A portable array nucleic acid amplicon signal detection device

Abstract

This invention discloses a portable array nucleic acid amplicon signal detection device, comprising an array sample plate 1, a photosensitive colorimetric paper base 3, an array focusing plate 6, an array lens 9, an array LED 10, a housing 12, a battery 20, a transformer 21, and a power switch 22. The array sample plate is horizontally located in the middle of the housing, and the photosensitive colorimetric paper base is located on the array sample plate. The array focusing plate, array lens, and array LED are sequentially fixed inside the housing above the array sample plate. The battery and transformer are fixed inside the housing below the array sample plate. The power switch is fixed on the outside of the housing, with one end connected to the array LED and the other end sequentially connected to the transformer and battery. This invention not only employs solid-phase photosensitive colorimetric technology but also designs an array-type detection structure, thus simplifying the operation steps and increasing the throughput of single-batch detection. It can greatly improve the throughput and efficiency of single-batch analysis of nucleic acid amplicon signals, and is expected to promote the large-scale promotion and application of nucleic acid diagnosis.

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic device technology, specifically relating to a portable array nucleic acid amplicon signal detection device. Background Technology

[0002] Nucleic acids are the genetic material of all life. Due to significant differences between species and individuals, they can be used not only to diagnose diseases related to endogenous genes by analyzing the differences between the nucleic acids being tested, but also to screen and identify exogenous organisms by detecting specific target genes. Based on this, nucleic acid testing has been applied in fields such as medical diagnostics, forensic examination, environmental analysis, and food inspection.

[0003] Polymerase chain reaction (PCR) is a nucleic acid amplification technology used to amplify specific nucleic acid fragments. Due to its high specificity and sensitivity, it is widely used in molecular biology, molecular diagnostics, and many other fields, and is also one of the most effective methods for early screening of COVID-19 patients. In addition, to reduce the limitations of single nucleic acid amplification, various isothermal amplification technologies have been developed, including loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA). These technologies primarily use fluorescence as the output signal for nucleic acid amplicon (target amplification product), such as the TaqMan probe in quantitative real-time PCR and the exo and fpg probes in RPA. Clearly, these technologies require additional fluorescent detection components and fluorescently labeled probes, which undoubtedly increases the cost of instruments and reagents for nucleic acid testing. It also raises the requirements for testing sites and environments, hindering real-time nucleic acid detection and making it difficult to use in grassroots and resource-poor areas. Therefore, developing new, efficient, inexpensive, and accurate amplicon detection methods and devices is crucial for promoting the application and widespread use of nucleic acid detection technology.

[0004] Previous studies on point-of-care nucleic acid detection have shown that photosensitive colorimetric assay (PSA) can perform colorimetric quantification of double-stranded DNA (dsDNA) in a liquid phase (Chemical Communications., 2015, 51, 14465) without significant interference with single-stranded DNA (ssDNA). Based on this, the technology has been successfully applied to detect amplicon amplifications of various nucleic acids (CCS Chemistry 2020, 2, 2394-2404; Analytical Chemistry 2020, 92, 9, 6456–6461; Analytical Chemistry 2021, 93, 6559-6566). This label-free PSA can, to some extent, avoid the influence of environmental limitations on nucleic acid signal output, while also reducing reagent costs and dependence on instruments. However, liquid-phase PSA still has drawbacks such as numerous operational steps and relatively low throughput per batch. Therefore, simplifying PSA operations and increasing the throughput and efficiency of single-batch analysis of nucleic acid amplicon assays will hopefully promote the large-scale promotion and application of nucleic acid diagnostic technology in grassroots areas and regions with relatively scarce resources. Summary of the Invention

[0005] The purpose of this invention is to address the problem that existing nucleic acid amplification signal detection technologies struggle to simultaneously achieve high efficiency, high throughput, and portability, thus limiting their application and promotion in grassroots and resource-poor areas. The invention provides an array nucleic acid amplicon signal detection device that is highly efficient, high-throughput, and portable.

[0006] This invention provides a portable array nucleic acid amplicon signal detection device, characterized in that the device includes an array sample plate, a photosensitive colorimetric paper base, an array focusing plate, an array lens, an array LED, a housing, a battery, a transformer, and a power switch. The array sample plate is horizontally located in the middle of the housing and can be pulled out and pushed in through a flat rectangular hole on one side of the housing. The photosensitive colorimetric paper base is located on the array sample plate. The array focusing plate, array lens, and array LED are sequentially fixed in the housing above the array sample plate. The battery and transformer are fixed in the housing below the array sample plate. The power switch is fixed on the outside of the housing on the same side as the transformer, with one end connected to the array LED and the other end sequentially connected to the transformer and the battery.

[0007] The above device also includes a support plate located below the array sample plate. The support plate has a raised frame around its perimeter. The array sample plate is fitted inside the frame. A raised handle is also provided in the middle of one side of the frame so that the array sample plate placed on it can be pulled out and pushed out from the flat rectangular hole in the housing.

[0008] The array sample carrier described in the above device has an array of circular grooves, with a photosensitive color-developing paper base located within each circular groove. The array sample carrier can be made of polymer materials such as polypropylene, polyethylene, and polystyrene, but is not limited to these materials. Furthermore, the size of the circular grooves and the array arrangement can be designed according to application requirements. The photosensitive color-developing paper base is prepared by pre-loading a liquid photosensitive color-developing reagent onto the paper base and then freeze-drying it. The paper base can be made of glass cellulose paper, nitrocellulose paper, cellulose acetate paper, etc., but is not limited to these materials.

[0009] The above-described device features an array of circular through-holes distributed on the array focusing aperture plate. Each circular through-hole corresponds perpendicularly to a circular groove distributed on the array sample plate. Each circular through-hole has an annular step on its upper inner wall, and all lenses in the array lens are located on this annular step, forming a tight fit with the inner wall above the step. The array lenses can be plano-convex lenses or concave lenses, etc.

[0010] In the above device, each LED light source in the array LED is vertically positioned above each lens in the array lens and fixed on an aluminum substrate connected to a power switch. It is then connected to a transformer and a storage battery in sequence through conductive paths laid on the aluminum substrate. The aluminum substrate is supported by steps set on the inner wall of the housing, so that the LED light source on it can be suspended above the lens.

[0011] The housing described in the above device consists of three parts: a lower housing, a middle housing, and an upper cover plate. The lower housing is a rectangular box with a concave cross-section. One side of its front housing wall is lower than the other three housing walls, so as to form a flat rectangular hole by combining with the lower end face of the same side housing wall of the middle housing. Two supporting steps are also provided parallel to the inner side of the adjacent two housing walls along the height of this side housing wall to support the tray below the array sample plate to be pulled out and pushed on its upper end face. The middle housing is a rectangular frame that matches the size of the lower housing. Its lower edge extends inward to form a rectangular step to support the array focusing aperture plate. The rear side of the frame extends to form a flat elongated frame so that the wire connected to the power switch can pass through it and connect to the conductive plate located above the array focusing aperture plate. The upper cover plate is a rectangular flat plate that matches the size of the middle housing.

[0012] To read the photosensitive color information obtained by the above devices, a camera and a signal reading device can be provided. For example, a smartphone that is easy to carry and quick to take pictures is preferred as the camera; the signal reading device is a smartphone or a small computer with software installed that can read photo information.

[0013] The liquid photosensitive color developer used in the photosensitive color-developing paper base of the above device is a solution prepared from nucleic acid dye, 3,3',5,5'-tetramethylbenzidine (TMB), trehalose, sodium citrate, and magnesium chloride. Specifically, the nucleic acid dye, TMB, trehalose, sodium citrate, and magnesium chloride can be dissolved directly by stirring at room temperature. The nucleic acid dye can be selected from SYBR Green I, SYBR Green II, TOTO-1, or TOTO-3 manufactured by Thermo Fisher Scientific.

[0014] In use, first transfer the nucleic acid amplicon solution to be tested onto the photosensitive colorimetric paper base located in the groove of the array sample plate, then place it on the tray that has been pulled out and is located in the middle of the shell, and then push it in; next, turn on the power switch, and the power from the battery is transmitted to the array LED light source fixed on the circuit board through the transformer. The light from the LED light source shines on the photosensitive colorimetric paper base carrying the nucleic acid amplicon solution through the array focusing plate and the array lens inside it, directly irradiating for at least 2 minutes to oxidize the colorless TMB to blue; after the irradiation is completed, use the protruding handle on the outside of the tray to pull out the array sample plate, take a picture of it with a smartphone, and transfer the picture to the mobile phone software or computer software to quickly read the three primary color (RGB) signal values ​​of the sample area in the picture. Finally, the ratio of the blue signal to the red signal is used as the nucleic acid amplicon output signal.

[0015] Compared with the prior art, the present invention has the following advantages:

[0016] 1. Because the detection device provided by this invention not only adopts solid-phase photosensitive colorimetric technology (PSA) but also designs an array-type detection structure, the operation steps are simple and the single-batch detection throughput is large, which greatly improves the throughput and efficiency of single-batch analysis of nucleic acid amplicon. It is expected to promote the large-scale promotion and application of nucleic acid diagnostic technology in grassroots and resource-poor areas.

[0017] 2. Since the detection device provided by the present invention not only converts liquid PSA into paper-based PSA, but also designs an array sample carrier, it lays the foundation for high-throughput and high-efficiency output of nucleic acid amplicon signals, and solves the problems of low detection throughput and low efficiency in the existing technology.

[0018] 3. Since the detection device provided by the present invention is also designed with an array of LEDs that match the array sample plate as the light source for irradiating the PSA, and at the same time utilizes the polished through holes in the array focusing plate and the lens located therein to adjust the direction of the light, it is possible to obtain an array photosensitive color light source with relatively consistent light flux and uniform illuminance, so as to further improve the efficiency and accuracy of detection.

[0019] 4. Since the detection device provided by the present invention can quickly obtain and process the photosensitive colorimetric signal of nucleic acid amplicon quantitative conversion through photography and software processing, it can quickly realize efficient and high-throughput detection of nucleic acid amplicon signals.

[0020] 5. Because the detection device provided by this invention is not only small in size, lightweight, portable, and inexpensive, but also the photosensitive colorimetric paper base it carries is easy to carry and store, the entire detection device can fully meet the environmental conditions and nucleic acid screening needs of grassroots and resource-poor areas, and is easy to promote and apply. Attached Figure Description

[0021] Figure 1 This is a cross-sectional structural diagram of the detection device provided by the present invention;

[0022] Figure 2 for Figure 1 A top-view structural diagram;

[0023] Figure 3 for Figure 1 A magnified schematic diagram of a local structure;

[0024] Figure 4 This is a schematic diagram of the upper housing of the detection device provided by the present invention;

[0025] Figure 5 This is a schematic diagram of the structure of the housing in the detection device provided by the present invention;

[0026] Figure 6 This is a block diagram illustrating the working principle of the detection device provided by the present invention.

[0027] In the diagram: 1-Array sample carrier; 2-Circular groove; 3-Photosensitive color developing paper base; 4-Panel; 5-Handle; 6-Array focusing aperture plate; 7-Circular through hole; 8-Annular step; 9-Array lens; 10-Array LED; 11-Aluminum substrate; 12-Housing; 13-Lower housing; 14-Flat rectangular hole; 15-Supporting step; 16-Middle housing; 17-Rectangular step; 18-Flat elongated frame; 19-Top cover plate; 20-Battery; 21-Transformer; 22-Power switch. Detailed Implementation

[0028] The present invention will be clearly and completely described below through embodiments. It should be noted that the following embodiments are only used to further illustrate the present invention and should not be construed as limiting the scope of protection of the present invention. Those skilled in the art can make some non-essential improvements and adjustments based on the above description of the present invention, and these non-essential improvements and adjustments should still fall within the scope of protection of the present invention.

[0029] Example 1

[0030] like Figure 1 , 2 As shown, the portable array nucleic acid amplicon signal detection device given in this embodiment includes an array sample plate 1, a photosensitive colorimetric paper base 3, a tray 4, an array focusing plate 6, an array lens 9, an array LED 10, a housing 12, a battery 20, a transformer 21, and a power switch 22.

[0031] The array sample carrier 1 is a flat plate with circular grooves 2 arranged in an array. In this embodiment, there are 12 × 8 = 96 circular grooves 2, but the invention is not limited to this. In use, after placing the nucleic acid amplicon on the photosensitive colorimetric paper base 3 located in the circular groove 2, it can be placed horizontally on the tray 4 in the middle of the housing 12, and can be pulled out and pushed in through the tray 4 through the flat rectangular hole 14 on one side of the middle of the housing 12.

[0032] Photosensitive color-developing paper base 3 is pre-prepared before use, and the specific preparation method is as follows:

[0033] (1) First, prepare 500mM sodium citrate, 4× nucleic acid dye, 2mM TMB, 1mM magnesium chloride, 2mM trehalose, and pH 4.0. In this example, the nucleic acid dye used is SYBR Green I.

[0034] (2) First, use a punch to make glass cellulose paper into a circular paper base with a diameter of 6mm. Then, drop 20μL of photosensitive color developing liquid onto each paper base and freeze dry to make a photosensitive color developing paper base.

[0035] When using the prepared photosensitive color-developing paper base 3, it is placed one by one into the circular groove 2 of the array sample plate 1, such as... Figure 3 As shown.

[0036] The tray 4 is located below the array sample plate 1. The tray 4 has a raised frame around it. The array sample plate 1 is matched and located inside the frame. A raised handle 5 is also provided in the middle of one side of the frame so that the array sample plate 1 placed on it can be pulled out and pushed out from the flat rectangular hole 14 on one side of the housing 12.

[0037] The array focusing aperture plate 6 is a rectangular cube with arrayed circular through holes 7 that correspond perpendicularly to the circular grooves 2 on the array sample plate 1. Each circular through hole 7 has an annular step 8 on its upper inner wall. Each lens in the array lens 9 is located on this annular step 8 and forms a tight fit with the inner wall above the step. Figure 3 As shown, the circular through holes 7 distributed on the array focusing plate 6 have polished inner surfaces. Their function is to block the cross-influence between individual LED light sources and achieve a focusing effect through reflection from the inner surface, ensuring that different samples in the array sample carrier obtain a consistent light flux. The array lens 9 is a plano-convex lens or a concave lens, etc.

[0038] In the LED array 10, each LED light source is vertically positioned above each lens in the array lens 9 and fixed in an array on an aluminum substrate 11 connected to a power switch 22. The substrate 11 is then connected to a transformer 21 and a battery 20 via conductive paths laid on it. The aluminum substrate 11 is supported by rectangular steps 15 on the inner wall of the housing 12, allowing the LED light sources 10 to be suspended above the lenses. The LED light sources are light-emitting diodes with a wavelength range of 420-495nm.

[0039] The housing 12 consists of three parts: a lower housing 13, a middle housing 16, and an upper cover plate 19. The lower housing 13 is a rectangular box with a concave cross-section. One side of its front housing wall is lower than the other three housing walls, forming a flat rectangular hole 14 by connecting with the lower end face of the same side housing wall of the middle housing 16. Two supporting steps 15 extend horizontally and parallel to the inner sides of the adjacent housing walls along this side housing wall to support the tray 4 below the array sample plate 1 as it is pulled out and pushed forward from its upper end face. Figure 4 As shown. The middle housing 16 is a rectangular frame that matches the size of the lower housing 13. Its lower edge extends inward to form a rectangular step 17 to support the array focusing aperture plate 6. A flat, elongated frame 18 extends from the rear of the frame to allow the wire connected to the power switch 22 to pass through and connect to the conductive path of the aluminum substrate located above the array focusing aperture plate 6. Figure 5 As shown. The upper cover 19 is a rectangular flat plate that matches the size of the middle shell 16. The lower shell 13, the middle shell 16, and the upper cover 19 can be connected as a whole by means of a frame and connectors.

[0040] In this embodiment, the battery 20 is a commercially available 12V, 4800mA Maico battery; the transformer 21 is a commercially available DM02-28033024DS transformer from Bairui Technology, which converts the battery voltage from 12V to 3V to match the voltage of the LED array. It is worth noting that the circuit, required components, and dimensions designed in this invention can be modified and optimized according to the parameters of the LED array and the power supply provided by the detection environment, such as household power, vehicle power, or a self-contained battery power supply, and are not limited thereto.

[0041] To verify the technical effect of the device of the present invention, this embodiment uses a PCR amplification kit (Takara Bio: R090S), with the invA gene of the commercially available Salmonella genome as the target nucleic acid. The forward primer sequence is: GTAGCGCCGCCAAACCTAA, the reverse primer sequence is: CGAGATCGCCAATCAGTCCT, the template gene number is 1000 copies, and PCR amplification is performed for 35 cycles to obtain the target nucleic acid amplicon.

[0042] During testing, the detection principle is as follows: Figure 6 As shown, firstly, 18 μL of the obtained target nucleic acid amplicon solution is transferred to the photosensitive colorimetric paper base 3 located in the groove 2 of the array sample carrier, and then placed on the tray 4 that has been pulled out and is located in the middle of the housing 12 and pushed in; secondly, the power switch 22 is turned on, and the power of the battery 20 is transformed and transmitted to the array LED light source 10 fixed on the aluminum substrate 11 through the transformer 21. The light emitted by the LED light source 10 is irradiated on the photosensitive colorimetric paper base 3 carrying the nucleic acid amplicon solution through the array focusing plate 6 and the array lens 9 inside it for 2 minutes, so that the colorless TMB is oxidized to blue; after the irradiation is completed, the array sample carrier 1 is pulled out using the handle 5 protruding on the outside of the tray 4, and a picture is taken of it with a smartphone. The picture is then transferred to the mobile phone software or computer software to quickly read the three primary colors (RGB) signal values ​​of the sample area in the picture. Finally, the ratio of the obtained blue signal to the red signal is used as the nucleic acid amplicon output signal.

[0043] Examples 2-5

[0044] All examples in this group used the apparatus, detection method, and commercially available Salmonella genome invA gene as the target nucleic acid for detection, as given in Example 1. The difference was the type of nucleic acid dye used. The specific detection results are shown in Table 1.

[0045] Comparative Examples 1-4

[0046] The comparative examples in this group also used the apparatus and detection method given in Example 1. The difference is that no target nucleic acid was added during detection; the types of nucleic acid dyes used correspond to those in Examples 2-5. The specific detection results are shown in Table 1.

[0047] Table 1

[0048]

[0049] Examples 6-8

[0050] This set of embodiments also uses the apparatus and detection method given in Embodiment 1, the difference being:

[0051] Example 6 uses a PCR amplification kit (Takara Bio: R090S) to amplify the invA gene of Salmonella genome. The amplification is also performed in 35 cycles to obtain the target nucleic acid amplicon for PCR.

[0052] Example 7, however, used a LAMP amplification kit (NEB: E1700S) to amplify the invA gene of the Salmonella genome as the target nucleic acid. The FIP sequence in the LAMP amplification kit was: GAC GAC TGG TAC TGA TCG ATA GTTTTT CAA CGT TTC CTG CGG, the BIP sequence was: CCG GTG AAA TTA TCG CCA CAC AAA ACC CAC CGCCAG G, the F3 sequence was: GGC GAT ATT GGT GTT TAT GGG G, the B3 sequence was: AAC GAT AAA CTG GAC CACGG, the Loop-F sequence was: GAC GAA AGA GCG TGG TAA TTA AC, and the Loop-B sequence was: GGG CAA TTC GTTATT GGC GAT AG. The template gene number was 5000 copies, and the amplification time was 30 minutes, obtaining the target nucleic acid amplicons for LAMP.

[0053] Example 8 uses an RPA amplification kit (TwistDx: TABAS03KIT) to amplify the invA gene of Salmonella genome as the target nucleic acid. The forward primer sequence in the RPA amplification kit is: AAG CAA AAC GTA GCGCCG CCA AAC CTA A, and the reverse primer sequence is: CAC TCG CAT CAA ATC AAA ATA GAC CGT A. The template gene number is 5000 copies, and the amplification time is 15 minutes to obtain the target nucleic acid amplicon for RPA.

[0054] The test results are shown in Table 2.

[0055] Comparative Examples 5-7

[0056] The comparative examples in this group also used the apparatus and detection method given in Example 1. The difference is that no target nucleic acid was added during detection; the types of nucleic acid dyes used correspond to those in Examples 6-8. The specific detection results are shown in Table 2.

[0057] Table 2

[0058]

Claims

1. A portable array nucleic acid amplicon signal detection device, characterized in that... The device includes an array sample plate (1), a photosensitive color-developing paper base (3), an array focusing aperture plate (6), an array lens (9), an array LED (10), a housing (12), a battery (20), a transformer (21), and a power switch (22). The array sample plate (1) is horizontally located in the middle of the housing (12) and can be pulled out and pushed in through a flat rectangular hole (14) on one side of the middle of the housing (12). The photosensitive color-developing paper base (3) is located on the array sample plate (1). The array focusing aperture plate (6), the array lens (9), and the array LED (10) are fixed in sequence in the array. Inside the housing (12) above the array carrier plate (1), the storage battery (20) and the transformer (21) are fixedly located inside the housing (12) below the array carrier plate (1). The power switch (22) is fixedly located outside the housing (12) on the same side as the transformer (21). One end of the switch is connected to the array LED (10), and the other end is connected to the transformer (21) and the storage battery (20) in sequence. The array carrier plate (1) has a circular groove (2) distributed in an array. The photosensitive color developing paper base (3) is located in the circular groove (2). The wavelength range of the array LED (10) is 420 - 495 nm.

2. The portable array nucleic acid amplicon signal detection device according to claim 1, characterized in that... The device also includes a tray (4) located below the array sample plate (1). The tray (4) has a raised frame around it. The array sample plate (1) is located inside the frame. A raised handle (5) is provided on the middle of one side of the frame so that the array sample plate (1) placed on it can be pulled out and pushed out from the flat rectangular hole (14) of the housing.

3. The portable array nucleic acid amplicon signal detection device according to claim 1 or 2, characterized in that... The array focusing plate (6) in the device has a circular through hole (7) distributed in an array. Each circular through hole (7) corresponds vertically to a circular groove (2) distributed in an array on the array sample plate (1). Each circular through hole (7) has an annular step (8) on the inner wall of the upper half of the inner wall. Each lens in the array lens (9) is located on the annular step (8) and forms a tight fit with the inner wall above the step.

4. The portable array nucleic acid amplicon signal detection device according to claim 1 or 2, characterized in that... In this device, each LED light source in the array LED (10) is vertically positioned above each lens in the array lens (9) and fixed on an aluminum substrate (11) connected to a power switch (22). The LED light source is then connected to a transformer (21) and a storage battery (20) in sequence through the conductive path on the aluminum substrate (11). The aluminum substrate (11) is supported by a step (15) set on the inner wall of the housing (12), so that the LED light source (10) on it can be suspended above the lens (9).

5. The portable array nucleic acid amplicon signal detection device according to claim 3, characterized in that... In this device, each LED light source in the array LED (10) is vertically positioned above each lens in the array lens (9) and fixed on an aluminum substrate (11) connected to a power switch (22). The LED light source is then connected to a transformer (21) and a storage battery (20) in sequence through the conductive path on the aluminum substrate (11). The aluminum substrate (11) is supported by a step (15) set on the inner wall of the housing (12), so that the LED light source (10) on it can be suspended above the lens (9).

6. The portable array nucleic acid amplicon signal detection device according to claim 1 or 2, characterized in that... The housing (12) in the device consists of three parts: a lower housing (13), a middle housing (16), and an upper cover plate (19). The lower housing (13) is a rectangular box with a concave cross-section. One side of its front housing wall is lower than the other three housing walls, so as to form a flat rectangular hole (14) by combining with the lower end face of the same side housing wall of the middle housing (16). Two supporting steps (15) are also provided parallel to the inner side of the adjacent two housing walls along the height of this side housing wall to support the tray (4) below the array sample plate (1). Pull out and push out from its upper end face; the middle shell (16) is a rectangular frame that matches the size of the lower shell (13), and its lower edge extends inward to form a rectangular step (17) to support the placement of the array focusing aperture plate (6), and the rear side of the frame extends to form a flat elongated frame (14) so ​​that the wire connected to the power switch (22) can pass through it and connect to the conductive path of the aluminum substrate (11) located above the array focusing aperture plate (6); the upper cover plate (19) is a rectangular plate that matches the size of the middle shell (16).

7. The portable array nucleic acid amplicon signal detection device according to claim 3, characterized in that... The housing (12) in the device consists of three parts: a lower housing (13), a middle housing (16), and an upper cover plate (19). The lower housing (13) is a rectangular box with a concave cross-section. One side of its front housing wall is lower than the other three housing walls, so as to form a flat rectangular hole (14) by combining with the lower end face of the same side housing wall of the middle housing (16). Two supporting steps (15) are also provided parallel to the inner side of the adjacent two housing walls along the height of this side housing wall to support the tray (4) below the array sample plate (1). Pull out and push out from its upper end face; the middle shell (16) is a rectangular frame that matches the size of the lower shell (13), and its lower edge extends inward to form a rectangular step (17) to support the placement of the array focusing aperture plate (6), and the rear side of the frame extends to form a flat elongated frame (14) so ​​that the wire connected to the power switch (22) can pass through it and connect to the conductive path of the aluminum substrate (11) located above the array focusing aperture plate (6); the upper cover plate (19) is a rectangular plate that matches the size of the middle shell (16).

8. The portable array nucleic acid amplicon signal detection device according to claim 5, characterized in that... The housing (12) in the device consists of three parts: a lower housing (13), a middle housing (16), and an upper cover plate (19). The lower housing (13) is a rectangular box with a concave cross-section. One side of its front housing wall is lower than the other three housing walls, so as to form a flat rectangular hole (14) by combining with the lower end face of the same side housing wall of the middle housing (16). Two supporting steps (15) are also provided parallel to the inner side of the adjacent two housing walls along the height of this side housing wall to support the tray (4) below the array sample plate (1). Pull out and push out from its upper end face; the middle shell (16) is a rectangular frame that matches the size of the lower shell (13), and its lower edge extends inward to form a rectangular step (17) to support the placement of the array focusing aperture plate (6), and the rear side of the frame extends to form a flat elongated frame (14) so ​​that the wire connected to the power switch (22) can pass through it and connect to the conductive path of the aluminum substrate (11) located above the array focusing aperture plate (6); the upper cover plate (19) is a rectangular plate that matches the size of the middle shell (16).

Images