A kit and method for identifying transcription factor-chromatin interactions in plants using CUT&Tag technology.

By using biotinylated Tn5 transposase and streptavidin magnetic bead purification technology, the sensitivity problem of CUT&Tag technology in identifying low-abundance transcription factors in plants has been solved, realizing the combination of high-throughput sequencing and real-time PCR, and promoting the comprehensive development of plant transcription factor research.

CN114544925BActive Publication Date: 2025-11-14ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111382964.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-22
Publication Date
2025-11-14
Estimated Expiration
2041-11-22

AI Technical Summary

Technical Problem

The existing CUT&Tag technology has low sensitivity in identifying low-abundance transcription factors interacting with DNA in plants, and it cannot be used for quantitative real-time PCR experiments, which limits its research applications.

Method used

The biotinylated Tn5 transposase-mediated CUT&Tag technology is used to form a biotinylated Tn5 transposase dimer by incubating biotinylated adapter primers with the transposase. Combined with streptavidin magnetic bead purification technology, the target DNA fragment can be purified and subsequently analyzed by high-throughput sequencing or quantitative real-time PCR.

Benefits of technology

It achieves highly sensitive identification of low-abundance transcription factors interacting with DNA, and is capable of high-throughput sequencing and quantitative PCR, making up for the shortcomings of conventional CUT&Tag technology and providing a complete research protocol for plant transcription factors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114544925B_ABST
    Figure CN114544925B_ABST
Patent Text Reader

Abstract

This invention discloses a kit and method for identifying transcription factor-chromatin interactions in plants using CUT&Tag technology. The kit includes: biotinylated Tn5 transposase, nuclear extraction buffer, antibody hybridization buffer, streptavidin washing buffer, DNA elution buffer, primary antibody, secondary antibody, DNA purification magnetic beads, streptavidin magnetic beads, protease inhibitor, digitalis saponin solution, Triton X-100 solution, pre-packed Phase Lock Gel, DNA co-precipitant, and PCR reaction solution. This invention overcomes the shortcomings and limitations of existing CUT&Tag technology in plant applications, providing a widely applicable CUT&Tag-seq and CUT&Tag-qPCR strategy and corresponding kit for studying interactions between chromatin-binding proteins and DNA, particularly those with low abundance, in both plants and animals, thus promoting the development of new technologies and methods for epigenetic regulation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to a kit and method for identifying the interaction between transcription factors and chromatin in plants using CUT&Tag technology. Background Technology

[0002] Gene expression regulation plays a crucial role in the growth and development of multicellular organisms. In multicellular organisms, all cells share the same genome sequence. However, genomic regulation, including DNA methylation, histone modifications, and differential binding of transcription factors and their recruited protein complexes, leads to differences in gene expression across different tissues and developmental stages.

[0003] Chromatin immunoprecipitation (ChIP) is a widely used chromatin analysis method and is the gold standard for studying genome-wide DNA-protein interactions. The principle of ChIP is to fix the target protein and DNA complex with formaldehyde, then fragment the chromatin complex using mechanical sonication or enzymatic digestion. Following this, antibody-based co-precipitation enrichment of the target protein is performed, thereby simultaneously enriching the chromatin fragments interacting with the target protein. Furthermore, the enriched chromatin fragments can be used for subsequent high-throughput sequencing studies to characterize binding across the entire genome, or for quantitative real-time PCR (qPCR) experiments to verify the binding of transcription factors to specific DNA candidate sites.

[0004] In 2019, the Fred Hutchinson Cancer Research Center in Seattle developed CUT&Tag (Cleavage Under Targets and Tagmentation) technology, a novel strategy for epigenomic chromatin analysis. Its principle differs fundamentally from ChIP. In principle, CUT&Tag is an enzyme-tethering strategy. It first uses an antibody to recognize a target protein within an intact cell or cell nucleus. Then, a Protein A / G fused Tn5 transposase is added to recognize the antibody bound to the target protein. Thus, the Tn5 transposase is tethered near the target protein and its bound chromatin. Under the influence of magnesium ions, the Tn5 transposase cleaves the adjacent chromatin and adds a DNA adapter. The resulting target fragment is used for subsequent library construction and high-throughput sequencing.

[0005] CUT&Tag functions the same as conventional ChIP technology, but has its own unique advantages: 1) High resolution and low background signal due to in situ activation of transposase; 2) Because DNA sonication is not required to fragment chromatin, the library construction process does not require adapters, which greatly simplifies the experimental operation and library construction process and saves experimental time; 3) Due to the high sensitivity of the process, only a small amount of starting materials are needed.

[0006] CUT&Tag technology is a relatively new technology and is still rapidly developing and refining. Initially, CUT&Tag was used for chromatin state analysis in animal cells. Currently, CUT&Tag workflows / methods for histone modification research have been specifically reported in both animal and plant cells; in animals, research on histone modification using CUT&Tag has even progressed to the single-cell level. However, due to the influence of cell wall tissues and various secondary metabolites in plants, CUT&Tag workflows for studying the binding of specific plant transcription factors to chromatin remain a challenge.

[0007] First, the presence of cell walls, large vacuoles, and complex secondary metabolites in plant cells limits the entry of antibodies and transposases into the cell. While there are successful reports of plant CUT&Tag experiments using extracted plant cell nuclei for CUT&Tag reactions, only histone modifications H3K4me3 and H3K27me3, which are present in high abundance in chromatin, have been successfully identified in both plants and animals. However, there are currently no successful reports of using CUT&Tag to identify plant-specific transcription factors binding to DNA. This is likely due to the fact that CUT&Tag technology is designed to use low starting cell amounts. Existing purification and library construction methods are also based on CUT&Tag reactions with low cell starting amounts. Because the amount of chromatin used is insufficient (less than that used in traditional ChIP), the sensitivity for identifying low-abundance transcription factor interactions with DNA is low. Furthermore, increasing the amount of chromatin in the reaction system can lead to excessive uncut DNA, which can affect subsequent next-generation library construction and sequencing. Therefore, establishing a CUT&Tag workflow suitable for plant transcription factor research, especially low-abundance transcription factors, is a significant challenge.

[0008] ChIP combined with qPCR is the gold standard for identifying the binding of transcription factors to specific DNA regions. However, conventional CUT&Tag assays have a significant drawback compared to traditional ChIP: they cannot be followed by quantitative real-time PCR (qPCR) experiments like ChIP-qPCR. This is because, in principle, after the CUT&Tag reaction, uncut (non-target) chromatin remains in the system and cannot be removed. This makes it impossible to distinguish between total input chromatin and fragmented target chromatin, thus hindering subsequent qPCR experiments. This limitation severely restricts the application of CUT&Tag in identifying specific pre-selected DNA binding sites for transcription factors. It's conceivable that researchers would use CUT&Tag combined with high-throughput sequencing to study the overall binding characteristics across the entire genome, while simultaneously performing traditional ChIP-qPCR to separately determine the binding of transcription factors to a few gene sites of interest. This approach is extremely unscientific and unreasonable in terms of experimental design, operation, and reagents.

[0009] Due to these limitations of CUT&Tag, current commercially available CUT&Tag-based kits for studying chromatin states are all suitable for small sample sizes, limited to library construction and high-throughput sequencing, and only well-suited for studies in small numbers of animal cells. To date, there is no complete and effective CUT&Tag kit for plant transcription factors. Summary of the Invention

[0010] The technical problem to be solved by this invention is to overcome the defects and shortcomings of existing CUT&Tag technology in plants, and to provide a CUT&Tag-seq and CUT&Tag-qPCR strategy and corresponding kits that are widely applicable in the study of the interaction between chromatin-binding proteins (such as transcription factors) and DNA in animals and plants, especially in plants with low abundance, thereby promoting the development of new technologies and methods for epigenetic regulation.

[0011] The specific technical solution is as follows:

[0012] This invention provides a kit for identifying transcription factor-chromatin interactions in plants using CUT&Tag technology. The kit comprises: biotinylated Tn5 transposase, nuclear extract, washing buffer, antibody hybridization buffer, streptavidin washing buffer, DNA elution buffer, primary antibody, secondary antibody, DNA purification magnetic beads, streptavidin magnetic beads, protease inhibitor, digitalis saponin solution, EDTA solution, sodium chloride solution, magnesium chloride solution, Triton X-100 solution, sodium dodecyl sulfate solution, glycine solution, pre-packed Phase Lock Gel, DNA co-precipitant, and PCR reaction solution.

[0013] Since this kit is mediated by a transposase containing a biotinylated linker sequence, we call it the biotinylated transposase-mediated CUT&Tag (B-CUT&Tag).

[0014] Further, the biotinylated transposase is formed by incubating the transposase with a biotinylated DNA adapter primer; the biotinylated DNA adapter primer consists of a double linker I formed by annealing primer A and primer B and a double linker II formed by annealing primer A and primer C; primer A contains a mosaic end (ME) sequence fragment recognized by the transposase, phosphorylated at the 5' end, and modified with an amino group (AminolinkerC7) at the 3' end; the 3' end of primer B is a sequence that is inversely complementary to primer A, and the 5' end is a sequencing adapter sequence; the 3' end of primer C is a sequence that is inversely complementary to primer A, and the 5' end is a sequencing adapter sequence; the 5' end of either primer B or primer C is labeled with biotinylated triethylene glycol.

[0015] Preferably, the Tn5 transposase is pG-Tn5 transposase or pA-Tn5 transposase; the nuclear extraction buffer is Tris buffer containing 0.5%-1% Triton X-100; the washing buffer is Tris buffer containing protease inhibitors and digitalis saponins; the antibody hybridization buffer is Tris buffer containing EDTA, BSA, protease inhibitors and digitalis saponins; the streptavidin washing buffer is Tris buffer containing EDTA and Tween-20; the DNA elution buffer is a solution containing sodium acetate and formamide; and the DNA purification magnetic beads are magnetic beads with surface carboxylation modification.

[0016] Preferably, the PCR reaction solution includes: primer I, primer II, and PCR premix solution;

[0017] The base sequence of primer I is one of the sequences shown in SEQ ID NO.4-SEQ ID NO.15; the base sequence of primer II is one of the sequences shown in SEQ ID NO.16-SEQ ID NO.23.

[0018] This invention relates to a comprehensive solution and related kits for identifying plant transcription factor-chromatin interactions. First, using conventional primer modification methods, the adapter primers used for transposase embedding are biotin-labeled, resulting in biotin-labeled transposons after embedding. These transposons mediate the cleavage of target gene sites, simultaneously attaching their own biotinylated adapters to the cleaved DNA sites (cut-and-paste principle). Second, after obtaining total DNA for the CUT&Tag reaction using conventional plant DNA extraction methods, the biotin-streptavidin binding property is utilized to purify the biotinylated target gene DNA fragments from the total DNA using streptavidin magnetic beads, removing a large amount of genomic DNA that has not been recognized and cleaved by transcription factors and transposases. Then, polymerase chain reaction (PCR) is used... The biotinylated double-stranded DNA bound to magnetic beads undergoes an extension reaction on the beads to fill in the protruding ends generated by transposase cleavage. Next, the double-stranded DNA bound to the magnetic beads is denatured using a specific concentration of sodium hydroxide at a specific temperature, thereby releasing the unbiotinylated single strand into the solution. After further pH adjustment to neutral, precipitation, and washing, purified single-stranded DNA with sequencing adapters is obtained. This can be used for subsequent next-generation sequencing library construction, and more importantly, for quantitative real-time PCR (qPCR) experiments to identify the binding status of transcription factors to specific candidate sites. Finally, this invention provides an optimized subsequent qPCR protocol, i.e., a data analysis strategy.

[0019] This invention also provides a method for identifying transcription factor-chromatin interactions in plants using CUT&Tag technology, comprising the following steps:

[0020] (1) Biotinylated DNA adapter primers were incubated with Tn5 transposase to assemble biotinylated Tn5 transposase dimers.

[0021] (2) Fix the interaction state between transcription factors and chromatin in the cell nucleus and extract the cell nuclei of the plant tissue to be tested;

[0022] (3) Primary and secondary antibodies are used to identify transcription factors that bind to chromatin in the cell nucleus. Then, biotinylated transposase dimers are used to identify the region where the antibody is located and cut the chromatin to form biotinylated chromatin fragments.

[0023] (4) Extract the DNA after the reaction using plant genomic DNA extraction solution, and purify the biotin-labeled DNA fragments using streptavidin magnetic beads to form a streptavidin magnetic bead-DNA fragment mixture.

[0024] (5) Using streptavidin magnetic bead-DNA fragment as a template, PCR library construction was performed to establish a high-throughput sequencing library of transcription factor-chromatin interaction.

[0025] (6) Library quality control, high-throughput sequencing and bioinformatics analysis;

[0026] or,

[0027] (A) Biotinylated DNA adapter primers were incubated with Tn5 transposase to assemble biotinylated Tn5 transposase dimers.

[0028] (B) Fix the interaction state between transcription factors and chromatin in the cell nucleus and extract the cell nuclei from the plant tissue to be tested;

[0029] (C) Primary and secondary antibodies are used to recognize transcription factors that bind to chromatin in the cell nucleus. Biotinylated transposase dimers are then used to recognize the regions where the antibodies are located and cut the chromatin to form biotinylated chromatin fragments.

[0030] (D) Extract DNA from the reaction using plant genomic DNA extraction solution, take out a portion of the DNA solution to use as input DNA for real-time PCR, then use DNA purification magnetic beads to bind large fragments in the remaining DNA, and recover the supernatant solution.

[0031] (E) Use streptavidin magnetic beads to purify the small fragments in the product of step (D) with biotin-avidin to form a streptavidin magnetic bead-DNA fragment mixture;

[0032] (F) The DNA fragments bound to the streptavidin magnetic beads were eluted using DNA elution buffer; and the eluted DNA was used as a template for real-time PCR.

[0033] (G) The ΔCt method was used to analyze the real-time PCR data.

[0034] Furthermore, in step (1), the specific steps include:

[0035] a) Preparation of biotinylated DNA adapter primers: double linker I is formed by annealing primer A and primer B, and double linker II is formed by annealing primer A and primer C;

[0036] Primer A contains a transposase-recognized mosaic end (ME) sequence fragment, phosphorylated at the 5' end, and modified with an amino group (AminolinkerC7) at the 3' end; Primer B has a sequence at the 3' end that is inversely complementary to primer A, and a sequencing adapter sequence at the 5' end; Primer C has a sequence at the 3' end that is inversely complementary to primer A, and a sequencing adapter sequence at the 5' end; the 5' end of either primer B or primer C is labeled with biotinylated triethylene glycol.

[0037] b) Preparation of Tn5 transposase dimer: Adapter I and adapter II are mixed in a 1:1 ratio to form an adapter mixture, and the adapter mixture is incubated with Tn5 transposase to form Tn5 transposase dimer.

[0038] Preferably, in step (5), the PCR reaction system includes: primer I, primer II, and PCR premix; the base sequence of primer I is one of the sequences shown in SEQ ID NO.4-SEQ ID NO.15; the base sequence of primer II is one of the sequences shown in SEQ ID NO.16-SEQ ID NO.23. The PCR reaction program is: 98℃ for 3 min, 98℃ for 30 s; 98℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 18-20 cycles, 72℃ for 5 min.

[0039] Preferably, in step (D), the DNA elution buffer is formulated as a solution containing 30 mM sodium acetate and 95% formamide at pH 9.0; and the DNA purification magnetic beads are AMPure XP Beads magnetic beads.

[0040] Preferably, in step (F), the reaction system of the real-time PCR includes: SYBR Green, template, upstream gene-specific primer, and downstream gene-specific primer; the template is the input DNA in step (D) and the DNA eluted in step (F); the target fragment region covered by the upstream and downstream gene-specific primers contains the predicted transcription factor binding motif; the reaction program is: 98℃ for 3 min, 98℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, for 45 cycles.

[0041] Further, in step (G), the ΔCt method is any one of the following:

[0042] (G-1)ΔCt = Ct value of antibody group sample - Ct value of IgG control group sample, the enrichment factor of antibody group fragment is = 2 -ΔC The antibody group refers to samples that have undergone CUT & Tag reactions using antibodies specific to the target transcription factor or antibodies against fusion protein tags as primary antibodies; the IgG control group refers to samples that have undergone CUT & Tag reactions using IgG.

[0043] (G-2)ΔCt = Ct value of CUT & Tag sample – Ct value of 1% input, then the proportion of the target fragment in the CUT & Tag sample to 1% input = 2 -ΔCt ×100%. The CUT&Tag sample refers to the antibody group or the IgG control group CUT&Tag. The 1% input DNA comes from step (D); finally, the difference in the proportion of the target fragment in the antibody group and the IgG control group is compared.

[0044] Experiments have shown that the combination of B-CUT&Tag and high-throughput sequencing (B-CUT&Tag-seq) can be applied to the study of high-abundance histone modifications, and the generated signal is highly consistent with the ordinary CUT&Tag signal. This demonstrates the feasibility and accuracy of the B-CUT&Tag process.

[0045] Next, B-CUT&Tag and high-throughput sequencing (B-CUT&Tag-seq) were applied to studies on plant transcription factor-chromatin interactions that could not be successfully completed using ordinary CUT&Tag, yielding excellent results. Taking the SPL9 transcription factor, which has been thoroughly studied in plants, as an example, B-CUT&Tag was used to study SPL9 target genes. The results showed that SPL9 targets the small RNA gene miR172, which is related to the transition from juvenile to adulthood in Arabidopsis thaliana; targets multiple MADS box genes (including AP1, LFY, FUL, AGL42, SOC1, etc.) related to the flowering pathway; targets the BRC1 gene to regulate plant branching; targets MYB genes, including TCL1, TRY, CPC, and ETC3, to participate in the development of epidermal trichomes; targets genes involved in anthocyanin and wax synthesis to participate in the regulation of plant secondary metabolite synthesis; and also binds to genes involved in the signal transduction and response pathways of plant hormones gibberellin and methyljasmonic acid, regulating the interactions between hormone responses. These target genes show a high degree of similarity to those obtained by traditional chromatin immunoprecipitation (ChIP) and have been further confirmed by promoter and gel migration assays (EMSA), supported by high-quality research papers. Therefore, B-CUT&Tag-seq has proven to produce accurate and stable results.

[0046] Furthermore, this invention developed a suitable subsequent qPCR system for B-CUT&Tag. First, using qPCR with high abundance of histone H3K4me3 modification as an example, we found that primer pairs designed with the same strategy as ChIP-qPCR—namely, gene-specific upstream and downstream primer pairs—can be successfully used in qPCR studies of histone modifications with low chromatin input, achieving excellent enrichment compared to the IgG control group. The resulting enrichment signal is consistent with the signal trend of CUT&Tag-seq. Further studies using plant transcription factors AtSPL9 and OsPHR2 as examples revealed that the subsequent qPCR procedure developed using high abundance of histone H3K4me3 modification is also applicable to B-CUT&Tag-qPCR of plant transcription factors. Finally, we clarified the method for CUT&Tag-qPCR data analysis, finding that the amplification cycle number (Ct) of the IgG control group and the sample's own unpurified 1% input can both be used as normalized controls for calculating the relative enrichment fold or proportion.

[0047] The invention of the B-CUT&Tag-seq and B-CUT&Tag-qPCR systems, and the establishment of comprehensive experimental protocols in plants, facilitate the study of transcription factor-chromatin interactions in plants. Based on the principle of B-CUT&Tag, a large amount of uncut chromatin from non-target genes can be purified and removed using biotinylate without affecting downstream library construction and sequencing. Theoretically, low-abundance transcription factors can also achieve target gene analysis by flexibly adjusting the staining quality used in the reaction or by combining chromatin from multiple experiments for purification.

[0048] Compared with the prior art, the present invention has the following beneficial effects:

[0049] Compared to existing CUT&Tag technologies, B-CUT&Tag technology uses Tn5 transposase to link biotin-labeled linkers to the target sites of transcription factors. It also eliminates uncut non-target chromatin through a biotin-avidin purification step, purifying the biotin-labeled chromatin fragments. Based on this principle, the amount of chromatin in the reaction system can be flexibly increased as needed without affecting downstream library construction and sequencing. This method is an experimental procedure specifically developed for large-sample CUT&Tag reactions and shows great promise in the study of interactions between DNA and chromatin-binding proteins, especially those with low abundance (such as rare histone modifications and specific transcription factors). It will greatly promote research on the epigenetic regulation of gene expression in the life sciences.

[0050] More importantly, compared with conventional CUT&Tag technology, the establishment of B-CUT&Tag and subsequent qPCR system makes up for the inability of conventional CUT&Tag technology to perform qPCR. It achieves the same function as the gold standard method for identifying the binding of transcription factors to specific sites in chromatin, namely chromatin immunoprecipitation combined with qPCR (ChIP-qPCR), and is simpler to operate than ChIP. Attached Figure Description

[0051] Figure 1 This describes the technical principle of the CUT&Tag reagent kit of the present invention.

[0052] Figure 2 A comparison of the B-CUT&Tag workflow with the traditional chromatin immunoprecipitation (ChIP) workflow.

[0053] Figure 3 The results of B-CUT&Tag technology analysis of the H3K4me3 modification status of Arabidopsis leaf cells;

[0054] In this figure, a represents the correlation analysis results of sequencing signal distribution among different samples; b represents the heatmap of signals from three different CUT&Tag samples near the coding gene.

[0055] Figure 4 Electrophoresis gel images of the experimental process for studying the target genes of SPL9 using B-CUT&Tag;

[0056] Among them, the two anti-FLAG samples (anti-FLAG rep1 and anti-FLAG rep2) were two experimental replicates, and the two IgG samples were two negative controls; the samples were DNA that had not been bound after being purified by streptavidin.

[0057] Figure 5 A heatmap of signal distribution was generated for the analysis of target genes of SPL9 using B-CUT & Tag-seq; two SPL9 samples were two experimental replicates, and two IgG samples were two negative controls.

[0058] Figure 6 A summary diagram of some known SPL9 target genes successfully identified using B-CUT&Tag technology.

[0059] Figure 7 The figure shows the results of identifying the H3K4me3 histone modification levels in two different regions of a specific GB_D10G1774 gene locus using B-CUT&Tag-qPCR.

[0060] In the figure, a is a schematic diagram of the four combinations of attachment adapters for Tn5 transposase to cleave target chromatin; b is an IGV diagram of the CUT&Tag-seq results of the GB_D10G1774 gene site, from top to bottom, showing the number of reads aligned to different regions in the H3K4me3 experimental group and the IgG control group, and the CUT&Tag-qPCR results of the relative content of fragments in different regions in the H3K4me3 experimental group and the IgG control group; c is the qPCR results of the corresponding regions of the same gene site, where the control group is the DNA of the sample before biotinylate purification, i.e., input DNA.

[0061] Figure 8 This demonstrates that primer P1 causes nonspecific amplification in B-CUT&Tag-qPCR.

[0062] In this diagram, a is a schematic diagram of the cause of non-specific amplification by the P1 single primer in qPCR; b is a qPCR amplification curve of the experimental group and the control group in the presence of the P1 single primer.

[0063] Figure 9Figure showing the results of using B-CUT&Tag-qPCR to identify the binding of Arabidopsis SPL9 transcription factor and rice PHR2 transcription factor to their target genes.

[0064] Figure a shows the igv graph of signal enrichment at three target gene sites in the B-CUT & Tag-seq results of Arabidopsis SPL9 transcription factor, with AtACT2 gene as a control; Figure b shows the comparison of RPM (number of reads aligned to the target region per million reads) of the qPCR target region (marked in Figure a) in the B-CUT & Tag-seq data between the rSPL9 experimental group and the IgG control group; Figure c shows the B-CUT & Tag-qPCR results of the enrichment of the target regions AtTCL1, AtTRY, AtFUL, and AtACT2 in the rSPL9 experimental group compared to the IgG control group; Figure d shows the distribution of the P1BS motif in the promoter regions of the three known target genes of rice PHR2 transcription factor; Figure e shows the B-CUT & Tag-qPCR results of the enrichment of the target regions OsPT2, OsPT8, and OsRAM1 in the PHR2 experimental group compared to the IgG control group under different phosphorus deficiency (-P) and sufficient (+P) treatments. Detailed Implementation

[0065] The present invention will be further described below with reference to the accompanying drawings, tables, and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following embodiments are all commercially available reagents.

[0066] Example 1: B-CUT & Tag Technology Principles and Operation Procedures

[0067] I. Generation of Tn5 transposases with biotin-labeled linkers

[0068] The protein A fusion Tn5 transposase used in the experiment was commercially available at a concentration of 500 ng / μL or 7.5 pmol / μL.

[0069] 1.1 Synthesis of adapter primers:

[0070] The primers and adapters used were synthesized using conventional primers and modified primers. Three primers were used: primer A, primer B, and primer C. Their base sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively. Primer A is a transposase-recognized ME sequence fragment modified with 5'-Phosphate and 3'-AminolinkerC7. Primer B has a 3' end that is inversely complementary to primer A, and a 5' end modified with a sequencing adapter sequence (5' end modified with Biotin TEG). Primer C is a standard primer with a 3' end that is inversely complementary to primer A, and a 5' end modified with a sequencing adapter sequence. The adapter sequences may vary depending on the sequencing platform and are not limited to these specific sequences. The detailed primer sequences are shown in Table 1.

[0071] Table 1 List of adapter primers

[0072]

[0073]

[0074] 1.2 Primer annealing to form a double linker:

[0075] Dispense primers into 1 OD tubes. Add annealing buffer to prepare a 100 μM stock solution (which can be stored long-term at -20°C). Then, set up the following reaction in two PCR tubes:

[0076] Reaction 1 (linker AB): 10 μL primer A (100 μM), 10 μL 100 μM primer B (100 μM);

[0077] Reaction 2 (linker AC): 10 μL primer A (100 μM), 10 μL 100 μM primer C (100 μM).

[0078] The tubes were placed in a PCR instrument and the following program was run: with a heated lid, 75°C for 15 minutes; 60°C for 10 minutes; 50°C for 10 minutes; 40°C for 10 minutes; 25°C for 30 minutes. The final adapter concentration was 50 pmol / μL per adapter.

[0079] 1.3 Biotinylated transposase generation (formation of transposase dimers):

[0080] The following reaction was performed in a 1.5 ml centrifuge tube to embed the transposase: 10 μL pA-Tn5 transposase (500 ng / μL or 7.5 pmol / μL), 0.75 μL adapter AB (50 pmol / μL), 0.75 μL adapter AC (50 pmol / μL), and 7.25 μL embedding buffer, for a total of 18.75 μL. Therefore, the ratio of adapter mixture to transposase in the system was 1:1. The mixture was gently pipetted 20 times to ensure thorough mixing, and then incubated in a 30°C water bath for 1 hour. The resulting transposase concentration was 4 pmol / μL. The embedded transposase was stored at -20°C.

[0081] II. Preparation of each component of the reagent kit

[0082] The formulation of each component of the reagent kit (taking the optimal composition as an example) is as follows:

[0083] The kit includes one core enzyme (pA-Tn5 or pG-Tn5 transposase), five buffer stock solutions (10×IsoB, 10×WB, 5×AB, 2×SA WB, EB), two types of magnetic beads, two antibodies (IgG negative control antibody and H3K4me3 positive control antibody), and 11 other reagents / consumables, prepared to the concentrations shown in Table 2. The five buffer stock solutions are prepared according to the formulations in Table 3. Before the experiment, the working solutions are prepared according to the formulations provided in Table 4 and used immediately.

[0084] Table 2. List of reagent kit components

[0085]

[0086]

[0087] Table 3 Storage solution formulation

[0088]

[0089]

[0090] Table 4 Working solution formulation (prepare and use immediately)

[0091]

[0092]

[0093] Figure 1 The technical principle of the CUT&Tag kit of this invention is as follows: it demonstrates that biotin-labeled transposases participate in the CUT&Tag reaction, cutting and attaching biotinylated linkers to the chromatin at the target site, thereby obtaining biotinylated chromatin fragments. After further purification based on biotinylate, the product is used for subsequent library construction and sequencing or quantitative real-time PCR.

[0094] III. Specific Steps for B-CUT & Tag

[0095] (a) Formaldehyde cross-linking treatment was performed on plant tissues to fix the interaction state between transcription factors and chromatin in the cell nucleus, and the intact cell nuclei of the plant tissues to be tested were extracted.

[0096] The key extraction process involves filtering the lysed cells through a 500-mesh filter, collecting the cell nuclei that pass through the filter, and gently washing them with WB(C+) buffer. The WB(C+) buffer is prepared by diluting the 10x WB stock solution provided in the kit to a 1x concentration and then adding a protease inhibitor cocktail at a ratio of 1:1000.

[0097] (b) Generate Tn5 transposase with biotin-labeled linkers (see Part I).

[0098] (c) Primary antibody incubation: Resuspend the cell nuclei in Ab buffer and incubate with primary antibody;

[0099] The volume ratio of cell nuclei (volume under centrifugal force of 300×g-400×g) to AB buffer is 1:20, that is, 50 μL of cell nuclei are resuspended in 1 mL of AB buffer; the volume of the above cell nucleus suspension used for each reaction is 250 μL, and the content of primary antibody is 2 μg (1:125 dilution); the AB buffer is the 5x AB stock solution provided in the kit diluted to 1x concentration and then the protease inhibitor cocktail is added at 1:1000, and 5% w / v digitonin is added at a volume ratio of 1:50 (0.1% final concentration) or 1:100 (0.05% final concentration).

[0100] (d) Secondary antibody incubation: Gently wash the cell nuclei to remove unbound primary antibody, and add secondary antibody for signal amplification; the secondary antibody content is 250 μL WB(C+D+) buffer containing 1 μg (1:250 dilution), the WB(C+D+) buffer is the 10x WB stock solution provided in the kit diluted to 1x concentration, the protease inhibitor cocktail is added at 1:1000, and 5% w / v digitonin is added at a volume ratio of 1:100 (0.05% final concentration).

[0101] (e) Transposase incubation: Gently wash the cell nuclei to remove unbound secondary antibodies, and add pA-Tn5 transposase for incubation; wherein, the content of Tn5 transposase is 250 μL TIB buffer containing 8 pmol pA-Tn5 transposase, and the TIB buffer is WB(C+D+) added to 3M sodium chloride solution at a volume ratio of 1:20 in step (h).

[0102] (f) Fragmentation: The cell nucleus was gently washed to remove unbound pA-Tn5 transposase, and TB buffer was added for fragmentation. TB buffer was prepared by adding WB(C+D+) to 3M sodium chloride solution at a volume ratio of 1:20 and 1M magnesium chloride solution at a volume ratio of 1:100 in step (h), and then cutting at 37°C for 1 hour.

[0103] (g) Biotinylate purification of DNA: After the reaction in step (f) is completed, DNA is extracted according to conventional methods and purified by streptavidin magnetic beads; DNA is added to pre-washed streptavidin magnetic beads and incubated by rotation at room temperature for 30-40 minutes to bind biotinylated DNA fragments to streptavidin magnetic beads. After washing, a mixture of streptavidin magnetic beads and DNA is obtained and finally resuspended in sterile water.

[0104] The concentration of streptavidin magnetic beads is 10 mg / ml, with each milligram of magnetic bead capable of binding 500-3500 pmol of biotinylated DNA fragments; the amount of streptavidin magnetic beads used is 5-10 μl; the pre-washing and activation method for streptavidin magnetic beads is as follows: wash the streptavidin magnetic beads twice with 1×SA WB buffer, then wash once with 2×SA WB buffer, and finally resuspend in 2×SA WB buffer; 2×SA WB buffer is provided by the kit, and 1×SA WB can be obtained by diluting 2×SA WB buffer; the magnetic bead-DNA mixture is finally resuspended in 50 μl of sterile water.

[0105] (h) PCR on magnetic beads: PCR library construction was performed using the product of step (g) as a template. The reaction system was: 42 μl of the product of step (g), 4 μl of primer N70X, 4 μl of primer N50X, and 50 μl of PCR mix. The reaction program was: 98℃ for 3 min, 98℃ for 30 s; 98℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 18-20 cycles, 72℃ for 5 min. The base sequences of primers N701-N712 are shown in SEQ ID NO.4-SEQ ID NO.15; the base sequences of primers N501-N508 are shown in SEQ ID NO.16-SEQ ID NO.23.

[0106] (i) Library quality control, high-throughput sequencing and bioinformatics analysis.

[0107] The principle of B-CUT&Tag technology is as follows: Figure 1 The demonstration showed that biotin-labeled transposase DNA adapters were used to add biotin-labeled primers and adapters to DNA fragments during transposase chromatin digestion. The DNA was then purified using a biotin-streptavidin system and subsequently used for PCR library construction.

[0108] Compared to conventional CUT&Tag, the B-CUT&Tag adapter primers are biotin-labeled; therefore, after embedding, the mature transposons are fitted with biotin-labeled adapters. In the cell nucleus, the target protein bound to a segment of chromatin is recognized by its specific antibody or by an antibody fused to the target protein. Subsequently, the Tn5 transposase fused to protein A recognizes and binds to the antibody. Activated by magnesium ions, the transposase is activated and cleaves the chromatin in situ. The Tn5 transposase operates on a cleavage-and-paste model; after cleaving the chromatin, the adapter sequence is added to the cleaved site. Because the adapters in the B-CUT&Tag are biotin-labeled, the resulting chromatin flakes are ultimately biotin-labeled.

[0109] The second major difference between B-CUT&Tag and regular CUT&Tag lies in the subsequent biotin-avidin purification and magnetic bead in-situ PCR library construction. Fragmented chromatin, due to its biotin labeling, can be purified using avidin magnetic beads. Because the biotin-avidin binding is a very stable ligand-receptor relationship, once formed, it is difficult to separate the two. Therefore, B-CUT&Tag developed magnetic bead in-situ PCR library construction. Since only one adapter primer is labeled, one strand of the double-stranded DNA generated by Tn5 transposase fragmentation is not biotin-labeled. This unlabeled strand can be used as a template for amplification during DNA denaturation under PCR heating, where the hydrogen bonds in the base pairs of the nucleic acid double helix break, transforming the double strand into a single strand. This significantly reduces the impact of magnetic beads on PCR.

[0110] B-CUT&Tag technology still has incomparable advantages compared to traditional ChIP. Figure 2 This paper compares the B-CUT&Tag and ChIP workflows. It shows that B-CUT&Tag does not require sonication to break down chromatin, while the quality of sonication often directly determines the success of the ChIP reaction. Exploring the optimal sonication conditions for different amounts of chromatin at different fixed times is extremely challenging, and subsequent cross-linking verification of the breakdown effect also requires significant time. Furthermore, B-CUT&Tag technology directly incorporates sequencing adapter primers during fragmentation, allowing for direct PCR library construction. In contrast, ChIP requires adapter addition using specific kits. From the perspectives of time cost, reagent cost, and operational simplicity, B-CUT&Tag, like CUT&Tag, still holds significant advantages.

[0111] Example 2: Study on chromatin histone modification using B-CUT & Tag-seq

[0112] This embodiment first investigated the feasibility and signal stability of B-CUT&Tag technology. Using histone modification H3K4me3 as an example, and following a reported experimental system for small-scale input chromatin targeting histones (reference DOI: https: / / doi.org / 10.1186 / s13007-020-00664-8), the consistency and stability of the signal between B-CUT&Tag-seq and conventional CUT&Tag-seq were compared. This embodiment also included a sample where B-CUT&Tag-seq was performed directly on the extracted DNA (B-CUT&Tag beads) without streptavidin magnetic bead purification, similar to conventional CUT&Tag, to detect whether the activity of biotin linker-tagged transposases was affected. Furthermore, this embodiment included an IgG negative control to assess the strength of background shearing.

[0113] The results show that the three samples of H3K4me3—CUT&Tag, B-CUT&Tag beads-, and B-CUT&Tag—exhibit a high degree of signal consistency (correlation coefficient > 0.99). Figure 3 a). Analysis of enriched peaks using macs2 software yielded 17076, 18632, and 17309 peaks respectively from the CUT&Tag, B-CUT&Tag beads-, and B-CUT&Tag samples. The number of peaks was similar, and their signal intensity and characteristics near the genes were highly consistent. Figure 3 b).

[0114] The above results demonstrate that B-CUT&Tag is technically feasible, and that biotin labeling and magnetic bead in situ PCR do not affect the signal; that is, the generated signal is highly consistent with that of conventional CUT&Tag. This forms the basis for further research on transcription factor B-CUT&Tag.

[0115] Example 3: Study of transcription factor-DNA interactions using B-CUT & Tag-seq

[0116] This embodiment combines B-CUT & Tag with next-generation sequencing (B-CUT & Tag-seq) to study the interaction between plant transcription factors and DNA, aiming to identify target gene sites of transcription factors. This embodiment uses SPL9, a transcription factor that has been extensively studied in plants, as an example to explore whether B-CUT & Tag can be used to study target genes of plant transcription factors.

[0117] SPL9 has been reported to participate in the regulation of multiple developmental and metabolic pathways, including the transition from juvenile to adulthood, flowering, development of epidermal trichomes, synthesis of anthocyanins and epidermal waxes, branching development, and participation in plant hormone responses by targeting key signal transduction genes for methyljasmonic acid and gibberellin. The target genes of these pathways have been thoroughly validated experimentally in various high-level research papers (e.g., through promoter analysis, transgenic studies, gel arrest experiments, etc.).

[0118] This embodiment uses the kit and B-CUT&Tag method provided in Example 1 to analyze and identify SPL9:

[0119] Day 1:

[0120] Formaldehyde cross-linking and cell nucleus extraction (steps 1 to 11)

[0121] 1. Place 0.5 g of pSPL9::3xflag-rSPL9 transgenic Arabidopsis inflorescence in a container containing 25 ml of... IsoB(F+) Place the centrifuge tubes into 50 ml centrifuge tubes and vacuum-fix them for 10 minutes.

[0122] 2. Add 2.5 ml of 2M glycine, mix gently, and continue vacuuming for 5 minutes to terminate the reaction.

[0123] 3. Rinse the fixed inflorescence material three times with sterile water, and then remove excess water with absorbent paper.

[0124] 4. The material is ground into a fine powder in liquid nitrogen.

[0125] 5. Place the ground inflorescences into a 50 ml centrifuge tube and add 25 ml of pre-chilled ice water. IsoB Mix gently, place on ice and shake gently for 5 minutes to resuspend the material evenly, centrifuge at 400 x g for 5 minutes at 4 degrees Celsius, and collect the precipitate.

[0126] 6. Remove the supernatant and resuspend the material in 10 ml of water. IsoB(T+) In a 5-10 minute period of lysis, gently mix the contents of the centrifuge tubes and place them on ice.

[0127] 7. Filter the lysate through a 500-mesh cell sieve. Large, unly lysed tissues will remain on the sieve, while cell nuclei will pass through the sieve pores and be collected in a culture dish placed below.

[0128] 8. Collect the lysate containing cell nuclei in a 2 mL centrifuge tube, centrifuge at 400 x g for 5 minutes at 4 degrees Celsius, and collect the cell nuclei.

[0129] 9. Remove the supernatant and resuspend all cell nuclei in 1 ml. WB(C+E+)Centrifuge at 400x g for 5 minutes at 4 degrees Celsius to collect cell nuclei. This yields approximately 50 μL of cell nuclei.

[0130] 10. Remove the supernatant; at this point, approximately 50 μL of cell nuclei can be collected. Add 1 mL of... WB(C+E+) Resuspend the cell nuclei, centrifuge at 400×g for 5 minutes at 4 degrees Celsius, and collect the cell nuclei.

[0131] 11. Repeat step 10 for a total of three times. After the last wash, remove the supernatant and continue centrifugation at 400×g for 2 minutes at 4 degrees Celsius to remove as much of the remaining supernatant as possible.

[0132] Primary antibody incubation (steps 12 to 17)

[0133] 12. Add 50 μL of cell nuclei to 1 mL of... AB(C+D+) Resuspended and placed on ice for later use.

[0134] 13. Set up the following reactions in 1.5 mL centrifuge tubes: two IgG control groups, each replicate containing 250 μL of cell nucleus resuspension and 2 μg of IgG; two antibody experimental groups, each replicate containing 250 μL of cell nucleus resuspension and 2 μg of anti-Flag antibody. Gently mix and incubate overnight on a horizontal rocker at 12 rpm and 4°C.

[0135] 14. Remove the reaction tube from the shaker, centrifuge at 350x g for 4 minutes at 4 degrees Celsius, collect the cell nuclei, and remove the supernatant.

[0136] 15. Add 800 μL WB(C+D+) Resuspend the cell nuclei and place them on a horizontal rocker incubator. Incubate and wash at 12 rpm for 5 minutes at room temperature.

[0137] 16. Remove the reaction tube from the shaker, centrifuge at 350x g for 4 minutes at 4 degrees Celsius, collect the cell nuclei, and remove the supernatant.

[0138] 17. Centrifuge at 350x g for 2 minutes at 4 degrees Celsius, removing as much supernatant as possible.

[0139] Secondary antibody incubation (steps 18 to 22)

[0140] 18. Add 250 μL of solution containing 1 μg of secondary antibody. WB(C+D+) Resuspend the cell nuclei, gently mix, place on a horizontal rocker incubator, and incubate at 12 rpm for 1 hour at room temperature.

[0141] 19. Remove the reaction tube from the shaker, centrifuge at 350x g for 4 minutes at 4 degrees Celsius, collect the cell nuclei, and remove the supernatant.

[0142] 20. Add 800 μL WB(C+D+) Resuspend the cell nuclei, gently mix, place on a horizontal rocker incubator, and incubate at 12 rpm for 5 minutes at room temperature.

[0143] 21. Remove the reaction tube from the shaker, centrifuge at 350x g for 4 minutes at 4 degrees Celsius, collect the cell nuclei, and remove the supernatant.

[0144] 22. Repeat steps 21 to 22 for a total of three times. After the last wash, centrifuge at 350x g for 2 minutes at 4 degrees Celsius to remove as much supernatant as possible. Transposase incubation steps 23 to 27.

[0145] 23. Add 250 μL of solution containing 8 pmol transposase. TIB Resuspend the cell nuclei, gently mix, place on a horizontal rocker incubator, and incubate at 12 rpm for 3-4 hours at room temperature.

[0146] 24. Remove the reaction tube from the shaker, centrifuge at 350x g for 4 minutes at 4 degrees Celsius, collect the cell nuclei, and remove the supernatant.

[0147] 25. Add 800 μL WB(C+D+) Resuspend the cell nuclei, gently mix, place on a horizontal rocker incubator, and incubate at 12 rpm for 5 minutes at room temperature.

[0148] 26. Remove the reaction tube from the shaker, centrifuge at 350x g for 4 minutes at 4 degrees Celsius, collect the cell nuclei, and remove the supernatant.

[0149] 27. Repeat steps 25 to 26 for a total of three times. After the last wash, centrifuge at 350 x g for 2 minutes at 4 degrees Celsius to remove as much supernatant as possible.

[0150] Fragmentation reaction and decrosslinking (steps 28 to 30)

[0151] 28. Add 300 μL TB Resuspend the cell nuclei and incubate in a 37°C water bath for 1 hour to carry out the fragmentation reaction.

[0152] 29. Add 15 μL of EDTA and 15 μL of 20% SDS to each tube to terminate the reaction.

[0153] 30. The reaction tube was placed in a 65-degree water bath overnight to de-crosslink.

[0154] DNA extraction (steps 31 to 38)

[0155] 31. Add 300 μL of CTAB plant DNA extraction solution and incubate in a 65°C water bath for 39 minutes, gently inverting and mixing every 10 minutes during the process.

[0156] 32. Add 600 μL of phenol:chloroform:isoamyl alcohol (25:24:1) and mix thoroughly by inverting.

[0157] 33. Pre-centrifuge the pre-loaded phase gel lock centrifuge tube at 13000xg for 2 minutes, then transfer the sample to the phase gel lock centrifuge tube and centrifuge at 13000xg at 4 degrees for 10 minutes.

[0158] 34. Transfer the supernatant (about 600 μL) to a new 1.5 mL centrifuge tube, add 600 μL of chloroform, mix thoroughly by inverting, and centrifuge at 13000 x g for 10 minutes at 4 degrees Celsius.

[0159] 35. Transfer the supernatant (about 600 μL) to a new 1.5 mL centrifuge tube, add 600 μL isopropanol and 2 μL co-precipitant, mix thoroughly, and precipitate at -20°C for 1 hour.

[0160] 36. Centrifuge at 13000 x g for 10 minutes at 4 degrees Celsius.

[0161] 37. Remove the supernatant, wash the DNA precipitate with 75% alcohol, and centrifuge at 13000x g for 5 minutes at 4 degrees Celsius.

[0162] 38. Remove the supernatant, then incubate at 13000x g, 4°C for 30 seconds to remove as much supernatant as possible. Vacuum dry for 2 minutes, then redissolve the DNA in 150 μL of sterile water.

[0163] Biotin-streptavidin purification (steps 39 to 46)

[0164] 39. Resuspend 5-10 μL of streptavidin magnetic beads in 500 μL of water. 1×SA WB Mix well and place on a magnetic rack for about 5 minutes to collect the magnetic beads.

[0165] 40. Remove the supernatant, remove the centrifuge tube from the magnetic rack, and resuspend the magnetic beads in 500 μL of water. 1×SA WB Mix well and place on a magnetic rack for about 5 minutes to collect the magnetic beads. Remove the supernatant. (Second wash).

[0166] 41. Remove the centrifuge tubes from the magnetic rack and resuspend the magnetic beads in 500 μL of water. 2×SA WB Mix well and place on a magnetic rack for about 5 minutes to collect the magnetic beads. Remove the supernatant.

[0167] 42. Remove the centrifuge tubes from the magnetic rack and resuspend the magnetic beads in 150 μL of water. 2×SA WB Add 150 μL of the DNA sample obtained in step 38, mix well, and incubate in a hybridization oven at room temperature for 20-30 minutes.

[0168] 43. After incubation, place the centrifuge tubes on a magnetic rack for about 5 minutes to collect the magnetic beads. Remove the supernatant.

[0169] 44. Remove the centrifuge tubes from the magnetic rack and resuspend the magnetic beads in 500 μL of water. 1×SA WB Mix well and wash in a hybridization oven at room temperature for 5 minutes by rotation. Then place the centrifuge tube on a magnetic rack for about 5 minutes to collect the magnetic beads. Remove the supernatant.

[0170] 45. Repeat step 44 (cleaning step) a total of 3 times.

[0171] 46. ​​Resuspend the magnetic beads in 30 μL of sterile water. The product at this time is a mixture of biotinylated DNA fragments and streptavidin magnetic beads.

[0172] Next-generation sequencing library preparation (steps 47 to 50)

[0173] 47. Set up the following reaction in a PCR tube: 30 μL DNA product from step 46, 12 μL sterile water, 50 μL 2×PCR mix, 4 μL N50X, and 4 μL N70X. Mix thoroughly, and add 50 μL of paraffin oil to the top layer to prevent evaporation.

[0174] 48. Set the following program in the PCR instrument: 72 degrees for 3 minutes, 98 degrees for 30 seconds, then 98 degrees for 30 seconds, 60 degrees for 30 seconds, 72 degrees for 30 seconds, 16-18 cycles, and finally extend at 72 degrees for 5 minutes.

[0175] 49. After PCR, place the product on ice temporarily, remove 3 μL of product, and perform gel electrophoresis to detect the concentration and size distribution of the product. If no obvious band enrichment is detected, add 2 more cycles per round as appropriate.

[0176] 50. The PCR amplification products were purified and recovered using 1.2 volumes of DNA purification magnetic beads (e.g., commercially available AMPure XP magnetic beads).

[0177] During the development of this process, since biotin and avidin are difficult to separate after binding, we tried to recover single-stranded DNA by denaturing the DNA with 300mM NaOH at 65℃ for 10 minutes. However, we found that subsequent pH adjustment and DNA reprecipitation and purification were required, and the final yield was not high.

[0178] Therefore, we tried the magnetic bead in situ PCR method, using streptavidin magnetic beads bound to biotinylated DNA fragments as templates for PCR reaction. At the same time, we added paraffin oil to the upper layer of the PCR tube and gently tapped the tube to mix after every 2-3 cycles during the PCR process to prevent the magnetic beads from settling. We also strictly controlled the amount of magnetic beads used to prevent excessive magnetic beads from inhibiting PCR.

[0179] Based on the established procedure, we conducted B-CUT & Tag experiments on SPL9 overexpressing plants. Figure 4 This demonstrates that during the SPL9 B-CUT & Tag-seq experiment, after the biotinylate purification step, no chromatin bound to the magnetic beads (chromatin that was not recognized, cleaved, and biotinylated by transposases) was found. This uncleaved chromatin is not inherently a target site for SPL9 and was removed after the purification step. The purified biotinylated fragment was then subjected to in-situ PCR with magnetic beads and high-throughput sequencing.

[0180] Bioinformatics analysis revealed 6383 enriched peaks, involving 4476 target genes (some target genes showed more than one enriched peak, resulting in a higher number of peaks than target genes in the results). The signals from these enriched peaks were primarily distributed upstream of the gene transcription start site (promoter region). Figure 5 Importantly, similar to the ChIP results, B-CUT&Tag accurately identified all the well-reported target genes involved in the aforementioned SPL9-related developmental and metabolic pathways, including non-coding RNA (miR172), multiple MADS boxes, MYB, DELLA, and JAZ genes, as well as the secondary metabolite anthocyanin (F3'H) and the key gene for wax synthesis (CER1). Figure 6 ).

[0181] In addition, we identified a series of previously unreported target genes that coexisted in both B-CUT&Tag and traditional ChIP results (shared target genes). These target genes, which can be stably identified simultaneously using techniques with different experimental principles, will be the focus of future research and will provide excellent insights into new pathways and functions of SPL9 in regulation.

[0182] Therefore, through the process of this embodiment and the experiment conducted using Arabidopsis thaliana SPL9 transcription factor as an example, we conclude that the combination of B-CUT&Tag and next-generation sequencing (B-CUT&Tag-seq) can be well applied to the study of plant transcription factor-DNA interaction, and is particularly suitable for large-scale screening of target gene sites of transcription factors from the genome.

[0183] Example 4: Study on the modification level of histone H3K3me3 at specific gene loci using B-CUT & Tag-qPCR

[0184] This embodiment investigated whether B-CUT&Tag could subsequently be combined with real-time quantitative PCR (B-CUT&Tag-qPCR) to perform the same function as traditional ChIP-qPCR for identifying the binding of transcription factors to specific target sites.

[0185] The B-CUT&Tag-qPCR system was explored to investigate the modification level of histone H3K3me3 in the leaves of cotton sea island.

[0186] The B-CUT & Tag procedure for histone H3K3me3-modified cotton leaves is similar to that in Example 3, but differs in the amount of cell nucleus used. The amount of histone H3K3me3-modified cell nucleus used is 100 μL. Correspondingly, the amounts of buffer, antibody, and transposase used in some steps are different. Furthermore, secondary antibody signal amplification is not required.

[0187] The specific steps are as follows:

[0188] Perform steps 1 to 46 of Example 3, except for the following steps:

[0189] Step 13. Set up the following reactions in 1.5 mL centrifuge tubes: two IgG control groups, each replicate containing 100 μL of cell nuclear resuspension and 1 μg of IgG; two anti-H3K4me3 antibody experimental groups, each replicate containing 100 μL of cell nuclear resuspension and 1 μg of anti-H3K4me3 antibody. Gently mix and incubate overnight on a horizontal rocker at 12 rpm and 4°C.

[0190] Steps 18-20 of the secondary antibody incubation are omitted.

[0191] Step 23. Add 100 μL of TIB containing 4 pmol transposase, resuspend the cell nuclei, mix gently, place on a horizontal rocker incubator, and incubate at 12 rpm for 3-4 hours at room temperature.

[0192] Step 38. Remove the supernatant, then incubate at 13000x g for 30 seconds at 4°C to remove as much supernatant as possible. Vacuum dry for 2 minutes, then redissolve the DNA in 120 μL of sterile water. Take out 20 μL of DNA, label it "input", and add 50 μL (1:0.5) of DNA purification magnetic beads (such as AMPure XP Beads) to the remaining 100 μL. Incubate at room temperature for 20 minutes, then separate the beads using a magnetic rack and collect the supernatant containing small fragments that were not bound to the beads (~150 μL).

[0193] The product was then purified using biotinylate according to steps 39 to 45.

[0194] In step 46, 50 μL of EB buffer was added to the resulting streptavidin magnetic bead-DNA mixture, and the DNA was eluted at 90°C for 10 minutes. The supernatant was collected using a magnetic rack, and the product was used for subsequent qPCR analysis.

[0195] qPCR and data analysis (steps 51 to 55)

[0196] 51. Following step 46 above, design target site sequence-specific qPCR primer pairs, denoted as GSPf and GSPr, based on the similar primer design principles of ChIP-qPCR.

[0197] 52. Set up the qPCR reaction system according to the following principles: The template is DNA from the antibody group and the IgG control group. Add 1 μL of the DNA obtained in step 46 above to each tube. At the same time, set up a reaction for the input DNA from the antibody group and the IgG control group, with 1 μL of the input DNA from step 38 as the template, denoted as 1% input. Set up 3 technical replicates for each reaction.

[0198] 53. After the qPCR reaction is complete, calculate the amplification cycle number (Ct value) of the sample.

[0199] 54. The ΔCt method was used to calculate the content of the target sequence in different samples, with the Ct of the IgG control group serving as a normalized control. The Ct of the antibody experimental group was subtracted from the Ct of the IgG control group, ΔCt = Ct. 抗体实验组 -Ct IgG The enrichment factor of the target sequence in the antibody experimental group compared to the IgG control group was 2. -ΔCt .

[0200] 55. Alternatively, use the 1% input Ct of the sample itself as a normalized control. ΔCt = Ct 样本 –Ct 1%input The sample refers to the antibody group and the IgG control group; therefore, the proportion of the target sequence in the sample to 1% of its input is 2. -ΔCt x100%, compare the difference in this proportion between the antibody group and the IgG control group.

[0201] Based on the embedding and operational patterns of transposase dimers, we summarized that after chromatin target sites are cleaved by transposases, the two linker primers in the transposase dimer combine in pairs and are added to the fragmented DNA sequence in four different "attachment" methods. Figure 7 a, left).

[0202] To this end, we designed a common adapter primer P1 (sequence: ATTACTAGGTCTCGTGGGCTCGG; qPCR, overlap with Primer C), and target-site sequence-specific qPCR primer pairs, denoted as GSPf and GSPr, designed according to ChIP-qPCR primer design principles. Theoretically, the combination of primer P1 / GSPr can identify the target fragment generated in scenario 1; the combination of primer P1 / GSPf can identify the target fragment generated in scenario 2; and the combination of the target-site-specific primer pairs GSPf and GSPr can identify the sum of target fragments from scenarios 1, 2, and 4. In scenario 3, since all incorporated components are unbiotinylated adapter C, this part of the product is lost during the biotinylate purification step and is not within the range that can be identified by qPCR. Figure 7 a, right).

[0203] We used target site sequence-specific qPCR primer pairs (GSPf / GSPr) to perform qPCR after H3K4me3 modification B-CUT & Tag reaction. Taking the gene GB_D10G1774 as an example, we selected the 5' end (region 1) of genes with high H3K4me3 modification levels and the 3' downstream (region 2) of genes with high H3K4me3 modification levels, and designed two pairs of gene-specific GSPf / GSPr primers, respectively. The primer sequences are shown in SEQ ID NO.24-SEQ ID NO.27.

[0204] qPCR results showed that, compared with the IgG control group, the content of the target region in the H3K4me3 experimental group was 10 times higher in region 1 than in the control group, while in region 2, there was no significant enrichment compared with the control group. This is consistent with the trend of the fragment read count obtained by B-CUT & Tag-seq. Figure 7 (b) We also evaluated another normalization method, using 1% of the input DNA before streptomycin affinity purification as a normalization control. The results showed that the proportion of the target fragment in region 1 of the H3K4me3 experimental group was 36.6% of that in the 1% input control, while the proportion of the target fragment in region 1 of the IgG control group was 3.59% of that in the 1% input control; the H3K4me3 experimental group showed significant enrichment of the target fragment in region 1. In region 2, the proportion of the target fragment in the H3K4me3 experimental group was 2.45% of that in the 1% input control, while the proportion of the target fragment in the IgG control group was 2.34% of that in the 1% input control. Figure 7 c) The H3K4me3 experimental group did not show significant enrichment of the target fragment in region 2.

[0205] Because gene-specific primers cannot exclude large biotin-tagged fragments (>1000bp) generated by transposase background cleavage, we explored the feasibility of using a common primer sequence P1 paired with target-site specific GSPf and GSPr for H3K4me3-modified B-CUT & Tag qPCR. We found that two overlapping or partially overlapping DNA fragments from cleavage scenarios 1 and 2, respectively, under the condition of primer P1 alone, under these conditions, under non-specific PCR amplification occurred. Figure 8 ).

[0206] Therefore, it is not recommended to use a combination of common primer P1 and specific primers for qPCR.

[0207] To address the issue that gene-specific primers cannot exclude large biotin-tagged fragments (>1000bp) generated by transposase background cleavage, we added a fragment sorting step before biotinylate purification to remove large fragments generated by background cleavage using DNA purification magnetic beads (step 38).

[0208] Therefore, we have successfully established the B-CUT & Tag-qPCR procedure.

[0209] Example 5: Study on the binding of transcription factors to predicted target gene sites using B-CUT & Tag-qPCR

[0210] Finally, to determine whether the B-CUT&Tag-qPCR procedure we established based on the aforementioned histone modification levels is suitable for verifying the specific binding of transcription factors, we performed B-CUT&Tag-qPCR on plant transcription factors using Arabidopsis thaliana SPL9 and rice PHR2, an important transcription factor related to phosphorus metabolism, as examples. We followed the B-CUT&Tag procedure for transcription factors in Example 1 and the qPCR procedure in Example 4. Since the Arabidopsis thaliana and rice overexpressing AtSPL9 and OsPHR2 we used are both 3xFLAG-tagged fusion proteins, anti-FLAG antibodies were still used in the CUT&Tag system.

[0211] First, we used B-CUT&Tag-qPCR to determine the specific binding of Arabidopsis SPL9. We used three target genes of AtSPL9 that have been reported and studied in detail in the literature: AtTCL1 and AtTRY in Arabidopsis trichome development (Yu et al., 2010), and AtFUL gene in flowering regulation (Wang et al., 2009). The gene-specific primer pairs used for B-CUT&Tag-qPCR were the same as the primers reported in previous ChIP-qPCR studies (Wang et al., 2009; Yu et al., 2010), with sequences as shown in SEQ ID NO. 28-SEQ ID NO. 35. The ACT2 gene was used as a control. Based on the B-CUT&Tag-seq data, we summarized the fragment reads that located the qPCR target region (…). Figure 9 (a) and (b) the RPM (number of reads aligned to the target region per million reads) ratios of the qPCR target regions for AtTCL1, AtTRY, AtFUL, and AtACT2 were 2.45, 2.25, 3.18, and 1.45, respectively. Consistently, the B-CUT&Tag-qPCR results showed that, compared with the IgG control group, the target regions of AtTCL1, AtTRY, AtFUL, and AtACT2 were enriched by 1.78, 1.98, 2.01, and 1.15 times (a) and 1.15 times, respectively (b). Figure 9 c) The trend is consistent with that of high-throughput sequencing results.

[0212] We further used rice plants overexpressing OsPHR2 as material and employed B-CUT & Tag-qPCR to determine the specific binding of OsPHR2. OsPHR2 is an important transferrinmonite (TF) that plays a role in phosphate homeostasis in rice. We selected three target genes of OsPHR2, including the low-affinity Pi transporter OsPT2 (Liu et al., 2010), which is a direct target of OsPHR2 and is responsible for the excessive accumulation of stem Pi mediated by OsPHR2 overexpression; the high-affinity Pi transporter OsPT8, which is also key to Pi homeostasis (Jia et al., 2011); and the AM symbiosis-related marker gene OsRAM1, which is regulated in mycorrhizal symbiosis by a network centered on OsPHR2 (Shi et al., 2021). We identified the distribution of the PHR1 binding site (P1BS) in the promoters of OsPT2, OsPT8, and OsRAM1, and designed qPCR primers whose product fragments covered the indicated P1BS cis-elements. Figure 9d) Sequences are shown in SEQ ID NO.36-SEQ ID NO.41. Under phosphorus-sufficient (+P) culture conditions, compared with the IgG control group, the target regions of OsPT8 and OsRAM1 in the OsPHR2 experimental group (anti-FLAG tag antibody) were not enriched, while the target region of OsPT2 was enriched 2.36 times that of the IgG control group. In contrast, under phosphorus-deficient (-P) conditions, the target regions of OsPT2, OsPT8, and OsRAM1 were enriched 2.56 times, 2.13 times, and 3.47 times, respectively. Figure 9 e) These results indicate that OsPHR2 has different regulatory effects on phosphorus balance and mycorrhizal symbiosis under phosphorus-sufficient (+P) and phosphorus-deficient (-P) conditions.

[0213] Through the above examples, we have demonstrated that the CUT&Tag kit and process provided by this invention can effectively identify the binding of transcription factors to DNA. sequence list <110> Zhejiang Academy of Agricultural Sciences <120> A kit and method for identifying transcription factor-chromatin interactions in plants using CUT&Tag technology. <160> 41 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 ctgtctctta tacacatct 19 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <400> 2 tcgtcggcag cgtcagatgt gtataagaga cag 33 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <400> 3 gtctcgtggg ctcggagatg tgtataagag acag 34 <210> 4 <211> 51 <212> DNA <213> Artificial Sequence <400> 4 aatgatacgg cgaccacccga gatctacact agatcgctcg tcggcagcgt c 51 <210> 5 <211> 51 <212> DNA <213> Artificial Sequence <400> 5 aatgatacgg cgaccaccga gatctacacc tctctattcg tcggcagcgt c 51 <210> 6 <211> 51 <212> DNA <213> Artificial Sequence <400> 6 aatgatacgg cgaccacccga gatctacact atcctcttcg tcggcagcgt c 51 <210> 7 <211> 51 <212> DNA <213> Artificial Sequence <400> 7 aatgatacgg cgaccaccga gatctacaca gagtagatcg tcggcagcgt c 51 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <400> 8 aatgatacgg cgaccaccga gatctacacg taaggagtcg tcggcagcgt c 51 <210> 9 <211> 51 <212> DNA <213> Artificial Sequence <400> 9 aatgatacgg cgaccaccga gatctacaca ctgcatatcg tcggcagcgt c 51 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <400> 10 aatgatacgg cgaccaccga gatctacaca aggagtatcg tcggcagcgt c 51 <210> 11 <211> 51 <212> DNA <213> Artificial Sequence <400> 11 aatgatacgg cgaccaccga gatctacacc taagccttcg tcggcagcgt c 51 <210> 12 <211> 47 <212> DNA <213> Artificial Sequence <400> 12 caagcagaag acggcatacg agattaaggc gagtctcgtg ggctcgg 47 <210> 13 <211> 47 <212> DNA <213> Artificial Sequence <400> 13 caagcagaag acggcatacg agatcgtact aggtctcgtg ggctcgg 47 <210> 14 <211> 47 <212> DNA <213> Artificial Sequence <400> 14 caagcagaag acggcatacg agataggcag aagtctcgtg ggctcgg 47 <210> 15 <211> 47 <212> DNA <213> Artificial Sequence <400> 15 caagcagaag acggcatacg agattcctga gcgtctcgtg ggctcgg 47 <210> 16 <211> 47 <212> DNA <213> Artificial Sequence <400> 16 caagcagaag acggcatacg agatggactc ctgtctcgtg ggctcgg 47 <210> 17 <211> 47 <212> DNA <213> Artificial Sequence <400> 17 caagcagaag acggcatacg agattaggca tggtctcgtg ggctcgg 47 <210> 18 <211> 47 <212> DNA <213> Artificial Sequence <400> 18 caagcagaag acggcatacg agatctctct acgtctcgtg ggctcgg 47 <210> 19 <211> 47 <212> DNA <213> Artificial Sequence <400> 19 caagcagaag acggcatacg agatcagaga gggtctcgtg ggctcgg 47 <210> 20 <211> 47 <212> DNA <213> Artificial Sequence <400> 20 caagcagaag acggcatacg agatgctacg ctgtctcgtg ggctcgg 47 <210> twenty one <211> 47 <212> DNA <213> Artificial Sequence <400> twenty one caagcagaag acggcatacg agatcgaggc tggtctcgtg ggctcgg 47 <210> twenty two <211> 47 <212> DNA <213> Artificial Sequence <400> twenty two caagcagaag acggcatacg agataagagg cagtctcgtg ggctcgg 47 <210> twenty three <211> 47 <212> DNA <213> Artificial Sequence <400> twenty three caagcagaag acggcatacg agatgtagag gagtctcgtg ggctcgg 47 <210> twenty four <211> 20 <212> DNA <213> Artificial Sequence <400> twenty four caaatggggt cgtcggcggt 20 <210> 25 <211> twenty three <212> DNA <213> Artificial Sequence <400> 25 agtggatttc ccaggcggcc tta 23 <210> 26 <211> twenty one <212> DNA <213> Artificial Sequence <400> 26 tttgggtcgc gcctatccac t 21 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <400> 27 aggggaaaaa ttaagcacca gtcgc 25 <210> 28 <211> twenty two <212> DNA <213> Artificial Sequence <400> 28 tctttcgccg tagactacag at 22 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <400> 29 gaccccattaa actaacgtat ttaat 25 <210> 30 <211> twenty two <212> DNA <213> Artificial Sequence <400> 30 gagaaatcaa atcgagggcg ta 22 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <400> 31 aacccctaga ttgttgaaag ttgaa 25 <210> 32 <211> twenty four <212> DNA <213> Artificial Sequence <400> 32 aaaaacttgt ctccatgcaa aaag 24 <210> 33 <211> twenty three <212> DNA <213> Artificial Sequence <400> 33 ttgtcgagtc ctcattggct act 23 <210> 34 <211> 26 <212> DNA <213> Artificial Sequence <400> 34 cttcttccgc tctttctttc caaggt 26 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <400> 35 tggatctctc catcaaggtc aagcca 26 <210> 36 <211> twenty one <212> DNA <213> Artificial Sequence <400> 36 accatcagcc acggctaaaa t 21 <210> 37 <211> twenty one <212> DNA <213> Artificial Sequence <400> 37 agaatggccc catggattgg c 21 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <400> 38 cgcgtccatg gctgacagg 19 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <400> 39 tctggtgacg tgttgggacc 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <400> 40 acagcgatcc cctctgctct 20 <210> 41 <211> twenty four <212> DNA <213> Artificial Sequence <400> 41 ggggtgtgtc catttttaat gcgt 24

Claims

1. A kit for identifying transcription factor-chromatin interactions in plants using CUT&Tag technology, characterized in that, include: Biotinylated Tn5 transposase, nuclear extract, washing buffer, antibody hybridization buffer, streptavidin washing buffer, DNA elution buffer, primary antibody, secondary antibody, DNA purification magnetic beads, streptavidin magnetic beads, protease inhibitor, digitalis saponin solution, EDTA solution, sodium chloride solution, magnesium chloride solution, Triton X-100 solution, sodium dodecyl sulfate solution, glycine solution, pre-packed Phase Lock Gel, DNA co-precipitant, and PCR reaction solution. The biotinylated transposase is formed by incubating the transposase with a biotinylated DNA adapter primer; The biotinylated DNA adapter primer consists of a double linker I formed by annealing primer A and primer B and a double linker II formed by annealing primer A and primer C. Primer A contains a transposase-recognized mosaic end (ME) sequence fragment, phosphorylated at the 5' end, and modified with an amino group (AminolinkerC7) at the 3' end; Primer B has a sequence that is inversely complementary to primer A at the 3' end and a sequencing adapter sequence at the 5' end; Primer C has a sequence that is inversely complementary to primer A at the 3' end and a sequencing adapter sequence at the 5' end; either primer B or primer C has a biotinylated triethylene glycol label at the 5' end.

2. The kit according to claim 1, characterized in that, The Tn5 transposase is either pG-Tn5 or pA-Tn5 transposase; the nuclear extraction buffer is Tris buffer containing 0.5%-1% Triton X-100; the washing buffer is Tris buffer containing protease inhibitors and digitalis saponins; the antibody hybridization buffer is Tris buffer containing EDTA, BSA, protease inhibitors, and digitalis saponins; the streptavidin washing buffer is Tris buffer containing EDTA and Tween-20; the DNA elution buffer is a solution containing sodium acetate and formamide; and the DNA purification magnetic beads are surface carboxyl-modified magnetic beads.

3. The kit according to claim 1, characterized in that, The PCR reaction solution includes: primer I, primer II, and PCR premix; The base sequence of primer I is one of the sequences shown in SEQ ID NO.4-SEQ ID NO.15; the base sequence of primer II is one of the sequences shown in SEQ ID NO.16-SEQ ID NO.

23.

4. A method for identifying transcription factor-chromatin interactions in plants using CUT&Tag technology, characterized in that, Includes the following steps: (1) Biotinylated DNA adapter primers were incubated with Tn5 transposase to assemble biotinylated Tn5 transposase dimers. (2) Fix the interaction state between transcription factors and chromatin in the cell nucleus and extract the cell nuclei of the plant tissue to be tested; (3) Primary and secondary antibodies are used to identify transcription factors that bind to chromatin in the cell nucleus. Then, biotinylated transposase dimers are used to identify the region where the antibody is located and cut the chromatin to form biotinylated chromatin fragments. (4) Extract the DNA after the reaction using plant genomic DNA extraction solution, and purify the biotin-labeled DNA fragments using streptavidin magnetic beads to form a streptavidin magnetic bead-DNA fragment mixture. (5) Using streptavidin magnetic bead-DNA fragment as a template, PCR library construction was performed to establish a high-throughput sequencing library of transcription factor-chromatin interaction. (6) Library quality control, high-throughput sequencing and bioinformatics analysis; or, (A) Biotinylated DNA adapter primers were incubated with Tn5 transposase to assemble biotinylated Tn5 transposase dimers. (B) Fix the interaction state between transcription factors and chromatin in the cell nucleus and extract the cell nuclei from the plant tissue to be tested; (C) Primary and secondary antibodies are used to recognize transcription factors that bind to chromatin in the cell nucleus. Biotinylated transposase dimers are then used to recognize the regions where the antibodies are located and cut the chromatin to form biotinylated chromatin fragments. (D) Extract DNA from the reaction using plant genomic DNA extraction solution, take out a portion of the DNA solution to use as input DNA for real-time PCR, then use DNA purification magnetic beads to bind large fragments in the remaining DNA, and recover the supernatant solution. (E) Use streptavidin magnetic beads to purify the small fragments in the product of step (D) with biotin-avidin to form a streptavidin magnetic bead-DNA fragment mixture; (F) The DNA fragments bound to the streptavidin magnetic beads were eluted using DNA elution buffer; and the eluted DNA was used as a template for real-time PCR. (G) The ΔCt method was used to analyze the real-time PCR data. Specifically, in step (1) or step (A), the steps include: a) Preparation of biotinylated DNA adapter primers: double linker I is formed by annealing primer A and primer B, and double linker II is formed by annealing primer A and primer C; Primer A contains a transposase-recognized mosaic end (ME) sequence fragment, phosphorylated at the 5' end, and modified with an amino group (AminolinkerC7) at the 3' end; primer B has a sequence that is inversely complementary to primer A at the 3' end and a sequencing adapter sequence at the 5' end; primer C has a sequence that is inversely complementary to primer A at the 3' end and a sequencing adapter sequence at the 5' end; the 5' end of either primer B or primer C is labeled with biotinylated triethylene glycol. b) Preparation of Tn5 transposase dimer: Adapter I and adapter II are mixed in a 1:1 ratio to form an adapter mixture, and the adapter mixture is incubated with Tn5 transposase to form Tn5 transposase dimer.

5. The method as described in claim 4, characterized in that, In step (5), the PCR reaction system includes: primer I, primer II and PCR premix; The base sequence of primer I is one of the sequences shown in SEQ ID NO.4-SEQ ID NO.15; the base sequence of primer II is one of the sequences shown in SEQ ID NO.16-SEQ ID NO.

23. The PCR reaction program was as follows: 98℃ for 3 min, 98℃ for 30 s; 98℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 18-20 cycles, 72℃ for 5 min.

6. The method as described in claim 4, characterized in that, In step (D), the DNA elution buffer is formulated as a solution containing 30 mM sodium acetate and 95% formamide at pH 9.0; the DNA purification magnetic beads are AMPure XP Beads magnetic beads.

7. The method as described in claim 4, characterized in that, In step (F), the reaction system of the real-time PCR includes: SYBR Green, template, upstream gene-specific primer, and downstream gene-specific primer; the template is the input DNA in step (D) and the DNA eluted in step (F); the target fragment region covered by the upstream and downstream gene-specific primers contains the predicted transcription factor binding motif; The reaction program was: 98℃ for 3 min, 98℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, for 45 cycles.

8. The method as described in claim 4, characterized in that, In step (G), the ΔCt method is any one of the following: (G-1)ΔCt = Ct value of antibody group sample - Ct value of IgG control group sample, the enrichment factor of antibody group fragment is = 2 -ΔC The antibody group refers to samples that have undergone CUT & Tag reactions using antibodies specific to the target transcription factor or antibodies against fusion protein tags as primary antibodies; the IgG control group refers to samples that have undergone CUT & Tag reactions using IgG. (G-2)ΔCt = Ct value of CUT & Tag sample – Ct value of 1% input, then the proportion of the target fragment in the CUT & Tag sample to 1% input = 2 -ΔCt ×100%, the CUT&Tag sample refers to the antibody group or IgG control group CUT&Tag, and the 1% input DNA comes from step (D); finally, compare the difference in the proportion of the target fragment in the antibody group and the IgG control group.

Citation Information

Patent Citations

  • Application and method of biotinylated transposon in recovery of CUT&Tag or ATAC-seq product

    CN112795563A