Disruption of the CDC42 effector in yeast for increased alcohol and lysine production

Abstract

Described are compositions and methods involving yeast having a genetic mutation that results in a reduced amount of Cdc42 effector protein, resulting in increased alcohol and lysine production. Such yeast are well suited for commercial alcohol production to increase yield and improve the value of fermentation co-products containing amino acids.

Description

Technical Field

[0001] The strains and methods of the present invention relate to yeasts with genetic mutations that result in reduced amounts of Cdc42 effector proteins, thereby increasing alcohol and lysine production. Such yeasts are very suitable for use in commercial alcohol production to increase yields and improve the value of fermentation products and co-products containing amino acids. Background Art

[0002] Many countries produce fuel alcohol from fermentable substrates such as corn starch, sugar cane, cassava, and molasses. In the United States alone, fuel ethanol production approached 15 billion gallons in 2015, according to the Renewable Fuels Association (Washington, D.C., USA).

[0003] In addition to producing about 2.8 gallons of ethanol, a bushel (56 pounds) of corn processed in a dry-milling ethanol plant also produces about 17.5 pounds of animal feed. Animal feed is usually in the form of distillers dried grains with solute (DDGS), and represents the part of corn that is depleted of starch plus the biomass of yeast used for fermentation. By unit weight, DDGS is more nutritious to animals than unprocessed corn because it is richer in protein and fat. In addition to DDGS, dry-milling ethanol plants can also produce other protein-rich corn co-products for animal feed applications.

[0004] Lysine is an essential amino acid for most animals and must be supplemented if it is not supplied in sufficient quantities in DDGS to meet feed conversion expectations. Synthetic lysine is expensive and can represent a significant cost in animal feed. There is a need for methods to improve or maintain the production of alcohol from starch-containing feedstocks while increasing the nutritional value of animal feed co-products. Summary of the invention

[0005] Described are compositions and methods involving yeast cells having genetic mutations that result in reduced amounts of Cdc42 effector proteins, resulting in increased alcohol and lysine production. Such yeast are well suited for commercial alcohol production to increase yield and improve the value of fermentation products and co-products containing amino acids. Aspects and embodiments of the compositions and methods are described in the following independently numbered paragraphs.

[0006] 1. In one aspect, a modified yeast cell derived from a parent yeast cell is provided, the modified cell comprising a genetic alteration that causes the modified cell to produce a reduced amount of a functional Cdc42 effector polypeptide compared to the parent cell, wherein the modified cell exhibits increased alcohol production and / or increased lysine production compared to the parent cell under equivalent fermentation conditions.

[0007] 2. In some embodiments of the modified cell of paragraph 1, the genetic alteration reduces or prevents the production of functional Gic1 and / or Gic2 polypeptides compared to the parent cell.

[0008] 3. In some embodiments of the modified cell as described in paragraph 1, the cell produces a reduced amount of Gic1 and / or Gic2 polypeptide, or does not produce a measurable amount of Gic1 and / or Gic2 polypeptide.

[0009] 4. In some embodiments of the modified cell of any of paragraphs 1-3, the genetic alteration comprises disruption of the YHR061c gene or a homolog thereof encoding a Gic1 polypeptide and / or disruption of the YDR309c gene or a homolog thereof encoding a Gic2 polypeptide present in the parental cell.

[0010] 5. In some embodiments of the modified cell as described in paragraph 4, the disruption is caused by the complete or partial deletion of the YHR061c gene or its homolog and / or the YDR309c gene or its homolog, respectively.

[0011] 6. In some embodiments of the modified cell as described in paragraph 4, the disruption is caused by the deletion of a portion of the genomic DNA comprising the YHR061c gene or its homolog and / or the YDR309c gene or its homolog, respectively.

[0012] 7. In some embodiments of the modified cell as described in paragraph 4, the disruption is caused by mutagenesis of the YHR061c gene or its homolog and / or the YDR309c gene or its homolog, respectively.

[0013] 8. In some embodiments of the modified cells described in any of paragraphs 4-7, the respective disruptions of the YHR061c gene or its homolog and / or the YDR309c gene or its homolog are combined with the introduction of a gene of interest at the corresponding genetic loci.

[0014] 9. In some embodiments of the modified cell of any of paragraphs 1-8, the cell further comprises one or more genes of a phosphoketolase pathway.

[0015] 10. In some embodiments of the modified cell of paragraph 9, the gene of the phosphoketolase pathway is selected from the group consisting of: phosphoketolase, phosphotransacetylase, and acetylated acetyl dehydrogenase.

[0016] 11. In some embodiments of the modified cell of any of paragraphs 1-10, the cell further comprises an exogenous gene encoding a carbohydrate processing enzyme.

[0017] 12. In some embodiments, the modified cell of any of paragraphs 1-11 further comprises an alteration in the glycerol pathway and / or the acetyl-CoA pathway.

[0018] 13. In some embodiments, the modified cell of any of paragraphs 1-12 further comprises an alternative pathway for producing ethanol.

[0019] 14. In some embodiments of the modified cell of any of paragraphs 1-13, the cell belongs to a Saccharomyces species.

[0020] 15. In another aspect, a method for producing a modified yeast cell is provided, the method comprising: introducing a genetic alteration into a parent yeast cell, the genetic alteration reducing or preventing the production of a functional Cdc42 effector polypeptide compared to the parent cell, thereby producing the following modified cell, the modified cell producing an increased amount of alcohol and / or lysine during fermentation compared to the parent cell under equivalent fermentation conditions.

[0021] 16. In some embodiments of the method of paragraph 15, the genetic alteration reduces or prevents the production of functional Gic1 and / or Gic2 polypeptides compared to the parent cell.

[0022] 17. In some embodiments of the method of paragraph 15, the cell produces reduced amounts of Gic1 and / or Gic2 polypeptides, or does not produce measurable amounts of Gic1 and / or Gic2 polypeptides.

[0023] 18. In some embodiments of the method of any of paragraphs 15-17, the genetic alteration comprises disruption of the YHR061c gene or a homolog thereof encoding a Gic1 polypeptide and / or disruption of the YDR309c gene or a homolog thereof encoding a Gic2 polypeptide present in the parental cell.

[0024] 19. In some embodiments of the method of any one of paragraph 18, the disruption is caused by the complete or partial deletion of the YHR061c gene or its homolog and / or the YDR309c gene or its homolog, respectively.

[0025] 20. In some embodiments of the method of any one of paragraph 18, the disruption is caused by a deletion of a portion of genomic DNA comprising the YHR061c gene or its homolog and / or the YDR309c gene or its homolog, respectively.

[0026] 21. In some embodiments of the modified cell of any of paragraph 18, the disruption is caused by mutagenesis of the YHR061c gene or a homolog thereof and / or the YDR309c gene or a homolog thereof, respectively.

[0027] 22. In some embodiments of the method as described in any of paragraphs 18-21, the respective disruption of the YHR061c gene or its homolog and / or the YDR309c gene or its homolog is combined with the introduction of a target gene at the corresponding genetic locus.

[0028] 23. In some embodiments of the method of any of paragraphs 15-22, the cell further comprises exogenous genes encoding carbohydrate processing enzymes, alterations in the glycerol pathway, the acetyl-CoA pathway, and / or alternative pathways for producing ethanol.

[0029] 24. In some embodiments of the method of any of paragraphs 15-23, the cell is of a Saccharomyces species.

[0030] 25. In some embodiments of the method of any of paragraphs 15, the cell is a modified cell of any of paragraphs 1-14.

[0031] 26. In another aspect, there is provided a method for increasing the amount of lysine present in a post-fermentation product, the method comprising:

[0032] (i) hydrolyzing a starch-containing feedstock with an α-amylase to produce a starch liquefact; (ii) saccharifying the starch liquefact with a glucoamylase to produce glucose; (iii) fermenting the glucose with a modified yeast cell derived from a parent yeast cell, the modified yeast cell comprising a genetic alteration that results in the production of a reduced amount of a functional Cdc42 effector polypeptide as compared to the parent cell; and (iv) recovering a post-fermentation byproduct that is enriched in lysine compared to a post-fermentation byproduct recovered from an otherwise identical process using the parent yeast.

[0033] 27. In some embodiments of the method of paragraph 26, the post-fermentation product is selected from the group consisting of fermentation broth, whole stillage, thin stillage, dried distiller's grains, dried distiller's grains with solubles, concentrated distiller's grains solubles, or other protein-containing co-products.

[0034] 28. In some embodiments of the method of paragraph 26 or 27, one or more steps (i)-(iv) are combined in a simultaneous or overlapping manner.

[0035] 29. In another aspect, a method for increasing the amount of lysine present in a fermentation product is provided, the method comprising: (i) fermenting glucose or another sugar with a modified yeast cell derived from a parent yeast cell, the modified yeast cell comprising a genetic alteration that results in the production of a reduced amount of a functional Cdc42 effector polypeptide as compared to the parent cell; and (ii) recovering a fermentation product enriched in lysine as compared to a fermentation product recovered from an otherwise identical process using the parent yeast.

[0036] 30. In some embodiments of the method of any of paragraphs 26-29, the cell is a modified cell of any of paragraphs 1-14.

[0037] 31. In another aspect, a modified yeast cell is provided, which is produced by the method of any one of paragraphs 15-25.

[0038] 32. In another aspect, a fermentation product is provided, which is produced by the method of any one of paragraphs 26-30.

[0039] 33. In another aspect, there is provided a composition or method having the features as described in paragraphs 1 to 32 or any of the features mentioned in the specification.

[0040] These and other aspects and embodiments of the modified cells and methods of the invention will be apparent from the description including the accompanying drawings. DETAILED DESCRIPTION

[0041] I. Overview

[0042] Described are methods involving yeast with genetic mutations that result in reduced amounts of Cdc42 effector (or target) proteins, resulting in increased alcohol and lysine production. Such yeast are well suited for use in commercial alcohol production to increase yields and improve the value of fermentation products and co-products containing amino acids.

[0043] II. Definitions

[0044] Before describing the strains and methods of the present invention in detail, the following terms are defined for clarity. Undefined terms shall be consistent with the ordinary meanings of these terms used in the relevant art.

[0045] As used herein, "alcohol" refers to an organic compound in which a hydroxyl functional group (-OH) is bonded to a saturated carbon atom.

[0046] As used herein, the phrase "degree of polymerization" (DP) refers to the number (n) of anhydropyranose glucopyranose units in a given sugar. Examples of DP1 are the monosaccharides glucose and fructose. Examples of DP2 are the disaccharides maltose and sucrose. The meanings of DP1, DP12, DP3, DP4, DP4+, etc. are well known in carbohydrate processing science.

[0047] As used herein, "yeast cells", "yeast strains", or simply "yeast" refers to organisms from the phylum Ascomycota and Basidiomycota. An exemplary yeast is a budding yeast from the order Saccharomycetales. A specific example of yeast is a species of the genus Saccharomycetes, including but not limited to S. cerevisiae. Yeast includes organisms used to produce fuel alcohols as well as organisms used to produce drinkable alcohols, including specialty and proprietary yeast strains used to make unique flavored beer, wine, and other fermented beverages.

[0048] As used herein, the phrase "variant yeast cell," "modified yeast cell," or similar phrases (see above) refers to yeast that includes the genetic modifications and features described herein. Variant / modified yeast does not include naturally occurring yeast.

[0049] As used herein, the phrase "substantially inactive" or similar phrases means that the specified activity is either undetectable in the mixture or is present in an amount that does not interfere with the intended purpose of the mixture.

[0050] As used herein, the terms "polypeptide" and "protein" (and their respective plural forms) are used interchangeably and refer to polymers of any length comprising amino acid residues linked by peptide bonds. Conventional one-letter or three-letter codes for amino acid residues are used herein, and all sequences are presented from the N-terminal to the C-terminal direction. The polymer can be linear or branched, it can contain modified amino acids, and it can be interrupted by non-amino acids. These terms also encompass amino acid polymers modified naturally or by intervention (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component). Also included within the definition are, for example, polypeptides containing one or more amino acid analogs (including, for example, non-natural amino acids, etc.) and other modifications known in the art.

[0051] As used herein, proteins that are functionally and / or structurally similar are considered "related proteins". Such proteins may be derived from organisms of different genera and / or species, or even from organisms of different classes (e.g., bacteria and fungi). Related proteins also encompass homologs determined by primary sequence analysis, by secondary or tertiary structure analysis, or by immunological cross-reactivity.

[0052] As used herein, the term "homologous protein" refers to a protein with similar activity and / or structure to a reference protein. This is not intended to mean that homologues are necessarily evolutionarily related. Therefore, the term is intended to encompass one or more enzymes that are identical, similar, or corresponding (i.e., in terms of structure and function) obtained from different organisms. In certain embodiments, it is desirable to identify homologues with similar quaternary, tertiary, and / or primary structures to the reference protein. In certain embodiments, homologous proteins induce similar one or more immune responses as reference proteins. In certain embodiments, homologous proteins are engineered to produce enzymes with one or more desired activities.

[0053] The degree of homology between sequences can be determined using any suitable method known in the art (see, e.g., Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al. (1984) Nucleic Acids Res. 12:387-95).

[0054] For example, PILEUP is a useful program for determining the level of sequence homology. PILEUP uses progressive, pairwise comparisons to create a multiple sequence alignment from a group of related sequences. It can also draw a tree showing the clustering relationship used to create the comparison. PILEUP uses a simplification of the progressive comparison method of Feng and Doolittle (Feng and Doolittle (1987) J.Mol.Evol. [Molecular Evolution Magazine] 35:351-60). The method is similar to the method described by Higgins and Sharp ((1989) CABIOS [Computer Applications in Biology] 5:151-53). Useful PILEUP parameters include a default gap weight of 3.00, a default gap length weight of 0.10, and a weighted end gap. Another example of a useful algorithm is the BLAST algorithm, described by Altschul et al. ((1990) J. Mol. Biol. 215:403-10) and Karlin et al. ((1993) Proc. Natl. Acad. Sci. USA 90:5873-87). A particularly useful BLAST program is the WU-BLAST-2 program (see, e.g., Altschul et al. (1996) Meth. Enzymol. 266:460-80). The parameters "W", "T", and "X" determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 11, the BLOSUM62 scoring matrix (see, e.g., Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915), alignments (B) of 50, expectation (E) of 10, M'5, N'-4, and a comparison of both strands.

[0055] As used herein, in the context of at least two nucleic acids or polypeptides, the phrases "substantially similar" and "substantially identical" typically mean that a polynucleotide or polypeptide comprises a sequence having at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or even at least about 99% identity, or higher identity compared to a reference (i.e., wild-type) sequence. The sequence identity percentages are calculated using the CLUSTAL W algorithm with default parameters. See Thompson et al. (1994) Nucleic Acids Res. [Nucleic Acids Research] 22: 4673-4680. The default parameters for the CLUSTAL W algorithm are:

[0056] Open field goal penalty: 10.0

[0057] Gap Extension Penalty: 0.05

[0058] Protein Weight Matrix: BLOSUM Series

[0059] DNA weight matrix: IUB

[0060] Delayed divergence sequence %: 40

[0061] Space separation distance: 8

[0062] DNA conversion weight: 0.50

[0063] List hydrophilic residues: GPSNDQEKR

[0064] Use Negativity Matrix: Off

[0065] Toggle special residue penalties: On

[0066] Toggle hydrophilic penalty: On

[0067] Switch to end the empty space separation penalty level.

[0068] Another indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ in conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, e.g., where the two peptides differ only in conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (e.g., within a range of moderate to high stringency).

[0069] As used herein, the term "gene" is synonymous with the term "allele" and refers to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are typically haploid, so a single copy of a given gene (i.e., a single allele) is sufficient to confer a given phenotype.

[0070] As used herein, the terms "wild type" and "native" are used interchangeably and refer to a gene, protein or strain as found in nature.

[0071] As used herein, the term "target protein" refers to a polypeptide that is desired to be expressed in a modified yeast. Such proteins can be enzymes, substrate binding proteins, surfactant proteins, structural proteins, selective markers, etc., and can be expressed at high levels. The target protein is encoded by a modified endogenous gene or heterologous gene (i.e., target gene) relative to the parent strain. The target protein can be expressed intracellularly or as a secreted protein.

[0072] As used herein, "deletion of a gene" refers to the removal of the gene from the genome of the host cell. When a gene includes a control element (e.g., an enhancer element) that is not immediately adjacent to the gene coding sequence, the deletion of the gene refers to the deletion of the coding sequence, and optionally adjacent enhancer elements (e.g., including but not limited to promoter and / or terminator sequences), but does not require the deletion of non-adjacent control elements.

[0073] As used herein, "disruption of a gene" refers generally to any genetic or chemical manipulation (i.e., mutation) that substantially prevents a cell from producing a functional gene product (e.g., protein) in a host cell. Exemplary methods of disruption include complete or partial deletion of any part of a gene (including a polypeptide coding sequence, a promoter, an enhancer, or another regulatory element) or mutagenesis thereof, wherein mutagenesis encompasses substitutions, insertions, deletions, inversions, and combinations and variations thereof, any of which substantially prevents the production of a functional gene product. Genes may also be destroyed using RNAi, antisense, or any other method for eliminating gene expression. Genes may be destroyed by deletion or genetic manipulation of non-adjacent control elements.

[0074] As used herein, the terms "genetic manipulation" and "genetic alteration" are used interchangeably and refer to changes / variations in a nucleic acid sequence. The changes may include, but are not limited to, substitution, deletion, insertion or chemical modification of at least one nucleic acid in a nucleic acid sequence.

[0075] As used herein, "major genetic determinant" refers to a gene or genetic manipulation thereof that is necessary and sufficient to confer a particular phenotype in the absence of other genes or genetic manipulations thereof. However, the fact that a particular gene is necessary and sufficient to confer a particular phenotype does not exclude the possibility that additional effects on the phenotype may be achieved through further genetic manipulations.

[0076] As used herein, a "functional polypeptide / protein" is a protein that has activity (e.g., enzymatic activity, binding activity, surface active properties, etc.) and has not been mutagenized, truncated, or otherwise modified to eliminate or reduce this activity. As noted, a functional polypeptide can be thermostable or thermolabile.

[0077] As used herein, a "functional gene" is a gene that can be used by cell components to produce an active gene product (typically a protein). A functional gene is the opposite of a disrupted gene, which is modified so that they cannot be used by cell components to produce an active gene product, or have a reduced ability to be used by cell components to produce an active gene product.

[0078] As used herein, a yeast cell has been "modified to prevent the production of a specified protein" if it has been genetically or chemically altered to prevent the production of a functional protein / polypeptide exhibiting the activity characteristic of a wild-type protein. Such modifications include, but are not limited to, deletion or disruption of a gene encoding a protein (as described herein), genetic modifications that render the encoded polypeptide lacking the aforementioned activity, genetic modifications that affect post-translational processing or stability, and combinations thereof.

[0079] As used herein, "fermentation broth" is the product of an ethanol production facility after fermentation with yeast but before distillation.

[0080] As used herein, "whole stillage" is the byproduct of an ethanol production facility after distillation.

[0081] As used herein, "thin stillage" is the liquid portion of whole stillage after separation of solid materials.

[0082] As used herein, "distillers grains (DG)" is the solid / slurry component of whole stillage.

[0083] As used herein, "distillers dried grains (DDG)" is DG that has been dried.

[0084] As used herein, "distillers dried grains with solubles (DDGS)" is DG that has been dried along with concentrated thin stillage to increase nutritional value.

[0085] As used herein, a "wet" distillation by-product contains at least 20% water by weight.

[0086] As used herein, a "dry" distillation by-product contains less than 20% water by weight.

[0087] As used herein, "aerobic fermentation" refers to growth in the presence of oxygen.

[0088] As used herein, "anaerobic fermentation" refers to growth in the absence of oxygen.

[0089] As used herein, the singular articles "a / an" and "the" include plural referents unless the context clearly indicates otherwise. All references cited herein are hereby incorporated by reference in their entirety. Unless otherwise stated, the following abbreviations / acronyms have the following meanings:

[0090] ℃ Celsius

[0091] DG Distillers Lees

[0092] DDG Dried Distillers Grains

[0093] DDGS Distillers Dried Grains with Dissolved Matter

[0094] DNA deoxyribonucleic acid

[0095] DP degree of polymerization

[0096] DS Dry Solids

[0097] EtOH

[0098] g or gm gram

[0099] g / L grams / liter

[0100] GA Glucoamylase

[0101] GAU / g DS Glucoamylase unit / gram dry solids

[0102] HPLC High Performance Liquid Chromatography

[0103] hr or h hours

[0104] kDa kilodaltons

[0105] M Moore

[0106] mg milligram

[0107] mL or ml milliliters

[0108] ml / min ml / min

[0109] mM millimole

[0110] N equivalent concentration

[0111] Na Not applicable

[0112] PCR polymerase chain reaction

[0113] ppm parts per million

[0114] SAPU / g DS Protease Unit / g Dry Solids

[0115] SSCU / g DS Fungal α-amylase unit / g dry solid

[0116] Δ is associated with deletion

[0117] μg microgram

[0118] μL and μl microliter

[0119] μM and μm micromolar

[0120] III. Modified Yeast Cells Expressing Reduced Levels of Cdc42 Target Polypeptides

[0121] Cdc42 is a GTPase of the Rho family that serves as a major regulator of cytoskeletal remodeling in many cell types, including budding yeast. Activated Cdc42 is concentrated in an area of ​​the cell cortex where it recruits effector proteins to remodel the cytoskeleton in a polarized manner. At least in yeast cells, polarization involves a positive feedback loop in which effectors, including those known as p21-activated kinases (PAKs), recruit guanine nucleotide exchange factors (GEFs), resulting in further local increases in GTP-Cdc42 concentrations. Additional effector proteins include Gic1 and Gic2, which are involved in the regulation of the actin and septin cytoskeleton.

[0122] Applicants have found that yeast with genetic alterations that reduce Gic1 or Gic2 production exhibit increased ethanol production in fermentation compared to otherwise identical yeast. In addition, Applicants have found that yeast with such genetic alterations exhibit increased lysine production in fermentation compared to otherwise identical yeast.

[0123] The reduction in the amount of functional Gic polypeptides may be caused by the disruption of a gene encoding a Gic1 polypeptide (e.g., YDR309c) and / or a gene encoding a Gic2 polypeptide (e.g., 2YHR061c) in Saccharomyces cerevisiae. Because the disruption of a gene encoding a Gic polypeptide is the primary genetic determinant that confers an altered alcohol and lysine production phenotype to a modified cell, in some embodiments, the modified cell need only contain such a disrupted gene, while all other genes may remain intact. In other embodiments, the modified cell may optionally include additional genetic changes compared to the parent cell from which the modified cell was derived. Although such additional genetic changes are not necessary to confer the phenotype, they may confer other advantages to the modified cell.

[0124] The disruption of the gene encoding the Gic polypeptide can be performed using any suitable method that substantially prevents the expression of a functional Gic polypeptide. Exemplary disruption methods known to those skilled in the art include, but are not limited to: complete or partial deletion of a gene encoding a Gic polypeptide, including complete or partial deletion of, for example, a Gic coding sequence, a promoter, a terminator, an enhancer, or another regulatory element; and complete or partial deletion of a portion of any portion of a chromosome containing a gene encoding a Gic polypeptide. Specific methods for disrupting a gene encoding a Gic polypeptide include nucleotide substitution or insertion in any portion of such a gene (e.g., a gene encoding a Gic polypeptide coding sequence, a promoter, a terminator, an enhancer, or another regulatory element).

[0125] Mutations in genes encoding Gic polypeptides can reduce promoter efficiency, reduce enhancer efficiency, interfere with mRNA splicing or editing, interfere with mRNA translation, introduce stop codons into the Gic coding sequence to prevent translation of full-length Gic protein, alter the coding sequence of the Gic protein to produce less active or inactive protein or reduce the interaction of Gic with other proteins or DNA, alter the coding sequence of the Gic protein to produce a more unstable protein or target the protein for destruction, cause the Gic protein to be misfolded or mismodified (e.g., by glycosylation), or interfere with cellular trafficking of the Gic protein. In some embodiments, these and other genetic manipulations are used to reduce or prevent the expression of functional Gic protein, or to reduce or prevent the normal function of Gic1 or Gic2.

[0126] Preferably, disruption of the gene encoding the Gic polypeptide is performed by genetic manipulation using sequence-specific molecular biology techniques, without the use of chemical mutagenesis, which generally does not target specific nucleic acid sequences. However, chemical mutagenesis is not excluded as a method for preparing modified yeast cells.

[0127] An exemplary Gic1 polypeptide described herein is represented by Genbank Accession No. NP_011928 and SEQ ID NO:2 as follows:

[0128]

[0129] An exemplary Gic2 polypeptide described herein is represented by Genbank Accession No. NP_010595 and SEQ ID NO:2 as follows:

[0130]

[0131] It is expected that the compositions and methods of the present invention will be applicable to other structurally similar Gic polypeptides, as well as other related proteins, homologs, and functionally similar polypeptides.

[0132] In some embodiments of the compositions and methods of the present invention, the amino acid sequence of the Gic protein with altered production levels has a particular degree of overall amino acid sequence identity with the amino acid sequence of SEQ ID NO: 1 or 2, such as at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% identity with SEQ ID NO: 1 or 2.

[0133] In some embodiments of the compositions and methods of the present invention, the disrupted gene encoding the Gic polypeptide encodes a Gic protein having a particular degree of overall amino acid sequence identity with the amino acid sequence of SEQ ID NO: 1 or 2, such as at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% identity with SEQ ID NO: 1 or 2.

[0134] In some embodiments of the compositions and methods of the present invention, the disrupted gene encoding the Gic polypeptide is YDR309c (SEQ ID NO: 3, hereinafter), which encodes Gic2. In some embodiments, the disrupted gene encoding the Gic polypeptide is YHR061c (SEQ ID NO: 4, hereinafter), which encodes Gic1. In some embodiments, the disrupted gene encoding the Gic polypeptide has a specific degree of overall amino acid sequence identity with the nucleic acid sequence of SEQ ID NO: 3 or 4, such as at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% identity with SEQ ID NO: 3 or 4.

[0135] The amino acid and nucleic acid sequence information provided herein readily allows a skilled artisan to identify Gic proteins and nucleic acid sequences encoding Gic proteins in any yeast and to generate appropriate disruptions in genes encoding Gic polypeptides to affect production of Gic proteins.

[0136] In some embodiments, the reduction in the amount of functional Gic1 and / or Gic2 polypeptides in the modified cells is a reduction of at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or more compared to the amount of functional Gic polypeptides in parent cells grown under the same conditions. In some embodiments, the reduction in the expression of functional Gic1 and / or Gic2 proteins in the modified cells is a reduction of at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or more compared to the amount of functional Gic polypeptides in parent cells grown under the same conditions.

[0137] In some embodiments, the increase in alcohol production by the modified cell is an increase of at least 1%, at least 1.5%, at least 2%, at least 2.5%, at least 3%, at least 3.5%, at least 4%, at least 4.5%, at least 5%, or more compared to the amount of alcohol produced by the parent cell grown under the same conditions.

[0138] In some embodiments, the increase in lysine produced by the modified cell is an increase of at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, or even at least 2 times or more compared to the amount of lysine produced by the parent cell grown under the same conditions. In a specific embodiment, the increase is under high-DS conditions.

[0139] In some embodiments, the modified parent cell already includes a gene of interest, such as a gene encoding a selectable marker, a carbohydrate processing enzyme, or other polypeptide. In some embodiments, the introduced gene is subsequently introduced into the modified cell.

[0140] In some embodiments, the modified cells include additional genes or other modifications that increase lysine production.

[0141] IV. Combination of reduced Cdc42 effectors with other mutations affecting alcohol production

[0142] In some embodiments, in addition to expressing reduced amounts of a Cdc42 effector polypeptide, the modified yeast cells of the invention further comprise additional modifications that affect alcohol production.

[0143] In a specific embodiment, the modified yeast cell comprises an artificial or alternative ethanol production pathway resulting from the introduction of a heterologous phosphoketolase (PKL) gene, a heterologous phosphotransacetylase (PTA) gene, and a heterologous acetylated acetyl dehydrogenase (AADH) gene, as described in WO 2015148272 (Miasnikov et al.), which enzymes are introduced to channel carbon flux away from the glycerol pathway and towards the synthesis of acetyl-CoA, which is then converted to ethanol.

[0144] The modified cell may further include a mutation that results in a reduction in the native glycerol biosynthetic pathway, which is known to increase alcohol production. Methods for reducing the glycerol biosynthetic pathway in yeast are known and include, for example, reducing or eliminating endogenous NAD-dependent glycerol 3-phosphate dehydrogenase (GPD) or phosphoglycerol phosphatase (GPP) activity by disrupting one or more of the genes GPD1, GPD2, GPP1 and / or GPP2. See, for example, U.S. Pat. Nos. 9,175,270 (Elke et al.), 8,795,998 (Pronk et al.), and 8,956,851 (Argyros et al.).

[0145] The modified yeast may further be characterized by increased acetyl-CoA synthase (also known as acetyl-CoA ligase) activity (EC 6.2.1.1) to scavenge (i.e., capture) acetate produced by chemical or enzymatic hydrolysis of acetyl-phosphate (or present in the culture medium of the yeast for any other reason) and convert it to Ac-CoA. This avoids the adverse effects of acetate on yeast cell growth and may further contribute to increased alcohol production. Increasing acetyl-CoA synthase activity may be achieved by introducing a heterologous acetyl-CoA synthase gene into the cell, increasing the expression of an endogenous acetyl-CoA synthase gene, and the like. A particularly useful acetyl-CoA synthase for introduction into a cell may be obtained from Methanosaetaconcilii (UniProt / TrEMBL accession number: WP_013718460). Homologs of these enzymes, including enzymes having at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, and even at least 99% amino acid sequence identity to the above-mentioned acetyl-CoA synthase from M. consiliense, can also be used in the compositions and methods of the present invention.

[0146] In some embodiments, the modified cell may further include a gene encoding NAD + A heterologous gene for a protein that is dependent on acetylation of acetaldehyde dehydrogenase activity and / or a heterologous gene encoding a pyruvate formate lyase. The introduction of such a gene in combination with attenuation of the glycerol pathway is described, for example, in U.S. Pat. No. 8,795,998 (Pronk et al.).

[0147] In some embodiments, the modified yeast cells of the invention may further overexpress a sugar transporter-like (STL1) polypeptide (see, e.g., Ferreira et al. (2005) Mol Biol Cell 16:2068-76; et al. (2015) Mol Microbiol 97:541-59 and WO 2015023989 A1), thereby increasing ethanol production and reducing acetate.

[0148] In some embodiments, the modified yeast cells of the invention may further overexpress a poly(A) binding protein, such as PAB1, thereby increasing alcohol production and decreasing acetate production.

[0149] In some embodiments, the modified yeast cells of the present invention further comprise a butanol biosynthetic pathway. In some embodiments, the butanol biosynthetic pathway is an isobutanol biosynthetic pathway. In some embodiments, the isobutanol biosynthetic pathway comprises a polynucleotide encoding a polypeptide that catalyzes the conversion of a substrate to a product selected from the group consisting of: (a) pyruvate to acetolactate; (b) acetolactate to 2,3-dihydroxyisovalerate; (c) 2,3-dihydroxyisovalerate to 2-ketoisovalerate; (d) 2-ketoisovalerate to isobutyraldehyde; and (e) isobutyraldehyde to isobutanol. In some embodiments, the isobutanol biosynthetic pathway comprises a polynucleotide encoding a polypeptide having acetolactate synthase, ketoacid reductoisomerase, dihydroxyacid dehydratase, ketoisovalerate decarboxylase, and alcohol dehydrogenase activity.

[0150] In some embodiments, the modified yeast cell comprising a butanol biosynthetic pathway further comprises a modification in a polynucleotide encoding a polypeptide having pyruvate decarboxylase activity. In some embodiments, the yeast cell comprises a deletion, mutation, and / or substitution in an endogenous polynucleotide encoding a polypeptide having pyruvate decarboxylase activity. In some embodiments, the polypeptide having pyruvate decarboxylase activity is selected from the group consisting of: PDC1, PDC5, PDC6, and combinations thereof. In some embodiments, the yeast cell further comprises a deletion, mutation, and / or substitution in one or more endogenous polynucleotides encoding FRA2, ALD6, ADH1, GPD2, BDH1, and YMR226C.

[0151] V. Combination of reduced Cdc42 effectors with other beneficial mutations

[0152] In some embodiments, in addition to expressing a reduced amount of a Cdc42 effector polypeptide, optionally in combination with other genetic modifications that are beneficial to alcohol production, the modified yeast cells of the present invention further comprise any number of additional genes of interest encoding proteins of interest. Additional genes of interest may be introduced before, during, or after genetic manipulations that result in reduced expression of a Cdc42 effector polypeptide. Proteins of interest include selectable markers, carbohydrate processing enzymes, and other commercially relevant polypeptides, including but not limited to enzymes selected from the group consisting of dehydrogenases, transketolases, phosphoketolase, transaldolase, epimerase, phytase, xylanase, β-glucanase, phosphatase, protease, α-amylase, β-amylase, glucoamylase, pullulanase, isoamylase, cellulase, trehalase, lipase, pectinase, polyesterase, cutinase, oxidase, transferase, reductase, hemicellulase, mannanase, esterase, isomerase, pectinase, lactase, peroxidase, and laccase. The protein of interest can be secreted, glycosylated, and modified in other ways.

[0153] VI. Yeast Cells Suitable for Modification

[0154] Yeast is a unicellular eukaryotic microorganism classified as a member of the fungi kingdom, and includes organisms from the Ascomycota and Basidiomycota. Yeast that can be used for alcohol production includes but is not limited to Saccharomyces species, including Saccharomyces cerevisiae, and Kluyveromyces, Lachancea, and Schizosaccharomyces species. Many yeast strains are commercially available, many of which have been selected or genetically engineered to obtain desired characteristics, such as high ethanol production, fast growth rate, etc. Some yeasts have been genetically engineered to produce heterologous enzymes, such as glucoamylase or alpha-amylase.

[0155] VII. Substrates and conditions

[0156] The production of alcohol from many carbohydrate substrates (including but not limited to corn starch, sugar cane, cassava and molasses) is well known, as are the numerous variations and modifications of enzyme and chemical conditions and mechanical methods. It is believed that the compositions and methods of the present invention are fully compatible with such substrates and conditions.

[0157] There are many variations of ethanol production processes, including cold cooking or no cooking, processes involving liquefaction at or below gelatinization temperature, simultaneous saccharification and fermentation, fractionation, etc. It is contemplated that the above processes are compatible with the compositions and methods of the present invention.

[0158] VIII. Fermentation Products and Co-products

[0159] Typical alcohol fermentation products include organic compounds with hydroxyl functional groups (-OH) bound to carbon atoms. Exemplary alcohols include, but are not limited to, methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, n-pentanol, 2-pentanol, isopentanol, and higher alcohols. The most commonly prepared fuel alcohols are ethanol and butanol. Using the modified yeast of the present invention, an increase of at least 1%, at least 1.5%, at least 2%, at least 2.5%, at least 3%, at least 3.5%, at least 4%, at least 4.5%, at least 5%, or more can be achieved.

[0160] A valuable byproduct (or co-product) of alcohol production (and particularly dry mill ethanol production) is an animal feed product, typically in the form of distillers dried grains (DDG) or, more commonly, distillers dried grains with solubles (DDGS). These animal feed products are in many ways more nutritious than the original feedstock for ethanol production because they are depleted of carbohydrates but enriched with amino acids from the feedstock and the fermenting organism (i.e., the ethanologen).

[0161] The specific amino acid composition of DDGS or other corn co-products is important to the quality of animal feed because some amino acids are far more important than others. Lysine is an essential amino acid for most farm animals and must be supplemented to maximize feed conversion if it is not adequately provided by DDG, DDGS or other fermentation co-products. Synthetic lysine is expensive and represents a significant cost in animal feed.

[0162] Because yeast can represent an important component in post-fermentation products, the amino acid content of yeast can significantly affect the amino acid content of fermentation broth, whole stillage, thin stillage, dried distiller's grains, dried distiller's grains with solubles, concentrated distiller's grains solubles or other protein-containing post-fermentation co-products. Substituting the yeast of the present invention for conventional yeast increases the amount of lysine in such post-fermentation products, thereby increasing their value as animal feed products.

[0163] Using the modified yeast of the present invention, an increase in lysine of at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, or even at least 2 times or more can be achieved.

[0164] These and other aspects and embodiments of the strains and methods of the invention will be clear to the skilled person in view of this specification.The following examples are intended to further illustrate but not limit the strains and methods.

[0165] Examples

[0166] Example 1: Deletion of Gic2 in yeast

[0167] Using standard molecular biology techniques, the FERMAX TM Gold (Martrex, Inc., Chaska, MN, USA, referred to herein as "FG"), a commercially available Saccharomyces cerevisiae strain for large-scale ethanol production, was used to disrupt the YDR309c gene by essentially deleting the entire coding sequence of Gic2. All procedures were based on the publicly available nucleic acid sequence of YDR309c, which is provided below as SEQ ID NO: 3; 9SGDID: S000002717; chrIV: 1079048..1080199; the corresponding Gic2 effector polypeptide is represented by SEQ ID NO: 2 (supra):

[0168]

[0169] The deletion of the Gic2 gene was confirmed by colony PCR. The modified yeast was grown in non-selective medium to remove the plasmid that confers kanamycin resistance for selection of transformants, resulting in a modified yeast that does not require growth supplements compared to the parent yeast. A modified strain (named FG-Gic2) was selected for further study.

[0170] Example 2: Deletion of Gic1 in yeast

[0171] Using standard molecular biology techniques, the YHR061c gene was disrupted by essentially deleting the entire coding sequence of Gic1 in FG. All procedures were based on the publicly available nucleic acid sequence of YHR061c, which is provided below as SEQ ID NO: 4; SGDID: S000001103; chrVIII: 221534..222478; the corresponding Gic1 effector polypeptide is represented by SEQ ID NO: 1 (supra):

[0172] ATGACTGAAGGAAAGAGGCTGCAACAGATGGAGCTTCCTCAAATGAAATCCATTTGGATTGACGAGGATCAGGAAATGGAAAAATTGTATGGATTCCAAGTAAGGCAACGATTCATGAATGGACCTAGTACGGATTCCGATGAAGACGCCGACGAAGATTTAGGAATTGTTCTCGTTGACAGTAAAAAGCTGGCTTTGCCGAACAAGAACAACATCAAATTGCCCCCTTTGCCCAATTACATGACGATCAACCCTAACATAAATTCCAATCACAAGTCATTAACTAATAAAAAGAAGAATTTCCTGGGCATGTTCAAAAAAAAGGACCTGTTGTCGAGGAGACATGGGTCTGCCAAAACCGCAAAACAGTCAAGTATATCTACACCATTTGATTTTCACCATATTTCGCATGCTAATGGTAAAAGGGAAGACAACCCTCTTGAGTCGCACGAAGAAAAACATGATGTAGAATCATTAGTCAAATTCACGTCTTTGGCACCGCAACCCCGACCAGATTCAAACGTCTCTTCTAAATATTCCAATGTTGTGATGAACGATTCGAGCAGAATAGTGTCTTCCTCCACAATAGCTACAACGATGGATTCTCACCACGATGGTAACGAAACCAACAATACCCCAAATGGCAATAAGCAATTAGACTCGCCTACAGATTTGGAAATGACCTTGGAAGACTTGAGAAATTATACATTTCCTTCTGTTCTTGGAGATAGCGTCAGCGAAAAGACCAATCCTTCCTCTCCCTCTGTTTCATCATTTTCTGGCAAATTCAAGCCAAGAGAGTTGAGTGCGCTACATACGCCCGAATTAGGAAATTGTTTCAATGTAGATCAGTCGCTAAATTCCCCTGGTAACAGAATATCTGTGGATGACGTGCTAAAATTCTACTATCAATGTAGTGAAACTAGTACTCCTCGAAATACCTGA

[0173] The deletion of the Gic1 gene was confirmed by colony PCR, and the modified yeast was grown in non-selective medium to remove the plasmid that confers kanamycin resistance for selection of transformants, resulting in a modified yeast that does not require growth supplements compared to the parent yeast. A modified strain (named FG-Gic1) was selected for further study.

[0174] Example 3: Ethanol production by modified yeast at a single temperature

[0175] The ability of FG-Gic2 and FG-Gic1 yeasts to produce ethanol in liquefact at 32°C was tested compared to FG benchmark yeast (wild type for both genes). TM A liquefact (ie, a corn flour slurry having a dry solids (DS) value of 33%) was prepared at pH 4.8 using 2.5x (acid fungal protease), 0.33 GAU / g DS variant Trichoderma reesei glucoamylase and 1.46 SSCU / g DS Aspergillus kawachii alpha-amylase.

[0176] 50 grams of liquefied material are weighed into 100ml container, and inoculated with fresh overnight culture from modified bacterial strain or FG bacterial strain colony at 32 ℃.At 55.2hr, sample is collected by centrifugation, filtered by 0.2 μm filter, and uses Bio-Rad Aminex HPX-87H column (its isocratic flow rate in 0.01N H2SO4 eluent is 0.6ml / min) to analyze ethanol, glucose, acetate and glycerol content (all figures are in g / L unless otherwise stated) by HPLC (Agilent Technologies (Agilent Technologies) 1200 series) at 55 ℃.Use 2.5 μl sample injection volume.The calibration standard for quantitative includes known amount of DP4+, DP3, DP2, DP1, glycerol and ethanol.Analysis results are shown in Table 1.Reported relative to the ethanol increase of FG bacterial strain.

[0177] Table 1. Analysis of fermentation broth after 55 hours of fermentation at 32°C

[0178] strain DP2 DP3 DP4+ glucose glycerin Acetate EtOH Multiple increase FG 3.14 1.27 6 0.53 13.74 0.76 139.26 -0- FG-Gic2 3.24 1.3 6.08 0.51 13.52 0.7 140.83 1.011 FG-Gic1 3.26 1.29 6.07 0.56 13.9 0.73 140.45 1.009

[0179] Yeast carrying the disrupted Gic1 or Gic2 gene produced approximately 1% more ethanol at 32°C compared to the unmodified FG reference strain.

[0180] Example 4: Ethanol production by modified yeast under ramped temperature

[0181] The ability of FG-Gic2 and FG-Gic1 yeast to produce ethanol in a 35°C ramped liquefact was tested compared to a benchmark FG yeast (wild type for both genes). The liquefact (as above) was weighed into a 100 ml container and inoculated with a fresh overnight culture from a colony of the modified strain or the FG strain using the 35°C ramp conditions summarized in Table 2. After 55.2 hr, the samples were collected by centrifugation, filtered through a 0.2 μm filter, and analyzed by HPLC as described above for the content of ethanol, glucose, acetate, and glycerol. The results of the analysis are shown in Table 3. The increase in ethanol relative to the FG strain is reported.

[0182] Table 2. Temperature ramp conditions

[0183]

[0184]

[0185] Table 3. Analysis of fermentation broth after fermentation under ramp conditions

[0186] strain DP2 DP3 DP4+ glucose glycerin Acetate EtOH Multiple increase FG 3.87 1.43 5.87 18.32 14.24 0.93 128.96 -0- FG-Gic2 4.28 1.46 5.86 8.93 13.74 0.97 133.64 1.036 FG-Gic1 4.37 1.46 5.89 10.47 14.02 1.02 132.89 1.030

[0187] As shown in Table 3, yeast carrying a deletion of Gic1 or Gic2 produced approximately 3.0% to 3.6% more ethanol in a 35°C ramp compared to the unmodified reference strain.

[0188] Example 5: Ethanol production by modified yeast under high-DS conditions

[0189] FG-Gic2 and FG-Gic1 yeasts were tested for their ability to produce ethanol in high-DS (ie, 35%) liquefact conditions at 32°C compared to a baseline FG yeast. Liquefacts were prepared and analyzed as above. The results of the analysis are shown in Table 4. Ethanol increases relative to the FG strains are reported.

[0190] Table 4: Analysis of fermentation broth after fermentation under high-DS conditions

[0191]

[0192] As shown in Table 4, yeast carrying a deletion of the Gic2 or Gic1 gene produced approximately 4.5% to 5% more ethanol at 35% DS compared to the unmodified reference strain.

[0193] Example 6: Lysine content in fermentation final product using modified yeast

[0194] After 24 hours of growth in minimal medium, the intracellular free lysine content of FG-Gic2 and FG-Gic1 yeasts was tested and compared with the benchmark FG yeast (wild type for both genes). Standard amino acid extraction conditions were used to extract the intracellular metabolites from the cell sediment with 60% methanol solution (Villas-Boas, SG et al., (2005) Biochem J. [Journal of Biological Chemistry] 388: 669-77), and HPLC was used to process the samples. After derivatization with o-phthalaldehyde, the L-lysine content in the analysis sample was analyzed. By HPLC (Agilent Technologies 1260), EclipsePlus C18 columns (4.6x 150mm, 3.5 microns) were used to detect the derivatized L-lysine at 40°C in a gradient of phosphate buffer (pH 7.8) and acetonitrile: methanol: water (45:45:10). Calibration standards used for quantification included known amounts of L-lysine or an amino acid standard mixture containing L-lysine (Agilent Technologies).

[0195] As shown in Table 5, yeast carrying the mutations produced 1.3 to 1.67 times more free intracellular lysine compared to the unmodified reference strain.

[0196] Table 5. Intracellular free lysine in modified and unmodified cells

[0197] strain Intracellular free lysine (mM) Fold increase relative to FG FG 0.91 na FG-Gic2 1.18 1.3 FG-Gic1 1.52 1.67

[0198] Example 7: Bioavailable Lysine Content of Fermentation Co-Products Using Modified Yeast

[0199] The total lysine content of the fermentation co-product using FG-Gic2 and the benchmark strain was tested. The liquefied material (corn mash slurry) was prepared by adding 600ppm urea, 0.124SAPU / g ds acid fungal protease, 0.33GAU / g ds variant Trichoderma reesei glucoamylase and 1.46SSCU / g ds Aspergillus kawachii alpha-amylase, adjusted to pH 4.8 with sulfuric acid. 100g of the prepared corn liquefied material was fermented with FG-Gic2 or the benchmark FG strain at 32°C with 200rpm shaking. After 67 hours, the fermented liquid in duplicate fermentation bottles was collected in 800-mL beakers and placed in 95°C shaking water baths to evaporate ethanol. The fermented liquid was allowed to incubate for about 3-5 hours until HPLC did not detect significant ethanol.

[0200] The resulting material (i.e., whole stillage) was spun at 6,000 rpm for 10 min. The supernatant (i.e., thin stillage) and the precipitate (i.e., wet cake) were collected. The wet cake was dried at 37° C. until a dry solids content of about 34%-35% was reached. The thin stillage was weighed into a 600 mL beaker and placed in a 97° C. shaking water bath to concentrate the contents by about 5 times (by weight) to produce a slurry.

[0201] To make the fermentation co-product similar to the DDGS sample, the wet cake and the corresponding slurry were combined in a 2 to 1 mass ratio (e.g., by weight) and mixed well. The DDGS was spread on a metal tray and dried in a 99°C oven for about 3 hours with occasional mixing until dried to a dry solids content of >90%.

[0202] To test bioavailable amino acids, DDGS samples were incubated with pepsin and pancreatin based on a previously reported method (Qiao, Y (2001), Routine techniques for monitoring the nutritional value of animal meals, Doctoral thesis at North Carolina State University). Briefly, 0.33 g of DDGS was added to a 20 mL scintillation vial with 3.33 mL of 0.05 M citrate buffer (pH 2) and approximately 0.012 g of pepsin (from porcine gastric mucosa) at >400 U / mg protein. The mixture was allowed to incubate at 38° C. with shaking at 200 rpm for approximately 24 hours. Thereafter, 5 mL of phosphate buffer (0.2 M, pH 11.5, containing 0.025% w / w sodium azide) and approximately 0.023 g of pancreatin (from porcine pancreas, 4x UXP specification) were added to each vial. The vials were returned to the 38°C incubator (shaking at 200 rpm) for approximately 66 hours. After this time, samples were removed from each vial, spun down through a 0.2 μM filter, and analyzed for free amino acids by HPLC.

[0203] The results shown in Table 6 compare the bioavailable lysine content measured in the fermentation co-product produced with the FG-Gic2 strain and the FG benchmark. As shown, a 19% increase in bioavailable lysine in the co-product was observed using the FG-Gic2 strain.

[0204] Table 5. Lysine in fermentation co-products produced by modified and unmodified cells

[0205]

[0206]

[0207] Similar results were obtained using yeast carrying an exogenous PKL pathway and yeast expressing exogenous glucoamylase (data not shown).

Claims

1. A method for producing a modified yeast cell, the method comprising: introducing into a parent yeast cell a genetic alteration that reduces or prevents the production of a functional Cdc42 effector polypeptide compared to the parent cell, thereby producing a modified cell that produces an increased amount of ethanol and / or lysine during fermentation compared to the parent cell under equivalent fermentation conditions, wherein the functional Cdc42 effector polypeptide is a Gic1 polypeptide and / or a Gic2 polypeptide, and wherein the modified yeast cell is a budding yeast from the genus Saccharomyces.

2. The method of claim 1, wherein the genetic alteration comprises disruption of the YHR061c gene or a homologue thereof encoding a Gic1 polypeptide and / or disruption of the YDR309c gene or a homologue thereof encoding a Gic2 polypeptide present in the parent cell.

3. The method of claim 1, wherein the cell produces reduced amounts of Gic1 and / or Gic2 polypeptides, or does not produce measurable amounts of Gic1 and / or Gic2 polypeptides.

4. The method of claim 2, wherein (i) the disruption is caused by the complete or partial deletion of the YHR061c gene or its homolog and / or the YDR309c gene or its homolog, respectively; (ii) the disruption is caused by a deletion of a portion of the genomic DNA comprising the YHR061c gene or its homologue and / or the YDR309c gene or its homologue, respectively; or (iii) the disruption is caused by mutagenesis of the YHR061c gene or its homologue and / or the YDR309c gene or its homologue, respectively.

5. The method of claim 2, wherein the respective disruption of the YHR061c gene or its homologue and / or the YDR309c gene or its homologue is combined with the introduction of a target gene at the corresponding genetic locus.

6. The method of claim 1, wherein the cell further comprises one or more genes of the phosphoketolase pathway.

7. The method of claim 6, wherein the genes of the phosphoketolase pathway are selected from the group consisting of phosphoketolase, phosphotransacetylase, and acetylated acetyl dehydrogenase.

8. The method of claim 1, wherein the cell is a Saccharomyces cerevisiae cell.

9. A method for increasing the amount of lysine present in a post-fermentation product, the method comprising: (i) hydrolyzing a starch-containing raw material with α-amylase to produce a starch liquefact; (ii) saccharifying the starch liquefact with glucoamylase to produce glucose; (iii) fermenting the glucose with a modified yeast cell derived from a parent yeast cell, the modified yeast cell comprising a genetic alteration that results in the production of a reduced amount of a functional Cdc42 effector polypeptide as compared to the parent cell, wherein the modified cell exhibits increased ethanol production and / or increased lysine production as compared to the parent cell under equivalent fermentation conditions, wherein the genetic alteration comprises a disruption of a YHR061c gene or a homolog thereof encoding a Gic1 polypeptide and / or a disruption of a YDR309c gene or a homolog thereof encoding a Gic2 polypeptide present in the parent cell, wherein the functional Cdc42 effector polypeptide is a Gic1 polypeptide and / or a Gic2 polypeptide, and wherein the modified yeast cell is a budding yeast from the genus Saccharomyces; and (iv) recovering a post-fermentation product enriched in lysine compared to a post-fermentation product recovered from an otherwise identical process using said parent yeast.

10. The method of claim 9, wherein the post-fermentation product is selected from the group consisting of: fermentation broth, whole stillage, thin stillage, dried distiller's grains, dried distiller's grains and solubles, concentrated distiller's grains solubles or other protein-containing co-products; and / or wherein one or more steps (i)-(iv) are combined in a simultaneous or overlapping manner.

11. A method for increasing the amount of lysine present in a fermentation product, the method comprising: (i) fermenting glucose or another sugar with a modified yeast cell derived from a parent yeast cell, the modified yeast cell comprising a genetic alteration that results in the production of a reduced amount of a functional Cdc42 effector polypeptide as compared to the parent cell, wherein the modified cell exhibits increased ethanol production and / or increased lysine production as compared to the parent cell under equivalent fermentation conditions, wherein the genetic alteration comprises a disruption of a YHR061c gene or a homolog thereof encoding a Gic1 polypeptide and / or a disruption of a YDR309c gene or a homolog thereof encoding a Gic2 polypeptide present in the parent cell, wherein the functional Cdc42 effector polypeptide is a Gic1 polypeptide and / or a Gic2 polypeptide, and wherein the modified yeast cell is a budding yeast from the genus Saccharomyces; and (ii) recovering a fermentation product enriched in lysine compared to a fermentation product recovered from an otherwise identical process using said parent yeast.

12. The method of any one of claims 9 to 11, wherein the cell is a modified cell as defined in any one of claims 1 to 8.

Images