Primer combinations for amplifying molecular markers linked to the red trait of pear peel

Abstract

The present invention relates to a primer combination for amplifying a molecular marker linked to a pear fruit skin red trait, comprising a primer pair 1 and a primer pair 2; the upstream primer sequence of the primer pair 1 comprises a sequence shown in SEQ ID NO: 1, and the downstream primer sequence of the primer pair 1 comprises a sequence shown in SEQ ID NO: 2; the upstream primer sequence of the primer pair 2 comprises a sequence shown in SEQ ID NO: 4, and the downstream primer sequence of the primer pair 2 comprises a sequence shown in SEQ ID NO: 5. The primer combination and a kit comprising the primer combination can be used in pear fruit skin red / green trait assisted selection breeding, quickly eliminate green fruit skin single plants in the seedling stage of hybrid seedlings, save the subsequent hybrid seedling maintenance and identification evaluation costs, and significantly improve the red skin pear breeding efficiency.

Description

[0001] This invention is a divisional application. The original Chinese patent application number is: 202110982710.9, the application date is: August 25, 2021, and the patent name at the time of application is: Loci and molecular markers linked to the red trait of pear skin and their applications. Technical Field

[0002] The invention belongs to the field of pear molecular genetic breeding, and in particular relates to a primer combination for amplifying a molecular marker linked to a pear peel red trait. Background Art

[0003] Pear (Pyrus L.) is an important fruit tree of the Rosaceae family and one of the three major fruits in my country. According to the data from the Food and Agriculture Organization of the United Nations (FAOSTAT), in 2019, my country's pear cultivation area was 950,000 hectares, with a production of 17 million tons, accounting for 69% and 71% of the world's total production and area, respectively, and it occupies an important position in the fruit industry. In recent years, red pears have become increasingly popular among consumers due to their attractive appearance and rich nutritional value. However, in actual production, there are not many red pear varieties that can be cultivated in my country, especially the Oriental pear, which is the main pear variety cultivated in my country. There is a lack of red varieties with excellent quality and stable coloring. Therefore, red-skinned pears have always been an important breeding target for pear breeders in my country and even around the world.

[0004] At present, hybrid breeding is the most commonly used breeding method in pear breeding. Because pear is a perennial fruit tree, the genetic mechanism of its traits is complex, the selection rate of hybrid offspring is low, and seedlings usually need to go through 3 to 5 years or even longer in childhood before they can bloom and bear fruit. The breeding process requires a lot of land, manpower and material costs, and the breeding cost is high.

[0005] The important premise for applying molecular marker-assisted selection breeding technology to pear breeding is to develop molecular markers that are closely linked to important pear traits. As an important appearance quality trait of pear fruit, red peel has also been developed and applied with related molecular markers, but the genetic mechanism of this trait is complex, and the formation mechanism of the red trait of different red pear varieties is different. In addition, the existing molecular markers have the problem of low accuracy, and it is necessary to develop more extensive and effective marker loci for application in pear breeding. At the same time, most of the markers developed by predecessors require the use of fluorescent quantitative PCR or ordinary PRC plus polyacrylamide gel electrophoresis to distinguish the phenotypes of different test samples, which have the disadvantages of high cost and cumbersome experimental procedures. Therefore, the development of molecular markers that can successfully distinguish the phenotypes of different samples by ordinary PCR plus agarose gel electrophoresis can greatly reduce the experimental cost and improve the breeding efficiency. Summary of the invention

[0006] In view of the problems existing in the prior art, the present invention provides a primer combination for amplifying a molecular marker linked to the red trait of pear fruit skin, a locus linked to the red trait of pear fruit skin, a molecular marker and an application thereof. The above-mentioned locus and molecular marker can be used in the assisted selection breeding of the red / green trait of pear fruit skin, and the green fruit skin single plants can be quickly eliminated in the seedling stage of hybrid seedlings, thus saving the subsequent hybrid seedling maintenance and identification and evaluation costs, significantly improving the breeding efficiency of red-skinned pears, and having the advantage of high accuracy.

[0007] The technical solution of the present invention to solve the above technical problems is as follows:

[0008] A locus linked to the red trait of pear fruit skin, the nucleotide sequence of the locus includes the nucleotide sequence of the locus located at base 26394198 of Chr5 of the 'Zhongai 1' pear reference genome, and the GeneBank accession number of the reference genome is: SMOL000000000.

[0009] The beneficial effects of the present invention are as follows: the above-mentioned marker can be used in the auxiliary selection breeding of the red / green trait of pear fruit skin, and the green fruit skin single plants can be quickly eliminated in the seedling stage of hybrid seedlings, thus saving the subsequent hybrid seedling maintenance and identification and evaluation costs, significantly improving the breeding efficiency of red-skinned pears, and having the advantages of high accuracy, etc.

[0010] Further, the base sequence at the base is AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG or A.

[0011] The present invention provides application of the above-mentioned locus in assisted selection breeding of red / green trait of pear fruit skin.

[0012] The beneficial effects of the present invention are as follows: based on the above-mentioned loci, marker primers and the like can be developed, which can be used in the auxiliary selection breeding of the red / green trait of pear fruit skin, and the green fruit skin single plants can be quickly eliminated in the seedling stage of hybrid seedlings, thus saving the subsequent hybrid seedling maintenance and identification and evaluation costs, significantly improving the breeding efficiency of red-skinned pears, and having the advantages of high accuracy, etc.

[0013] The invention provides a molecular marker linked to the red trait of pear fruit skin, wherein the site is located inside the molecular marker amplification product.

[0014] Furthermore, the upstream primer sequence of the molecular marker includes the sequence shown in SEQ ID NO:1, and the downstream primer sequence of the molecular marker includes the sequence shown in SEQ ID NO:2.

[0015] Preferably, the upstream primer sequence of the molecular marker is the sequence shown in SEQ ID NO:1, and the downstream primer sequence of the molecular marker is the sequence shown in SEQ ID NO:2.

[0016] The present invention also provides application of the above molecular marker in auxiliary selection breeding of pear peel red / green trait.

[0017] The invention provides a primer for amplifying the above molecular marker.

[0018] Further, the primers include the sequence shown in SEQ ID NO: 1 and / or the sequence shown in SEQ ID NO: 2. Preferably, the upstream primer is the sequence shown in SEQ ID NO: 1, and the downstream primer is the sequence shown in SEQ ID NO: 2.

[0019] The beneficial effects of adopting the above technical scheme are as follows: the above primers can be used to realize assisted selection breeding of the red / green trait of pear peel, quickly eliminate single plants with green peel in the seedling stage of hybrid seedlings, save the cost of subsequent hybrid seedling maintenance and identification and evaluation, significantly improve the breeding efficiency of red-skinned pears, and have the advantages of high accuracy.

[0020] The present invention provides application of the above primers in auxiliary selection breeding of red / green trait of pear peel.

[0021] The invention provides a pear peel color auxiliary selection breeding kit, comprising the primers.

[0022] The beneficial effects of adopting the above technical scheme are as follows: the above kit can be used to realize assisted selection breeding of pear peel red / green traits, quickly eliminate green peel single plants in the seedling stage of hybrid seedlings, save the subsequent hybrid seedling maintenance and identification and evaluation costs, significantly improve the breeding efficiency of red-skinned pears, and has the advantages of high accuracy.

[0023] Furthermore, the kit also includes: an enzyme for PCR amplification, deionized water, a positive control, a negative control, or a combination of several of them.

[0024] The present invention provides application of the kit in auxiliary selection breeding of red / green trait of pear peel.

[0025] The invention provides a method for auxiliary selection breeding of pear peel red / green traits, comprising the following steps: extracting DNA of hybrid seedlings to be selected and bred, and performing PCR amplification using the primers.

[0026] Further, the method comprises the following steps: extracting DNA of the hybrid seedlings to be selected for breeding, and performing PCR amplification using a primer pair, wherein the primer pair comprises a sequence shown in SEQ ID NO:1 and a sequence shown in SEQ ID NO:2.

[0027] The beneficial effects of the above technical solution are as follows: the method of PCR amplification combined with agarose electrophoresis is adopted, the experimental operation is simple, and different sample phenotypes can be successfully distinguished without complex and expensive instruments, which greatly reduces the experimental cost and improves the breeding efficiency. The above primers have the advantage of high accuracy, and can realize the auxiliary selection breeding of pear peel red / green traits, quickly eliminate green peel plants in the seedling stage of hybrid seedlings, save the subsequent hybrid seedling maintenance and identification and evaluation costs, and significantly improve the breeding efficiency of red-skinned pears.

[0028] Furthermore, the reaction conditions of PCR amplification include: 94°C for 3 min; 95°C for 10 s, 56°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.

[0029] The beneficial effects of adopting the above technical solution: adopting the above amplification conditions is conducive to obtaining clear and definite band shapes, which is conducive to the analysis and judgment of the results.

[0030] Furthermore, the hybrid seedlings are 'Pingguoli'×'August Red' hybrid seedlings.

[0031] The beneficial effects of adopting the above technical solution are as follows: 'August Red' is a new early-maturing, crisp-fleshed red pear variety bred by hybridizing 'Zaobali' and 'Zaosu'. Its fruit has a sweet and sour flavor, and its skin easily turns red over a large area, making it popular among consumers and breeders. It is one of the excellent parents for breeding new red-skinned pear varieties.

[0032] The present invention provides a locus combination linked to the pear fruit skin red trait, including locus 1, which is the same as the above-mentioned locus.

[0033] Furthermore, a locus combination linked to the red trait of pear skin includes site 1 and site 2, site 1 is the same as the above-mentioned site; the nucleotide sequence of site 2 includes the nucleotide sequence of the site located at base 26306039 of Chr5 of the 'Zhongai 1' pear reference genome, the GeneBank accession number of the reference genome is: SMOL00000000, and the base sequence at the base is T or TAACAAATTTTACTACCAAAGGATTCCATTTTAGC.

[0034] Beneficial effects of adopting the above scheme: The combined use of the above site combination can be applied in assisted selection breeding for the red trait of pear skin, and further improve the accuracy of selection and breeding efficiency.

[0035] The invention provides a molecular marker combination linked to the red trait of pear fruit skin, comprising a B717-Del2 molecular marker and a B717-In1 molecular marker, wherein the site 1 is located inside the amplification product of the B717-Del2 molecular marker, and the site 2 is located inside the amplification product of the B717-In1 molecular marker.

[0036] Further, the upstream primer sequence for amplifying the B717-Del2 molecular marker includes the sequence shown in SEQ ID NO:1, and the downstream primer sequence for amplifying the B717-Del2 molecular marker includes the sequence shown in SEQ ID NO:2; the upstream primer sequence for amplifying the B717-In1 molecular marker includes the sequence shown in SEQ ID NO:4, and the downstream primer sequence for amplifying the B717-In1 molecular marker includes the sequence shown in SEQ ID NO:5.

[0037] Preferably, the upstream primer sequence used to amplify the B717-Del2 molecular marker is the sequence shown in SEQ ID NO:1, and the downstream primer sequence used to amplify the B717-Del2 molecular marker is the sequence shown in SEQ ID NO:2; the upstream primer sequence used to amplify the B717-In1 molecular marker is the sequence shown in SEQ ID NO:4, and the downstream primer sequence used to amplify the B717-In1 molecular marker is the sequence shown in SEQ ID NO:5.

[0038] Beneficial effects of adopting the above scheme: The combined use of the above molecular marker combination can be applied in assisted selection breeding for the red trait of pear skin, and further improve the accuracy of selection and breeding efficiency.

[0039] The present invention provides a primer combination for amplifying the above molecular marker combination.

[0040] Further, the primer combination includes primer pair 1 and primer pair 2; the upstream primer sequence of primer pair 1 includes the sequence shown in SEQ ID NO:1, and the downstream primer sequence of primer pair 1 includes the sequence shown in SEQ ID NO:2; the upstream primer sequence of primer pair 2 includes the sequence shown in SEQ ID NO:4, and the downstream primer sequence of primer pair 2 includes the sequence shown in SEQ ID NO:5.

[0041] Preferably, the upstream primer sequence of primer pair 1 is the sequence shown in SEQ ID NO:1, and the downstream primer sequence of primer pair 1 is the sequence shown in SEQ ID NO:2; the upstream primer sequence of primer pair 2 is the sequence shown in SEQ ID NO:4, and the downstream primer sequence of primer pair 2 is the sequence shown in SEQ ID NO:5.

[0042] Beneficial effects of adopting the above scheme: The combined use of the above primer combination can be applied in assisted selection breeding for the red trait of pear fruit skin, and further improve the accuracy of selection and breeding efficiency.

[0043] The invention provides a pear peel color auxiliary selection breeding kit, comprising the primer combination.

[0044] Furthermore, the kit also includes one or a combination of PCR amplification enzyme, deionized water, positive control, and negative control.

[0045] Beneficial effects of adopting the above scheme: the above kit can be used in assisted selection breeding for the red trait of pear peel, and further improve the accuracy of selection and breeding efficiency.

[0046] The present invention provides application of the above-mentioned locus combination, the above-mentioned molecular marker combination, the above-mentioned primer combination and / or the above-mentioned kit in assisted selection breeding of pear peel red / green traits.

[0047] The invention provides a method for auxiliary selection breeding of pear peel red / green traits, comprising the following steps: extracting DNA of hybrid seedlings to be selected and bred, and performing PCR amplification by using the primer combination.

[0048] Beneficial effects of adopting the above scheme: The above method can be applied in assisted selection breeding for the red trait of pear fruit skin, and further improve the accuracy of selection and breeding efficiency.

[0049] Further, the method includes the following steps: extracting DNA of the hybrid seedlings to be selected for breeding, and performing PCR amplification using primer pair 1 and primer pair 2 respectively, wherein primer pair 1 includes the sequence shown in SEQ ID NO:1 and the sequence shown in SEQ ID NO:2, and primer pair 2 includes the sequence shown in SEQ ID NO:4 and the sequence shown in SEQ ID NO:5.

[0050] The beneficial effects of adopting the above technical solution are as follows: the above primer pair has the advantage of high accuracy, which can realize assisted selection breeding of pear peel red / green traits, quickly eliminate green peel single plants in the seedling stage of hybrid seedlings, save subsequent hybrid seedling maintenance and identification and evaluation costs, and significantly improve the breeding efficiency of red-skinned pears.

[0051] Furthermore, the reaction conditions of PCR amplification include: 94°C for 3 min; 95°C for 10 s, 56°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.

[0052] The beneficial effects of adopting the above technical solution: adopting the above amplification conditions is conducive to obtaining clear and definite band shapes, which is conducive to the analysis and judgment of the results.

[0053] The method for judging the result of PCR amplification comprises the following steps:

[0054] (1) PCR amplification was performed using primer pair 1. If the band pattern was a double band of 196 bp and 133 bp, it indicated that the plant was red-skinned; if the band pattern was a single band of 196 bp, it indicated that the plant was green-skinned;

[0055] (2) PCR amplification was performed using primer pair 2. If the band pattern was a double band of 138 bp and 172 bp, it indicated that the individual was red-skinned; if the band pattern was a single band of 138 bp, it indicated that the individual was green-skinned;

[0056] (3) When PCR amplification is performed using primer pair 1 and primer pair 2 respectively, if the amplification result of any of the labeled primer pairs indicates a red-skinned plant, it can be preliminarily considered that the plant has a red phenotype; otherwise, it can be preliminarily determined that the plant has a green phenotype.

[0057] Furthermore, the hybrid seedlings are 'Pingguoli'×'August Red' hybrid seedlings.

[0058] The beneficial effects of adopting the above technical solution are as follows: 'August Red' is a new early-maturing, crisp-fleshed red pear variety bred by hybridizing 'Zaobali' and 'Zaosu'. Its fruit has a sweet and sour flavor, and its skin easily turns red over a large area, making it popular among consumers and breeders. It is one of the excellent parents for breeding new red-skinned pear varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is the location of the fruit skin red trait in the genome using the composite interval mapping method. The ordinate represents the LOD value, the abscissa represents the distribution of the mapping blocks on the chromosome, and the gray horizontal line represents the LOD threshold (7.916) corresponding to 0.99 confidence level after 1000 PT tests.

[0060] Figure 2 This is the banding diagram of B717-Del2 SCAR marker in red-skinned pear and green-skinned pear. 1, 3, 4, 5 are the banding types of green-skinned pear, 2, 6, 7, 8 are the banding types of red-skinned pear, and M is marker.

[0061] Figure 3 The figure shows the amplification results of B717-Del2SCAR marker in 150 progeny of the hybrid combination of 'Pingguoli'×'Bayuehong'; M stands for Marker.

[0062] Figure 4 This is the band diagram of B717-In1 SCAR marker in red-skinned pear and green-skinned pear. 1 is the green-skinned pear band type, 2 is the red-skinned pear band type, and M is Marker. DETAILED DESCRIPTION

[0063] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0064] The invention provides an InDel site linked to a red trait of pear peel, a molecular marker based on the site and an application thereof.

[0065] The InDel site linked to the red trait of pear skin provided by the present invention is located at base 26394198 of Chr5 of the 'Zhongai 1' pear reference genome (GeneBank accession number: SMOL00000000), and the base sequence therein is shown in SEQ ID NO: 3, which is 5'-AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG-3', and the variant sequence is A.

[0066] The variation range of this variant site is relatively large, with a difference of 63 bp, which makes it easy to distinguish the amplified fragments by simple agarose electrophoresis. The site is located near the LOD peak in the chromosome localization results of the red skin trait (such as Figure 1 As shown in the figure, the region closely linked to the red trait is obtained. The closer the region is to the peak, the more reliable the linkage relationship is and the more accurate the selected marker is.

[0067] The present invention provides a SCAR molecular marker developed based on the above-mentioned InDel site, which is recorded as B717-Del2, and the InDel site is located inside the SCAR molecular marker amplification product.

[0068] The application of the B717-Del2 SCAR molecular marker in the assisted selection breeding of the red trait of pear fruit skin. The length difference of the two fragments amplified by the above marker is relatively large, and they are easy to distinguish.

[0069] The primer pair of the B717-Del2 SCAR molecular marker of the present invention is:

[0070] Upstream primer (forward primer) sequence: 5'-TCCTCCTTGGACTCTCTGTGG-3', as shown in SEQ ID NO: 1;

[0071] The sequence of the downstream primer (reverse primer) is: 5′-CGCAGAACCATATCAGCAAAA-3′, as shown in SEQ ID NO:2.

[0072] The primer pair is used in the breeding of pear fruit skin red trait. The length difference of the two fragments amplified by the above markers is relatively large, and they are easy to distinguish.

[0073] The present invention uses the above molecular markers to identify the hybrid combination population of 'Apple Pear'×'August Red'. The SCAR marker can select individual plants with red skin in the test population, and the selection efficiency is 98.85%. It can be applied to the early selection of red-skinned pear breeding, and can significantly improve the efficiency of red-skinned pear breeding, and has good application prospects.

[0074] The present invention provides an InDel site combination linked to the pear fruit skin red trait, including site 1 and site 2. Site 1 and site 2 can be used in combination to select individual plants with red fruit skin in a test population.

[0075] The description of site 1 is the same as the above-mentioned site. That is, site 1 is located at base 26394198 of Chr5 of the 'Zhongai 1' pear reference genome (GeneBank accession number: SMOL00000000), and the base sequence therein is shown in SEQ ID NO: 3, which is 5'-AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG-3', and the variant sequence is A.

[0076] Site 2 is located at base 26306039 of Chr5 of the 'Zhongai 1' pear reference genome (GeneBank accession number: SMOL00000000), where the base sequence is T. The variant sequence is shown in SEQ ID NO: 6, which is 5'-TAACAAATTTTACTACCAAAGGATTCCATTTTAGC-3'.

[0077] The variation range of the above two mutation sites is relatively large, which makes it easy to distinguish the amplified fragments by simple agarose electrophoresis. Both sites are located near the LOD peak in the chromosome localization results of the red skin trait (such as Figure 1 The region closely linked to the red trait was obtained. The closer the region is to the peak, the more reliable the linkage relationship is, and the more accurate the selected marker is. The combined use of the two loci can further improve the screening accuracy and efficiency of red pear breeding.

[0078] The present invention provides a SCAR molecular marker combination developed based on the above-mentioned InDel site, denoted as B717-Del2 and B717-In1, wherein the above-mentioned InDel sites are respectively located inside the amplification product of the SCAR molecular marker combination, that is, the above-mentioned site 1 is located inside the amplification product of the B717-Del2 molecular marker, and the above-mentioned site 2 is located inside the amplification product of the B717-In1 molecular marker. The above-mentioned molecular marker combination can be used in the assisted selection breeding of the red trait of pear fruit skin, and further improves the accuracy of selection and breeding efficiency.

[0079] The present invention provides a primer combination for amplifying the above-mentioned molecular marker. The primer combination includes a primer pair 1 and a primer pair 2;

[0080] The primer pair 1 of the B717-Del2 SCAR molecular marker of the present invention is:

[0081] Upstream primer (forward primer) sequence: 5'-TCCTCCTTGGACTCTCTGTGG-3', as shown in SEQ ID NO: 1;

[0082] The sequence of the downstream primer (reverse primer) is: 5′-CGCAGAACCATATCAGCAAAA-3′, as shown in SEQ ID NO:2.

[0083] The primer pair 2 of the B717-In1 SCAR molecular marker of the present invention is:

[0084] Upstream primer (forward primer) sequence: 5'-AAGCAGCAAAAACTGAGTCACT-3', as shown in SEQ ID NO: 4;

[0085] The sequence of the downstream primer (reverse primer) is: 5′-TGCCTTTACAGTCCCATTTG-3′, as shown in SEQ ID NO:5.

[0086] The primer pair can be used in breeding for the red trait of pear fruit skin. The length difference between the two fragments amplified by the primer pair is relatively large, and they are easy to distinguish. The primer pair can be used in combination in the application of auxiliary selection breeding for the red trait of pear fruit skin, and further improve the accuracy of selection and breeding efficiency.

[0087] SCAR marker primer sequences

[0088]

[0089] Primer pair 1 was used for PCR amplification. If the band pattern was a double band of 196 bp and 133 bp, it indicated that it was a red-skinned plant; if the band pattern was a single band of 196 bp, it indicated that it was a green-skinned plant.

[0090] Primer pair 2 was used for PCR amplification. If the band pattern was a double band of 138 bp and 172 bp, it indicated that it was a red-skinned plant; if the band pattern was a single band of 138 bp, it indicated that it was a green-skinned plant.

[0091] When PCR amplification is performed using primer pair 1 and primer pair 2 respectively, if the amplification result of any of the labeled primer pairs indicates a red-skinned plant, the plant can be preliminarily considered to be a red phenotype. Otherwise, the plant can be preliminarily identified as a green phenotype.

[0092] The present invention uses the above molecular marker combination to identify the hybrid combination population of 'Apple Pear'×'August Red'. The SCAR marker can select individual plants with red skin in the test population, and the selection efficiency is 100%. It can be applied to the early selection of red-skinned pear breeding, and can significantly improve the efficiency of red-skinned pear breeding, and has good application prospects.

[0093] The following is a further introduction through specific embodiments.

[0094] Example 1

[0095] The primer pair of the B717-Del2 molecular marker was used to identify the red trait of pear peel as follows.

[0096] 1. Collect young leaves from new shoots of 150 individual plants of the hybrid combination of 'Pingguoli'×'August Red' and extract DNA from them.

[0097] 2. The extracted DNA was amplified by PCR using primer pairs labeled with B717-Del2. The PCR amplification used a 20 μL reaction system. The composition of the reaction system and the PCR reaction procedure are shown in Tables 1 and 2. The primer pairs for amplifying molecular markers are shown in Table 3. 2×Taq PCR Mix (containing dye) was derived from the ready-to-use PCR kit 3.0 (CAT#: 90805-10) produced by Beijing Tianenze Gene Technology Co., Ltd., and the primer sequences were synthesized by Sino-US Taihe Biotechnology (Beijing) Co., Ltd.

[0098] Table 1 PCR reaction system

[0099]

[0100] Table 2 PCR reaction program

[0101]

[0102] Table 3 SCAR marker primer sequences

[0103]

[0104] 3. Perform 3% agarose gel electrophoresis on the PCR product and count the bands of the electrophoresis results. The band patterns of the red-skinned and green-skinned strains are as follows: Figure 2 As shown, if the band pattern is a double band of 196bp and 133bp, it indicates a red-skinned plant; if the band pattern is a single band of 196bp, it indicates a green-skinned plant.

[0105] 4. 150 fruit-bearing plants of the test hybrid combination were selected. According to the fruit skin color, 87 plants had a red phenotype and 63 plants had a green phenotype.

[0106] The above method was used to perform PCR amplification with primers on the DNA of 150 fruit-bearing plants of the test hybrid combination. According to the PCR amplification results, there were 89 red-skinned plants (of which 3 plants were green phenotypes and 86 plants were red phenotypes according to the fruit skin color), and 96.63% (86 / 89) of the PCR amplification results of the red-skinned plants were consistent with the red phenotype; according to the PCR amplification results, there were 61 green plants (of which 1 plant was red phenotype and 60 plants were green phenotypes according to the fruit skin color). The results showed that the use of this marker can identify 98.85% of the red phenotypes of the combination (87 plants were red phenotypes according to the fruit skin color, and the amplification results showed that 86 of them were red phenotypes). The electrophoresis results are as follows: Figure 3 As shown in the figure, samples No. 1 to No. 150 are arranged from left to right and from top to bottom. The data amplified using the primer sequence labeled with B717-Del2 according to the electrophoresis results are shown in Table 4.

[0107] Table 4

[0108]

[0109] The above steps can be used to quickly eliminate green-skinned individual plants during the seedling stage of hybrid seedlings, saving the cost of subsequent hybrid seedling maintenance and identification and evaluation, and significantly improving the breeding efficiency of red-skinned pears.

[0110] Example 2

[0111] The primer pair 1 of the B717-Del2 molecular marker and the primer pair 2 of the B717-In1 molecular marker were used together to identify the red trait of pear peel as follows.

[0112] 1. PCR amplification was performed on 150 individual plants of the hybrid combination of 'Pingguoli'×'Bayuehong' using primer 1 of the B717-Del2 molecular marker. The method, sample serial number sequence, judgment criteria, etc. were the same as those in Example 1.

[0113] The upstream primer sequence of primer pair 1 is 5'-TCCTCCTTGGACTCTCTGTGG-3', as shown in SEQ ID NO: 1; the downstream primer sequence is 5'-CGCAGAACCATATCAGCAAAA-3', as shown in SEQ ID NO: 2.

[0114] 2. PCR amplification was performed on 150 individual plants of the above-mentioned 'Pingguoli'×'August Red' hybrid combination using primer 2 labeled with the B717-In1 molecule (the sequence of sample numbers is the same as in Example 1). The upstream primer sequence of primer pair 2 is 5'-AAGCAGCAAAAACTGAGTCACT-3', as shown in SEQ ID NO:4; the downstream primer sequence of primer pair 2 is 5'-TGCCTTTACAGTCCCATTTG-3', as shown in SEQ ID NO:5.

[0115] The reaction system and amplification method of PCR amplification are the same as those in Example 1. Figure 4 As shown, if the band pattern is a double band of 138 bp and 172 bp, it indicates a red-skinned individual plant, and if the band pattern is a single band of 138 bp, it indicates a green-skinned individual plant (due to limited space, the electrophoresis diagrams of all samples No. 1-150 are not listed).

[0116] 3. The results of PCR amplification using primer pair 1 labeled with the B717-Del2 molecule and primer pair 2 labeled with the B717-In1 molecule are shown in Table 5.

[0117] Table 5

[0118]

[0119]

[0120] Judgment criteria: if the amplification result of any of the labeled primer pairs indicates a red-skinned plant, it can be preliminarily considered that the plant has a red phenotype.

[0121] 150 fruit-bearing plants of the test hybrid combination were selected. According to the fruit skin color, 87 plants had a red phenotype and 63 plants had a green phenotype.

[0122] The primer pair 1 of the B717-Del2 molecular marker and the primer pair 2 of the B717-In1 molecular marker were used together to identify the red trait of the pear peel. According to the PCR amplification results, there were 90 red-skinned plants (of which 3 plants were green phenotypes and 87 plants were red phenotypes according to the peel color), and 96.67% (87 / 90) of the PCR amplification results of the red-skinned plants were consistent with the red phenotype; according to the PCR amplification results, there were 60 green plants (of which all 60 plants were green phenotypes according to the peel color). The results showed that the combination of markers could identify all 87 red phenotypes in the combination. Therefore, it can be seen that the combination of two markers can identify 100% of the red phenotypes of the combination.

[0123] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention. Sequence Listing <110> Fruit Research Institute, Chinese Academy of Agricultural Sciences <120> Primer combinations for amplifying molecular markers linked to the red trait of pear peel <130> HF22A0212 <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 tcctccttgg actctctgtg g 21 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 cgcagaacca tatcagcaaa a 21 <210> 3 <211> 64 <212> DNA <213> pear <400> 3 aaagcctagt gcaccttttt taaatctgtt tctatttcag tatctttgtt atgctggaaa 60 atgg 64 <210> 4 <211> twenty two <212> DNA <213> Artificial Sequence <400> 4 aagcagcaaa aactgagtca ct 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 tgcctttaca gtcccatttg 20 <210> 6 <211> 35 <212> DNA <213> pear <400> 6 taacaaattt tactaccaaa ggattccatt ttagc 35

Claims

1. Application of primer combination in assisted selection breeding for red and / or green trait of pear peel, characterized in that: The primer combination consists of a primer pair 1 and a primer pair 2; the upstream primer sequence of the primer pair 1 is the sequence shown in SEQ ID NO: 1, and the downstream primer sequence of the primer pair 1 is the sequence shown in SEQ ID NO: 2; the upstream primer sequence of the primer pair 2 is the sequence shown in SEQ ID NO: 4, and the downstream primer sequence of the primer pair 2 is the sequence shown in SEQ ID NO: 5; the pear is a hybrid combination population of 'Apple Pear'×'August Red'; the application comprises the following steps: (1) PCR amplification was performed using primer pair 1. If the band pattern was a double band of 196 bp and 133 bp, it indicated that the plant was red-skinned; if the band pattern was a single band of 196 bp, it indicated that the plant was green-skinned; (2) PCR amplification was performed using primer pair 2. If the band pattern was a double band of 138 bp and 172 bp, it indicated that the plant was red-skinned; if the band pattern was a single band of 138 bp, it indicated that the plant was green-skinned; (3) When PCR amplification is performed using primer pair 1 and primer pair 2 respectively, if the amplification result of any one of the primer pairs indicates a red-skinned plant, the plant is preliminarily considered to have a red phenotype; otherwise, the plant is preliminarily considered to have a green phenotype.

2. Application of the kit in assisted selection breeding for red and / or green trait of pear peel, characterized in that: The kit comprises the primer combination of claim 1, and the pear is a hybrid combination population of 'Apple Pear'×'August Red'; and the application comprises the following steps: (1) PCR amplification was performed using primer pair 1. If the band pattern was a double band of 196 bp and 133 bp, it indicated that the plant was red-skinned; if the band pattern was a single band of 196 bp, it indicated that the plant was green-skinned; (2) PCR amplification was performed using primer pair 2. If the band pattern was a double band of 138 bp and 172 bp, it indicated that the plant was red-skinned; if the band pattern was a single band of 138 bp, it indicated that the plant was green-skinned; (3) When PCR amplification is performed using primer pair 1 and primer pair 2 respectively, if the amplification result of any one of the primer pairs indicates a red-skinned plant, the plant is preliminarily considered to have a red phenotype; otherwise, the plant is preliminarily considered to have a green phenotype.

3. The application according to claim 2, characterized in that: The kit also includes one or a combination of PCR amplification enzyme, deionized water, positive control, and negative control.

4. A method for auxiliary selection breeding of pear fruit skin red and / or green traits, characterized in that: The following steps are involved: Extracting DNA from hybrid seedlings to be selected for breeding, and performing PCR amplification using the primer combination of claim 1 or the kit of claim 2 or 3, wherein the hybrid seedlings are 'Pingguoli'×'Bayuehong' hybrid seedlings; The method for judging the result of PCR amplification comprises the following steps: (1) PCR amplification was performed using primer pair 1. If the band pattern was a double band of 196 bp and 133 bp, it indicated that the plant was red-skinned; if the band pattern was a single band of 196 bp, it indicated that the plant was green-skinned; (2) PCR amplification was performed using primer pair 2. If the band pattern was a double band of 138 bp and 172 bp, it indicated that the plant was red-skinned; if the band pattern was a single band of 138 bp, it indicated that the plant was green-skinned; (3) When PCR amplification is performed using primer pair 1 and primer pair 2 respectively, if the amplification result of any one of the primer pairs indicates a red-skinned plant, the plant is preliminarily considered to have a red phenotype; otherwise, the plant is preliminarily considered to have a green phenotype.

5. The method according to claim 4, characterized in that: The reaction conditions of PCR amplification include: 94°C, 3 min; 95°C, 10 s, 56°C, 30 s, 72°C, 30 s, 35 cycles; 72°C, 5 min.

Images