Garlic leaf blight gene and its application
By identifying and transferring the garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1, disease-resistant garlic varieties were bred, solving the problem of lack of resistant varieties in the control of garlic leaf blight and realizing effective control of leaf blight and breeding value.
Patent Information
- Application Number
- CN202210042289.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-01-14
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2042-01-14
AI Technical Summary
Garlic leaf blight is widespread and seriously affects yield and quality. Existing control methods, such as pesticide control, are costly, polluting, and have low safety. Biological control has not progressed enough, and there is a lack of effective breeding techniques for disease-resistant varieties.
The garlic leaf blight-related genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 were identified and cloned. These genes were then transferred into susceptible garlic varieties using Agrobacterium-mediated transformation to cultivate resistant garlic varieties.
It significantly improves garlic's resistance to leaf blight, reduces changes in agronomic traits, provides an effective disease-resistant breeding approach, controls disease damage, and promotes the sustainable development of garlic production.
Smart Images

Figure CN114350682B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the garlic leaf blight gene and its application. Background Technology
[0002] Garlic, an annual or biennial herbaceous plant belonging to the genus Allium in the family Liliaceae, is also known as garlic or wild garlic. It is one of the important allium vegetables and has high medicinal value in clinical practice, including its ability to promote blood circulation and remove blood stasis in the treatment of acute cerebral infarction, its lipid-lowering effects, its inhibitory effect on platelet aggregation, its antibacterial properties, its antitrichomonal effects, its antitumor effects, and its immune-activating effects. In particular, modern pharmacological research on the antibacterial, antitrichomonal, antitumor, and lipid-lowering properties of garlic has yielded significant results and has received widespread attention worldwide.
[0003] Garlic leaf blight is a common disease of garlic, widely distributed and prevalent. This disease is caused by infection with the genus *Stemphylium*. The asexual generation of the pathogen consists of conidiophores that are straight or slightly curved, light brown, scattered or clustered, unbranched or occasionally branched. Conidiophores are produced whole-walled by budding, extending in a ring-like pattern, nodular in shape, and septate. The disease can occur in both spring and autumn. Mild cases have no significant impact on production, while severe cases cause extensive leaf death, significantly affecting yield and quality. With the increasing planting area and the growing years of garlic cultivation, garlic leaf blight has become increasingly severe. Generally, diseased fields experience yield reductions of 20%–30%, while severely affected fields suffer reductions of over 50%, seriously hindering further development of garlic production. Currently, pesticides are mainly used to control the disease; however, pesticide use only temporarily alleviates the damage caused by leaf blight and is costly, polluting, and has low safety. When pathogens are exposed to pesticides for a long time, they will inevitably mutate, reducing the effectiveness of pesticides. Breeding and planting resistant varieties is the most economical and effective way to control garlic leaf blight.
[0004] Currently, the main methods for controlling garlic leaf blight both domestically and internationally are crop rotation, cultivation management, and chemical control. Chemical control is ineffective, leading to drug resistance and environmental pollution, and biological control has not made significant progress. Therefore, the disease remains uncontrolled. Thus, breeding and utilizing disease-resistant varieties is an important measure for controlling garlic leaf blight. Summary of the Invention
[0005] To address the aforementioned technical problems, the present invention aims to provide a garlic leaf blight gene and its application. In this invention, by identifying the correspondence between garlic disease resistance genes and leaf blight, it is helpful to further select or cultivate related resistant varieties, which not only better controls the damage caused by garlic leaf blight, but also has important breeding value for garlic gene function and garlic disease resistance breeding.
[0006] To achieve the above-mentioned technical effects, the present invention adopts the following technical solution:
[0007] In a first aspect, the present invention provides garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1, the nucleotide sequences of which are SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 in the sequence listing, respectively.
[0008] Furthermore, the garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 can all be cloned using primer pairs, and the sequences of the primer pairs are Asa7G07594.1-F, Asa7G07594.1-R, Asa4G02411.1-F, Asa4G02411.1-R, Asa3G01174.1-F, Asa3G01174.1-R, Asa5G02196.1-F, and Asa5G02196.1-R, respectively, as listed in the sequence listing.
[0009] Secondly, the present invention also provides a method for cloning the above-mentioned garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1. This method involves PCR amplification of garlic varieties using primer pairs such as Asa7G07594.1-F, Asa7G07594.1-R, Asa4G02411.1-F, Asa4G02411.1-R, Asa3G01174.1-F, Asa3G01174.1-R, Asa5G02196.1-F, and Asa5G02196.1-R as shown in the sequence listing, to obtain the garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1.
[0010] Thirdly, the present invention also provides the application of garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 in the breeding of garlic resistant to leaf blight.
[0011] Furthermore, the application of the garlic leaf blight resistance genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 in breeding garlic varieties resistant to leaf blight is achieved through the following method: by transferring the garlic leaf blight resistance genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 into susceptible garlic varieties, garlic varieties resistant to leaf blight are obtained. The specific transfer method is as follows: The garlic leaf blight resistance genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 are constructed on a transgenic vector and transferred into susceptible garlic using Agrobacterium-mediated transformation to obtain resistant garlic plants containing the garlic leaf blight resistance genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 as described in claim 1.
[0012] Furthermore, the susceptible garlic variety is garlic material that does not contain the Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 genes.
[0013] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0014] Firstly, the Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 genes of this invention are resistance genes against garlic leaf blight, and are directly associated with the leaf blight pathogen races containing the genes encoding the pathogenic proteins AvrAsa7G07594.1, Asa4G02411.1, Asa3G01174.1, Asa5G02196.1 and PthXo3. Genetic and molecular biological functional analyses have demonstrated that the Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 genes exhibit dominant resistance effects. Transferring these genes into susceptible varieties can transform garlic from susceptible to resistant, significantly improving its resistance to leaf blight. Garlic plants infused with the Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 genes did not show significant changes in agronomic traits, meaning that these genes do not cause significant alterations in garlic agronomic traits.
[0015] Secondly, by identifying the correspondence between garlic disease resistance genes and leaf blight, this invention helps to further reveal the disease mechanism of garlic and the interaction mechanism between garlic and pathogens, and to further select or cultivate related resistant varieties. This not only better controls the damage of leaf blight, but also has important breeding value for garlic gene function and garlic disease resistance breeding. Attached Figure Description
[0016] Figure 1 A heatmap of gene expression of Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 in garlic resistant and non-resistant varieties provided in an embodiment of the present invention. Detailed Implementation
[0017] The embodiments of the technical solution of the present invention will now be described in detail with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise specified, the experimental methods described in the following embodiments are conventional methods, and the reagents and materials, unless otherwise specified, are all commercially available.
[0018] Example 1: Detection of the expression differences of four garlic leaf blight resistance genes in "garlic resistant varieties" and non-resistant varieties.
[0019] 1.1 Experimental Procedure:
[0020] Simultaneously, two garlic varieties, "Garlic Resistance Variety" and "Chaling Purple Skin," were sown, with the "Garlic Resistance Variety" being variety G39. RNA was extracted from the leaves of both garlic varieties. Before extraction, all glassware, pipette tips, and 1.5 mL centrifuge tubes were soaked overnight in 0.1% DEPC water. The mortar, pestle, and spatula were thoroughly cleaned, dried, and then autoclaved. Before use, alcohol was poured into the mortar, and the mortar containing the pestle and spatula was ignited to achieve sterilization. The electrophoresis tank was rinsed with 75% ethanol before use and dried. The specific extraction steps are as follows:
[0021] (1) Transfer fresh garlic leaves to a mortar pre-cooled with liquid nitrogen and grind them with a pestle (liquid nitrogen needs to be added to the mortar continuously during the grinding process) until they are powdered.
[0022] (2) Transfer 100 mg of the powdered sample to an RNasefree centrifuge tube containing 500 μL of guanidine isothiocyanate lysis buffer (50 × DTTS solution has been added to Buffer RLS before use), and repeatedly pipette until there is no obvious precipitate.
[0023] (3) After letting the above lysis buffer stand at room temperature for 2 min, centrifuge at 12000 rpm and 4℃ for 5 min. Carefully aspirate 400 μL of the supernatant into a new 1.5 mL centrifuge tube (RNase-free).
[0024] (4) Add 200 μL of anhydrous ethanol to a 1.5 mL centrifuge tube and mix by pipetting.
[0025] (5) Transfer all of the above mixture to the adsorption column, centrifuge at 12000 rpm at room temperature for 2 min, and discard the filtrate.
[0026] (6) Add 600 μL of Buffer RWA to the adsorption column, centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate.
[0027] (7) Add 750 μL of Buffer RWB to the adsorption column, centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate.
[0028] (8) Digest with DNase I, add 750 μL of Buffer RWB again, centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate.
[0029] (9) Place the adsorption column in a new RNase-free 1.5 mL centrifuge tube, add 60 μL of Nas-free Water to the center of the adsorption column membrane, let stand at room temperature for 5 min, and centrifuge at 12000 rpm at room temperature for 2 min to elute RNA. Extract leaf RNA from two garlic varieties, "garlic resistant variety" and "Chaling Purple Skin" planted at the same time, according to the above method and reverse transcribe it into cDNA. Quantitative expression analysis was performed using RT-qPCR to detect the expression levels of Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 genes in different varieties.
[0030] Before reverse transcription, the extracted RNA was spotted onto a 1% agarose gel, electrophoresed at 120V for 20 minutes, and then placed under a UV gel imaging spectrometer to observe the integrity of the extracted RNA bands and photographed for later use. The OD values of the extracted total RNA were measured under UV light at 260nm and 280nm. When all extracted RNA bands were clear and the OD260 / OD280 values were within the normal range, they could be used for reverse transcription.
[0031] 1.2 Experimental Results:
[0032] Gene heatmaps were constructed based on expression data from seven parts of garlic—bulbs, buds, leaves, pseudostems, scapes, roots, and flowers—of the "garlic-resistant variety." The analysis results are attached. Figure 1 As shown.
[0033] From the appendix Figure 1 It can be seen that the gene expression levels of Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 differ significantly between "Chaling Purple Skin" garlic and "garlic resistant varieties" (garlic leaves). Furthermore, the gene expression levels of Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 in "Chaling Purple Skin" are all lower than those in "garlic resistant varieties." In particular, the expression level of the Asa7G07594.1 gene (garlic leaves) differs significantly between resistant and non-resistant varieties, with the expression level in resistant varieties being 2.6 times that in non-resistant varieties.
[0034] Therefore, it is speculated that the genes sa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 may play an important role in regulating resistance to leaf blight in different garlic varieties.
[0035] Example 2: PCR amplification of four garlic leaf blight resistance genes
[0036] Primers were designed using the primer design software Oligo7. A pair of forward and reverse primers were designed for each sequence, and the primers were sent to the synthesis department of Qingke Biotechnology Co., Ltd. for synthesis. The primer designs are shown in Table 1.
[0037] Table 14 Primers Specific to Garlic Leaf Blight Genes
[0038] Primer name Sequence (5'-3') Asa7G07594.1-F GGGCAAGGAGGGATGGTTAGGTGGT Asa7G07594.1-R GGATCATGAGCAGGAGACTGCAGCG Asa4G02411.1-F TACGGATCTAGTGCCCCGCCTATACCTT Asa4G02411.1-R CTAGTGTCACATCTGTACTTGCTTTT Asa3G01174.1-F TGGCACTATGTCACGTTCCAAACG Asa3G01174.1-R GAGTTCTTCCCAGCTTGTTAGACCATTA Asa5G02196.1-F ATCAGGTCAGTTTAGATCTCAAATACATT Asa5G02196.1-R CCTATGATGATCGATAATTTGTCGTGTG
[0039] Gene fragments were amplified using the primers described above, and electrophoresis was performed on 1% agarose gels. The resulting fragments were all approximately 1000 bp in size. These electrophoretic fragments were compared with the CDS sequences of the 'garlic resistant varieties' Asa3G01174.1, Asa5G02196.1, Asa5G02196.1, and Asa5G04962.1, and the results showed that all fragments were within the correct size range.
[0040] After purification and recovery of the gel products, they were directly ligated into the 5-min TMTA / Blunt-Zero CloningKit (Vazyme) vector and transformed into *E. coli* DH5α. The plates were incubated overnight inverted. The next day, six single colonies were randomly picked from each *E. coli* plate containing the TA gene clone for PCR testing. The colonies showing positive results were added to LB liquid culture containing Kana resistance and incubated overnight at 37°C / 200 rpm. The next day, 1 mL of the bacterial culture was sent to Qingke Biotechnology for sequencing, and the sequencing results were correct.
[0041] Example 3: Genetic and molecular biological analysis to verify four garlic leaf blight resistance genes.
[0042] Purified cDNA fragments were constructed into a transgenic vector and transformed into susceptible garlic varieties using Agrobacterium-mediated transformation. The resulting genetically transformed plants were tested for disease resistance. Results showed that the Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 genes exhibited dominant resistance effects, transforming susceptible garlic varieties into resistant plants. Furthermore, the disease resistance of plants highly expressing these Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 genes was tested, demonstrating that these genes significantly improved resistance to leaf blight.
[0043] Furthermore, garlic plants infused with the Asa7G07594.1, Asa4G02411.1, Asa3G01174.1, and Asa5G02196.1 genes did not show significant changes in agronomic traits, meaning that these genes do not cause significant alterations in garlic agronomic traits.
[0044] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies. sequence list <110> Jiangsu Nongaitian Biotechnology Co., Ltd. <120> Garlic leaf blight gene and its application <141> 2022-01-13 <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 795 <212> DNA <213> Allium sativum <400> 1 atgacgtggt tcggtgctgg tggcatacga tggtcggtag aaggagg aagtgatttt 60 tccgtggaga tgtttttgcc tggaaaggaa gtggcacggc catatttccg ttcagggcaa 120 ggagggatgg ttaggtggtc atggtggggt ccagtggtga taggaaagga cattaataag 180 ttttctaagg aaatcgggaa gttaaaaatc gctaagcagg atgcgactga gcttattagg 240 300 aggcagctgg atgagactct ttcactgatt ggcaatctgg tgcatgatgg tgtacctgtt 360 gataacgatg aggctaataa ttctgtagtt cggacatggg gggagtgcag accaaaaggg 420 480 540 gcacttgtta gctttggatt agtctttttg actacaaact attgcaaccc 600 tcctttttca tgagaaaaga tatcatggca agatgtgctc agctatctca gtttgatgag 660 gagctgtaca aggtagaagg cgatgaaggc gatggagatg caaatgaaaa atatttgatc 720 gccacttctg agcaaccgtt atgtagccta ccatctgata aacgcattta ccaacaacag 780 ttgcctttta ggtaa 795 <210> 2 <211> 1074 <212> DNA <213> Allium sativum <400> 2 atgctagtga attgctccaa ctgcggaca ccactccagc tcccacctgg cgctcagtcc 60 atccgctgcg ccatctgcca ggccatcacc caccttgcgc cgccgccgga tccacggtca 120 acttctacac ctcccgtccc tagccattac ggatctagtg ccccgcctat accttctcca 180 catcccggtc cgctgggccc gccgcccggt gcccacgggga gaaagaaggc ggtcattgtc 240 ggcatctcgt ataagttttc caggcatgag ttgaaaggtt gcatcaatga tgccaaatgc 300 atgaagtata tgcttatgaa tcgctaccat tttcctgagg cttcttattat tatgcttaca 360 gaagaagaaa ccgatccata taaattcca atcaaacaca atataatgat ggccttattt 420 tggctagtac aaggttgtca acctggggac tctttagtgt ttcactattc tggtcatggt 480 tctcaacaaa ggagctatga agaggcagat ggatttgatg aaactctatg cccactagat 540 tttgaaacac aaggaatgat tgttgacgat gatatcaatg tagctattgt ccgaccactt cctcgcggag ttagctcca tgcatttata gatgcttgcc atagtggtac tgtacttgat 660 ctaccttttc tctgcagaat gggcaatatg tctgggaaga tcatcgtcca agaaatggcg cttggaaagg ttcaaatggt ggggaagtaa tttcgtttag tggctgtgac gatgatcaaa catctgccga cacttcggct ctttcaaaga taacatcaac aggagcaatg acattttgct tcatccaagc 900. 900. acattttgct tcatccaagc aattctatga gatcaaccat tagcact ggtgaatcca tgggtggtgg tcctgttact tcgcttttga ccatgctttt gactggtggc agtggaggtg gtggtttgag acaggaacca cagttgacgt catgcgaacc gttcgatgta tacatgaagc cattttctct ctaa <210> 3 <211> 1824 <212> DNA <213> Allium sativum <400> 3 atggacgaca gctgtgccgt gtgcgtggag tccttagatt gggttgctta cgggtcttgc 60 ggtcaccggg aggtgtgttc aacctgcgtc gttcgcctc gttcgttct tcaggatccc 120 aaatgttgca tttgcaaaac ccatttggat acggttttcg taactaaggc tttaggtcat 180 tacacacgag ttatatcaga ttttcggca tttcctccca ctcctagcaa gggtcaagtt 240 gcatcgcttt ggtttcacga aggatctcaa gcttacattg atgacgtgga tcactatcga 300 atgataaacg ccatgtgcac aatttttgt aacctttgtg aaaaaaatcc aaatggtcaa 360 ggtactgtta gcgcaaaaaa ttggggcaca actaaatcaa ccgagaagat gaacagcatt 420 gatgacttga aatgtcatct taaatatcag cataagatgt ttatgtgcga cctttgtctt 480 aaagggaaga aggtattat atgtgagcaa aaattataca cccaatctca actggatcga 540 cacatgaaat ttggtgattt ggaggtggat ggttcagaaa atgagtgtga tggctttaag 600 ggacatccaa tatgtgagtt ctgtggagat ttcttttatg gagacaatga actttatacg 660 cacatgcta ctgaacatta tacttgccac atatgcagaa ggcaacaccc tgagaaacac 720 gactacttca ataattatga taacttggag attcacttcc gcctagtgca ttttctttgt 780 gaagatgaag catgcctaga gaagaaattt gttgtttttc aatcagaagc cgaaatcaag 840 agacataatg cgttagtgca tgctggcact atgtcacgtt ccaaacgaaa tgctgccctt 900 cagataccag ttagcttcac ttataggcga agtaattatc aaagtcaaca acacagagga 960 ggccctgtaa ttgacaacca accagttggt agtgaagatg ataccgtcac aaatttggta 1020 gagttgccca tttcagctc agttcgaga tttcctcaag catcttctgg aagcactcat 1080 gttccggata tgtcttctgc accaaatcct tctaataaca atcagccttc tattagtctt 1140 actgctgact tgtttcctcc acttccccgt gttaaaaaga acaaaaggtc caaaaaaaa 1200 gtaccaaata tagacaacaa cagttccact tctctactta atcgaaaaaa gaattcagca 1260 actatttcta attctgttca gcccagcaca tcaaaaaata aatatatttc ttcatcatct 1320 aatcatgtgg tgggctcggt aaatttctca agctttcctc cgcttatacc tcttcatgat 1380 catgttatca gctcttctaa tcccgtgagt tcttcccagc ttgttagacc attacagaag 1440 tcaagtgcag tggtatcaga ttctaatggt atagttcgc agaaaaaatg cgtgtctact 1500 acaactactg ttcgggagg acaagctctt gtaacatctg aggaagttaa gatgtcaaat 1560 aagtcagtaa tagaaaagat tttacatgca ttaggagatg acaaggagaa gtttgcagca 1620 tttaaatgca tatcatccga ataccgcgat gggcaaatta atgtatgga atacatcttc 1680 aatgtcaaac agtttggact tacacatctg ttgtctgaat tagctttgct ttgtcctgat 1740 cctgataaaa ggaaagcgct tgcagatgcc tattctgcca atatacaagc atctgaaatg 1800 agtgacagta aagggaaggg aaaa 1824 <210> 4 <211> 3051 <212> DNA <213> Allium sativum <400> 4 atggcagaaa ccctaattca gcaagtagaa gaaatgatat caactccaaa tcgacctcaa 60 gcctactcag gtctccttca aatctttcga ttacatgcag atgattcgtc aaaaatgcaa 120 ttggttctc tctcttctga gcgtctcatc ccagttctca tctcggacat ccaatgtcat 180 gacgaagaga ttgctgcact ggctttgaag tgtcttgggt tcatgttgta ccatccgtta 240 cttgttcgta tattttcagg gaaagttgat ggtttggttt tggaaacatt ggggaaattg 300 gtaatgagca caagagcaaa ggctgtctgt aacttgggaa tatggtgcat ttgcgttcag 360 caattggatg atggtgttgt gagttcacaa cttgatctgt tgctaagggc ctttgtatat 420 gccattgata atccgtttgg atcattatcc accacatttg aggcaactca ggcattggca 480 aaaatagcaa ccagatttgg tgaaaagatg agaaatgcat cagacatatg ggctccacca 540 atatatagaa ggcttgttag cagtgacagg aaagagaggg gtatggcaga aaggtgccta 600 ctgaagttga agtcagttat ctatccccca attccaaatc tttcaaaggt agctgctttg 660 gatatcaaga aaaacctgct ttcaaatatg ctagttatgg ttgatgattg ccagaatatt 720 gttcccatga ttagagcatg ggggtggtat atttcactta ttggaccaga ctcggtaaag 780 catcgaagta ctgtcaacca aatgctgaaa attccagagc aaacattttc cagtcatagt 840 ccacaggttc aaattgcttc actggttgct tgggagcagt tgatagatgc attcatccct 900 cacatgacag atccagaatt aaattgctat gatcctgtag atggtctatt gaaaaggata 960 actatcataa tacttccctt aaaaaggatc atgaagcata aacatgacat ttctgttcat 1020 acatcttgtg tcaaaacatg gctctatctc ctacaaaaac ttgacattt agtaaatcat 1080 ccgtcagtta caaaagtatc attttgggaa ctggccgagt cggtgatttc aactgaactt 1140 attagcttgc agagtacctt tttgtggaca tcgtgccttg atctgctaaa tgattatgct 1200 caatcaaatg taagggccgt agctccagtt acatacaacc atatcaagtg gcttccgtgg 1260 gaagtaccca gtttacaaat gtttctaaaa atacttaaac ttgcactcac gcaatgtcat 1320 gtttggaatg gggaatacaa acatacaaac acactttttg aatattgtct gagaattact 1380 cgttcggttt tagagggtgt aaaagcaatg acaacttatc atgaaaacgt tcaattatgt 1440 acgttttcta ttatagaatt cttgacagag gttacggaaa gcatgatttc aaatgtaagt 1500 gatatttatg gcaagattca cttggtagta gcttttcagt tggttgaact tattagagaa 1560 gagatggatt cttcaatatt aacatccaca atatatcagg tcagtttaga tctcaaaatac 1620 attaaagaat tggaactatg caaaaacgat gaagacataa atgcagaaac tttgaatgta 1680 tctccgctta tatacaaaga tatggtttca ccgatggttt atatatcaat tctggggctt 1740 tgtttaat ctgaaaccat cgaaagaatg ttgatagttc aacttggcat tcagcatgca gttaagcatg caaagatatt gctcatttcg gaaaatcctc tactcaactt gcaagctaca attgcttttc tttatgcaca ttcaagaaaa tccacagata agaagtattg ctcattaatt ttatggagaa ttgttgcaaa gagcttgcat gaaactgtag gaaccatgta taatgatgaa aaatccttca taatgttcaa gttcttgtgt tatccatttg ttgtgctttt aaattcttct gaggcttcag tttatagaag aaccagttgt aactcagaca tgtgccttgt ttcattgcat aaagaagtcg agtttgaact tatattgaa gcatggaagt tacttttgga atctttaagc attttcagta aaaatcgtcc tatgatgatc gataatttgt cgtgtgagct tgtcaaaata ttggatagtt cttcgtgctc atcctggaat tctccgaaaa ttgattttct catgatgtat gctgagtttg ttatctgtat tctgaatcag attcaagtta tgcttgagga aattagaagt tcaaatgtaa tcagcctaac taatagctgt cagaataatt gcggtccttt cgataacact tttaatcttg tttccaggtt catgaagatg tcgctaattc atttcaaaat taaccatgag gcaacatatg ctattttctg cagggtgctt gctgctttga attatttgat tagtcatgtc 2520 ttctcagcaa acgatgtcat gcttctagcg aagctgatca tcgaaccgtt tgctgactgg 2580 ctatcctttt gcattgattt gtctgctgaa acacaagaaa atagtagcat tatgcatcag 2640 agcgaatgtc ttttgaatca tatgtttgat tgttgtagaa gaagttccga ttctttcttt 2700 cttggaatcc agaattctat tcttcaaagt tcactcaatc atccccatcg cccaatatgt 2760 gatttagcaa caaaattctg gaatgaaata catggtaaag atgcaggatc aaatgcccct 2820 ggttccttgc ttctgctaga taaatcatca actagtggac taaatgctga gtcaaaaccc 2880 ccctttattt ctgcaaatga ttgttcaaaa aacgaaaagg tcgtagcttt gtctcagatt 2940 caaagtatga aaagaatgaa atctaaaatt actcgacgtc ccagcaatac aaaaggaaaa 3000 ctggagtgtc aaaattcgga tcatctgtta aacaaattta gaagagcata g 3051 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <400> 5 gggcaaggag ggatggttag gtggt 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 ggatcatgag caggagactg cagcg 25 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <400> 7 tacggatcta gtgccccgcc tatacctt 28 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <400> 8 ctagtgtcac atctgtactt gctttt 26 <210> 99 <211> 24 <212> DNA <213> Artificial Sequence <400> 99 tggcactatg tcacgttcca aacg 24 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <400> 10 gagttcttcc cagcttgtta gaccatta 28 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <400> 11 atcaggtcag tttagatctc aaatacatt 29 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <400> 12 cctatgatga tcgataattt gtcgtgtg 28
Claims
1. Use of garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 in breeding garlic resistant to leaf blight, characterized in that: The garlic leaf blight resistant genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 are introduced into a susceptible garlic variety, which is a garlic material not containing the Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 genes, to obtain a garlic variety resistant to leaf blight, wherein the nucleotide sequences of the garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 are shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4, respectively.
2. Use of garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 in breeding garlic resistant to leaf blight according to claim 1, characterized in that, The introduction method is as follows: the garlic leaf blight resistant genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 are constructed on a transgenic vector, and are introduced into a susceptible garlic by an Agrobacterium-mediated method to obtain a disease-resistant garlic variety plant containing the garlic leaf blight genes Asa7G07594.1, Asa4G02411.1, Asa3G01174.1 and Asa5G02196.1 as described in claim 1.