTR-miRNA-locus (modification scheme: only B2M-3'UTR-miRNA-locus or CIITA-3'UTR-miRNA-locus, i.e., the second nucleic acid molecule (SEQ ID NO. 2), was knocked into the 3'UTR region of the B2M and CIITA genes, respectively.) and cultured for 72 hours. The cells were then digested into single cells as target cells.

[0320] 3. Add target cells and NK cells in a 1:1 ratio into a 5 ml flow cytometry tube for reaction before detection;

[0321] 4. According to NK cell CD 107a The expression of NK cell cytotoxicity was detected, and the results are shown in Table 9.

[0322] Table 9 NK cell CD 107a Expression detection results

[0323]

[0324]

[0325] As can be seen from Table 9, when the B2M / CIITA-3'UTR-shRNA and B2M / CIITA-3'UTR-shRNA-miR produced by the cells reach the recipient cells through exosomes, they will only act on the cells that have been knocked in and transformed with B2M&CIITA-3'UTR-miRNA-locus, thereby producing immune compatibility, and will not cause other non-donor cells to produce immune compatibility effects, that is, the immune compatibility effect produced by the cells can only work in donor cells.

[0326] 4.4 Immune compatibility of different pluripotent stem cells or their derivatives

[0327] According to the experimental group B4 in Table 5, hPSCs, hPSCs-MSCs, NSCs, and EBs were transformed. These transformed cells were digested into single cells as target cells and used 51 Cr release test to detect target cell immune compatibility effect:

[0328] 1. The Sutra 51 Cr-labeled target cells and T cells were added to 96-well culture plates at a ratio of 1:5 for post-reaction detection;

[0329] 3. According to 51 Cr release assay to detect cell specificity of target cells 51 Cr release rate, the results are shown in Table 10.

[0330] Table 10 hPSCs-MSCs, NSCs, EBs immune-compatible cells 51 Cr release rate

[0331]

[0332]

[0333] Note: Group 1 is the control group (unmodified cell group); Group 2 is the constructed immune-compatible cell group (Scheme B4); Group 3 is the immune-compatible cell group treated with inducer (Dox).

[0334] As can be seen from Table 10, the hPSCs and hPSC-derived derivatives (hPSCs-MSCs, NSCs, EBs) prepared by us have significant immune compatibility. After treatment with the inducer (Dox), these cells can restore the antigen presentation ability, achieving reversible immune compatibility. <110> Future Homo Sapiens Regenerative Medicine Research Institute (Guangzhou) Co., Ltd.; Wang Linli <120> A pluripotent stem cell and its derivatives <130> <160> 26 <170> PatentIn version 3.5 <210> 1 <211> twenty one <212> DNA <213> Caenorhabditis elegans <400> 1 ttgtactaca caaaagtact g 21 <210> 2 <211> 210 <212> DNA <213> Artificial sequence <400> 2 attctagata cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta 60 cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta cagtactttt 120 gtgtagtaca acgtacagta cttttgtgta gtacaacgta cagtactttt gtgtagtaca acgtacagta cttttgtgta gtacaacgta <210> 3 <211> 24 <212> DNA <213> Caenorhabditis elegans <400> 3 tcacaacctc ctagaaagag from <210> 4 <211> 234 <212> DNA <213> The snowstorm <400> 4 attctagata tctactcttt ctaggaggtt gtgacgtatc tactctttct aggaggttgt 120. gacgtatcta ctctttctag gaggttgtga cgtatctact ctttctagga ggttgtgacg 180. tatctactct ttctaggagg ttgtgacgta tctactcttt ctaggaggtt gtgacgtatc tactctttct aggaggttgt gacgtatcta ctctttctag gaggttgtga cgta 234 <210> 5 <211> 686 <212> DNA <213> The snowstorm <400> 5 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 120. aatattgga ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 300 gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 360 agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 420 ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagaagaaa 480 agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 540 tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 600 aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 660 gaccgatcca gcctgctagc gccacc 686 <210> 6 <211> 9 <212> DNA <213> Artificial sequence <400> 6 ttcaagaga 9 <210> 7 <211> 119 <212> DNA <213> Artificial sequence <400> 7 gaggcttcag tactttacag aatcgttgcc tgcacatctt ggaaacactt gctgggatta 60 cttcttcagg ttaacccaac agaaggctaa agaaggtata ttgctgttga cagtgagcg 119 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 tagtgaagcc acagatgta 19 <210> 9 <211> 119 <212> DNA <213> Artificial Sequence <400> 9 tgcctactgc ctcggacttc aaggggctac tttaggagca attatcttgt ttactaaaac 60 tgaatacctt gctatctctt tgatacattt ttacaaagct gaattaaaat ggtataaat 119 <210> 10 <211> 804 <212> DNA <213> Artificial Sequence <400> 10 tgctttctct gacctgcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt 60 ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt 120 cttcctccac tccctcttcc ccttgctctc tgctgtgttg ctgcccaagg atgctctttc 180 cggagcactt ccttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240 tctgggtcct ctccgggcat ctctcctccc tcacccaacc ccatgccgtc ttcactcgct 300 gggttccctt ttccttctcc ttctggggcc tgtgccatct ctcgtttctt aggatggcct 360 tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc 420 gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc 480 ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt 540 catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600 ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttcctc caacccgggc 660 ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720 gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780 gtcccctcca ccccacagtg gggc 804 <210> 11 <211> 837 <212> DNA <213> Artificial Sequence <400> 11 actagggaca ggattggtga cagaaaagcc ccatccttag gcctcctcct tcctagtctc ctgatattgg gtctaacccc cacctcctgt taggcagatt ccttatctgg tgacacaccc 120 cctttcctg gagccatctc tctccttgcc agaacctcta aggtttgctt acgatggagc 180 cagagaggat cctggggaggg agagcttggc agggggtggg agggagggg gggatgcgtg 240 acctgcccgg ttctcagtgg ccccctgcg ctaccctctc ccgaacctg agctgctctg 300 acgcggccgt ctggtgcgtt tcactgatcc tggtgctgca gcttccttac acttcccaag 360 aggagaagca gtttggaaaa acaaaatcag aataagttgg tcctgagttc taactttggc tcttcacctt tctagtcccc aatttatatt gttcctccgt gcgtcagttt tacctgtgag 480 ataaggccag tagccagccc cgtcctggca gggctgtggt gaggaggggg gtgtccgtgt 540 ggaaaactcc ctttgtgaga atggtgcgtc ctaggtgttc accaggtcgt ggccgcctct actccctttc tctttctcca tccttctttc cttaaagagt ccccagtgct atctgggaca 660 tattcctccg cccagagcag ggtcccgctt ccctaaggcc ctgctctggg cttctgggtt 720 tgagtccttg gcaagcccag gagaggcgct caggcttccc tgtccccctt cctcgtccac 780 catctcatgc ccctggctct cctgcccctt ccctacaggg gttcctggct ctgctct 837 <210> 12 <211> 900 <212> DNA <213> Artificial sequence <400> 12 cctggacttc tccagtactt tctggctgga ttggtatctg aggctagtag gaagggcttg 60 ttcctgctgg gtagctctaa acaatgtatt catgggtagg aacagcagcc tattctgcca 120 gccttatttc taaccatttt agacatttgt tagtacatgg tattttaaaa gtaaaactta 180 atgtcttcct tttttttctc cactgtcttt ttcatagatc gagacatgta agcagcatca 240 tggaggtaag tttttgacct tgagaaaatg tttttgtttc actgtcctga ggactattta 300 tagacagctc taacatgata accctcacta tgtggagaac attgacagag taacatttta 360 gcagggaaag aagaatccta cagggtcatg ttcccttctc ctgtggagtg gcatgaagaa 420 ggtgtatggc cccaggtatg gccatattac tgaccctcta cagagagggc aaaggaactg 480 ccagtatggt attgcaggat aaaggcaggt ggttacccac attacctgca aggctttgat 540 ctttcttctg ccatttccac attggacatc tctgctgagg agagaaaatg aaccactctt 600 ttcctttgta taatgttgtt ttattcttca gacagaagag aggagttata cagctctgca 660 gacatcccat tcctgtatgg ggactgtgtt tgcctcttag aggttcccag gccactagag 720 gagataaagg gaaacagatt gttataactt gatataatga tactataata gatgtaacta 780 caaggagctc cagaagcaag agagagggag gaacttggac ttctctgcat ctttagttgg 840 agtccaaagg cttttcaatg aaattctact gcccagggta cattgatgct gaaaccccat 900 <210> 13 <211> 900 <212> DNA <213> Artificial Sequence <400> 13 tcaaatctcc tgttatattc tagaacaggg aattgatttg ggagagcatc aggaaggtgg 60 atgatctgcc cagtcacact gttagtaaat tgtagagcca ggacctgaac tctaatatag 120 tcatgtgtta cttaatgacg gggacatgtt ctgagaaatg cttacacaaa cctaggtgtt 180 gtagcctact acacgcatag gctacatggt atagcctatt gctcctagac tacaaacctg 240 tacagcctgt tactgtactg aatactgtgg gcagttgtaa cacaatggta agtatttgtg 300 tatctaaaca tagaagttgc agtaaaaata tgctatttta atcttatgag accactgtca 360 tatatacagt ccatcattga ccaaaacatc atatcagcat tttttcttct aagattttgg 420 gagcaccaaa gggatacact aacaggatat actctttata atgggtttgg agaactgtct 480 gcagctactt cttttaaaaa ggtgatctac acagtagaaa ttagacaagt ttggtaatga 540 gatctgcaat ccaaataaaa taaattcatt gctaaccttt ttcttttctt ttcaggtttg 600 aagatgccgc atttggattg gatgaattcc aaattctgct tgcttgcttt ttaatattga 660 tatgcttata cacttacact ttatgcacaa aatgtagggt tataataatg ttaacatgga 720 catgatcttc tttataattc tactttgagt gctgtctcca tgtttgatgt atctgagcag 780<s gttgctccac aggtagctct aggagggctg gcaacttaga ggtggggagc agagaattct 840 cttatccaac atcaacatct tggtcagatt tgaactcttc aatctcttgc actcaaagct 900 <210> 14 <21l> 900 <212> DNA <213> Artificial sequence <400> 14 It should be noted that there may be some inaccuracies in the original text. For example, in the original, there is a "gatctgcaat ccaaataaaa taaattcatt gctaaccttt ttcttttctt ttcaggtttg 600" which seems to be a continuous sequence without proper formatting. And in the translation, the "gatctgcaat" part in the original is translated as "gatctgcaat" without any separation as it should be for better readability in English. Also, there is a possible error in the "21l" in the original which is likely a misspelling of "211". These issues are presented as they are in the original text for the purpose of translation according to the requirements. cttgacaagt ctcctgctcc tcactatgaa gatcactgtc ccccagccct gtgctccccg 60 cactgtgctg cacgtccacc tccattccac tgcccctccc atccccccat cttgatagca 120 cccttcccag gtgtcaagct gcccctccta gagtgtcctg cctaaacccc ctctcctggc 180 tcctcccgct acagcatgtt ctctgaggac actaaccacg ctggaccttg aactgggtac 240 ttgtggacac agctcttctc caggctgtat cccatgagcc tcagcatcct ggcacccggc 300 ccctgctggt tcagggttgg cccctgcccg gctgcggaat gaaccacatc ttgctctgct 360 gacagacaca ggcccggctc caggctcctt tagcgcccag ttgggtggat gcctggtggc 420 agctgcggtc cacccaggag ccccgaggcc ttctctgaag gacattgcgg acagccacgg 480 ccaggccaga gggagtgaca gaggcagccc cattctgcct gcccaggccc ctgccaccct 540 ggggagaaag tacttctttt tttttatttt tagacagagt ctcactgttg cccaggctgg 600 cgtgcagtgg tgcgatctgg gttcactgca acctccgcct cttgggttca agcgattctt 660 ctgcttcagc ctcccgagta gctgggacta caggcaccca ccatcatgtc tggctaattt 720 ttcattttta gtagagacag ggttttgcca tgttggccag gctggtctca aactcttgac 780 ctcaggtgat ccacccacct cagcctccca aagtgctggg attack tgagccactg 840 900. 900. 900. 900. 900. 900. 900. 900. 900. 900 <210> 15 <211> 900 <212> DNA <213> The snowstorm <400> 15 60. cacaccgggc actcagaaga cactgatggg caacccccag cctgctaatt ccccagattg 120. caacaggctg ggcttcagtg gcagctgctt ttgtctatgg gactcaatgc actgacattg ttggccaaag ccaaagctag gcctggccag atgcaccagc ccttagcagg gaaacagcta atgggacact aatggggcgg tgagagggga acagactgga agcacagctt catttcctgt gtcttttttc actacattat aaatgtctct ttaatgtcac aggcaggtcc aggttttgag ttcataccct gttaccattt tggggtaccc actgctctgg ttatctaata tgtaacaagc 420. caccccaaat catagtggct taaaacaaca ctcacattta ttctgctcac atatctgtca tttgagcagg gctcagcggg gacagctcct tctgtcctac tctgtgtcag gtggggcagc 480 ttgagggttg ggctggtgtc acctgaagac tcattcttct gtacgtctga caggcaatgc 540 tggctgttgg ctgggggcct cagtgccact acggaatagt tggctaggac ccctccatgt 600 gggctagttg ggcttcctca tagtatggtg gctgggttgg agggtgtccc aaaaagaaag 660 gaggggatag agagagacca cttttcataa cctagcctta gaagtcacac agtattactt 720 ctgctacata tatatgtttt aagaggcagg gtctcactct gtcgcccagt ctggaatgca 780 gtggtatgat cacggctcac tgcagcctca acctcctggg ctaagtgatc ctcccacctc 840 agcctcccga atagctggga ctacaggtgt gagtcaccaa gcccagttaa tctttagttt 900 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence​​​​​​​​​​​​​​​​​​​​​​​​​​​ctcctgttat attctagaac agg 23 <210> 19 <211> twenty three <212> DNA <213> Artificial sequence <400> 19 tttcagcatc aatgtaccct ggg 23 <210> 20 <211> twenty three <212> DNA <213> Artificial sequence <400> 20 ggcactcaga agacactgat ggg 23 <210> twenty one <211> twenty three <212> DNA <213> Artificial sequence <400> twenty one aaggtgtctg gtcggagagc agg 23 <210> twenty two <211> twenty two <212> DNA <213> Artificial sequence <400> twenty two ccatagctca gtctggtcta tc 22 <210> twenty three <211> twenty two <212> DNA <213> Artificial sequence <400> twenty three ctcttcgtcc agatcatcct ga 22 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <400> twenty four cacaccttgc cgatgtcgag 20 <210> 25 <211> twenty four <212> DNA <213> Artificial sequence <400> 25 gcactgaacg aacatctcaa gaag 24 <210> 26 <211> twenty two <212> DNA <213> Artificial sequence <400> 26 tgctccgggt ttgtctcaga tg 22

Claims

1. A pluripotent stem cell or a derivative thereof, characterized in that: A first nucleic acid molecule is introduced into the genome of the pluripotent stem cell or its derivative; Furthermore, a second nucleic acid molecule is introduced into the 3'UTR region of the immune response-related gene in the pluripotent stem cell or its derivative; A CD47 expression sequence is also introduced into the genome of the pluripotent stem cell or its derivative; The first nucleic acid molecule encodes a small nucleic acid molecule that mediates RNA interference, the small nucleic acid molecule specifically targets the transcription product of the second nucleic acid molecule, and the small nucleic acid molecule does not target any other mRNA or lncRNA of the pluripotent stem cell or its derivative; The pluripotent stem cells or their derivatives are derived from humans; The pluripotent stem cells are induced pluripotent stem cells; The pluripotent stem cell derivatives are selected from mesenchymal stem cells, neural stem cells and embryoid bodies derived from induced pluripotent stem cells; An inducible gene expression system is also introduced into the genome of the pluripotent stem cell or its derivative to regulate the expression of the first nucleic acid molecule; The immune response-related genes are B2M and CIITA; The sequence of the small nucleic acid molecule is: 5'-TTGTACTACACAAAAGTACTG-3'; The second nucleic acid molecule is SEQ ID NO.

2.

2. The pluripotent stem cell or its derivative according to claim 1, characterized in that The small nucleic acid molecule is derived from Caenorhabditis elegans.

3. The pluripotent stem cell or its derivative according to claim 1, wherein: The inducible gene expression system includes at least one of a Tet-Off system and a dimer inducible expression system.

4. The pluripotent stem cell or its derivative according to claim 3, wherein: The introduction sites of the first nucleic acid molecule and the inducible gene expression system are genomic safe sites.

5. The pluripotent stem cell or its derivative according to claim 4, wherein: The genomic safety site is at least one of the AAVS1 safety site, the eGSH safety site, and the H11 safety site.

6. The pluripotent stem cell or its derivative according to claim 3, characterized in that The introduction of the first nucleic acid molecule and the inducible gene expression system adopts viral vector interference, non-viral vector transfection or gene editing methods; the introduction of the second nucleic acid molecule adopts gene editing method; the gene editing is gene knock-in.

7. Use of the pluripotent stem cell or its derivative according to any one of claims 1 to 6 in the preparation of a product for cell therapy or a product for organ transplantation.

8. Use of the pluripotent stem cell or its derivative according to any one of claims 1 to 6 in constructing a universal pluripotent stem cell bank.

9. Use of the pluripotent stem cell or its derivative according to any one of claims 1 to 6 in the preparation of a gene drug carrier.

Images