GH10 Xylanase, GH62 Arabinofuranosidase, Grinding Method and Other Applications
The treatment of crop grains using enzyme compositions of GH10 xylanase and GH62 arabinofuranosidase solves the problems of inefficiency and dependence on chemical agents in the existing wet grinding methods, and efficient starch and gluten separation and fiber removal are achieved.
Patent Information
- Application Number
- CN202210178096.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2016-11-25
- Filing Date
- 2017-11-24
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2037-11-24
AI Technical Summary
Existing wet grinding methods are inefficient and dependent on chemical agents when treating crop grains, making it difficult to effectively isolate starch, gluten and fiber.
Using an enzyme composition of GH10 xylanase and GH62 arabinofuranosidase, the grains are processed to improve the separation efficiency of starch and gluten and reduce the protein content of the fiber during soaking and milling crop grains.
It improves the quality and yield of starch and gluten, reduces dependence on chemical agents, and makes it easier to separate starch and fibers, improving overall processing efficiency.
Smart Images

Figure BDA0003521166220000331 
Figure BDA0003521166220000332 
Figure BDA0003521166220000341
Abstract
Description
[0001] This application is a divisional application of the patent application for invention with the application date of November 24, 2017, application number 201780040290.4, and invention title "GH10 Xylanase, GH62 Arabinofuranosidase, Grinding Method and Other Applications".
[0002] Reference to the Sequence Listing
[0003] This application contains a sequence listing in computer-readable form, which is incorporated herein by reference. Field of the Invention
[0004] The present invention relates to an improved method for processing crop kernels to provide starch products of high quality suitable for converting starch into monosaccharides and oligosaccharides, ethanol, sweeteners, etc. The present invention relates to polypeptides having GH10 xylanase activity and polypeptides having GH62 arabinofuranosidase activity. The present invention also relates to a method for extracting or separating crude palm oil. Additionally, the present invention relates to an enzyme composition comprising one or more enzyme activities suitable for the methods of the present invention. Background of the Invention
[0005] Description of Related Art
[0006] Corn kernels are typically separated into their four basic components: starch, germ, fiber, and protein using wet milling.
[0007] Typically, the wet milling method comprises four basic steps. First, the kernels are soaked or immersed for about 30 minutes to about 48 hours to initiate the breaking of starch and protein bonds. The next step of the method involves coarse grinding to break the pericarp and separate the germ from the remaining kernels. The remaining slurry consisting of fiber, starch, and protein is finely ground and screened to separate the fiber from the starch and protein. The starch is separated from the remaining slurry in a hydrocyclone. Then, the starch can be converted into syrup or alcohol, or dried and sold as corn starch, or modified chemically or physically to produce modified corn starch.
[0008] The use of enzymes in the soaking step of the wet milling method has been demonstrated. It has been shown that a commercial enzyme product (available from Novozymes A / S) is suitable for the first step of the wet milling method, namely the soaking step of soaking corn kernels in water.
[0009] Recently, "enzymatic milling" has been developed, which is a modified wet milling method that uses proteases to significantly reduce the total processing time during corn wet milling and eliminates the need for sulfur dioxide as a processing agent. Johnston et al., Cereal Chem, 81, p. 626-632 (2004).
[0010] US 6,566,125 discloses a method for obtaining starch from maize, which involves soaking maize kernels in water to produce soaked maize kernels, milling the soaked maize kernels to produce a milled maize slurry and incubating the milled maize slurry with an enzyme (e.g., protease).
[0011] US 5,066,218 discloses a method for milling grains (especially maize), which includes cleaning the grains, impregnating the grains in water to soften them, and then milling the grains with cellulase.
[0012] WO 2002 / 000731 discloses a method for treating crop kernels, which includes soaking the kernels in water for 1-12 hours, wet milling the soaked kernels and treating the kernels with one or more enzymes (including acid protease).
[0013] WO 2002 / 000911 discloses a method for separating starch gluten, which includes subjecting milled starch to acid protease.
[0014] WO 2002 / 002644 discloses a method for washing a starch slurry obtained from the starch gluten separation step of a self-milling method, which includes washing the starch slurry with an aqueous solution including an effective amount of acid protease.
[0015] Palm oil is an edible vegetable oil that is obtained from the mesocarp of palm fruits. Palm fruits or berries grow in large bunches. After sterilization, the palm berries are stripped from the fruit bunches. High temperatures cause the enzymes naturally present in the palm fruits to denature and facilitate the stripping of the fruits from the bunch stalks. The palm berries are discharged into a container commonly referred to as a digester, whereby a mash of digested palm fruits is produced at a controlled temperature. The digested mash is then pressed, e.g., by using a screw press for subsequent recovery of palm oil. The crude palm oil can be screened, e.g., to remove coarse fibers, and then subjected to a clarification process to separate the oil from water, cell debris and any remaining fibrous material.
[0016] The mesocarp of palm fruits contains a large amount of oil, which exists as oil droplets within the mesocarp cells. Generally, the oil extraction rate (OER), which is a measure of the amount of oil extracted relative to the weight of the palm fruits, is in the range of 20 - 24%, depending on, for example, fruit quality and is affected by seasonal variations. Generally, palm oil milling methods are carefully optimized at each mill to minimize oil losses as much as possible, but there is still a strong incentive to improve the OER.
[0017] WO 2012 / 011130 discloses an enzyme composition (having exocellulolytic, pectinolytic, mammanolytic, and glucanolytic activities) in a method for palm oil extraction.
[0018] There is still a need to improve methods for wet milling or palm oil extraction. Summary of the Invention
[0019] The present invention provides a method for processing crop kernels, the method comprising the steps of: a) soaking the kernels in water to produce soaked kernels; b) milling the soaked kernels; c) and treating the soaked kernels or a fraction of the maize kernels in the presence of an effective amount of a polypeptide having GH62 arabinofuranosidase activity and / or a polypeptide having GH10 xylanase activity; wherein step c) is carried out before, during, or after step b).
[0020] In one embodiment, the method of the present invention further comprises a fiber washing step.
[0021] In one embodiment, the method of the present invention further comprises a starch gluten separation step and a starch washing step.
[0022] In one embodiment, the present invention provides the above method, wherein step c) is carried out during the fiber washing step.
[0023] In one embodiment, the present invention provides the above method, wherein the soaking is carried out in the presence of between 0.01% - 1%, preferably 0.05% - 0.3%, especially 0.1% SO 2 and / or NaHSO 3 of.
[0024] In one embodiment, the present invention provides the above method, wherein the crop kernels are from maize (Zea mays), rice, barley, sorghum, soybean or fruit hull or wheat.
[0025] In one embodiment, the present invention provides the above method, which further comprises treating the soaked crop kernels or fractions of the crop kernels in the presence of one or more cellulolytic enzymes, preferably the one or more hydrolytic enzymes are expressed in an organism such as Trichoderma reesei.
[0026] In one embodiment, the present invention provides the above method, wherein the crop kernels or fractions of the crop kernels are mixed with the one or more hydrolytic enzymes, preferably the one or more hydrolytic enzymes are expressed in an organism such as Trichoderma reesei.
[0027] In one embodiment, the present invention provides the above method, which comprises treating the soaked crop kernels or fractions of the crop kernels in the presence of a polypeptide having GH30 xylanase activity.
[0028] In one embodiment, the present invention provides the above method, which further comprises treating the soaked crop kernels or fractions of the crop kernels in the presence of an enzyme selected from the group consisting of: a cellulolytic enzyme or cellulase, an endoglucanase, a protease, cellobiohydrolase I, cellobiohydrolase II, a GH61 polypeptide, or a combination thereof.
[0029] In one embodiment, the present invention provides the above method, wherein the GH62 polypeptide having arabinofuranosidase activity is derived from a strain of the genus Aspergillus, such as a strain of Aspergillus niger.
[0030] In one embodiment, the present invention provides the above method, wherein the polypeptide having GH62 arabinofuranosidase activity is selected from the group consisting of:
[0031] a) a polypeptide having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide of SEQ ID NO:1 or the mature polypeptide of SEQ ID NO:3;
[0032] b) a variant of the mature polypeptide of SEQ ID NO:1 or the mature polypeptide of SEQ ID NO:3, which comprises substitutions, deletions and / or insertions at one or more positions.
[0033] In one embodiment, the present invention provides the above method, wherein the polypeptide having GH10 xylanase activity is derived from a strain of the genus Aspergillus, such as a strain of Aspergillus niger.
[0034] In one embodiment, the present invention provides the above method, wherein the polypeptide having GH10 xylanase activity is selected from the group consisting of:
[0035] a) a polypeptide having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide of SEQ ID NO:4;
[0036] b) a variant of the mature polypeptide of SEQ ID NO:4, which comprises substitutions, deletions and / or insertions at one or more positions.
[0037] In one embodiment, the present invention provides the above method, wherein the polypeptide having GH30 xylanase activity is selected from the group consisting of:
[0038] a) a polypeptide having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide of SEQ ID NO:6;
[0039] b) a variant of the mature polypeptide of SEQ ID NO:6, which comprises substitutions, deletions and / or insertions at one or more positions.
[0040] In one embodiment, the present invention provides the above method, wherein the polypeptide having GH30 xylanase activity is derived from a strain of the genus Bacillus, such as a strain of Bacillus subtilis.
[0041] In one embodiment, the present invention provides the above method, wherein the fiber washing step comprises a space configured to provide a total retention time of at least 0.5 hours, preferably at least 2 hours, and most preferably at least 4 hours in a fiber washing system.
[0042] The present invention also provides a polypeptide having GH62 arabinofuranosidase activity, and the polypeptide is selected from the group consisting of:
[0043] a) a polypeptide having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide of SEQ ID NO:1;
[0044] b) a variant of the mature polypeptide of SEQ ID NO:1, which comprises substitutions, deletions and / or insertions at one or more positions;
[0045] c) a polypeptide encoded by a polynucleotide having at least 85%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:2 or its cDNA sequence.
[0046] In one embodiment, the polypeptide having GH62 arabinofuranosidase activity of the present invention is derived from a strain of the genus Aspergillus, such as a strain of Aspergillus niger.
[0047] The present invention also provides a polypeptide having GH10 xylanase activity, which polypeptide is selected from the group consisting of:
[0048] a) a polypeptide having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO:4;
[0049] b) a variant of the mature polypeptide of SEQ ID NO:4, which comprises substitutions, deletions and / or insertions at one or more positions;
[0050] c) a polypeptide encoded by a polynucleotide having at least 85%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:5 or its cDNA sequence.
[0051] In one embodiment, the polypeptide having GH10 xylanase activity of the present invention is derived from a strain of the genus Aspergillus, such as a strain of Aspergillus niger.
[0052] The present invention also provides a method for extracting or separating crude palm oil, the method comprising the steps of: contacting a substrate containing palm oil with an enzyme composition, and extracting or separating the crude palm oil; wherein the enzyme composition comprises a GH10 xylanase and a GH62 arabinofuranosidase.
[0053] In one embodiment, the GH10 xylanase of the present invention and the GH62 arabinofuranosidase of the present invention are defined in any of the foregoing embodiments.
[0054] The present invention also provides a polypeptide having GH62 arabinofuranosidase activity, a polypeptide having GH10 xylanase activity or a polypeptide having GH30 xylanase activity for use in improving the total starch yield and / or gluten yield from corn kernels or the oil yield from crude palm oil in the method defined in any of the foregoing embodiments, wherein preferably the polypeptide is defined in any of the foregoing embodiments.
[0055] The present invention also provides an enzyme composition comprising or consisting of: GH62 arabinofuranosidase, GH10 xylanase and / or GH30 xylanase, preferably, the GH62 arabinofuranosidase, the GH10 xylanase and / or the GH30 xylanase are defined in any of the foregoing embodiments.
[0056] In one embodiment, the enzyme composition of the present invention further consists of one or more hydrolases, preferably one or more cellulolytic enzymes, preferably, the one or more cellulolytic enzymes are expressed in an organism such as Trichoderma reesei.
[0057] Definition
[0058] Arabinofuranosidase: The term "arabinofuranosidase" refers to α-L-arabinofuranoside arabinofuranohydrolase (EC 3.2.1.55), which catalyzes the hydrolysis of terminal non-reducing α-L-arabinofuranoside residues in α-L-arabinosides. This enzyme acts on α-L-arabinofuranosides, α-L-arabans, arabinoxylans and arabinogalactans containing (1,3)- and / or (1,2)- and / or (1,5)-bonds. α-L-Arabinofuranosidase is also known as arabinosidase, α-arabinosidase, α-L-arabinosidase, α-arabinofuranosidase, polysaccharide α-L-arabinofuranosidase, α-L-arabinofuranohydrolase, L-arabinofuranosidase or α-L-arabanase. Arabinofuranosidase activity can be determined by arabinose analysis using 5 mg of medium-viscosity wheat arabinoxylan (Megazyme International Ireland, Ltd., Bray, Co. Wicklow, Ireland) / ml in 100 mM sodium acetate pH 5 in a total volume of 200 μl at 40 °C for 30 minutes, followed by HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
[0059] The arabinofuranosidase of the present invention has arabinofuranosidase activity of at least 20%, such as at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 100% of one or more polypeptides selected from the list consisting of SEQ ID NO:1 and SEQ ID NO:3.
[0060] Arabinoxylan-containing material: The term "arabinoxylan-containing material" refers to any material containing arabinoxylan. Arabinoxylan is a hemicellulose found in both the primary and secondary cell walls of plants (including wood and cereal grains), and is composed of a copolymer of two pentoses, arabinose and xylose. Arabinoxylan chains contain a large number of 1,4-linked xylose units. Many xylose units are substituted by 2-, 3- or 2,3-substituted arabinose residues.
[0061] Examples of arabinoxylan-containing materials are forage, roughage, seeds and grains (from, for example, the whole of corn, oats, rye, barley, wheat or prepared by grinding, milling, etc.), trees or hardwoods (such as poplar, willow, eucalyptus, palm, maple, birch), bamboo, herbaceous and / or woody energy crops, agricultural food and feed crops, animal feed products, cassava peel, cocoa pod, sugar cane, beet, locust bean pulp, vegetable or fruit pomace, wood waste, bark, wood chips, sawdust, wood pulp, pulping liquor, waste paper, cardboard, construction and demolition wood waste, industrial or municipal wastewater solids or sludge, manure, by-products in the brewing and / or fermentation process, wet distillers grain, dry distillers grain, spent grain, vinasse and bagasse.
[0062] Forage as defined herein also includes roughage. Forage is fresh plant material such as hay and silage from forage plants, grasses and other forage plants, grasses and other forage plants, seaweed, sprouted grains and legumes, or any combination thereof. Examples of forage plants are alfalfa (lucerne), birdsfoot trefoil, brassica (such as kale, rapeseed (canola), rutabaga (swede), turnip), clover (such as alsike clover, red clover, subterranean clover, white clover), grasses (such as Bermuda grass, brome, false oat grass, fescue, heath grass, meadow grasses, miscanthus, orchard grass, ryegrass, switchgrass, timothy-grass), maize (corn), hemp, millet, barley, oats, rye, sorghum, soybeans and wheat, and vegetables such as beetroot. Crops suitable for forage silage are common grasses, clover, alfalfa, laver, oats, rye and maize. Forage further includes crop residues from grain production (such as corn stover; straw of wheat, barley, oats, rye and other grains); residues from vegetables such as beet tops; residues from oilseed production such as stems and leaves of soybeans, rapeseed and other legumes; and fractions from grain refining for animal or human consumption or from fuel production or other industries.
[0063] Roughage is generally dry plant material with a high level of fibre such as fibre from seeds and grains, bran, husk and crop residues (such as straw, copra, rice straw, chaff, beet waste).
[0064] Preferred sources of arabinoxylan-containing materials are forage, roughage, seeds and grains, sugar cane, beet and wood pulp.
[0065] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from mature, spliced mRNA molecules obtained from eukaryotic or prokaryotic cells. cDNA lacks the intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is the precursor of mRNA, which is processed through a series of steps, including splicing, before it appears as mature, spliced mRNA.
[0066] Xylanase: The term "xylanase" means 1,4-β-D-xylan-xylose hydrolase (E.C. 3.2.1.8), which catalyzes the endohydrolysis of 1,4-β-D-xylosidic linkages in xylan. Xylanase activity can be measured at 37 °C in 0.01% X-100 and 200 mM sodium phosphate (pH 6) using 0.2% AZCL-xylan as the substrate. One unit of xylanase activity is defined as the production of 1.0 μmole of azurine per minute from 0.2% AZCL-xylan as the substrate in 200 mM sodium phosphate (pH 6) at 37 °C and pH 6.
[0067] In one aspect, the GH10 xylanase of the present invention has at least 20%, such as at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 100% of the xylanase activity of the mature polypeptide of SEQ ID NO:4.
[0068] In one aspect, the GH30 xylanase of the present invention has at least 20%, such as at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 100% of the xylanase activity of the mature polypeptide of SEQ ID NO:6.
[0069] Cellobiohydrolase: The term "cellobiohydrolase" means a 1,4-β-D-glucan cellobiohydrolase (E.C. 3.2.1.91 and E.C. 3.2.1.176) that catalyzes the hydrolysis of 1,4-β-D-glycosidic bonds in cellulose, cellooligosaccharides, or any polymer containing β-1,4-linked glucose, thereby releasing cellobiose from the reducing end (cellobiohydrolase I) or non-reducing end (cellobiohydrolase II) of the chain (Teeri, 1997, Trends in Biotechnology 15: 160-167; Teeri et al., 1998, Biochem. Soc. Trans. 26: 173-178). Cellobiohydrolase activity can be determined according to the procedures described by Lever et al., 1972, Anal. Biochem. 47: 273-279; van Tilbeurgh et al., 1982, FEBS Letters 149: 152-156; van Tilbeurgh and Claeyssens, 1985, FEBS Letters 187: 283-288; and Tomme et al., 1988, Eur. J. Biochem. 170: 575-581.
[0070] Cellulase or cellulolytic enzyme: The term "cellulase" or "cellulolytic enzyme" means one or more (e.g., several) enzymes that hydrolyze cellulosic materials. Such enzymes include one or more endoglucanases, one or more cellobiohydrolases, one or more β-glucosidases, or combinations thereof. Two basic methods for measuring cellulase activity include: (1) determining total cellulase activity, and (2) determining individual cellulase activities (endoglucanase, cellobiohydrolase, and β-glucosidase), as described in Zhang et al., 2006, Biotechnology Advances 24: 452-481. Total cellulase activity can be measured using insoluble substrates, including Whatman No. 1 filter paper, microcrystalline cellulose, bacterial cellulose, algal cellulose, cotton, pretreated lignocellulose, etc. The most commonly used assay for total cellulase activity is the filter paper assay using Whatman No. 1 filter paper as the substrate. This assay was established by the International Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Pure Appl. Chem. 59: 257-68).
[0071] Cellulase activity can be determined by measuring the increase in sugars produced / released during the hydrolysis of a cellulosic material by one or more cellulases compared to a control hydrolysis without added cellulase protein under the following conditions: 1 - 50 mg of cellulase protein / g of cellulose in pretreated corn stover (PCS) (or other pretreated cellulosic material), at a suitable temperature (such as 40°C - 80°C, e.g., 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, or 80°C) and a suitable pH (such as 4 - 9, e.g., 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0) for 3 - 7 days. Typical conditions are: 1 ml reaction, washed or unwashed PCS, 5% insoluble solids (dry weight), 50 mM sodium acetate (pH 5), 1 mM MnSO 4 , 50°C, 55°C or 60°C, 72 hours, by HPX - 87H column chromatography (Bio - Rad Laboratories, Inc., Hercules, CA, USA) for sugar analysis.
[0072] Cellulosic material: The term "cellulosic material" means any material containing cellulose. Cellulose is a homopolymer of anhydrocellobiose and is thus a linear β-(1 - 4)-D - glucan, while hemicellulose includes a variety of compounds such as xylan, xyloglucan, arabinoxylan, and mannan in complex branched chain structures with a range of substituents. Although cellulose is generally polymorphic, it is found to exist mainly as an insoluble crystalline matrix of parallel glucan chains in plant tissues. Hemicellulose is usually hydrogen - bonded to cellulose and other hemicelluloses, which helps to stabilize the cell wall matrix.
[0073] Coding sequence: The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of a coding sequence are generally determined by an open reading frame that starts with a start codon (such as ATG, GTG, or TTG) and ends with a stop codon (such as TAA, TAG, or TGA). A coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.
[0074] Control sequence: The term "control sequence" means the nucleic acid sequences necessary to express a polynucleotide encoding the mature polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide, or native or foreign to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. The control sequence at least includes a promoter and transcription and translation termination signals. To introduce specific restriction sites facilitating the ligation of the control sequence to the coding region of the polynucleotide encoding the polypeptide, linkers can be provided to the control sequence.
[0075] Crop grain: The term "crop grain" includes grains from, for example, maize (corn), rice, barley, sorghum, soybean, hulls, and wheat. Maize grains are exemplary. A variety of maize grains are known, including, for example, dent maize, flint maize, pod corn, striped maize, sweet corn, waxy corn, etc. In an embodiment, the maize grain is a yellow dent maize grain. The yellow dent maize grain has an outer covering called the "Pericarp" that protects the germ in the grain. It is waterproof and water vapor-proof and is unfavorable to insects and microorganisms. The only area of the grain not covered by the "Pericarp" is the "Tip Cap", which is the attachment point of the grain to the ear axis.
[0076] Dry solids: The term "dry solids" is the total solids (in percentage) of the slurry on a dry weight basis.
[0077] Endoglucanase: The term "endoglucanase" means a 4-(1,3;1,4)-β-D-glucan 4-glucanohydrolase (E.C. 3.2.1.4) that catalyzes the endohydrolysis of 1,4-β-D-glycosidic bonds in cellulose, cellulose derivatives such as carboxymethyl cellulose and hydroxyethyl cellulose, lichenin, and mixed β-1,3-1,4 glucans such as cereal β-D-glucan or xyloglucan, and β-1,4 bonds in other plant materials containing a cellulose component. Endoglucanase activity can be determined by measuring the decrease in substrate viscosity or by the increase in reducing ends determined by reducing sugar assays (Zhang et al., 2006, Biotechnology Advances 24:452 - 481). Endoglucanase activity can also be assayed using carboxymethyl cellulose (CMC) as a substrate at pH 5 and 40 °C according to the procedure of Ghose, 1987, Pure and Appl. Chem. 59:257 - 268.
[0078] Protease: The term "proteolytic enzyme" or "protease" means one or more (e.g., several) enzymes that break down the amide bonds of proteins by hydrolyzing the peptide bonds that link amino acids together in a polypeptide chain. Proteases can include, for example, metalloproteases, trypsin-like serine proteases, subtilisin-like serine proteases, and aspartic proteases.
[0079] Expression: The term "expression" includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0080] Expression vector: The term "expression vector" means a linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
[0081] Fragment: The term "fragment" means a polypeptide in which one or more (e.g., several) amino acids are deleted from the amino and / or carboxyl terminus of the mature polypeptide; wherein the fragment has enzymatic activity. In one aspect, the fragment comprises at least 85%, such as at least 90% or at least 95%, of the amino acid residues of the mature polypeptide of the enzyme.
[0082] Germ: The "germ" is the only living part of a corn kernel. It contains the genetic information, enzymes, vitamins, and minerals necessary for the kernel to grow into a corn plant. In yellow dent corn, approximately 25% of the germ is corn oil. The endosperm, which covers or surrounds the germ, constitutes approximately 82% of the dry weight of the kernel and is the source of energy (starch) and protein for seed germination. There are two types of endosperm, soft endosperm and hard endosperm. In hard endosperm, the starch is tightly packed together. In soft endosperm, the starch is loose.
[0083] Milling (grind or grinding): The term "milling" means any method of breaking the pericarp and opening the crop kernel.
[0084] Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is different from the parent cell due to mutations that occur during replication.
[0085] Isolated: The term "isolated" means a substance in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any substance that does not occur in nature, (2) any substance, including but not limited to any enzyme, variant, nucleic acid, protein, peptide, or cofactor, that has been removed at least in part from one or more or all of the naturally occurring components with which it is associated in nature; (3) any substance that has been artificially modified relative to a substance found in nature; or (4) any substance that has been modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of the gene encoding the substance; and use of a promoter stronger than the promoter naturally associated with the gene encoding the substance).
[0086] Ground: The term "ground" means that the plant material has been broken down into smaller particles, for example, by crushing, sizing, milling, grinding, etc.
[0087] Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form after translation and any post-translational modifications such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc.
[0088] In one aspect, the mature polypeptide of SEQ ID NO:1 consists of amino acids 27 to 332, and amino acids 1 to 26 of SEQ ID NO:1 are the signal peptide.
[0089] In one aspect, the mature polypeptide of SEQ ID NO:3 consists of amino acids 27 to 332, and amino acids 1 to 26 of SEQ ID NO:3 are the signal peptide.
[0090] In one aspect, the mature polypeptide of SEQ ID NO:4 consists of amino acids 20 to 319, and amino acids 1 to 19 of SEQ ID NO:4 are the signal peptide.
[0091] In one aspect, the mature polypeptide of SEQ ID NO:6 consists of amino acids 27 to 417, and amino acids 1 to 26 of SEQ ID NO:6 are the signal peptide.
[0092] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature polypeptide.
[0093] In one aspect, the mature polypeptide coding sequence of GH62 arabinofuranosidase is nucleotides 79 to 996 of SEQ ID NO:2 or its cDNA sequence.
[0094] In another aspect, the mature polypeptide coding sequence of the GH10 xylanase is nucleotides 58 to 244, 301 to 341, 401 to 449, 511 to 632, 685 to 830, 884 to 972, 1029 to 1052, 1129 to 1217, 1280 to 1345, 1406 to 1492 of SEQ ID NO:5 or its cDNA sequence.
[0095] Nucleic acid construct: The term "nucleic acid construct" means a single-stranded or double-stranded nucleic acid molecule isolated from a naturally occurring gene or otherwise modified in a manner that does not exist or is synthesized in nature to contain a segment of nucleic acid, which contains one or more control sequences.
[0096] Oligosaccharide: The term "oligosaccharide" is a compound having 2 to 10 monosaccharide units.
[0097] Operably linked: The term "operably linked" means a structure in which a control sequence is positioned relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.
[0098] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".
[0099] For the purposes of the present invention, the degree of sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (preferably version 3.0.0 or later). Version 6.1.0 is used. The optional parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The Needle output labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
[0100] (Identical residues X 100) / (Alignment length - Total number of gaps in the alignment)
[0101] For the purposes of the present invention, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (preferably version 3.0.0 or later). Version 6.1.0 is used. The optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The Needle output labeled "longest identity" (obtained using the -non -simplified option) is used as the percent identity and is calculated as follows:
[0102] (Number of identical deoxyribonucleotides X 100) / (Alignment length - Total number of gaps in the alignment)
[0103] Starch: The term "starch" means any material composed of complex polysaccharides of plants, composed of glucose units in the form of storage granules widely present in plant tissues, composed of amylose and amylopectin, and represented as (C6H10O5)n, where n is any number.
[0104] Steep or steeping: The term "steep" or "steeping" means soaking crop grains with water and optionally SO 2 Soaking crop grains.
[0105] Subsequence: The term "subsequence" means a polynucleotide that is missing one or more (e.g., several) nucleotides from the 5' end and / or 3' end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having arabinofuranosidase or xylanase activity.
[0106] Substantially pure polypeptide: The term "substantially pure polypeptide" means a preparation containing at most 10%, at most 8%, at most 6%, at most 5%, at most 4%, at most 3%, at most 2%, at most 1% and at most 0.5% (by weight) of other polypeptide materials related to it naturally or recombinantly. Preferably, the polypeptide is at least 92% pure of the total polypeptide material present in the preparation, such as at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99%, at least 99.5% pure and 100% pure (by weight). The polypeptides of the present invention are preferably in substantially pure form. This can be achieved, for example, by preparing the polypeptide by well-known recombinant methods or by classical purification methods.
[0107] Variant: The term "variant" means a polypeptide having xylanase or arabinofuranosidase activity that contains alterations (i.e., substitutions, insertions, and / or deletions of one or more amino acid residues) at one or more positions. Substitution means replacing the amino acid occupying the position with a different amino acid; deletion means removing the amino acid occupying the position; and insertion means adding 1 - 3 amino acids adjacent to the amino acid occupying the position.
[0108] Wet milling benefits: The term "wet milling benefits" means one or more of improved starch yield and / or purity, improved gluten quality and / or yield, improved fiber, gluten, or steep water filtration, dehydration, and evaporation, easier separation of germ and / or better post - saccharification filtration, and process energy savings.
[0109] Xylan - degrading activity or xylan - hydrolyzing activity: The term "xylan - degrading activity" or "xylan - hydrolyzing activity" means the biological activity of hydrolyzing xylan - containing materials. Two basic methods for measuring xylan - hydrolyzing activity include: (1) measuring total xylan - hydrolyzing activity, and (2) measuring individual xylan - hydrolyzing activities (e.g., endo - xylanase, β - xylosidase, arabinofuranosidase, α - glucuronidase, acetylxylan esterase, ferulic acid esterase, and α - glucuronate esterase). Recent advances in the determination of xylan - hydrolases are summarized in several publications, including Biely and Puchard, 2006, Journal of the Science of Food and Agriculture 86(11):1636 - 1647; Spanikova and Biely, 2006, FEBS Letters 580(19):4597 - 4601; Herrmann et al., 1997, Biochemical Journal 321:375 - 381.
[0110] Total xylanolytic activity can be measured by determining the reducing sugars formed from different types of xylans, including, for example, oat spelt xylan, beechwood xylan, and larchwood xylan, or by photometrically determining the xylan fragments released from differently covalently stained xylans. A common assay for total xylanolytic activity is based on the production of reducing sugars from polymeric 4-O-methylglucuronoxylan, as described in Bailey et al., 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology 23(3):257-270. Xylanase activity can also be assayed at 37 °C in 0.01% X-100 and 200 mM sodium phosphate (pH 6) using 0.2% AZCL-arabinoxylan as substrate. One unit of xylanase activity is defined as the production of 1.0 μmole of azoaniline per minute from 0.2% AZCL-arabinoxylan as substrate in 200 mM sodium phosphate (pH 6) at 37 °C, pH 6.
[0111] Xylanolytic activity can be assayed by measuring the increase in hydrolysis of birchwood xylan (Sigma Chemical Co., Inc., St. Louis, MO, USA) by one or more xylan-degrading enzymes under the following typical conditions: 1 ml reaction, 5 mg / ml substrate (total solids), 5 mg xylan-hydrolyzing protein / g substrate, 50 mM sodium acetate (pH 5), 50 °C, 24 h, and sugar analysis using p-hydroxybenzoic acid hydrazide (PHBAH) assay as described in Lever, 1972, Anal. Biochem. 47:273-279.
[0112] Crude oil: The term "crude oil" (also known as non-degummed oil) refers to pressed or extracted oil or mixtures thereof. In this context, it is understood that the oil is palm oil, particularly unrefined palm oil. In particular, the term "crude oil" refers to the effluent from the screw press of a palm oil mill; that is, it refers to the mixture of oil and water pressed out of the paste of palm fruits before clarification and separation of the oil from the water. Crude palm oil is also named CPO. Crude palm oil contains water.
[0113] Digestion: The term "digestion" refers to a method in which a substrate containing palm oil is maintained at a temperature in the range of 65 - 85 °C to break down the substrate and release palm oil from the mesocarp. Digestion can be carried out in a digester and / or a pre-cooker equipped with baffles. During digestion, the substrate containing palm oil, such as palm fruits, is broken down and the oil is released from the mesocarp. According to the present invention, the substrate containing palm oil can be contacted with an enzyme composition before or during digestion.
[0114] Oil Extraction Rate (OER): "Oil Extraction Rate (OER)" can be defined as in Chang et al., oil palm Industry economic journal, volume 3, 2003 [9]. Chang et al. defined the oil extraction rate as the ratio of the recovered oil and the Fresh Fruit Branch (FFB) multiplied by 100, and the mathematical formula is:
[0115] OER = (weight of recovered oil / weight of treated FFB) × 100
[0116] Palm Oil Mill Effluent (POME): Palm Oil Mill Effluent (POME) is wastewater discharged, for example, from the sterilization process and the crude oil clarification process.
[0117] Palm Pressing Liquid: The term "palm pressing liquid" refers to the liquid discharged from pressing a substrate containing palm oil. The palm pressing liquid is not crude palm oil, and water has not been separated from the palm pressing liquid.
[0118] Nomenclature
[0119] For the purposes of the present invention, the nomenclature [Y / F] means that the amino acid at that position can be tyrosine (Try, Y) or phenylalanine (Phe, F). Similarly, for other combinations described herein, the nomenclature [V / G / A / I] means that the amino acid at that position can be valine (Val, V), glycine (Gly, G), alanine (Ala, A) or isoleucine (Ile, I), etc. Unless otherwise further restricted, the amino acid X is defined such that it can be any one of the 20 natural amino acids. Detailed Description of the Invention
[0120] Grinding Method
[0121] The object of the present invention is to provide an improved method for processing crop grains to provide high-quality starch.
[0122] In one embodiment, the enzyme composition for the method of the present invention provides the following benefits, including improved starch yield and / or purity, improved gluten quality and / or yield, improved filtration, dehydration, and evaporation of fiber, gluten, or steep water, easier separation of germ and / or better filtration after saccharification, and energy savings in the process.
[0123] Furthermore, unexpectedly, the inventors have found that due to the better separation of both the starch and protein fractions from the fiber fraction, the enzymes useful according to the present invention provide a reduction in fiber quality and a decrease in the protein content of the fiber. Separating starch and gluten from fiber is valuable to the industry because fiber is the lowest value product in the wet milling process, and higher purity starch and protein are desired.
[0124] Unexpectedly, the inventors have found that replacing some of the protease activity in the enzyme composition can provide improvements relative to other compositions that are otherwise similar but primarily contain only protease activity. This can provide benefits to the industry, for example, based on cost and ease of use.
[0125] Grind the kernels to open the structure and allow further processing and separate the kernels into four main components: starch, germ, fiber, and protein.
[0126] In one embodiment, a wet milling method is used. Wet milling separates the germ well from the grits (starch granules and protein) and is often applied in facilities that produce syrup in parallel.
[0127] The inventors of the present invention have unexpectedly found that the quality of the starch end product can be improved by processing crop kernels in the method as described herein.
[0128] The method of the present invention produces a higher quality starch compared to traditional methods because the starch end product is purer and / or a higher yield is obtained and / or less processing time is used. Another advantage can be that the amount of chemicals (such as SO2 and NaHSO3) that need to be used can be reduced or even completely eliminated.
[0129] Wet grinding
[0130] Starch is formed within plant cells as tiny, water-insoluble granules. When placed in cold water, these starch granules can absorb a small amount of liquid and swell. At temperatures up to about 50°C to 75°C, the swelling can be reversible. However, at higher temperatures, irreversible swelling begins, which is called "gelatinization". The granular starch to be processed according to the present invention can be a material containing crude starch, which includes (for example, ground) whole grains, and these whole grains include non-starch fractions such as germ residues and fibers. The particle size of the raw material (such as whole grains) can be reduced, for example, by wet milling, in order to open the structure and allow further processing. Wet milling separates the germ well from the grits (starch granules and proteins) and is often applied at sites where starch hydrolyzates are used, for example, in the production of syrups.
[0131] In one embodiment, the particle size is reduced to between 0.05 - 3.0 mm, preferably 0.1 - 0.5 mm, or such that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the starch-containing material is suitable to pass through a sieve with a 0.05 - 3.0 mm mesh, preferably a 0.1 - 0.5 mm mesh.
[0132] More particularly, the degradation of corn kernels and other crop kernels into starches suitable for converting into monosaccharides and oligosaccharides, ethanol, sweeteners, etc. generally consists of four steps:
[0133] 1. Impregnation and germ separation,
[0134] 2. Fiber washing and drying,
[0135] 3. Starch gluten separation, and
[0136] 4. Starch washing.
[0137] 1. Impregnation and germ separation
[0138] The corn kernels are softened by soaking them in water at a temperature of about 50 °C (e.g., between about 45 °C and 60 °C) for between about 30 minutes and about 48 hours (preferably 30 minutes to about 15 hours, e.g., about 1 hour to about 6 hours). During the steeping process, the kernels absorb water, thereby increasing their moisture content from 15% to 45% and more than doubling in size. Optionally, 0.1% sulfur dioxide (SO2) and / or NaHSO3, for example, are added to the water to prevent excessive bacterial growth in the warm environment. As the corn swells and softens, the mild acidity of the steep water begins to loosen the gluten bonds within the corn and release the starch. After the corn kernels are steeped, they split open to release the germ. The germ package contains valuable corn oil. The germ is separated from the heavier density mixture of starch, hulls, and fiber essentially by "floating" the germ segments free of other substances under closely controlled conditions. This method is used to eliminate any adverse effects of trace amounts of corn oil in subsequent processing steps.
[0139] In an embodiment of the present invention, the kernels are soaked in water for 2 - 10 hours, preferably about 3 - 5 hours, at a temperature ranging between 40 °C and 60 °C, preferably about 50 °C.
[0140] In one embodiment, 0.01% - 1%, preferably 0.05% - 0.3%, especially 0.1% SO 2 and / or NaHSO 3 .
[0141] 2. Fiber washing and drying
[0142] To obtain maximum starch recovery and keep any fiber in the end product to an absolute minimum, free starch must be washed from the fiber during processing. The fiber is collected, pulped, and screened to recover any residual starch or protein.
[0143] 3. Starch gluten separation
[0144] The starch - gluten suspension (referred to as mill starch) from the fiber washing step is separated into starch and gluten. Gluten has a lower density compared to starch. The gluten is easily spun out by passing the mill starch through a centrifuge.
[0145] 4. Starch washing
[0146] The starch slurry from the starch separation step contains some insoluble proteins and many solubles, which must be removed before top-quality starch (high-purity starch) can be produced. In a hydrocyclone, the starch with only 1% or 2% protein remaining is diluted, washed 8 to 14 times, re-diluted and washed again to remove the last traces of protein and produce high-quality starch, typically with a purity greater than 99.5%.
[0147] Product
[0148] Wet milling can be used to produce (but is not limited to) corn steep liquor, corn gluten feed, germ, corn oil, corn gluten meal, corn starch, modified corn starch, syrups (such as corn syrup), and corn ethanol.
[0149] Palm oil extraction
[0150] The present invention also provides a method for the enzyme-assisted extraction of crude palm oil from a substrate containing palm oil. The substrate containing palm oil can be selected from the group consisting of: palm fruits, pressed palm fruit juice, mashed or partially mashed palm fruits. The inventors have found that by using GH10 xylanase on a substrate containing palm oil, the oil extraction rate (OER) can be increased.
[0151] The present invention relates to a method for the extraction or separation of crude palm oil (CPO), comprising the steps of:
[0152] i) contacting a substrate containing palm oil with an enzyme composition,
[0153] ii) extracting or separating the crude palm oil;
[0154] wherein the enzyme composition comprises GH10 xylanase and GH62 arabinofuranosidase.
[0155] In one embodiment of the present invention, the substrate containing palm oil is palm fruit, which contains oil in the mesocarp of the fruit. The palm fruit is contacted with the enzyme composition. In one embodiment, the substrate is palm fruit, which is mashed or partially mashed and contacted with the enzyme composition. This increases the availability of the mesocarp cells and thus enhances the enzymatic activity on the mesocarp cells. In one embodiment, the substrate containing palm oil is crude palm oil, which is contacted with the enzyme composition. In various aspects and embodiments of the present invention, the substrate containing palm oil can be a substrate that also contains fibers, particularly fibers from the mesocarp of palm fruit.
[0156] In one embodiment of the present invention, the substrate containing palm oil is sterilized before contacting with the enzyme composition. Palm fruits grow in large bunches and need to be stripped from the bunch stalks before contacting with the enzyme composition. Steam sterilization of fresh fruit bunches facilitates the stripping of fruits from the bunch to produce palm nuts. The sterilization step has several advantages. One is that it softens the mesocarp of the fruits for subsequent digestion. Another advantage is that if the palm fruits are stripped from the bunch stalks, the quality of the final palm oil product will be better.
[0157] The sterilization can be batch sterilization or continuous sterilization. The sterilization process can be carried out at a temperature of 100°C - 150°C. In one embodiment of the present invention, the pressure is reduced during the sterilization process.
[0158] After sterilization, the palm nuts are stripped from the stalks. The stripping or threshing can be carried out in a mechanized system having a rotating drum or a fixed drum equipped with a rotary beater bar that separates the fruits from the bunch and leaves the spikelets on the stalk. The stripped palm nuts can be contacted with the enzyme composition according to the present invention.
[0159] In one embodiment of the present invention, the substrate containing palm oil is digested before extracting the crude palm oil. The stripped palm nuts can be transported to a digester by one or more means of transportation (such as a conveyor belt). In the digester, the nuts are further heated to loosen the pericarp. The digester is typically a steam-heated vessel having a rotating shaft attached with stirring arms or equipped with baffles. The nuts are rotated, causing the pericarp to loosen from the nut and the mesocarp to degrade. The digestion is a continuous process where the digester remains full and fresh-stripped fruits are brought in when the digested fruits are withdrawn.
[0160] In one embodiment of the present invention, the first part of the digestion is carried out in a pre-cooker. The substrate can be maintained at a temperature in the range of 65 - 85°C for a period of time and then transferred to a digestion tank. A polypeptide having GH62 arabinofuranosidase activity
[0161] Preferred embodiments of aspects of the present invention relating to GH62 polypeptides having arabinofuranosidase activity are disclosed hereinafter.
[0162] In an embodiment, the polypeptide of the present invention having GH62 arabinofuranosidase activity is selected from the group consisting of:
[0163] a) a polypeptide having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the mature polypeptide of SEQ ID NO:1;
[0164] b) Variants of the mature polypeptide of SEQ ID NO:1, which comprise substitutions, deletions and / or insertions at one or more positions;
[0165] c) A polypeptide encoded by a polynucleotide having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:2 or its cDNA sequence.
[0166] In an embodiment, the polypeptide having GH62 arabinofuranosidase activity of the present invention is selected from the group consisting of:
[0167] a) A polypeptide having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO:3; and
[0168] b) Variants of the mature polypeptide of SEQ ID NO:3, which comprise substitutions, deletions and / or insertions at one or more positions.
[0169] In one aspect, the polypeptide differs from the mature polypeptide by at most 10 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In another embodiment, the present invention relates to variants of the mature polypeptide, which comprise substitutions, deletions and / or insertions at one or more (e.g., several) positions. In an embodiment, the number of amino acids substituted, deleted and / or inserted into the mature polypeptide is at most 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. The amino acid changes can be of a minor nature, i.e., conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; small deletions, typically 1 - 30 amino acids; small amino or carboxyl terminal extensions, such as an amino terminal methionine residue; small linker peptides of up to 20 - 25 residues; or small extensions that facilitate purification by altering the net charge or another function.
[0170] The polypeptide having arabinofuranosidase activity can be obtained from microorganisms of any genus. For the purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the polypeptide encoded by the polynucleotide is produced by the source or a strain into which the polynucleotide from the source has been inserted. In one aspect, the polypeptide obtained from a given source is secreted extracellularly.
[0171] The polypeptide can be a fungal polypeptide. In one embodiment, the polypeptide is from a fungus of the order Eurotiales, or from the family Aspergillaceae, or from a strain of the genus Aspergillus, or from Aspergillus clavatus or Aspergillus wentii or a species of Aspergillus niger.
[0172] In one embodiment, the GH62 arabinofuranosidase is derived from a strain of the genus Aspergillus, such as a strain of Aspergillus niger.
[0173] In one embodiment, the polypeptide is from a fungus of the order Eurotiales, or from the family Aspergillaceae, or from the genus Neosartorya or from the species Neosartorya fischeri.
[0174] In one embodiment, the polypeptide is from a fungus of the order Eurotiales, or from the family Trichocomaceae, or from the genus Talaromyces or from the species Talaromyces pinophilus.
[0175] The polypeptide can be a bacterial polypeptide. In one embodiment, the polypeptide is from a bacterium of the order Actinomycetales, or from the family Streptomycetaceae, or from the genus Streptomyces or from Streptomyces nitrosporeus or the species Streptomyces beijiangensis.
[0176] In one embodiment, the polypeptide is from a bacterium of the order Actinomycetales, or from the family Streptosporangiaceae, or from the genus Streptosporangium or from the species Streptosporangium sp-60756.
[0177] It should be understood that for the above species, the present invention encompasses the perfect and imperfect stages, as well as other taxonomic equivalents, such as anamorphs, regardless of their known species names. Those skilled in the art will readily recognize the identity of the appropriate equivalents.
[0178] Strains of these species are readily available to the public at many culture collections, such as the American Type Culture Collection (ATCC), the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), the Centraalbureau Voor Schimmelcultures (CBS), and the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).
[0179] Polypeptides can be identified and obtained from other sources, including microorganisms isolated from nature (such as soil, compost, water, etc.) or DNA samples obtained directly from natural materials (such as soil, compost, water, etc.) using the above probes. Techniques for directly isolating microorganisms and DNA from natural habitats are well known in the art. The polynucleotides encoding the polypeptides can then be obtained by similarly screening the genomic DNA or cDNA libraries of another microorganism or a mixed DNA sample. Once the polynucleotides encoding the polypeptides are detected with one or more probes, the polynucleotides can be isolated or cloned using techniques known to those of ordinary skill in the art (see, for example, Sambrook et al., 1989, supra).
[0180] Polypeptides having GH10 xylanase activity
[0181] Exemplary embodiments relating to GH10 polypeptides having xylanase activity are disclosed hereinafter.
[0182] In an embodiment, the polypeptides having GH10 xylanase activity are selected from the group consisting of:
[0183] a) polypeptides having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO:4;
[0184] b) variants of the mature polypeptide of SEQ ID NO:4, which contain substitutions, deletions and / or insertions at one or more (several) positions;
[0185] c) a polypeptide encoded by a polynucleotide having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:5 or its cDNA sequence.
[0186] In one aspect, the polypeptide differs from the mature polypeptide by at most 10 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids. In another embodiment, the present invention relates to variants of the mature polypeptide, which comprise substitutions, deletions and / or insertions at one or more (e.g., several) positions. In an embodiment, the number of amino acids substituted, deleted and / or inserted into the mature polypeptide is at most 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. Amino acid changes can be of a minor nature, i.e., conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; small deletions, typically 1 - 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; small linker peptides of up to 20 - 25 residues; or small extensions that facilitate purification by altering the net charge or another function.
[0187] The polypeptide with xylanase activity of the present invention (GH10 xylanase) can be obtained from microorganisms of any genus. For the purposes of the present invention, the term "obtained from" in relation to a given source as used herein shall mean that the polypeptide encoded by the polynucleotide is produced by the source or a strain into which the polynucleotide from the source has been inserted. In one aspect, the polypeptide obtained from a given source is secreted extracellularly.
[0188] The polypeptide can be a Talaromyces polypeptide.
[0189] In another embodiment, the polypeptide is a Talaromyces leycettanus polypeptide, such as the polypeptide obtained from the Talaromyces leycettanus strain CBS398.68.
[0190] The polypeptide can be an Aspergillus polypeptide. In another embodiment, the polypeptide is an Aspergillus niger polypeptide.
[0191] In one embodiment, the GH10 xylanase is derived from a strain of the genus Aspergillus, such as a strain of Aspergillus niger.
[0192] It should be understood that for the above species, the present invention encompasses the perfect and imperfect stages, as well as other taxonomic equivalents, such as anamorphs, regardless of their known species names. Those skilled in the art will readily recognize the identity of the appropriate equivalents.
[0193] Strains of these species are readily available to the public at a number of culture collections, such as the American Type Culture Collection (ATCC), the German Collection of Microorganisms and Cell Cultures (DSMZ), the Centraalbureau voor Schimmelcultures (CBS), and the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).
[0194] Polypeptides can be identified and obtained from other sources, including microorganisms isolated from nature (e.g., soil, compost, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, compost, water, etc.) using the above-described probes. Techniques for directly isolating microorganisms and DNA from natural habitats are well known in the art. The polynucleotide encoding the polypeptide can then be obtained by similarly screening the genomic DNA or cDNA library of another microorganism or a mixed DNA sample. Once the polynucleotide encoding the polypeptide is detected with one or more probes, the polynucleotide can be isolated or cloned using techniques known to those of ordinary skill in the art (see, e.g., Sambrook et al., 1989, supra).
[0195] A polypeptide having GH30 xylanase activity
[0196] A GH30 polypeptide refers to a polypeptide having enzymatic activity that is classified as a member of glycoside hydrolase family 30 in the Carbohydrate-Active Enzymes (CAZymes) database (http: / / www.cazy.org / ).
[0197] In an embodiment, the polypeptide having GH30 xylanase activity is selected from the group consisting of:
[0198] a) a polypeptide having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ ID NO:6;
[0199] b) a variant of the mature polypeptide of SEQ ID NO:6 that contains substitutions, deletions and / or insertions at one or more (several) positions.
[0200] In one aspect, the polypeptide differs from the mature polypeptide by at most 10 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In another embodiment, the invention relates to variants of the mature polypeptide that contain substitutions, deletions, and / or insertions at one or more (such as several) positions. In an embodiment, the number of amino acids substituted, deleted, and / or inserted into the mature polypeptide is at most 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Amino acid changes can be of a minor nature, i.e., conservative amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; small deletions, typically 1-30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; small linker peptides of up to 20-25 residues; or small extensions that facilitate purification by altering the net charge or another function.
[0201] The polypeptide having xylanase activity of the present invention (GH30 xylanase) can be obtained from microorganisms of any genus. For the purposes of the present invention, the term "obtained from" in relation to a given source as used herein shall mean that the polypeptide encoded by the polynucleotide is produced by the source or a strain into which the polynucleotide from the source has been inserted. In one aspect, the polypeptide obtained from a given source is secreted extracellularly.
[0202] In one embodiment, the polypeptide having GH30 xylanase activity is derived from a strain of the genus Bacillus, such as a strain of Bacillus subtilis.
[0203] The polypeptide can be a bacterial polypeptide. In one embodiment, the polypeptide can be a Bacillus polypeptide. In another embodiment, the polypeptide is a Bacillus subtilis polypeptide.
[0204] It should be understood that for the above species, the present invention encompasses perfect and imperfect stages, as well as other taxonomic equivalents, such as anamorphs, regardless of their known species names. Those skilled in the art will readily recognize the identity of appropriate equivalents.
[0205] Strains of these species are readily available to the public at many culture collection centers, such as the American Type Culture Collection (ATCC), the German Collection of Microorganisms and Cell Cultures (DSMZ), the Centraalbureau voor Schimmelcultures (CBS), and the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).
[0206] Polypeptides can be identified and obtained from other sources, including microorganisms isolated from nature (e.g., soil, compost, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, compost, water, etc.) using the above probes. Techniques for directly isolating microorganisms and DNA from natural habitats are well known in the art. Polynucleotides encoding the polypeptides can then be obtained by similarly screening genomic DNA or cDNA libraries of another microorganism or a mixed DNA sample. Once the polynucleotides encoding the polypeptides are detected with one or more probes, the polynucleotides can be isolated or cloned using techniques known to those of ordinary skill in the art (see, e.g., Sambrook et al., 1989, supra).
[0207] Cellulose hydrolysis composition
[0208] Exemplary cellulose hydrolysis compositions are described, for example, in WO 2015 / 081139 and PCT / US2015 / 034179.
[0209] In embodiments, the cellulose hydrolysis composition is derived from a strain of Trichoderma, such as a strain of Trichoderma reesei; a strain of Humicola, such as a strain of Humicola insolens, and / or a strain of Chrysosporium, such as a strain of Chrysosporium lucknowense.
[0210] In a preferred embodiment, the cellulose hydrolysis composition is derived from a strain of Trichoderma reesei.
[0211] In a preferred embodiment, the cellulose hydrolysis composition is a Trichoderma reesei cellulase preparation.
[0212] In embodiments, the cellulose hydrolysis composition comprises a Trichoderma reesei cellulase preparation containing an Aspergillus oryzae β-glucosidase fusion protein (WO 2008 / 057637) and a Thermoascus aurantiacus GH61A polypeptide (WO 2005 / 074656).
[0213] In embodiments, the cellulose hydrolysis composition comprises a Trichoderma reesei cellulolytic enzyme composition further comprising a Thermoascus aurantiacus GH61A polypeptide (WO 2005 / 074656) and an Aspergillus oryzae β-glucosidase fusion protein (WO 2008 / 057637) having enhanced cellulose hydrolysis activity.
[0214] In another embodiment, the cellulolytic composition comprises a Trichoderma reesei cellulolytic enzyme composition, further comprising an Aspergillus phoenicis GH61A polypeptide (SEQ ID NO: 2 in WO 2005 / 074656) having enhanced cellulolytic activity and an Aspergillus fumigatus β-glucosidase (SEQ ID NO: 2 of WO 2005 / 047499).
[0215] In another embodiment, the cellulolytic composition comprises a Trichoderma reesei cellulolytic enzyme composition, further comprising a Penicillium emersonii GH61A polypeptide having enhanced cellulolytic activity as disclosed in WO 2011 / 041397, an Aspergillus fumigatus β-glucosidase (SEQ ID NO: 2 of WO 2005 / 047499) or a variant thereof having the following substitutions: F100D, S283G, N456E, F512Y.
[0216] In an embodiment, the cellulolytic composition is derived from Trichoderma reesei RutC30.
[0217] In an embodiment, the cellulolytic composition comprises a Trichoderma reesei cellulase preparation comprising Trichophaea saccata GH10 xylanase (WO 2011 / 057083) and Talaromyces emersonii β-xylosidase.
[0218] Enzyme composition
[0219] The present invention also provides an enzyme composition composed of GH62 arabinofuranosidase, GH10 xylanase, and / or GH30 xylanase.
[0220] In an embodiment, the enzyme composition of the present invention further comprises one or more hydrolases, preferably one or more cellulolytic enzymes, preferably, the one or more cellulolytic enzymes are expressed in an organism such as Trichoderma reesei.
[0221] In an embodiment, the enzyme composition of the present invention further comprises a cellulolytic composition.
[0222] Preferably, the composition is enriched in useful polypeptides according to the present invention. The term "enriched" indicates that the enzyme activity of the composition has been increased, for example, having an enrichment factor of at least 1.1, such as at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 2.0, at least 3.0, at least 4.0, at least 5.0, at least 10. In an embodiment, the composition comprises a polypeptide of the first aspect of the present invention and one or more formulations as described in the "Formulations" subsection below.
[0223] The composition may comprise the polypeptide of the present invention as the main enzyme component, such as a single-component composition. Such compositions may further comprise a formulation as described in the "Formulation" subsection below. Alternatively, the composition may comprise multiple enzyme activities, such as one or more (e.g., several) enzymes selected from the group consisting of: phytase, xylanase, galactase, α-galactosidase, protease, phospholipase, glucoronidase, lysophospholipase, amylase, β-glucanase, arabinofuranosidase, β-xylosidase, endo-1,4-β-xylanase acetylxylan esterase, ferulic acid esterase, cellulase, cellobiohydrolase, β-glycosidase, pullulanase or any mixture thereof. As further outlined below, additional cellulolytic activities are particularly contemplated.
[0224] In the case of considering arabinofuranosidase and xylanase activities, xylanase is currently contemplated to be used in one or more of the following amounts (dose ranges): 0.01 - 200; 0.05 - 100; 0.1 - 50; 0.2 - 20; 0.1 - 1; 0.2 - 2; 0.5 - 5; or 1 - 10, where all these ranges are mg of xylanase protein per kg of substrate (ppm). Arabinofuranosidase is currently contemplated to be applied in one or more of the following amounts (dose ranges): 0.01 - 200; 0.05 - 100; 0.1 - 50; 0.2 - 20; 0.1 - 1; 0.2 - 2; 0.5 - 5; or 1 - 10, where all these ranges are mg of arabinofuranosidase protein per kg of substrate (ppm). A further consideration is that the ratio of GH10 xylanase to GH62 arabinofuranosidase is in the range of 100:1 to 1:100 xylanase:arabinofuranosidase, such as the range 50:1 to 1:50, 50:1 to 1:10, 25:1 to 1:5, 10:1 to 1:2 or for example 10:1 to 1:50, 5:1 to 1:25, 2:1 to 1:10 xylanase:arabinofuranosidase.
[0225] Formulation
[0226] The enzymes of the present invention can be formulated into liquids or solids. For liquid formulations, the formulation may comprise polyols (such as, for example, glycerol, ethylene glycol or propylene glycol), salts (such as, for example, sodium chloride, sodium benzoate, potassium sorbate) or sugars or sugar derivatives (such as, for example, dextrin, glucose, sucrose and sorbitol). Thus, in one embodiment, the composition is a liquid composition comprising the polypeptide of the present invention and one or more formulations selected from the list consisting of: glycerol, ethylene glycol, 1,2 - propylene glycol, 1,3 - propylene glycol, sodium chloride, sodium benzoate, potassium sorbate, dextrin, glucose, sucrose and sorbitol.
[0227] For solid dosage forms, the formulation can be, for example, granules, spray-dried powders or agglomerates. The formulation can contain salts (organic or inorganic zinc, sodium, potassium or calcium salts such as calcium acetate, calcium benzoate, calcium carbonate, calcium chloride, calcium citrate, calcium sorbate, calcium sulfate, potassium acetate, potassium benzoate, potassium carbonate, potassium chloride, potassium citrate, potassium sorbate, potassium sulfate, sodium acetate, sodium benzoate, sodium carbonate, sodium chloride, sodium citrate, sodium sorbate, sodium sulfate, zinc acetate, zinc benzoate, zinc carbonate, zinc chloride, zinc citrate, zinc sorbate, zinc sulfate), starch or sugars or sugar derivatives (such as, for example, sucrose, dextrin, glucose, lactose, sorbitol).
[0228] In an embodiment, the solid composition is in the form of granules. The granules can have a matrix structure in which the components are uniformly mixed. However, the granules generally comprise a core particle and one or more coating materials, which are generally salt and / or wax coating materials. The core particle can be a homogeneous mixture of the xylanase of the present invention, optionally in combination with one or more additional enzymes, and optionally with one or more salts, or an inert particle having the xylanase of the present invention, optionally in combination with one or more additional enzymes applied thereto.
[0229] In an embodiment, the material of the core particle is selected from the group consisting of: inorganic salts (such as calcium acetate, calcium benzoate, calcium carbonate, calcium chloride, calcium citrate, calcium sorbate, calcium sulfate, potassium acetate, potassium benzoate, potassium carbonate, potassium chloride, potassium citrate, potassium sorbate, potassium sulfate, sodium acetate, sodium benzoate, sodium carbonate, sodium chloride, sodium citrate, sodium sorbate, sodium sulfate, zinc acetate, zinc benzoate, zinc carbonate, zinc chloride, zinc citrate, zinc sorbate, zinc sulfate), starch or sugars or sugar derivatives (such as, for example, sucrose, dextrin, glucose, lactose, sorbitol), sugars or sugar derivatives (such as, for example, sucrose, dextrin, glucose, lactose, sorbitol), small organic molecules, starch, flour, cellulose and minerals.
[0230] The salt coating material is generally at least 1 μm thick and can be a specific salt or a mixture of salts, such as Na 2 SO 4 , K 2 SO 4 , MgSO 4 and / or sodium citrate. Other examples are those described in, for example, WO 2008 / 017659, WO 2006 / 034710, WO1997 / 05245, WO 1998 / 54980, WO 1998 / 55599, WO 2000 / 70034 or the polymer coating materials described in, for example, WO 2001 / 00042.
[0231] Enzyme amount
[0232] In the wet milling process, enzymes can be added in an effective amount, which can be adjusted according to the needs of the practitioner and the specific process. Generally, the enzyme can be present in an amount of 0.0001 - 1 mg enzyme protein / g dry solid (DS) grain, for example, 0.001 - 0.1 mg enzyme protein / g DS grain. In a specific embodiment, the enzyme can be present in the following amounts, for example, 1 μg, 2.5 μg, 5 μg, 10 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 75 μg, 100 μg, 125 μg, 150 μg, 175 μg, 200 μg, 225 μg, 250 μg, 275 μg, 300 μg, 325 μg, 350 μg, 375 μg, 400 μg, 450 μg, 500 μg, 550 μg, 600 μg, 650 μg, 700 μg, 750 μg, 800 μg, 850 μg, 900 μg, 950 μg, 1000 μg enzyme protein / g DS grain.
[0233] In some embodiments of palm oil extraction, the enzyme is dosed in an amount corresponding to 10 - 1000 ppm, for example, 20 - 1000 ppm, 30 - 1000 ppm, 40 - 1000 ppm, 50 - 1000 ppm, 100 - 1000 ppm, 200 - 1000 ppm, 100 - 500 ppm, for example, 200 - 500 ppm, 250 - 400 ppm or 350 - 1000 ppm, relative to the amount of the substrate containing palm oil.
[0234] The present invention is further described by the following examples, which should not be construed as limiting the scope of the present invention. Examples
[0235] Materials and Methods
[0236] Enzyme
[0237] GH62 arabinofuranosidase A: GH62 arabinofuranosidase derived from Aspergillus niger (SEQ ID NO:1).
[0238] GH62 arabinofuranosidase B: GH62 arabinofuranosidase derived from Aspergillus niger (SEQ ID NO:3).
[0239] GH10 xylanase: GH10 xylanase derived from Aspergillus niger (SEQ ID NO:4).
[0240] GH30 xylanase: GH30 xylanase derived from Bacillus subtilis (SEQ ID NO:6).
[0241] Celluclast 1.5L: A commercial product containing cellulase, available from Novozymes A / S.
[0242] Example 1: Cloning and recombinant expression of GH62 arabinofuranosidase from Aspergillus niger
[0243] The arabinofuranosidase-encoding gene having SEQ ID NO:2 was PCR amplified from genomic DNA isolated from an Aspergillus niger strain isolated in Ireland using gene-specific primers which also included the Kozak translation initiation sequence "CACC" immediately 5' of the start codon. The PCR amplification product was cloned into the Aspergillus expression vector pMStr57 (WO 04 / 032648) which had been digested with the restriction enzymes BamHI and XhoI.
[0244] The sequence of the GH62 arabinofuranosidase-encoding gene cloned in the expression vector was confirmed and the expression construct was transformed into an Aspergillus oryzae strain MT3568 by the method described in Christensen et al., 1988, Biotechnology 6, 1419-1422 and WO 04 / 032648. Transformants were selected during regeneration from protoplasts based on the ability to utilize acetamide as a nitrogen source conferred by the selectable marker in the expression vector. Production of the recombinant arabinofuranosidase was evaluated by culturing the transformants in 96-well deep-well microtiter plates in YPG medium (WO 05 / 066338) at 30 °C for 4 days and monitoring arabinofuranosidase expression by SDS-PAGE. The transformant showing the highest expression level in the microtiter plate cultures was selected and re-isolated twice under selection.
[0245] For larger-scale production of the recombinant arabinofuranosidase, the selected transformant was cultured in a 500 ml baffled flask containing 150 ml of DAP-4C-1 medium (WO 12 / 103350). The culture was shaken on a rotary shaker at 150 RPM for 4 days. Subsequently, the culture broth was separated from the cell material through a 0.22 μm filtration unit.
[0246] Example 2: Chromatographic purification of recombinant arabinofuranosidase from Aspergillus niger
[0247] The pH of the filtered sample was adjusted to approximately pH 7.5 and 1.8 M ammonium sulfate was added. The sample was applied to a 5 ml HiTrap on an Explorer TMPhenyl(HS) column. Before loading, the column was equilibrated in 5 column volumes (CV) of 50 mM HEPES + 1.8 M AMS (ammonium sulfate) at pH 7. To remove unbound material, the column was washed with 5 CV of 50 mM HEPES + 1.8 M AMS at pH 7. The target protein was eluted from the column into a 10 ml loop using 50 mM HEPES + 20% isopropanol at pH 7. From the loop, the sample was loaded onto a desalting column (HiPrep TM 26 / 10 Desalting) that had been equilibrated with 3 CV of 50 mM HEPES + 100 mM NaCl at pH 7.0. The target protein was eluted with 50 mM HEPES + 100 mM NaCl at pH 7.0, and relevant fractions were selected based on the chromatogram and pooled. The flow rate was 5 ml / min.
[0248] The GH62 arabinofuranosidase coding sequence and the full-length amino acid sequence of GH62 arabinofuranosidase are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The N-terminal sequence determination was: KCSLPSS, which was determined by N-terminal Edman degradation sequencing.
[0249] Example 3: Extraction of genomic DNA from Aspergillus niger NN053297
[0250] The Aspergillus niger strain NN053297 was isolated from a hot spring soil sample collected in Yunnan Province in 2010.
[0251] The Aspergillus niger strain NN053297 was inoculated on a PDA plate and incubated at 37 °C for 4 days. The mycelia were collected and frozen in liquid nitrogen in a sterile mortar, and ground into a fine powder with a pestle. Then, genomic DNA was extracted using a Biospin Fungus Genomic DNA Extraction Kit (Bioer Technology Co., Ltd., Hangzhou, China) following the manufacturer's instructions.
[0252] Example 4: Cloning of the Aspergillus niger GH10 xylanase gene into an Aspergillus oryzae expression vector
[0253] Based on DNA information from public databases, oligonucleotide primers as shown below were designed to amplify the coding sequence of the Aspergillus niger GH10 xylanase. The GH10 xylanase coding sequence and the full-length amino acid sequence are shown as SEQ ID NO:5 and SEQ ID NO:4. The primers were synthesized by Invitrogen, Beijing, China.
[0254] Primer 1 <![CDATA[ACACAACTGGGGATC CACC atggttcagatcaaggtagctgcac]]> Primer 2 CCCTCTAGATCTCGAGctagagagcatttgcgatagcagtgta
[0255] The lowercase characters of Primer 1 and Primer 2 represent the coding regions of the genes. The bold characters represent the regions homologous to the insertion sites of the Aspergillus oryzae expression vector pCaHj505 as described in WO2013029496. The 4 underlined letters in Primer 1 represent the Kozark sequence that serves as the start of the translation process.
[0256] Genomic DNA was prepared in Example 1. Phusion TM High-Fidelity DNA Polymerase (Phusion TM High-Fidelity DNA Polymerase) (Finnzymes Oy, Espoo, Finland) was used for PCR amplification. The fragment was cloned into the expression vector pCaHj505 using the In-fusion CF Dry-down PCR Cloning Kit (BD Biosciences, Palo Alto, CA, USA). The expression vector pCaHj505 contains the TAKA-amylase promoter derived from Aspergillus oryzae and the Aspergillus niger glucoamylase terminator element. In addition, pCaHj505 has a pUC19-derived sequence for selection and propagation in Escherichia coli, and the amdS gene, which encodes the acetamidase gene derived from Aspergillus nidulans, for selection of amds+ Aspergillus transformants. The plasmid pCaHj505 was linearized by digestion with Bam I and Xho I, separated by 1.0% agarose gel electrophoresis using TBE buffer, and purified using the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Buckinghamshire, UK) following the manufacturer's instructions.
[0257] For gene amplification, a PCR reaction was performed, which included the primer pair, Primer 1 and 2, and the genomic DNA of Aspergillus niger NN053297 as a template. Briefly, 20 picomoles of each primer pair were used in the PCR reaction, and the PCR reaction consisted of 2 μl of genomic DNA, 10 μl of 5X GC buffer (Finnzymes Oy, Espoo, Finland), 1 μl of 2.5 mM each of dATP, dTTP, dGTP, and dCTP, and 0.6 units of PHUSION TMConsisted of high-fidelity DNA polymerase (Finnzymes Oy, Espoo, Finland), with a final volume of 50 μl (using deionized water). Amplification was performed using a Peltier thermal cycler (MJ Research Inc., South San Francisco, CA, USA), and the program was set for denaturation at 98 °C for 1 minute; 10 cycles, each with denaturation at 98 °C for 15 seconds, annealing at 68 °C for 30 seconds, with a 1 °C reduction per cycle, and extension at 72 °C for 3 minutes; 25 cycles, each with 15 seconds at 98 °C, 30 seconds at 58 °C, and extension at 72 °C for 3 minutes; and finally extension at 72 °C for 7 minutes. Then the heating block entered a soak cycle at 4 °C.
[0258] By using ILLUSTRA TM GFX TM PCR DNA and Gel Band Purification Kit to purify the PCR product (~1.5 kb) from the solution.
[0259] Then, the purified PCR product was ligated to the linearized vector pCaHj505 using the Fusion TM Dry-down PCR Cloning Kit to generate p505-GH10_AnNz, where the transcription of the Aspergillus niger GH10 xylanase gene is controlled by the promoter from the Aspergillus oryzae α-amylase gene. Briefly, for the ligation reaction, the precipitate of the In-Fusion Dry Down mixture was suspended in 2 μl of double-distilled H2O, and 1 μl was added to 0.3 μl of the linearized vector pCaHj505 and 3.7 μl of the PCR product in the tube. The ligation reaction was incubated at 50 °C for 15 minutes.
[0260] All 5 μl of the ligation solution was used to transform Escherichia coli TOP10 competent cells (TIANGEN Biotech (Beijing) Co., Ltd., Beijing, China). The ligation solution was added to 50 μl of the frozen-thawed competent cells and kept on ice for 30 minutes. Then the cells were heat-shocked at 42 °C for 1 minute and placed on ice for 2 minutes. Next, 200 μl of LB medium was added to the cells, and they were incubated with shaking at 350 rpm in a thermal mixer at 37 °C for 60 minutes. Finally, all the cells were spread on an LB plate containing 100 μg / ml ampicillin and incubated overnight at 37 °C.
[0261] Two colonies were picked for sequencing using a 3730XL DNA Analyzer (Applied Biosystems Inc, Foster City, CA, USA). After confirming the sequence, the colonies with the correct insert were inoculated for use with The SpinMiniprep kit (QIAGEN GmbH, Hilden, Germany) was used for plasmid DNA extraction following the manufacturer's instructions. Thus, plasmid DNA of p505-GH10_AnNz was prepared for Aspergillus oryzae transformation in Example 5.
[0262] Example 5: Expression of Aspergillus niger GH10 xylanase gene in Aspergillus oryzae MT3568
[0263] Protoplasts of Aspergillus oryzae MT3568 were prepared according to the method of Christensen et al., 1988, Bio / Technology 6:1419 - 1422. For transformation, 3 μg of plasmid DNA of p505-GH10_AnNz was used to transform Aspergillus oryzae MT3568. Several transformants were generated. Four transformants were isolated and inoculated into 3 ml of Dap4C medium in a 24-well plate and incubated at 30 °C and 150 rpm. After 3 days of incubation, 20 μl of supernatant from each culture was analyzed according to the manufacturer's instructions on a NuPAGE Novex 4 - 12% Bis-Tris gel w / MES (Invitrogen Corporation, Carlsbad, CA, USA). The resulting gel was stained with Instant Blue (Expedeon Ltd., Babraham Cambridge, UK). The SDS-PAGE profile of the cultures showed that all 4 transformants had a protein band at 35 kDa. The transformant with the highest expression level for each gene was named O34EQ8.
[0264] Example 6: Preparation of Aspergillus niger GH10 xylanase
[0265] Two slants of the expression strain O34EQ8 were used to inoculate twelve 2-liter flasks, each containing 400 ml of Dap4C medium. Specifically, each slant was washed with 10 ml of Dap4C medium and inoculated into six flasks and shaken at 30 °C and 80 rpm. The cultures were harvested on the 4th day and filtered using a 0.22 μm DURAPORE membrane (Millipore, Bedford, MA, USA). After purification, Aspergillus niger GH10 xylanase was obtained.
[0266] Example 7: Use of the enzyme in the wet milling method
[0267] After incubation with and without enzymes, the amounts of starch and gluten isolated from the fiber were measured by 10-g fiber assay. The 10-g fiber assay is generally described as incubating a wet fiber sample in the presence of an enzyme, at conditions associated with the method (pH 3.5 to 4, temperature about 52 °C) and for a period between 1 and 4 hours. The wet fiber sample is obtained from a wet milling plant after fiber pressing and resuspended in a lactate buffer to a 200-g slurry containing 5% dry solid fiber (which is equivalent to the fiber content from 100 g of corn dry matter). After incubation, the slurry is transferred and pressed through a sieve (usually 100 microns or less), during which the filtrate passing through is collected. The fiber retained on the sieve is pressed using a spatula to recover as much filtrate as possible. Then the pressed fiber is transferred to a beaker containing 200-ml of water and stirred. The slurry is passed through a 75-micron sieve, and the collected filtrate is combined with the first one. The above pressing, washing, and filtering steps are repeated again to recover the final filtrate and combine it with the previous two. Then the combined filtrates are vacuum filtered, this time through a glass microfiber filter paper (Whatman), which retains the insoluble solids released from the fiber and passing through the 75-micron sieve. After passing 200 ml of water through the filter paper to remove any trace of solubles, the total insoluble solids retained on the filter paper are dried and weighed. The dry weight is reported as released starch + gluten, as a percentage (w / w) of the fiber dry matter of the starting substrate.
[0268] Example 8: Use of GH10 xylanase and / or GH62 arabinofuranosidase
[0269] The 10-g fiber assay was carried out at pH 3.8, using a mixture comprising Celluclast and GH10 xylanase A, in combination with GH62 arabinofuranosidase A or GH62 arabinofuranosidase B, incubated at 52 °C for 1 hour at a dose of 35 μg of enzyme protein per gram of corn. The mixture consisted of 5% GH62 arabinofuranosidase A or GH62 arabinofuranosidase B, 15% GH10 xylanase A, and the remaining 80% from Celluclast. For comparison, a mixture containing only Celluclast and GH10 xylanase A (without GH62 arabinofuranosidase) was used. Corn fiber with 13.63% residual starch and 10.44% residual protein was used as the substrate in the fiber assay. The starch + gluten (dry matter) released from the corn fiber was measured for the following specified doses.
[0270] Table 1
[0271]
[0272]
[0273] As shown in Table 1, the addition of GH62 arabinofuranosidase A and GH62 arabinofuranosidase B on top of Celluclast+GH10 xylanase A can significantly increase the yield of starch+gluten in the corn wet milling process.
[0274] Example 9: Use of GH10 xylanase and / or GH62 arabinofuranosidase
[0275] A 10-g fiber assay was conducted at pH 3.8 using a mixture comprising Celluclast and GH10 xylanase A, in combination with either GH62 arabinofuranosidase A or GH62 arabinofuranosidase B, incubated at 52 °C for 1 h at a dose of 30 μg enzyme protein per gram of corn. The mixture consisted of 5% GH62 arabinofuranosidase A or GH62 arabinofuranosidase B, 15% GH10 xylanase A, and the remaining 80% from Celluclast. For comparison, a mixture containing only Celluclast and GH10 xylanase A (without GH62) was included. Corn fiber with 16.67% residual starch and 10.77% residual protein was used as the substrate in the fiber assay. The starch+gluten (dry matter), as well as starch and protein separately, released from the corn fiber were measured for the following specified doses.
[0276] Table 2
[0277]
[0278]
[0279] As shown in Table 2, the addition of GH62 arabinofuranosidase A and GH62 arabinofuranosidase B on top of Celluclast+GH10 xylanase A can significantly increase the yield of starch+gluten in the corn wet milling process.
[0280] Example 10: Use of GH10 xylanase, GH30 xylanase and / or GH62 arabinofuranosidase
[0281] A 10-g fiber assay was conducted at pH 3.8 using an enzyme mixture containing GH10 xylanase A, GH30 xylanase A, GH62 arabinofuranosidase A and Celluclast (with a detailed ratio of 35 μg EP / g corn as shown in the table below), incubated at 52 °C for 1 h at a dose of 35 μg enzyme protein per gram of corn.
[0282] Table 3
[0283]
[0284]
[0285] For comparison, an enzyme composition containing only Celluclast was used. Corn fiber with 15.52% residual starch and 12.00% residual protein in the fiber was used as the substrate in the fiber assay. The starch + gluten (dry matter) released from the corn fiber at the specified dose was measured; the results are provided in Table 4 below.
[0286] Table 4
[0287]
[0288] As shown in Table 4, adding GH62 arabinofuranosidase A + GH30 xylanase A on top of Celluclast + GH10 xylanase A can significantly increase the yield of starch + gluten in the corn wet milling process.
[0289] Example 11: Preparation of sterilized palm fruit mesocarp
[0290]
[0291]
[0292] Example 12: Preparation of the substrate
[0293] Pressurized sterilized palm fruit mesocarp:
[0294]
[0295] Example 13: 10 g assay protocol for palm substrate
[0296] 1. Aliquot 10 g of the prepared paste into 50 ml Falcon tubes under intermittent mixing to ensure substrate uniformity. Record the exact weight of the weighed substrate;
[0297] 2. Additionally, record the empty weight of the plastic petriplate to be used for collecting the extracted oil;
[0298] 3. Pre-condition the tubes with the substrate and keep them at 90 °C for 5 minutes;
[0299] 4. Transfer the tubes to the corresponding incubation temperature (55 °C) water bath and pre-condition them for 10 minutes;
[0300] 5. Inoculate the tubes with 500 μL of water in the case of the control, and with 500 μL of the enzyme solution in the case of other enzyme treatments;
[0301] 6. After adding the enzyme / water, mix the contents 5 times in a clockwise direction and 5 times in a counterclockwise direction using a micro spatula to ensure proper mixing;
[0302] 7. Incubate for the specified time (15 minutes / 30 minutes), and mix intermittently with a spatula every 15 minutes during incubation, as specified in step 6;
[0303] 8. At the end of incubation, add 20 ml of water to each tube and mix well;
[0304] 9. For clarification, transfer the tubes to a 90 °C water bath and allow them to clarify for 30 minutes;
[0305] 10. Centrifuge the tubes at 7000 rpm and 30 °C in a tabletop centrifuge for 10 minutes to obtain an oil layer on top;
[0306] 11. Transfer the oil layer to a pre-weighed petri dish. Extract the free oil completely from each tube using hot water;
[0307] 12. Note the weight of the petri dish with the extracted oil;
[0308] 13. The oil yield can be calculated as: Oil yield = Weight of the petri dish with the extracted oil - Weight of the empty petri dish.
[0309] Table 5
[0310]
[0311] As shown in Table 5, adding GH10 xylanase A and GH62 arabinofuranosidase A can increase the oil yield from 10 g of oil palm mesocarp.
Claims
1. An enzyme composition comprising a cellulolytic composition from a strain derived from Trichoderma reesei, a polypeptide having GH62 arabinofuranosidase activity, and a polypeptide having GH10 xylanase activity, wherein: The polypeptide having GH62 arabinofuranosidase activity is selected from the group consisting of: a) a polypeptide having 100% sequence identity with the mature polypeptide of SEQ ID NO:1 or the mature polypeptide of SEQ ID NO:3; and b) a polypeptide encoded by a polynucleotide having 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:2 or its cDNA sequence; The polypeptide having GH10 xylanase activity is selected from the group consisting of: a) a polypeptide having 100% sequence identity with the mature polypeptide of SEQ ID NO:4; and b) a polypeptide encoded by a polynucleotide having 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:5 or its cDNA sequence.
2. The enzyme composition of claim 1, wherein the polypeptide having GH62 arabinofuranosidase activity is derived from a strain of the genus Aspergillus.
3. The enzyme composition of claim 2, wherein the strain of the genus Aspergillus is a strain of Aspergillus niger.
4. The enzyme composition of any one of claims 1-3, wherein the polypeptide having GH10 xylanase activity is derived from a strain of the genus Aspergillus.
5. The enzyme composition of claim 4, wherein the strain of the genus Aspergillus is a strain of Aspergillus niger.
6. An enzyme composition comprising: a cellulolytic composition from a strain derived from Trichoderma reesei, GH62 arabinofuranosidase, GH10 xylanase, and GH30 xylanase, wherein: The GH62 arabinofuranosidase is selected from the group consisting of: a) a polypeptide having 100% sequence identity with the mature polypeptide of SEQ ID NO:1 or the mature polypeptide of SEQ ID NO:3; and b) a polypeptide encoded by a polynucleotide having 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:2 or its cDNA sequence; The GH10 xylanase is selected from the group consisting of: a) a polypeptide having 100% sequence identity with the mature polypeptide of SEQ ID NO:4; and b) a polypeptide encoded by a polynucleotide having 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:5 or its cDNA sequence; The GH30 xylanase is selected from: a polypeptide having 100% sequence identity with the mature polypeptide of SEQ ID NO:6.
Citation Information
Patent Citations
Composition of a steeped starched-containing grain and a cellulase enzyme
US5066218A
Use of enzymes to reduce steep time and SO2 requirements in a maize wet-milling process
US6566125B2
Salt-stabilized enzyme preparations
WO1997005245A1
Carbohydrate-based enzyme granulates
WO1998054980A2
High-activity phytase compositions
WO1998055599A2