CA-IX Aptamer and Its Diagnostic and Therapeutic Uses

Abstract

The present invention provides nucleic acid aptamers that bind to carbonic anhydrase IX (CA-IX), derivatives and conjugates thereof, and their use as diagnostic tools, in particular for imaging organs and tissues expressing CA-IX, or as therapeutic agents for preventing or treating CA-IX-related diseases.

Description

Technical Field

[0001] The present invention provides nucleic acid aptamers, derivatives and conjugates that bind to carbonic anhydrase IX (CA-IX), and their use as diagnostic tools, in particular for imaging organs and tissues expressing CA-IX, or as therapeutic agents for preventing or treating CA-IX-related diseases. Background Art

[0002] Aptamer

[0003] Recently, functional oligonucleotide-based biomolecules (termed aptamers) have attracted great interest as potential alternatives to antibodies. Aptamer selection technology has drawn the attention of the scientific community due to its applicability in disease diagnosis and treatment.

[0004] Oligonucleotide aptamers range in size from about 20 to about 80 bases (8 to 25 kDa), and their structure is responsible for intramolecular interactions (Levy-Nissenbaum E. et al., Trends Biotechnol. 2008, 26(8), 442–449). Aptamers bind to their targets through interactions between aromatic compounds, through hydrogen-bonded base pairing, van der Waals interactions, and electrostatic interactions between charged groups or hydrogen bonds. Thus, aptamers undergo conformational changes upon target recognition and biomolecular interaction.

[0005] These biological, physical and chemical properties make these oligonucleotides effective recognition tools for diagnosis and treatment. The application of aptamers in the biological field is mainly limited by ribonuclease degradation of them. Chemical modifications are required to protect them from nucleases and to improve their thermal stability and pharmacokinetic properties.

[0006] Among these modifications, the OH at the 2'-position of ribose can be exchanged with 2'-F or 2'-NH2 groups to improve the stability of aptamers in the cellular environment. Other alterations of aptamers can include end-capping with small molecules such as amines, phosphate groups or thymidine residues and other unnatural bases (Gao S. et al., Anal. Bioanal. Chem. 2016, 408(17), 4567-4573).

[0007] Aptamers are selected by an in vitro method called Systematic Evolution of Ligands by EXponential enrichment (SELEX). This method was described simultaneously by Tuerk and Gold (Science, 1990, 249, 505-510) and by Ellington and Szostak (Nature, 1990, 346, 818-822). The SELEX method involves the stepwise selection of aptamers by repeated binding cycles, elution, and amplification of ligands from a random nucleic acid library to select sequences with higher binding affinity for the selected target.

[0008] A new application of this technology, called "cell-SELEX", has been developed that allows the selection of aptamers that bind to specific target cells (de Franciscis V. et al., Methods Mol Biol., 2016, 1380, 33-46). The selection parameters can be easily manipulated to obtain more effective aptamers suitable for various conditions such as pH, temperature, or buffer composition (Radom F. et al., Biotechnol. Adv. 2013, 31(8), 1260-1274). Some modifications, such as affinity chromatography, capillary electrophoresis, and filtration membranes, are included in the traditional SELEX method to maximize affinity and specificity and to increase the selection speed and success rate of specific aptamers (Stoltenburg R et al., Biomol. Eng. 2007, 24(4), 381-403). Various physical, chemical, and biological assays are used to characterize the selected oligonucleotides (Song KM et al., Sensors, 2012, 12(1), 612-631). Once selected, they can be synthesized in large quantities by chemical reactions in an accurate and reproducible manner. These chemical processes are more cost-effective than antibody production.

[0009] When compared to antibodies, aptamers are relatively small in size, which facilitates their chemical synthesis and possible modification. They are biocompatible and have low immunogenicity in vivo. They have high selectivity and the ability to bind and recognize specific targets, presenting affinity constants (Kd) in the nanomolar range, lower than those of antibodies (which typically have Kd values in the milli / micromolar range). In addition, due to their significantly lower molecular weight, they can penetrate tissues faster and more efficiently and can distinguish between extracellular or intracellular domains of proteins, which antibodies cannot (Gopinath S.C. et al., J. Gen. Virol., 2006, 87(3), 479–487).

[0010] The strong target affinity / selectivity, cost-effectiveness, chemical versatility, and safety of aptamers also outperform traditional peptide- or protein-based ligands, making them particularly suitable for molecular imaging. In fact, aptamers can be chemically modified to maintain long-term stability and can be bio-conjugated with various moieties, and are thus considered very useful as specific imaging agents (e.g., for optical, magnetic resonance, nuclear, computed tomography, ultrasound, and multimodal imaging) as well as therapeutic agents.

[0011] CA-IX

[0012] Carbonic anhydrase IX (CA-IX) is a zinc metalloenzyme located on the cell surface. It is a member of the large carbonic anhydrase (CA) family of enzymes that catalyze the reversible conversion of carbon dioxide to protons and bicarbonate, thereby lowering the pH.

[0013] To date, 16 CA isoforms have been characterized in mammals, which differ in cellular localization, catalytic activity, sensitivity to different inhibitors, and tissue-specific distribution. Among them, CA-IX is a marker of the tumor hypoxia response because its gene expression is promoted by the major regulator of hypoxia, a factor called hypoxia-inducible factor 1 (HIF-1), which is believed to be involved in maintaining the acidic environment of hypoxic cells (Wykoff et al., Cancer Res. 2000, 60, 7075-7083). Tumor hypoxia, mainly caused by poor perfusion and anemia, is one of the key factors inducing the clonal development of cells with an invasive and therapy-resistant phenotype, leading to rapid progression and poor prognosis in several cancer types. In fact, cancer cells survive in a hostile environment that alters their gene expression, particularly that of multiple genes involved in pH control.

[0014] CA-IX plays an important role in the growth and metastasis of numerous tumors, including renal cell carcinoma, cervical cancer, colon cancer, prostate cancer, breast cancer, head and neck tumors, etc., because its catalytic activity helps to reduce the extracellular pH value (pHe), which creates an acidic microenvironment that increases cancer cell proliferation and invasion.

[0015] Unlike other CAs, many studies have shown that CA-IX is expressed only in a few normal tissues (i.e., intestinal and gastric mucosa, gallbladder, and testis), while being overexpressed in many types of cancer cells. Therefore, using specific tools to target CA-IX opens up new important areas for improving conventional therapies as well as for the early diagnosis and prognosis of malignancies.

[0016] The main problem faced in the selection of CA-IX targeting moieties, particularly anti-CA-IX aptamers, concerns how to specifically target the active state of CA-IX.

[0017] The classes of CA-IX targeting agents developed so far for imaging and / or therapeutic applications include monoclonal antibodies (e.g., G250, M75) or minibodies (e.g., A3 and CC7) and small compounds such as inorganic ions, sulfonamide-based compounds, phenols, and coumarins. Some of these agents are currently in clinical development.

[0018] In particular, the monoclonal antibodies (mAbs) M75 and G250 represent the first solutions developed for targeting the CA-IX enzyme. Mab M75 binds to the proteoglycan-like (PG-like) domain of CA-IX at the target's N-terminus, while mab G250 interacts with the catalytic domain of CA-IX. A chimeric version of G250 labeled with the radionuclide 124 I (referred to as cG250) was developed for the detection of clear cell renal cell carcinoma (ccRCC).

[0019] Although monoclonal antibodies are generally considered the ligand of choice for most tumor-targeting applications, it has become increasingly clear that they have many drawbacks. In fact, antibodies are characterized by slow and inefficient tumor penetration and long blood residence times, which require the use of long-lived radioisotopes and late imaging, thus exposing patients to a high radiation burden. In fact, 124 I-cG250 reaches a tumor / blood ratio suitable for imaging only 2 - 7 days after injection into patients. In addition, monoclonal antibodies can be immunogenic and thus cannot be repeatedly administered in routine diagnostic procedures.

[0020] These problems can be circumvented by using small molecules. Unlike large macromolecules, small molecules are rapidly cleared from the circulation and thus reach a tumor / blood ratio suitable for imaging at early time points. This in turn enables physicians to obtain diagnostic information faster than with antibody-based imaging agents.

[0021] Among the small compounds targeting CA-IX, the best-studied and most robust class of inhibitors are sulfonamides because of their high affinity, availability, and ease of chemical manipulation. However, although some of them are promising agents, there are still concerns about off-target toxicity due to interaction with intracellular CA and other extracellular CAs such as CA-XII, which is expressed in both tumor and normal tissues.

[0022] WO2014 / 128258 describes a CA-IX targeting compound, such as the antibody cG250, for the treatment of cancer and for methods of diagnosing, predicting, and / or classifying cancer diseases, including quantifying CA-IX expression and determining a CA-IX score.

[0023] WO2011 / 139375 discloses novel antibodies and fragments thereof that bind to CA-IX and can be used for the diagnosis and treatment of cancer diseases associated with hypoxia and / or elevated CA-IX activity.

[0024] CN107648620 and Zhu L. et al., Int.J.Nanomedicine,2018,13,6481-6495 disclose targeted ultrasound nanobubbles that carry CA-IX aptamers immobilized in the lipid monolayer shell of nanoparticles; such compounds can penetrate the tumor vasculature and be used for ultrasound molecular imaging of tumor parenchymal cells.

[0025] WO2012 / 027493 describes a non-invasive method for in vivo detection of cancer cells by administering to a subject one or more targeted imaging probes that specifically bind to targets selected from CA-IX, CA-XII, etc. Aptamers are mentioned among the possible targeted probes, although no examples of specific isolated oligonucleotides are reported.

[0026] Despite efforts, there is still a need to develop CA-IX binders that are characterized by high and specific affinity for the target for use in diagnosis and / or treatment. Summary of the Invention

[0027] The present invention is based on the identification of RNA aptamer sequences that specifically target carbonic anhydrase IX (CA-IX) with high affinity.

[0028] Given the upregulation of CA-IX as a hypoxia marker in many types of cancer, the anti-CA-IX aptamers of the present invention can be used for early cancer diagnosis and staging, and for detecting and tracking the response of disseminated metastatic disease to systemic and targeted therapies from the perspective of more effective treatment.

[0029] In particular, the aptamers of the present invention solve the problem of specifically recognizing the target at the site of its physiological presence, i.e., on the surface of cells expressing CA-IX, and thus prove suitable for their in vivo use. In fact, the aptamers described herein have been found to be able to directly bind to cells that overexpress CA-IX on their surface.

[0030] To this end, the cell-SELEX method has been applied to specifically select aptamers that bind to CA-IX expressed on the cell surface.

[0031] Detailed Description

[0032] Binding was assayed to COS7 cells transiently transfected with human CA-IX (COS7-CAIX) using an RNA molecule library modified with 2'-fluoropyrimidine. The selection process involved the following repeating cycles: 1. The aptamer library was incubated on COS7 cells for the counter-selection step; 2. The unbound sequences were recovered and incubated on COS7-CAIX cells for the selection step; 3. The bound sequences were recovered and amplified. After repeating the selection step, the final RNA molecule library was cloned, individual sequences showing the highest COS7-CA-IX binding were isolated, and their sequences and affinities for the target were determined.

[0033] In a first aspect, the invention provides two aptamers that are capable of binding carbonic anhydrase IX (CA-IX) and comprise an RNA sequence selected from UCGAAUGAACCAAGGUUCCUCGGC (SEQ ID NO:1) and UUCGUGCCGCUGAGUGCGUACGGGC (SEQ ID NO:2) or derivatives thereof.

[0034] In one embodiment, the aptamers described above have a length of up to 100 nucleotides.

[0035] Specific RNA sequences of 24 and 25 nucleotides corresponding to SEQ ID NO:1 or SEQ ID NO:2 were obtained by shortening two initially selected 84mer aptamers to obtain small sequences useful for imaging and therapeutic applications.

[0036] In a preferred embodiment, the RNA aptamers defined above are characterized by nuclease resistance. In a more preferred embodiment, the RNA aptamers defined above are characterized in that all pyrimidine residues are modified with 2'-F (fluoropyrimidine).

[0037] In another more preferred embodiment, the RNA aptamers defined above can be conjugated to a binding moiety, such as biotin.

[0038] The preferred aptamers of the invention consist of SEQ ID NO:1 or SEQ ID NO:2. More preferably, the aptamer consists of SEQ ID NO:1.

[0039] Aptamer modification

[0040] The aptamers of the invention can be modified, for example, to increase their resistance to nucleases, modulate their pharmacokinetics, or conjugate to diagnostic or therapeutic moieties.

[0041] Preferably, the RNA aptamers of the present invention have at least one or all pyrimidine residues modified with 2'-fluoro. Additionally, the modification may include chemical substitution at positions preferably selected from the group consisting of the sugar position, phosphate position, and base position of the nucleic acid. In some embodiments, the modification is selected from the group consisting of: biotinylation, incorporation of a fluorescent label, incorporation of a modified nucleotide, 2'-pyrimidine modification, 3'-capping, conjugation with a linker, conjugation with a compound or drug, conjugation with a cytotoxic moiety, and labeling with a fluorophore, radioisotope, ultrasound contrast agent, or reporter moiety. The position of the modification may vary depending on the type of moiety attached to the aptamer. For example, the aptamer sequence may be modified at the 3'-terminus and / or 5'-terminus.

[0042] In a preferred embodiment, the aptamer is linked to biotin, such as biotinylation at the 3'-terminus, as shown in formula (I) below:

[0043]

[0044] The aptamers of the present invention, suitably labeled or conjugated with a reporter or therapeutic moiety, can be used for the diagnosis, treatment, or visualization of CA-IX-related states, disorders, dysfunctions, conditions, or diseases (especially cancer diseases). Exemplary applications include the diagnosis or treatment of cancer diseases associated with CA-IX expression, such as renal cancer, cervical cancer, colon cancer, prostate cancer, breast cancer, and head and neck tumors, as well as heart failure.

[0045] In a specific embodiment of the present invention, the aptamer labeled with a reporter moiety can be used for imaging of body tissues or organ systems that express CA-IX, particularly tumor parenchyma tissue.

[0046] Suitable imaging techniques include magnetic resonance imaging, positron emission tomography (PET), computed tomography (CT), ultrasound, photoacoustic imaging (PAI), near-infrared fluorescence (NIRF), single photon emission computed tomography (SPECT).

[0047] For imaging applications, the reporter moiety linked to the aptamer is typically selected from: molecules capable of generating a fluorescent signal, such as fluorescein; FITC; Alexa dyes; Cy dyes; DyLight dyes; IRDye dyes or VivoTag dyes; optical moieties, including reagents that can be used to generate contrast or a signal using optical imaging; magnetic moieties, including chelators of magnetic resonance agents capable of forming stable complexes with paramagnetic metal ions; radiolabeled moieties; X-ray moieties that can be used to generate contrast or a signal using X-ray imaging, such as iodinated organic molecules or chelates of heavy metal ions; ultrasound imaging moieties that can be used to generate contrast or a signal using ultrasound-targeted microbubbles; and photoacoustic imaging moieties, including photoacoustic imaging compatibilizers.

[0048] The aptamer and the reporter moiety or label can be covalently or non-covalently linked, optionally via insertion of a suitable linker or spacer, including peptides, amino acids or nucleic acids. Additionally, the aptamer and the reporter moiety or label can be linked using a tag system, including biotin / avidin, biotin / streptavidin, biotin / neutravidin or digoxigenin base (DIG) system.

[0049] In another aspect, the present invention provides a composition comprising at least one aptamer as defined herein and one or more suitable pharmaceutically acceptable carriers, excipients, diluents and / or additives. The components of the composition can vary depending on the intended use, whether for diagnostic, therapeutic or imaging applications. For example, the composition can further comprise one or more therapeutic compounds and / or one or more imaging agents.

[0050] In one embodiment, the composition is for imaging a target tissue bearing CA-IX and comprises an aptamer conjugated or labeled with a reporter moiety as defined above. The composition can be, for example, in the form of liposomes or nanoparticles and is suitable for different types of administration. In one embodiment, the composition is suitable for parenteral administration, preferably for intravenous or subcutaneous administration. The composition can be used to visualize tissues or organs expressing CA-IX, such as tumor parenchymal tissues.

[0051] There is also provided a kit comprising at least one aptamer of the present invention in one or more containers, preferably labeled or conjugated with a reporter or therapeutic moiety.

[0052] Brief Description of the Sequence Listing

[0053] - SEQ ID NO:1 lists the 24 nt short aptamer sequence named SAM-2.T1: 5'-UCGAAUGAACCAAGGUUCCUCGGC-3';

[0054] - SEQ ID NO:2 lists the 25 nt short aptamer sequence named SAM-1.T1: 5'-UUCGUGCCGCUGAGGUGCGUACGGGC-3'. Brief Description of the Drawings

[0055] Figure 1 : Binding assessment of CA-IX purified protein by ELONA assay. Absorbance at 450 nm of SAM-1.T1 and SAM-2.T1 (left panel) and polyclonal antibody anti-HSA (right panel).

[0056] Figure 2 : Stability of SAM-1.T1 and SAM-2.T1 aptamers in human serum: Samples of a) SAM-1.T1 and b) SAM-2.T1 collected at different times were loaded onto a denaturing gel (upper panel) and c) the bands were quantified by the ImageJ program (lower panel). The first lane of both gels represents the sequence not treated with human serum to evaluate the correct size of the samples.

[0057] Figure 3 : K d evaluation of HSA by ELONA assay. Absorbance at 450 nm of (a) SAM-1.T1, (b) SAM-2.T1, and (c) anti-HSA polyclonal antibody.

[0058] Experimental section

[0059] Device

[0060] RT-qPCR was performed by the StepOne TM Plus real-time PCR system (Applied Biosystem). Gel visualization was performed using the Gel DocEZ System (Bio-Rad). ELONA data were obtained by the Multiskan TM FC microplate photometer (ThermoFisher Scientific).

[0061] List of Abbreviations

[0062] CA-IX Carbonic anhydrase IX

[0063] SELEX Systematic evolution of ligands by exponential enrichment

[0064] RNA Ribonucleic acid

[0065] DNA Deoxyribonucleic acid

[0066] DMF Dimethylformamide

[0067] DMSO Dimethyl sulfoxide

[0068] WT Wild type

[0069] nt Nucleotide

[0070] 2'-F-Py 2'-Fluoropyrimidine

[0071] PAGE Polyacrylamide gel electrophoresis

[0072] pHe Extracellular pH

[0073] PG Proteoglycan-like domain

[0074] HPLC High Performance Liquid Chromatography

[0075] HSA Human Serum Albumin

[0076] ELONA Enzyme-Linked Oligonucleotide Assay

[0077] HIF-1 Hypoxia-Inducible Factor 1

[0078] MES 2-(N-Morpholino)ethanesulfonic Acid

[0079] COS7 CV-1 (Simian) cell line with SV40 genetic material

[0080] Rt-q PCR Real-Time Polymerase Chain Reaction

[0081] Example 1: Selection and Preparation of Anti-CA-IX Aptamer

[0082] Selection:By the cell-SELEX method, RNA sequences specific for CA-IX were selected from a non-initial library of 84-nt fragments. The method includes cycles of counter-selection / selection steps of a pre-enriched aptamer library with affinity for CA on COS7-WT and transiently transfected COS7-CA-IX cells, respectively, where a selection pressure is generated in each round. The enriched library was incubated on cells under acidic conditions (in the presence of 60 mM MES buffer) to reach the extracellular pH value (about 6.8) maintained by CA-IX. Before each round of cell-SELEX, the library was transcribed using a mutant form of T7 RNA polymerase capable of incorporating 2'-fluoropyrimidine into the RNA sequence. The counter-selection step was performed against COS7-WT cells to avoid selecting aptamers that recognize proteins normally expressed on COS7 cells. The selection step was performed against transiently transfected COS7-CA-IX cells to select aptamers specific for the target. For each cycle, the 2'-fluoropyrimidine RNA sequence library was first incubated on COS7-WT cells at 37 °C, and then the unbound 2'-fluoropyrimidine RNA sequences were incubated on COS7-CA-IX cells. After several washes, the sequences were recovered by total RNA extraction. At the end of the cell-SELEX protocol, the last cycle was cloned and the samples were sequenced. Enrichment analysis of the resulting sequences was performed, and binding assays were performed by RT-qPCR to select sequences capable of binding COS7-CA-IX cells. Essentially, the DNA sequences were amplified and transcribed, and then the RNA sequences were incubated at 37 °C for 15 minutes at 100 nM (as the final concentration) on COS7-WT cells and COS7-CA-IX cells under acidic conditions after pretreatment with 200 μg / mL yeast tRNA. After incubation, the cells were washed 3 times with PBS and recovered in TRIsure reagent. RNA sequences used as reference controls were found in each point for normalization. The fold ratio of the binding values comparing COS7-CA-IX with COS7-WT cells was calculated. Six sequences representing pairs or groups of the same sequence were screened. Those with higher fold ratios were selected for further analysis, and the experiments were performed in triplicate. To obtain shorter sequences suitable for imaging applications, the 84-mer original molecule was truncated, and shorter sequences corresponding to SEQ ID NO:1 (SAM-2.T1) and SEQ ID NO:2 (SAM-1.T1) were selected by isolating more structured regions and examining each short sequence that maintained the folding of the corresponding part in the long aptamer. The retention of binding ability in the truncated sequences was evaluated in Example 2 below.

[0083] Preparation: Then, the aptamers selected in the present invention were obtained by artificial synthesis. For example, according to methods well known in the art, they were synthesized by solid-phase synthesis using an RNA synthesizer. Then, they were conjugated with biotin at the 3'-end of the sequence.

[0084] After inserting the C6-amino linker (3'-C6-NH2), the RNA sequence was conjugated with commercial biotin at its 3'-end. The linker was inserted at the 3'-terminal phosphate by condensation with a C6 aliphatic diamine under alkaline catalysis. The resulting free NH2 moiety was coupled with biotin-NHS ester to form a covalent amide bond. The biotin-NHS ester was dissolved in high-quality anhydrous DMF or DMSO and the reaction was carried out at room temperature in 0.1 - 0.2 M sodium bicarbonate buffer (pH 8.3). Purification was performed by PAGE, followed by HPLC.

[0085] Example 2: Binding and Affinity of Aptamers SAM-1.T1 and SAM-2.T1 to CA-IX Positive Cells

[0086] To confirm that the short aptamers SAM-1.T1 (SEQ ID NO:2) and SAM-2.T1 (SEQ ID NO:1) contain the active sites of the original molecules and maintain high binding and affinity for COS7-CA-IX cells, binding assays were performed in duplicate to compare the sequence binding ability on COS7-CA-IX versus COS7-WT cells. COS7 cells were inoculated and transfected with human CA-IX cDNA. After 24 hours, the RNA sequences were incubated at 37 °C for 15 minutes at 100 nM (as the final concentration) on COS7-WT and COS7-CA-IX under acidic conditions. Samples were analyzed by RT-qPCR to quantify the amount of bound aptamer and the fold change in COS7-WT cells was calculated.

[0087] The fold change values of aptamers SAM-1.T1 and SAM-2.T1 were 1.3 and 2.4, respectively. This result confirmed their ability to bind to the target CA-IX in the physiological conformation on the cell surface membrane.

[0088] Example 3: Binding Assay of Aptamers SAM-1.T1 and SAM-2.T1 to Purified Human CA-IX Protein

[0089] The binding of aptamers SAM-1.T1 (SEQ ID NO:2) and SAM-2.T1 (SEQ ID NO:1) was further investigated in different experiments. Biotinylated aptamers SAM-1.T1 and SAM-2.T1 were tested on purified human CA-IX protein to confirm their ability to recognize the target.

[0090] Sequences SAM-1.T1 and SAM-2.T1, 200 nM, biotinylated at the 3' end, were incubated on 96-well microtiter high-binding plates pre-coated with 50 nM purified human CA-IX protein or uncoated (blank). For each experiment, an anti-CA-IX antibody was used as a positive control.

[0091] The samples were then analyzed by ELONA assay. The results are as Figure 1 shown, indicating that both aptamers bind to the CA-IX human protein, as does the anti-CA-IX antibody.

[0092] Example 4: Stability of aptamers SAM-1.T1 and SAM-2.T1 in human serum

[0093] The stability of aptamers SAM-1.T1 and SAM-2.T1 in human serum was tested to evaluate their resistance to enzymatic degradation. They were incubated at 37 °C in 87% human serum. The experiments were performed in triplicate. Samples were collected at different times (T0, 1, 2, 4, 8, 12, 24, 48, 72 h), incubated with proteinase K at 37 °C for 1 h to degrade serum proteins and loaded onto a denaturing gel.

[0094] Figure 2 The results reported in

[0095] showed that the SAM-1.T1 and SAM-2.T1 aptamers are very stable in human serum, especially the SAM-1.T1 aptamer is stable up to 24 h and the SAM-2.T1 aptamer is stable for more than 72 h.

[0096] ELONA assays were performed to evaluate the binding of SAM-1.T1 and SAM-2.T1 aptamers to human serum albumin (HSA). Biotinylated SAM-1.T1 and SAM-2.T1 aptamers were incubated at increasing concentrations (10 - 100 - 1000 nM) on 96-well microtiter high-binding plates pre-coated with 25 nM HSA or uncoated (blank). No aptamer binding was detected under any of the conditions used, indicating that the SAM-1.T1 and SAM-2.T1 aptamers do not react with HSA up to 1000 nM. In each experiment, a biotinylated polyclonal anti-HSA antibody was used as a positive control. The results are as Figure 3 shown.

Claims

1. An RNA aptamer that specifically binds to carbonic anhydrase IX (CA-IX), wherein the aptamer is as shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. The aptamer according to claim 1, wherein all pyrimidine residues are modified to 2'-fluoropyrimidines.

3. The aptamer according to claim 2, which is further modified to comprise at least one chemical modification, wherein the modification is a chemical substitution at a position selected from the sugar position, phosphate position, and base position of the nucleic acid.

4. The aptamer according to claim 3, wherein the modification is selected from the group consisting of incorporation of modified nucleotides, conjugation with a compound, and labeling with a reporter moiety.

5. The aptamer according to claim 4, wherein the reporter moiety is selected from the group consisting of a fluorophore moiety, a magnetic or paramagnetic moiety, a radiolabeled moiety, an affinity label, an X-ray moiety, an ultrasound imaging moiety, a photoacoustic imaging moiety, and a nanoparticle-based moiety.

6. The aptamer according to claim 5, wherein the affinity label is biotin.

7. The aptamer according to any one of claims 1 to 6, which is used for visualization of cancer diseases associated with the expression of CA-IX.

8. The aptamer according to claim 7, wherein the cancer disease is selected from renal cancer, cervical cancer, colon cancer, prostate cancer, breast cancer, and head and neck tumors.

9. The aptamer according to claim 7, wherein the visualization involves imaging of a body tissue or organ system that expresses CA-IX.

10. An imaging composition comprising the aptamer according to any one of claims 1 to 6, and a pharmaceutically acceptable carrier and excipient.

11. The composition according to claim 10, which is suitable for imaging of organs and tissues that express CA-IX.

12. The composition according to claim 11, wherein the imaging is based on magnetic resonance imaging, positron emission tomography (PET), computed tomography (CT), ultrasound, photoacoustic imaging (PAI), near-infrared fluorescence (NIRF), or single photon emission computed tomography (SPECT).

Images