A method for detecting the levels of endogenous low-abundance genes and lncRNA in cells

Abstract

The present invention provides. Specifically, the present invention provides a sgRNA-responsive promoter and a detection system for detecting endogenous nucleic acids in cells comprising the sgRNA-responsive promoter, as well as a corresponding detection method. The detection system or method of the present invention can reliably detect endogenous genes with very low expression levels in cells; and the transcriptional activity of long non-coding RNA (lncRNA) that is usually low in expression can also be monitored in living cells. In addition, the method of the present invention can amplify endogenous signals to visualize the dynamic process of low-abundance genes and lncRNA expression in cells, providing a powerful platform to detect the activity of endogenous genetic elements and their potential cellular functions.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for detecting endogenous low-abundance genes and lncRNA levels in cells. Background Art

[0002] Detecting endogenous signals and precisely controlling gene pathways in natural environments, as well as precisely manipulating genetic information are crucial for understanding biological processes, determining the basic biological design principles of organisms, and achieving higher levels of regulation in different systems.

[0003] Previous studies have developed a series of genetic switches that function as sensors or implement other functions. However, these strategies are mainly limited by their ability to process endogenous signals. Single guide RNA (sgRNA), similar to a GPS that can directly guide Cas nucleases to the target genomic site, has specificity, efficiency and versatility. Although various inducible sgRNAs have been developed to receive endogenous signals in living cells, these methods can only show responses to small RNAs. Conventional methods that usually detect endogenous gene activity rely on the precise insertion of fluorescent proteins into protein coding frames. However, for genes transcribed at low abundance, existing methods are not applicable, and current tools for processing endogenous information are very limited.

[0004] In addition, there is increasing evidence that long noncoding RNAs (lncRNAs) play important roles in various biological processes. However, functional annotation of lncRNAs is extremely challenging because they are not translatable and are usually expressed at lower levels compared to coding RNAs.

[0005] Therefore, there is an urgent need in the art to develop a method that can efficiently detect a broad spectrum of endogenous low-abundance genes and lncRNA expression levels in cells. Summary of the invention

[0006] The purpose of the present invention is to provide a method that can efficiently detect the broad spectrum of endogenous low-abundance genes and lncRNA expression levels in cells.

[0007] In a first aspect of the present invention, a sgRNA-responsive promoter is provided, which can respond to an upstream complex formed by sgRNA, dCas9 and a transcriptional activator whose expression is controlled by an endogenous transcript, and initiate the expression of a downstream reporter gene.

[0008] In another preferred embodiment, the sgRNA-responsive promoter is a mini-promoter.

[0009] In another preferred embodiment, the sgRNA-responsive promoter is a miniCMV promoter.

[0010] In another preferred embodiment, the dCas9 is dSpCas9 protein.

[0011] In another preferred embodiment, the downstream reporter gene is a gene sequence encoding a reporter protein.

[0012] In another preferred embodiment, the reporter protein includes fluorescent protein, luciferase (eg, Luciferase), or any signal element that can be used as a reporter indicator.

[0013] In another preferred embodiment, the fluorescent protein is selected from the following group: mCherry protein, GFP protein, ZsGreen, or a combination thereof.

[0014] In another preferred embodiment, the fluorescent protein is mCherry protein.

[0015] In a second aspect of the present invention, a detection system for endogenous nucleic acid in a cell is provided, comprising:

[0016] (a) a target nucleic acid editing module, including: sgRNA and tRNA targeting the target nucleic acid of the reporter system;

[0017] Wherein, the target nucleic acid editing module includes a structure as shown in Formula I,

[0018] L1-(tRNA-sgRNA) n -tRNA-R1 (Formula I)

[0019] In the formula,

[0020] L1 is the homology arm at the 5′ end;

[0021] R1 is the homology arm at the 3′ end;

[0022] tRNA is the endogenous mechanism that can successfully release a functional sgRNA;

[0023] sgRNA is guide RNA;

[0024] n is a positive integer ≥ 1, preferably 2≤n≤10; and

[0025] (b) a target nucleic acid reporter module, comprising: a reporter nucleic acid construct, a dCas protein, and a transcription activator;

[0026] Wherein, the reporter nucleic acid construct has a structure as shown in Formula II,

[0027] (TS-I) m -TS-P1-Z2 (Formula II)

[0028] In the formula,

[0029] TS is the binding target site of the sgRNA;

[0030] m is a positive integer ≥ 0, preferably 2≤m≤4;

[0031] I is the spacer sequence between TS;

[0032] P1 is the sgRNA-responsive promoter as described in the first aspect of the present invention;

[0033] Z2 is the reporter gene sequence.

[0034] In another preferred embodiment, the endogenous nucleic acid includes an endogenous gene or a long non-coding RNA (lncRNA).

[0035] In another preferred embodiment, the endogenous gene in the cell may be an endogenous low-abundance gene in the cell.

[0036] In another preferred embodiment, the endogenous low-abundance gene in the cell refers to a gene whose expression level in the cell is <0.001 when relative quantification is performed using the Gapdh internal reference gene.

[0037] In another preferred embodiment, the endogenous gene of the cell can be selected from the following group: Ascl1, Neurog2, Lmx1b, Nkx2-2, Gata3, Hbb, Tubb3, Actb, Nanog, Esrrb, Sox2, Tet1, Neurog2, Lncenc1, Med7, Tert, Jag1, Slc7a11, Dancr, Firre, Pvt1, Tunar, Miat, or a combination thereof.

[0038] In another preferred embodiment, when the Gapdh internal reference gene is used for relative quantification, the expression level of the lncRNA in the cell is <0.001.

[0039] In another preferred embodiment, 6≤n≤8.

[0040] In another preferred embodiment, the sgRNA in (a) targets the 3' untranslated region (3'UTR) of the target nucleic acid.

[0041] In another preferred embodiment, the tRNA can be accurately cleaved by endonucleases RNaseP and RNaseZ.

[0042] In another preferred example, the nucleotide sequence of the tRNA is as shown in SEQ ID NO: 143 (AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA).

[0043] In another preferred embodiment, the length of L1 is 15-50 bp, preferably 25-45 bp, and more preferably 35 bp.

[0044] In another preferred embodiment, the length of R1 is 15-50 bp, preferably 25-45 bp, and more preferably 35 bp.

[0045] In another preferred embodiment, the nucleic acid homologous recombinase in (a) is selected from the following group: SaKKHCas9, SaCas9.

[0046] In another preferred embodiment, the endonuclease in (a) is selected from the group consisting of tRNA, ribosome, or a combination thereof.

[0047] In another preferred example, the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO: 1-49 or 50-61 or 62-88.

[0048] In another preferred example, when the endogenous cell gene to be detected is Ascl1, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO: 50 or 51.

[0049] In another preferred example, when the endogenous cell gene to be detected is Neurog2, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:52 or 53.

[0050] In another preferred example, when the endogenous cell gene to be detected is Lmx1b, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:54 or 55.

[0051] In another preferred example, when the endogenous cell gene to be detected is Nkx2-2, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:56 or 57.

[0052] In another preferred example, when the endogenous cell gene to be detected is Gata3, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:58 or 59.

[0053] In another preferred example, when the endogenous cell gene to be detected is Hbb, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:60.

[0054] In another preferred example, when the endogenous cell gene to be detected is LacZ, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:61.

[0055] In another preferred example, the target nucleic acid editing module includes a nucleotide sequence as shown in SEQ ID NO: 165 or 166.

[0056] In another preferred embodiment, 1≤m≤3, more preferably m=2 (ie, there are 3 TS in Formula II).

[0057] In another preferred embodiment, the dCas9 is dSpCas9 protein.

[0058] In another preferred embodiment, the transcription activator is selected from the following group: HSF1, P65, or a combination thereof.

[0059] In another preferred embodiment, the length of I is 0-100 bp, preferably 15-50 bp, more preferably 30-40 bp, and most preferably 35 bp.

[0060] In another preferred example, the sgRNA-responsive promoter P1 is miniCMV, and its nucleotide sequence is shown in SEQ ID NO: 144 (TAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGC).

[0061] In another preferred example, the reporter gene is a sequence encoding mCherry, and the nucleotide sequence of the reporter gene sequence Z is shown in SEQ ID NO: 145().

[0062] In another preferred embodiment, (TS-I) in the formula II m - The nucleotide sequence of the TS-P1 portion is shown in any one of SEQ ID NOs: 151-160; preferably SEQ ID NO: 159.

[0063] In another preferred example, the nucleotide sequence of the reporter nucleic acid construct is as shown in SEQ ID NO: 150 or 162.

[0064] In another preferred example, the expression of the dCas protein and transcription activator in the target nucleic acid reporter module is regulated by the same promoter P2.

[0065] In another preferred embodiment, the promoter P2 is a CAG promoter.

[0066] In another preferred example, the target nucleic acid reporter module contains a coding sequence and a regulatory sequence for expressing dCas protein and transcription activator, and its sequence is shown in SEQ ID NO: 146 or 161.

[0067] In the third aspect of the present invention, a kit for detecting endogenous nucleic acid in cells is provided, comprising the detection system as described in the second aspect of the present invention.

[0068] In another preferred embodiment, the kit further includes a reagent for detecting the reporter gene or its encoded product in the target nucleic acid reporter module.

[0069] In another preferred embodiment, the kit further comprises a detection system for detecting a housekeeping gene or an internal reference gene in the cell, and the corresponding target nucleic acid editing module comprises an sgRNA precursor targeting the 3'UTR region of the housekeeping gene or the internal reference gene.

[0070] In another preferred embodiment, the housekeeping gene or internal reference gene is Gapdh.

[0071] In a fourth aspect of the present invention, a method for detecting whether a target endogenous nucleic acid exists in a cell sample is provided, comprising the steps of:

[0072] (i) introducing the detection system according to the second aspect of the present invention into a cell sample to be detected; and

[0073] (ii) detecting the level of the reporter gene or its encoded product in the detection target nucleic acid reporter module in the detection system.

[0074] In another preferred embodiment, the method includes qualitative detection and quantitative detection.

[0075] In another preferred embodiment, the method includes dynamically detecting the level of target endogenous nucleic acid in a cell sample.

[0076] In another preferred embodiment, the method is non-diagnostic and / or non-therapeutic.

[0077] In the fifth aspect of the present invention, there is provided a use of the sgRNA-responsive promoter as described in the first aspect of the present invention or the detection system as described in the second aspect of the present invention, characterized in that it is used to prepare a kit for detecting endogenous nucleic acids in cells.

[0078] In another preferred embodiment, the kit is a disease diagnosis kit, and the disease is a disease related to abnormal expression of endogenous nucleic acid in cells.

[0079] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Figure 1 Shown are the process and results of developing an endogenous switch that directly drives sgRNA through an endogenous promoter.

[0081] a. Schematic diagram showing the expression of sgRNA from an endogenous promoter. The sgRNA precursor is targeted and inserted into the transcribed region of the endogenous gene by SaKKHCas9-mediated homology-mediated end joining (HMEJ, 800 bp homology arm) or homologous recombination (HR, 800 bp homology arm). The sgRNA (orange) is flanked by two ends (purple)

[0082] After transcription, it is recognized and cut by the endogenous processing mechanism. The sgRNA precursor is transcribed along with the gene transcription under the drive of the endogenous promoter, and then formed into a mature sgRNA by the endogenous cutting program.

[0083] b. Average mCherry fluorescence intensity induced by different mini promoters, n = 3 replicates per group

[0084] c. Average mCherry fluorescence intensity of different interval lengths between two sgRNA targeting sites (TS) upstream of the miniCMV promoter, n = 3 replicates per group

[0085] d. Effect of sgRNA TS copy number on fluorescence intensity, n = 3 replicates per group

[0086] e. mCherry expression induced by SPH-OminiCMV and different commonly used promoters, n = 3 replicates per group

[0087] f. Schematic diagram showing the design of vectors and different sgRNA delivery systems used to generate SPH-OminiCMV transgenic mESC cell lines. First, the schematic diagram of SPH-OminiCMV mESC, followed by three different sgRNA precursors (three sgRNAs miR30, auto-splicing and tRNA, including one sgRNA targeting mCherry) inserted into the intron of Actb, n = 3 replicates per group

[0088] g. Mean mCherry expression intensity induced by different release strategies, n = 3 replicates per group.

[0089] h. Percentage of mCherry positive cells, n = 3 replicates per group

[0090] i. Schematic diagram showing the insertion site of the sgRNA precursor in the Nanog locus.

[0091] j. Average fluorescence intensity of mCherry, indicating that tRNA-sgRNA-tRNA induces different levels of mCherry in different introns. The numbers on the axis represent the number of cell clones in each group.

[0092] k. stands for western blot.

[0093] i. Western blot quantitative data showed that tRNA-sgRNA-tRNA inserted into intron or 3'UTR did not affect the expression of Nanog protein, n = 3 replicates per group.

[0094] All values ​​are expressed as mean ± standard error; unpaired t-test; *p<0.05, **p<0.01, ***p<0.001.

[0095] Figure 2 It was shown that SPH-OminiCMV-Ents can track low-abundance genes during differentiation.

[0096] a. Schematic diagram showing the SPH-OminiCMV-Ents strategy for detecting endogenous gene expression. The sgRNA precursor targeting mCherry is inserted into the 3'UTR of the endogenous gene, and the sgRNA is released along with the transcription of the endogenous gene.

[0097] The SPH-sgRNA complex binds to the upstream of OminiCMV, leading to the expression of mCherry.

[0098] b. Representative images showing mCherry expression by tRNA-sgRNA-tRNA or P2A-mCherry.

[0099] c. mCherry intensity of SPH-OminiCMV-Ents (red triangles) and P2A-mCherry (green diamonds) in different mESC cell lines and qPCR analysis of the expression levels of different genes in mESCs (purple circles, purple y-axis). P2A-mCherry or tRNA-sgRNA-tRNA was targeted and inserted into the 3'UTR of each gene.

[0100] d. Representative images showing the expression of mCherry in SPH-OminiCMV-Ents-Actb and Actb-P2A-mCherry mESC cell lines during differentiation.

[0101] e. Actb mRNA levels were quantified by qPCR. Data were normalized to day 0.

[0102] f. Representative images showing the expression of mCherry in SPH-OminiCMV-Nanog and Nanog-P2A-mCherry mESC cell lines during differentiation.

[0103] g. Quantification of Nanog mRNA levels by qPCR. Data were normalized to day 0.

[0104] Figure 3 The results of detecting lncRNA using SPH-OminiCMV-Ents are shown.

[0105] a. Representative images showing the mCherry expression and average mCherry intensity of SPH-OminiCMV-Malat1.

[0106] b. Representative images showing colocalization of mCherry and Malat1 in SPH-OminiCMV-Ents-Malat1 mESCs. Note that Malat1 expression was detected by RNA-FISH probe.

[0107] c. Representative images showing mCherry expression and average mCherry intensity in SPH-OminiCMV-Lncenc1 mESCs.

[0108] d. Representative images showing the expression of mCherry and Lncenc1 in undifferentiated (day 0) and differentiated (day 9) SPH-OminiCMV-Ents-Lncenc1 mESCs. Note that Lncenc1 is a pluripotency-associated lncRNA and its expression was detected by RNA-FISH probe.

[0109] e. Representative images showing the expression of mCherry in differentiated SPH-OminiCMV-Ents-Lncenc1 mESCs.

[0110] f. qPCR analysis of Lncenc1 expression in differentiated SPH-OminiCMV-Ents-Lncenc1 mESCs. Data were normalized to day 0.

[0111] Figure 4It was shown that encoding multiple sgRNAs could improve the sensitivity of SPH-OminiCMV-Ents and achieve multiple transcriptional regulation.

[0112] a. Schematic diagram showing the insertion of one or more sgRNA precursors into SPH-OminiCMV-Ents mESCs

[0113] b. Representative images show the expression of mCherry after insertion of one sgRNA or sgRNA array into the 3'UTR of a gene or lncRNA (green) in the SPH-OminiCMV-Ents mESCs cell line.

[0114] c and d. Representative images showing the expression of mCherry in SPH-OminiCMV-Ents mESCs after insertion of a sgRNA or a sgRNA array into the 3'UTR of lncRNA Tug1. Note that Tug1 was detected using RNA-FISH probe.

[0115] e. Mean fluorescence intensity of mCherry. LncRNA is represented by dark pink.

[0116] f. Representative images showing mCherry expression in undifferentiated (day 0) and differentiated (day 9) cells inserted with sgRNA arrays.

[0117] g. Representative images showing mCherry expression in the SPH-OminiCMV-Ents-Tubb3 mESC line during neuronal differentiation. The sgRNA array contains 8 copies of sgRNA. Arrows indicate induced neurons. Note that Tubb3 is lowly expressed in mESCs and highly expressed in neurons.

[0118] i. Schematic diagram showing the insertion of two sgRNA arrays that activate mCherry and Ngn2, respectively, and the fold changes of mCherry and Ngn2.

[0119] j. Schematic diagram showing the insertion of two sgRNA arrays that activate mCherry and Hbb, respectively, and the fold changes of mCherry and Hbb.

[0120] Figure 5 Shown is the homogeneous expression of mCherry driven by a single promoter for dCas9 and activator.

[0121] a. Schematic diagram of the SPH vector and representative images showing heterogeneous expression of mCherry in SPH-OminiCMV-Ents-Actb cell clones. Note that dCas9 and P65-HSF1 are expressed from two CAG promoters, respectively.

[0122] b. Schematic diagram showing representative images of homogeneous expression of mCherry in the SPH(single CAG) vector and SPH(single CAG)-OminiCMV-Ents-Actb cell clones. Note that expression of dCas9 and p65-HSF1 is driven by a single promoter.

[0123] c. Representative images showing mCherry expression in ESCs of P2A-mCherry and SPH (single CAG)-OminiCMV-Ents.

[0124] d. mCherry intensity of mESCs with SPH(single CAG)-OminiCMV-Ents-sgRNA (blue), SPH(single CAG)-OminiCMV-Ents-sgRNA array (red) and P2A-mCherry (green), and expression levels of different gene mRNAs (purple, qPCR, right purple y-axis). The correlation between the fluorescence intensity and relative mRNA expression of SPH(single CAG)-OminiCMV-Ents-sgRNA is shown by r2=0.9405, p<0.0001. r2=0.5855, p=0.0023 indicates the correlation between the fluorescence intensity and relative mRNA expression of SPH(single CAG)-OminiCMV-Ents-sgRNA array mESCs.

[0125] e. Representative images showing the mCherry expression of different lncRNAs.

[0126] f. mCherry expression intensity of SPH (single CAG)-OminiCMV-Ents-sgRNA (blue) and SPH (single CAG)-OminiCMV-Ents-sgRNA array (red) mESCs and mRNA expression levels of corresponding low-abundance lncRNAs (purple, qPCR, right purple y-axis). Correlation is shown as r2=0.2978, p=0.3414

[0127] Figure 6 The average mCherry intensity induced by different sgRNAs is shown.

[0128] Figure 7 Optimization of the miniCMV promoter and results are shown.

[0129] Figure 8 It was shown that the gene expression level induced by SPH-OminiCMV was higher than that mediated by SPH-mediated endogenous activation and CMV-mediated overexpression.

[0130] Fig. 9 The specificity of SPH-OminiCMV was demonstrated.

[0131] Fig.10 The generation and characterization of SPH-OminiCMV transgenic mESCs are shown.

[0132] Fig.11 It was shown that targeted insertion of tRNA-sgRNA-tRNA into the 3'UTR does not affect the normal protein production of the target gene.

[0133] Fig.12 SPH-OminiCMV-Ents was shown to visualize low-abundance genes during cell differentiation.

[0134] Fig.13 showed that insertion of the sgRNA array into an unexpressed gene did not induce mCherry expression.

[0135] Fig.14 Homogeneous expression of mCherry is shown by driving dCas9 and the activator under a single promoter.

[0136] Fig.15 FACS analysis of mCherry expression is shown.

[0137] Fig.16 Shown is a side-by-side comparison of the different strategies and the downregulation of mCherry and Nanog at the protein level during differentiation.

[0138] Fig.17 It is shown that the SPH (single CAG)-OminiCMV-Ents-sgRNA array induced the highest expression of mCherry.

[0139] Fig.18 Quantitative characterization of SPH (single CAG)-OminiCMV-Ents is shown. DETAILED DESCRIPTION

[0140] After extensive and in-depth research and a large number of screenings, the inventors have developed for the first time a universal endogenous transcription gating switch (Ents) that can be used to detect the expression levels of low-abundance genes and lncRNAs endogenous to cells, releasing single guide RNA (sgRNA) in the presence of endogenous promoters. When Ents is combined with the highly sensitive CRISPR-activation-related reporter system SPH-OminiCMV of the present invention, endogenous genes can be reliably detected, including genes with very low expression levels (<0.001, relative to Gadph, qPCR analysis). It is worth noting that the method of the present invention can also monitor the transcriptional activity of long non-coding RNAs (lncRNAs) that are usually low in expression in living cells. The method of the present invention is capable of amplifying endogenous signals to visualize the dynamic process of low-abundance genes and lncRNA expression in cells, providing a powerful platform to detect the activity of endogenous genetic elements and their potential cellular functions. The present invention was completed on this basis.

[0141] the term

[0142] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0143] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0144] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0145] As used herein, the term "polynucleotide" refers to a chain compound formed by polymerization of nucleotides.

[0146] sgRNA-responsive promoter

[0147] As used herein, the term "sgRNA-responsive promoter" refers to a type of promoter that can respond to the generated sgRNA and activate a downstream reporter gene in the detection of endogenous nucleic acids in cells of the present invention.

[0148] The sgRNA-responsive promoter provided by the present invention can respond to the complex formed by the upstream sgRNA, dCas9 and transcription activator whose expression is controlled by the endogenous transcript, and initiate the expression of the downstream reporter gene.

[0149] Preferably, the sgRNA-responsive promoter is a mini promoter. More preferably, the sgRNA is a miniCMV promoter.

[0150] The detection system of the present invention

[0151] In the present invention, a detection system for detecting endogenous nucleic acids in cells, especially genes with low expression abundance and long non-coding RNA (lncRNA) is provided for the first time. The detection system comprises two modules: target nucleic acid editing and target nucleic acid reporting.

[0152] The endogenous low-abundance gene in the cell refers to a gene whose expression level in the cell is <0.001 when relative quantification is performed using the Gapdh internal reference gene.

[0153] In one embodiment, the target nucleic acid editing module comprises a structure as shown in Formula I,

[0154] L1-(tRNA-sgRNA) n -tRNA-R1 (Formula I)

[0155] In the formula,

[0156] L1 is the homology arm at the 5′ end;

[0157] R1 is the homology arm at the 3′ end;

[0158] tRNA is the endogenous mechanism that can successfully release a functional sgRNA;

[0159] sgRNA is a guide RNA, which preferably targets the 3' untranslated region (3'UTR) of the target nucleic acid;

[0160] n is a positive integer ≥1, preferably 2≤n≤10, more preferably 6≤n≤8.

[0161] In one embodiment, the reporter nucleic acid construct has a structure as shown in Formula II,

[0162] (TS-I) m -TS-P1-Z2 (Formula II)

[0163] In the formula,

[0164] TS is the binding target site of the sgRNA;

[0165] m is a positive integer ≥ 0, preferably 2≤m≤4, more preferably m=2 (i.e., the structure of formula II most preferably contains 3 TS repeating sequences);

[0166] I is the spacer sequence between TS, which preferably has a length of 35-37 bp;

[0167] P1 is the sgRNA-responsive promoter of the present invention;

[0168] Z2 is a reporter gene sequence, wherein the reporter gene is preferably a gene encoding mCherry.

[0169] Preferably, the expression of the dCas protein and transcription activator in the target nucleic acid reporter module is regulated by the same promoter P2; more preferably, the promoter P2 is a CAG promoter.

[0170] The detection system provided by the present invention can be used to prepare a kit for detecting endogenous nucleic acids in cells. In a preferred embodiment, the kit can be used for disease diagnosis, and the disease is a disease related to abnormal expression of endogenous nucleic acids in cells.

[0171] Detection method of the present invention

[0172] The present invention also provides a method for detecting whether a target endogenous nucleic acid is present in a cell sample, comprising the steps of: (i) introducing the detection system of the present invention into the cell sample to be detected; and (ii) detecting the level of a reporter gene or its encoded product in a detection target nucleic acid reporter module in the detection system.

[0173] The method of the present invention includes qualitative detection and quantitative detection. In particular, the method includes dynamically detecting the level of target endogenous nucleic acid in a cell sample.

[0174] In one embodiment, the method is non-diagnostic and / or non-therapeutic.

[0175] The main advantages of the present invention include:

[0176] 1) The detection system and detection method of the present invention are transcript-dependent, and are independent of protein expression.

[0177] 2) The detection system and detection method of the present invention have a strong amplification effect, low-expressed genes and LncRNA can be detected, and can be used for gene detection with the expression level of the target gene / the expression level of Gapdh <0.001.

[0178] 3) The detection system and detection method of the present invention can monitor the dynamic expression of low-abundance genes or LncRNA in cells in real time.

[0179] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0180] Example 1: Development of the SPH-OminiCMV-Ents system

[0181] The key design of Ent-switch is to insert the sgRNA precursor into the transcription region of the endogenous gene. The sgRNA precursor is flanked by sequences that can be recognized and released by endogenous mechanisms after transcription, such as Figure 1 As shown in a. The targeted gene and sgRNA precursor are transcribed into a single transcript driven by the endogenous promoter, and then the mature sgRNA is released through the endogenous cleavage process, as shown in Figure 1 As shown in a.

[0182] In this example, a highly sensitive CRISPR activator-associated reporter system is provided to effectively detect the presence of released sgRNA. In this system, mCherry expression is induced by targeting a minimal promoter (mini-promoter) and using the CRISPR-activator Suntag-P65-HSF1 (SPH) activation system previously developed by the inventors.

[0183] In order to induce effective activation, sgRNAs were first pre-screened, and sgRNA 2 that could induce strong expression of mCherry was used for subsequent experiments ( Figure 6 a and Table 1). In Table 1, various sgRNAs (named Actb-Intron1, with a length of 21 bp) used to activate miniCMV-mCherry expression are listed, which are all sgRNAs used when Trna-sgRNA is knocked into the intron1 position of the actb gene.

[0184] Then, SPH, U6-driven sgRNA, and mCherry driven by a mini-promoter (Mini-TK, Luc2CP, TRE3G, or miniCMV) were co-transfected into N2a cells.

[0185] The results showed that the miniCMV promoter showed low background without sgRNA induction, and after sgRNA induction, mCherry was able to express the highest expression level ( Figure 1 b and Figure 7 a, b).

[0186] Table 1 Pre-screened sgRNA sequences

[0187]

[0188]

[0189] In addition, the effects of different copy numbers and spacing of sgRNA target sites (TS) upstream of the miniCMV promoter driving mCherry expression were tested.

[0190] The results showed that three TSs separated by 35 bp upstream of the miniCMV promoter could induce the highest expression level of mCherry ( Figure 1 c, d and Figure 7 c, d). Notably, the optimized miniCMV (OminiCMV) plus SPH induced higher mCherry expression levels than the commonly used strong promoters (CAG, CMV, and EF1a) ( Figure 1 e and Figure 7 e, f and 8a, b, and Table 2), and showed high site specificity ( Fig. 9 a and Table 1).

[0191] Table 2 sgRNA sequences for activating endogenous genes

[0192]

[0193]

[0194] Thus, in this example, tools were further established to detect sgRNA release with high sensitivity and wide dynamic range. Next, we explored whether a highly sensitive reporter system could effectively detect sgRNA released from a single transcript containing both the gene and the sgRNA precursor. SPH and OminiCMV-mCherry (SPH-OminiCMV) were transgenically integrated into mouse embryonic stem cells (mESCs), after which three different sgRNA precursors, miR30, self-cleavage, and tRNA, were inserted into the intron of the housekeeping gene Actb ( Figure 1 f and Fig.10 ad and Table 3). To avoid cutting of sgRNA TS(SpCas9) in OminiCMV, SaKKHCas9 was used to insert SpCas9 sgRNA precursor ( Figure 1f and Table 3).

[0195] Table 3 sgRNA sequences used for insertion of sgRNA precursor (SaKKHCas9)

[0196]

[0197]

[0198] The results showed that only the insertion of tRNA-sgRNA-tRNA precursor could effectively induce mCherry ( Figure 1 g, h). As previously reported, tRNA can be inserted into foreign genes in the form of sgRNA-tRNA precursors and precisely cleaved by endonucleases RNase P and RNase Z, followed by the release of sgRNA.

[0199] To investigate the effect of insertion position on mCherry induction and protein stability, tRNA-sgRNA-tRNA was inserted into different sites of the Nanog or Actb locus ( Figure 1 i and Fig.11 a). Although all insertions had no apparent effect on Nanog stability at the protein level, only the 3' untranslated region (3'UTR) insertion stably induced high-level expression of mCherry ( Figure 1 jl and Fig.11 ac). Therefore, 3'UTR insertion was chosen in subsequent experiments.

[0200] In addition, the present inventors also inserted a non-target tRNA-sgRNA-tRNA (sgLacZ) into the 3'UTR of Actb, but no increase in mCherry expression was observed ( Fig.11 d, e).

[0201] Example 2: SPH-OminiCMV-Ents can amplify the signals of low-abundance genes and track the dynamic expression of genes during differentiation

[0202] Fluorescence visualization technology provides a simple and direct method to capture the spatiotemporal information of cellular events. To explore whether SPH-OminiCMV-Ents can faithfully reflect the expression levels of target genes, tRNA-sgRNA-tRNA was inserted into the 3'UTR region of eight differentially expressed genes, including a highly expressed housekeeping gene Actb and seven pluripotency-related genes ( Figure 2 a).

[0203] The results showed that there was a significant correlation between gene expression level and mCherry intensity ( Figure 2b, c, r2=0.8644, p=0.0008), indicating that SPH-OminiCMV-Ents can be used as a reporter system to monitor gene expression levels at the cellular level.

[0204] In this example, the fluorescence intensity induced by SPH-OminiCMV-Ent and P2A-mCherry strategies was also compared 9. It is worth noting that the mCherry expression level induced by SPH-OminiCMV-Ents was higher than that of the P2A-mCherry strategy, and low-abundance genes (expression level of target gene / Gapdh < 0.01, qPCR analysis) such as Sox2, Tet1, Sall4 and Tbx3, which were almost invisible under the microscope using the P2A-mCherry strategy ( Figure 2 b, c and Table 4).

[0205] Table 4 Relative expression levels of genes

[0206] Gene name Relative mRNA expression (qPCR) Actb 0.080380 Nanog 0.028545 Med7 0.012146 Sox2 0.005398 Tet1 0.003195 Tbx3 0.002834 Sall4 0.002772 Esrrb 0.001845 Terb 0.000222 Jag1 0.000101 Fj 0.000050 Slc7a11 0.000016 Sema3a 0.000005 LncRNA Relative mRNA expression (qPCR) Malat1 0.003989 Lncenc1 0.008091 Tug1 0.003450 Dancr 0.007491 Firre 0.000511 Pvt1 0.000197 Tunar 0.000073 Miat 0.000014

[0207] Next, we examined whether SPH-OminiCMV-Ents could track the expression dynamics of endogenous genes during cell differentiation. To induce mESC differentiation into neural progenitor cells, SPH-OminiCMV mESCs inserted with tRNA-sgRNA-tRNA were cultured in N2B27 medium. In this case, the expression levels of genes such as Nanog, Esrrb, Sox2, and Tet1, which are associated with pluripotency, decreased after cell differentiation ( Figure 2 dg and Fig.12 af, Table 5), which is consistent with previous reports. Notably, mCherry expression decreased along with these pluripotency-related genes during differentiation, whereas mCherry expression remained stable in SPH-OminiCMV-Ents-Actb mESCs ( Figure 2 dg and Fig.12 a, c, e).

[0208] Table 5 qPCR primers

[0209]

[0210]

[0211] Together, these data demonstrate that SPH-OminiCMV-Ents can reliably track gene activities, including genes of low abundance.

[0212] Example 3: Detection of lncRNA activity using SPH-OminiCMV-Ents

[0213] Long noncoding RNAs (lncRNAs) have been identified as playing important roles in a variety of biological processes, and their expression is often restricted to specific cell types or at specific developmental stages. However, detection and functional analysis of lncRNAs is difficult because conventional strategies of co-expressing fluorescent proteins are not applicable to non-translated genetic elements. LncRNAs are also difficult to study because they are usually expressed at very low levels.

[0214] In this example, we tested whether SPH-OminiCMV-Ents can be used to detect lncRNAs. The tRNA-sgRNA-tRNA cassette targeting mCherry was inserted into the 3'UTR of two lncRNAs, malt1 and Lncenc1, in the SPH-OminiCMV mESC cell line. Interestingly, the results showed that mCherry was expressed in SPH-OminiCMV-Ents-Malat1 and SPH-OminiCMV-Ents-Lncenc1 cells, but not in SPH-OminiCMV mESCs ( Figure 3 ad).

[0215] Next, the inventors examined whether mCherry expression in SPH-OminiCMV-Ents-Lncenc1 mESCs was shut down due to the reduction of Lncenc1 expression during cell differentiation. The results were consistent with previous reports that the transcription level of Lncenc1 was significantly reduced during mESC differentiation ( Figure 3 df). Among them, the expression of mCherry is downregulated as the lncRNA decreases during differentiation ( Figure 3 d, e), indicating that SPH-OminiCMV-Ents can be used to track the dynamic expression of lncRNA.

[0216] Example 4: Improving the sensitivity of SPH-OminiCMV-Ents by encoding an sgRNA array

[0217] In this example, we investigated whether increasing the number of sgRNA copies would further enhance the production of fluorescent proteins. The inventors constructed an sgRNA precursor containing six to eight tandem sgRNA copies, each of which was flanked by tRNA ( Figure 4a). In the SPH-OminiCMV mESC cell line, the sgRNA arrays were inserted into the 3'UTR of an unexpressed gene, Sema3a (0.000005 relative to Gadph), two low-abundance genes, Tet1 (0.003195) and Fzd7 (0.000050), and three lncRNAs, Lncenc1 (0.008091), Malat1 (0.003989), and Tug1 (0.003450) ( Figure 4 be and Table 4).

[0218] The results showed that for some low-abundance genes (Tet1 and Fzd7) and two of the three lncRNAs (Lncenc1 and Tug1), cells with the sgRNA array inserted expressed higher levels of mCherry than cells with one copy of the sgRNA inserted. In contrast, the SPH-OminiCMV-Ents-Sema3a mESC line with one or more sgRNAs inserted had no mCherry expression ( Fig.13 ad). Notably, insertion of the sgRNA array enabled visualization and tracking of very low-abundance genes Fzd7 and lncRNA Tug1, whose expression could not be detected using only one copy of the sgRNA ( Figure 4 bf).

[0219] Subsequently, we tested whether SPH-OminiCMV-Ents (sgRNA array) could be turned on with increased gene expression during cell differentiation.

[0220] Specifically, the inventors generated SPH-OminiCMV-Ents-Tubb3 (sgRNA array) mESCs and differentiated them into neurons. The results showed that the expression of mCherry was upregulated as the expression of Tubb3 increased during the differentiation of mESCs ( Figure 4 g, h), which is consistent with previous reports.

[0221] In many cases, multiple events may need to be regulated in a specific cell type. To this end, the inventors inserted an sgRNA targeting mCherry and multiple sgRNAs of endogenous genes into the 3'UTR of Actb in the SPH-OminiCMV mESC cell line.

[0222] The results showed that inserting two sgRNA arrays targeting mCherry and Ngn2, respectively, upregulated the expression of both mCherry and Ngn2 ( Figure 4 i). Similarly, mCherry and Hbb can also be activated simultaneously by inserting sgRNA arrays targeting mCherry and Hbb ( Figure 4 j).

[0223] In summary, the present inventors demonstrated that the expression of multiple sgRNAs in the sgRNA precursor further improved the sensitivity of SPH-OminiCMV-Ents and could perform multiple transcriptional regulation in a cell type-specific manner.

[0224] Example 5: Achieving homogeneous expression of mCherry by driving dCas9 and activator under one promoter

[0225] The inventors have noticed that some cell clones show heterogeneous mCherry expression ( Figure 5 a and Fig.14 a, b). To explore the cause of heterogeneity, the present inventors sorted mCherry-high (high 5%) and mCherry-low (low 5%) mESCs and compared the expression levels of dCas9, P65-HSF1 and sgRNA in these two groups.

[0226] qPCR results showed that dCas9 was significantly downregulated in the mCherry-low cell population ( Fig.14 c), indicating that heterogeneity may be caused by the differential expression of dCas9 and activators driven by two CAG promoters in cells.

[0227] To reduce heterogeneity, the inventors constructed a single CAG-SPH vector to express dCas9 and an activator under a single promoter ( Figure 5 b and Fig.14 d). The results of the present inventors showed that SPH (single CAG)-OminiCMV-Ents induced mCherry expression more uniformly and at a higher level than SPH-OminiCMV-Ents (double CAG) ( Figure 5 bd and Fig.14 e, 10a, 10b).

[0228] Furthermore, the combination of SPH (single CAG) and sgRNA arrays further improved sensitivity compared with SPH (single CAG)–OminiCMV-Ents–single sgRNA, as demonstrated by mCherry expression levels ( Figure 5 c, d, and Fig.15a, 15b, 11a-e, 12a). By combining SPH (single CAG) and sgRNA arrays, it was demonstrated that SPH (single CAG)-OminiCMV-Ents-sgRNA arrays could detect low-abundance lncRNAs that could not be seen by SPH (single CAG)-OminiCMV-Ents-single sgRNA (the expression level of target lncRNA / Gapdh that could be achieved was <0.001, qPCR analysis) ( Figure 5 e, f).

[0229] Example 6: Quantitative characterization of the Ents system

[0230] During differentiation, for the Nanog-P2A-mCherry cell line, the decrease in Nanog expression was strictly correlated with the decrease in mCherry, while there was a time lag between Nanog and mCherry expression in the Ents system ( Fig.18 ad).

[0231] To determine the characteristics of Ents, a Tet-On system was designed in this example to insert tRNA-sgRNA-tRNA into the 3'UTR of GFP. Addition of doxycycline (Dox) to cell culture can induce the expression of GFP and tRNA-sgRNA-tRNA ( Fig.18 e).

[0232] The results showed that when cells were exposed to different concentrations of Dox, the expression levels of GFP and mCherry were highly correlated, suggesting the reliability of using SPH (single CAG)-OminiCMV-Ents to indicate the dynamic expression of endogenous genes ( Fig.18 f, g).

[0233] Next, the inventors used this system to explore the time difference between the expression and shutoff of the target gene and the reporter gene. The data showed that when turned on, the time difference between the expression of GFP and mCherry at the mRNA level was about 0.5 hours ( Fig.18 h, i), protein levels at 6 h ( Fig.18 j); when it is turned off, at the mRNA level, the time delay is about 4.5 hours ( Fig.18 k, 1), protein levels at 18 h ( Fig.18 m).

[0234] Table 6 Nucleic acid constructs and their sequence numbers involved in the present invention

[0235]

[0236] discuss

[0237] In the present invention, a highly programmable sgRNA switch (Ents) driven by an endogenous promoter was developed, which can theoretically process the information of any transcript. The data of the present invention show that when Ents is used in combination with SPH-OminiCMV, SPH-OminiCMV-Ents can amplify endogenous signals and reliably detect the activity of low-abundance genes and lncRNAs, opening up new ways to study the functional roles of these genetic elements in living cells.

[0238] For the P2A-mCherry strategy, endogenous genes with expression levels below 0.01 relative to Gapdh are almost impossible to visualize. The present invention uses the SPH (single CAG)-OminiCMV-Ents-single sgRNA system to visualize genes (Esrrb) with expression levels as low as 0.001845 relative to Gadph, and lncRNA (Malat1) with expression levels as low as 0.003989 relative to Gadph. For the SPH (single CAG)-OminiCMV-Ents-sgRNA array system, genes (Fzd7) with gene expression levels as low as 0.000050 relative to Gapdh and lncRNA (Pvt1) as low as 0.000197 can be observed.

[0239] In the present invention, all experiments were performed in cells. Future work will involve the application of SPH-OminiCMV-Ents in vivo to perform spatiotemporal profiles of gene expression and to mark specific cell populations. Because the processing of endogenous signals is supported by sgRNA, this design bypasses the cumbersome sensor-effector recognition process and provides an almost unlimited number of highly specific and efficient triggers. In addition to monitoring the expression of genetic elements, Ents can also be applied to perform many functions. For example, Ents can be paired with different CRISPR effectors to achieve cell type-specific gene disruption, base editing, or epigenetic modifications.

[0240] The present invention demonstrates that ENTs design enables the construction of multi-input logic operations by integrating multiple sgRNAs targeting different locations into a single precursor, thus providing a promising tool for probing endogenous signals and integrating complex cellular functions in specific cell types.

[0241] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences <120> A method for detecting the levels of endogenous low-abundance genes and lncRNA in cells <130> P2020-2075 <160> 166 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <400> 1 ggtcatcgct agaacgaagc 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <400> 2 gtcccctcca ccccacagtg 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 gcgataggta gtaagtcgcg 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 ctgacgatac cgcgtgatgt 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 ttctactggc gatcgtaatg 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 tacggtcgca taggacgcag 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <400> 7 cgacgattac aatgcgccac 20 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <400> 8 ttccagcgag ataagcggag 20 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <400> 9 ggattcgaca catcgtgcct 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <400> 10 taccttacgg tgatccgaag 20 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <400> 11 atacacatga ggtacggtgc 20 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 12 cctagccatt aacgtacgga 20 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <400> 13 atacattgac ggttaccaac 20 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <400> 14 cgtgctacga cgtcataacg 20 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <400> 15 cctcgttact cgaacgtagg 20 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <400> 16 caccttgtgt agcgaaccgc 20 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <400> 17 aatgactatc ttagcgatcg 20 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <400> 18 cctcgagaag ttatggtgca 20 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <400> 19 tccgacgttc gactatcacc 20 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <400> 20 attgaccgat tacgtgacag 20 <210> twenty one <211> 20 <212> DNA <213> Artificial sequence <400> twenty one aacgttcaat accactcgag 20 <210> twenty two <211> 20 <212> DNA <213> Artificial sequence <400> twenty two tcgttcgaga acttatcacc 20 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <400> twenty three gtactagacg tcgcctatag 20 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <400> twenty four ctcgaattag ctcaagacgc 20 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25 gcatgtcgag cacgaagatc 20 <210> 26 <211> 20 <212> DNA <213> Artificial sequence <400> 26 taaggatccg gatgagttag 20 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <400> 27 aggttcgcaa ccgtgctcag 20 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <400> 28 acatcttgct cgaaggtcgg 20 <210> 29 <211> 20 <212> DNA <213> Artificial sequence <400> 29 ttacctccta tacgcagtcg 20 <210> 30 <211> 20 <212> DNA <213> Artificial sequence <400> 30 tcttgagctt gtagtgcggt 20 <210> 31 <211> 20 <212> DNA <213> Artificial sequence <400> 31 tattcggtct accggtgttc 20 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <400> 32 tcagttcgtg ccagtaatag 20 <210> 33 <211> 20 <212> DNA <213> Artificial sequence <400> 33 cgagttcttc gctgtaatag 20 <210> 34 <211> 20 <212> DNA <213> Artificial sequence <400> 34 cacgcagtct agatagtacg 20 <210> 35 <211> 20 <212> DNA <213> Artificial sequence <400> 35 tacgtgtgat gatcgttact 20 <210> 36 <211> 20 <212> DNA <213> Artificial sequence <400> 36 ctcgttcaac ggttcactac 20 <210> 37 <211> 20 <212> DNA <213> Artificial sequence <400> 37 tcactgttgc gtccagacgt 20 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <400> 38 gcacagtatc cgacttcaag 20 <210> 39 <211> 20 <212> DNA <213> Artificial sequence <400> 39 gaccattcgt agctacgact 20 <210> 40 <211> 20 <212> DNA <213> Artificial sequence <400> 40 tcgacgatcc gtataagctc 20 <210> 41 <211> 20 <212> DNA <213> Artificial sequence <400> 41 cgattatgac gtgacaggtg 20 <210> 42 <211> 20 <212> DNA <213> Artificial sequence <400> 42 cttctgagcg cttcactagc 20 <210> 43 <211> 20 <212> DNA <213> Artificial sequence <400> 43 acatcggatt acacacgctc 20 <210> 44 <211> 20 <212> DNA <213> Artificial sequence <400> 44 agatcaagcg tggttcgacc 20 <210> 45 <211> 20 <212> DNA <213> Artificial sequence <400> 45 gaatggtacc gaactggcag 20 <210> 46 <211> 20 <212> DNA <213> Artificial sequence <400> 46 ctgtgtgcgg ttagttcgag 20 <210> 47 <211> 20 <212> DNA <213> Artificial sequence <400> 47 atagtggtcg ctcctgacgg 20 <210> 48 <211> 20 <212> DNA <213> Artificial sequence <400> 48 gctatgaacg cgattagatg 20 <210> 49 <211> 20 <212> DNA <213> Artificial sequence <400> 49 tgcgaatacg cccacgcgat 20 <210> 50 <211> 20 <212> DNA <213> Artificial sequence <400> 50 agctgaggag gtgggggaag 20 <210> 51 <211> 20 <212> DNA <213> Artificial sequence <400> 51 gagtttgcaa ggagcgggcg 20 <210> 52 <211> 20 <212> DNA <213> Artificial sequence <400> 52 gaaaacaatc agatctgccc 20 <210> 53 <211> 20 <212> DNA <213> Artificial sequence <400> 53 cgggggacca ggacaggcgg 20 <210> 54 <211> 20 <212> DNA <213> Artificial sequence <400> 54 tgcgcctcgt atcactgcgc 20 <210> 55 <211> 20 <212> DNA <213> Artificial sequence <400> 55 gcggctcctc gggcgcacca 20 <210> 56 <211> 20 <212> DNA <213> Artificial sequence <400> 56 agagagagga aacagaagcg 20 <210> 57 <211> 20 <212> DNA <213> Artificial sequence <400> 57 gagaaattaa ttggggtggg 20 <210> 58 <211> 20 <212> DNA <213> Artificial sequence <400> 58 gtggaggtga agtcctggag 20 <210> 59 <211> 20 <212> DNA <213> Artificial sequence <400> 59 cgcccctttc cggtcagtag 20 <210> 60 <211> 20 <212> DNA <213> Artificial sequence <400> 60 gcactaagat agtgtccagt 20 <210> 61 <211> 20 <212> DNA <213> Artificial sequence <400> 61 tgcgaatacg cccacgcgat 20 <210> 62 <211> twenty one <212> DNA <213> Artificial sequence <400> 62 ccgggcagcc gcgctcccag c 21 <210> 63 <211> twenty one <212> DNA <213> Artificial sequence <400> 63 ccaaagcatg gaccaactta c 21 <210> 64 <211> twenty one <212> DNA <213> Artificial sequence <400> 64 ggtttacagt gtagatgcgg t 21 <210> 65 <211> twenty one <212> DNA <213> Artificial sequence <400> 65 cttcacctcc cacacccatc c 21 <210> 66 <211> twenty one <212> DNA <213> Artificial sequence <400> 66 aaagggacag gactaatgga c 21 <210> 67 <211> twenty one <212> DNA <213> Artificial sequence <400> 67 ttgcgtaagt ctcatatttc a 21 <210> 68 <211> twenty one <212> DNA <213> Artificial sequence <400> 68 ttgcgtaagt ctcatatttc a 21 <210> 69 <211> twenty one <212> DNA <213> Artificial sequence <400> 69 gctctattta caacttggtg t 21 <210> 70 <211> twenty one <212> DNA <213> Artificial sequence <400> 70 aacagtccgc ctagaagcac t 21 <210> 71 <211> twenty one <212> DNA <213> Artificial sequence <400> 71 ttgcgtaagt ctcatatttc a 21 <210> 72 <211> twenty one <212> DNA <213> Artificial sequence <400> 72 tggagatgct ggaggccaag g 21 <210> 73 <211> twenty one <212> DNA <213> Artificial sequence <400> 73 agccctcaca tgtgcgacag g 21 <210> 74 <211> twenty one <212> DNA <213> Artificial sequence <400> 74 cagttccctc acttcctgga g 21 <210> 75 <211> twenty one <212> DNA <213> Artificial sequence <400> 75 agcctttaga cccaacgatt g 21 <210> 76 <211> twenty one <212> DNA <213> Artificial sequence <400> 76 ggtaaggacc ggggctcata c 21 <210> 77 <211> twenty one <212> DNA <213> Artificial sequence <400> 77 agccaagaga gaagttaaga c 21 <210> 78 <211> twenty one <212> DNA <213> Artificial sequence <400> 78 tgcacaaaga agcacacaat g 21 <210> 79 <211> twenty one <212> DNA <213> Artificial sequence <400> 79 tgccaagttc cattgctgct a 21 <210> 80 <211> twenty one <212> DNA <213> Artificial sequence <400> 80 tgaaatgaat gaaaggccat g 21 <210> 81 <211> twenty one <212> DNA <213> Artificial sequence <400> 81 cggaaggaga cagggttagt c 21 <210> 82 <211> twenty one <212> DNA <213> Artificial sequence <400> 82 ggaaagtgcc cagagcttga a 21 <210> 83 <211> twenty one <212> DNA <213> Artificial sequence <400> 83 gtcttctggt acaacttcta g 21 <210> 84 <211> twenty one <212> DNA <213> Artificial sequence <400> 84 gtgttaggac aaattgctcc a 21 <210> 85 <211> twenty one <212> DNA <213> Artificial sequence <400> 85 ctcagcttct tcaattacct t 21 <210> 86 <211> twenty one <212> DNA <213> Artificial sequence <400> 86 atcactgtca gacaaggtgg c 21 <210> 87 <211> twenty one <212> DNA <213> Artificial sequence <400> 87 accgtggctg tatgtatttt a 21 <210> 88 <211> twenty one <212> DNA <213> Artificial sequence <400> 88 gagtgactgg tttataaggg a 21 <210> 89 <211> twenty one <212> DNA <213> Artificial sequence <400> 89 ccaactactc caacgacttg a 21 <210> 90 <211> twenty one <212> DNA <213> Artificial sequence <400> 90 ctcttgttcc tctgggctaa g 21 <210> 91 <211> 19 <212> DNA <213> Artificial sequence <400> 91 ccgcatgcac aacctaaac 19 <210> 92 <211> 19 <212> DNA <213> Artificial sequence <400> 92 gtgagcgccc agatgtaat 19 <210> 93 <211> 20 <212> DNA <213> Artificial sequence <400> 93 gtaccacttg ggctgtttct 20 <210> 94 <211> twenty three <212> DNA <213> Artificial sequence <400> 94 gcaggtcttt ctccttctca tag 23 <210> 95 <211> 20 <212> DNA <213> Artificial sequence <400> 95 gagtcaccgg acaatgacaa 20 <210> 96 <211> 19 <212> DNA <213> Artificial sequence <400> 96 gtctgcgctt tggagaaga 19 <210> 97 <211> 20 <212> DNA <213> Artificial sequence <400> 97 agctgccaga tagcatgaag 20 <210> 98 <211> 20 <212> DNA <213> Artificial sequence <400> 98 tagggcggat aggtggtaat 20 <210> 99 <211> 20 <212> DNA <213> Artificial sequence <400> 99 gaaacccccg gattagagcc 20 <210> 100 <211> twenty one <212> DNA <213> Artificial sequence <400> 100 gagcaaaggt ctccttgagg t 21 <210> 101 <211> 20 <212> DNA <213> Artificial sequence <400> 101 tagaccccag cggcaactat 20 <210> 102 <211> twenty one <212> DNA <213> Artificial sequence <400> 102 gttccaggtt ccaagtccac c 21 <210> 103 <211> 20 <212> DNA <213> Artificial sequence <400> 103 ggctgtattc ccctccatcg 20 <210> 104 <211> twenty two <212> DNA <213> Artificial sequence <400> 104 ccagttggta acaatgccat gt 22 <210> 105 <211> twenty one <212> DNA <213> Artificial sequence <400> 105 tcttcctggt ccccacagtt t 21 <210> 106 <211> twenty three <212> DNA <213> Artificial sequence <400> 106 gcaagaatag ttctcgggat gaa 23 <210> 107 <211> 19 <212> DNA <213> Artificial sequence <400> 107 gcacctgggc tctagttgc 19 <210> 108 <211> twenty one <212> DNA <213> Artificial sequence <400> 108 tacagtcctc gtagctcttg c 21 <210> 109 <211> twenty one <212> DNA <213> Artificial sequence <400> 109 gcggagtgga aacttttgtc c 21 <210> 110 <211> twenty two <212> DNA <213> Artificial sequence <400> 110 cgggaagcgtgtacttatcc tt 22 <210> 111 <211> 20 <212> DNA <213> Artificial sequence <400> 111 acacagtggt gctaatgcag 20 <210> 112 <211> 20 <212> DNA <213> Artificial sequence <400> 112 agcatgaacg ggagaatcgg 20 <210> 113 <211> 20 <212> DNA <213> Artificial sequence <400> 113 aactccacgt ccccatacag 20 <210> 114 <211> 20 <212> DNA <213> Artificial sequence <400> 114 gaggcgcata acgatgcttc 20 <210> 115 <211> 19 <212> DNA <213> Artificial sequence <400> 115 ccagcgtcct gtggtaaag 19 <210> 116 <211> 20 <212> DNA <213> Artificial sequence <400> 116 gattctcatc ccctgcctat 20 <210> 117 <211> 20 <212> DNA <213> Artificial sequence <400> 117 catggccttc cgtgttccta 20 <210> 118 <211> 17 <212> DNA <213> Artificial sequence <400> 118 gcggcacgtc agatcca 17 <210> 119 <211> 19 <212> DNA <213> Artificial sequence <400> 119 aggacggcga gttcatcta 19 <210> 120 <211> twenty two <212> DNA <213> Artificial sequence <400> 120 cccatggtct tcttctgcat ta 22 <210> 121 <211> 20 <212> DNA <213> Artificial sequence <400> 121 ccccaccaag caagagagac 20 <210> 122 <211> 19 <212> DNA <213> Artificial sequence <400> 122 ggggcaaatc atcgggcaa 19 <210> 123 <211> 19 <212> DNA <213> Artificial sequence <400> 123 gcactttggt tgcccaatg 19 <210> 124 <211> 19 <212> DNA <213> Artificial sequence <400> 124 gcacgtttct ctcgttgcg 19 <210> 125 <211> 20 <212> DNA <213> Artificial sequence <400> 125 cctcgggtca gtttgagctg 20 <210> 126 <211> twenty two <212> DNA <213> Artificial sequence <400> 126 ccttgaggca cactttgaag ta 22 <210> 127 <211> 19 <212> DNA <213> Artificial sequence <400> 127 ggcaccgtca tcggatcag 19 <210> 128 <211> twenty one <212> DNA <213> Artificial sequence <400> 128 ctccacaggc agaccagaaa a 21 <210> 129 <211> 20 <212> DNA <213> Artificial sequence <400> 129 cccttcttca tgtcccactg 20 <210> 130 <211> 20 <212> DNA <213> Artificial sequence <400> 130 aaacggcgag catgtcatag 20 <210> 131 <211> 20 <212> DNA <213> Artificial sequence <400> 131 ggagaaaggc agaaatgcag 20 <210> 132 <211> 20 <212> DNA <213> Artificial sequence <400> 132 cagtgttcca gctccagtga 20 <210> 133 <211> 20 <212> DNA <213> Artificial sequence <400> 133 cttgtatggg tggtggcttt 20 <210> 134 <211> 19 <212> DNA <213> Artificial sequence <400> 134 ccagggagag agtggtgtg 19 <210> 135 <211> 20 <212> DNA <213> Artificial sequence <400> 135 attgggaggg gacttaatgg 20 <210> 136 <211> 20 <212> DNA <213> Artificial sequence <400> 136 gtgttacgga gccagagagc 20 <210> 137 <211> twenty four <212> DNA <213> Artificial sequence <400> 137 gggaggtgta taaagtgaga agct 24 <210> 138 <211> 25 <212> DNA <213> Artificial sequence <400> 138 gtatcccaag gaatgaagtc tgtct 25 <210> 139 <211> 18 <212> DNA <213> Artificial sequence <400> 139 gaaccgcatc gagctgaa 18 <210> 140 <211> twenty one <212> DNA <213> Artificial sequence <400> 140 tgcttgtcgg ccatgatata g 21 <210> 141 <211> 20 <212> DNA <213> Artificial sequence <400> 141 tcaagatccg ccacaacatc 20 <210> 142 <211> 20 <212> DNA <213> Artificial sequence <400> 142 gtgctcaggt agtggttgtc 20 <210> 143 <211> 77 <212> DNA <213> artificial sequence <400> 143 aacaaagcac cagtggtcta gtggtagaat agtaccctgc cacggtacag acccgggttc 60 gattcccggc tggtgca 77 <210> 144 <211> 60 <212> DNA <213> artificial sequence <400> 144 taggcgtgta cggtgggagg cctatataag cagagctcgt ttagtgaacc gtcagatcgc 60 <210> 145 <211> 711 <212> DNA <213> artificial sequence <400> 145 atggtgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 60 gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120 cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180 ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240 cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300 gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360 ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420 atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480 gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 540 gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600 aacatcaagt tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgaa 660 cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaagta a 711 <210> 146 <211> 9663 <212> DNA <213> Artificial Sequence <400> 146 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 240 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360 tagtcatcgc tattaccatg gtcgaggtga gccccacgtt ctgcttcact ctccccatct 420 cccccccctc cccaccccca attttgtatt tatttatttt ttaattattt tgtgcagcga 480 tgggggcggg gggggggggg gggcgcgcgc caggcggggc ggggcggggc gaggggcggg 540 gcggggcgag gcggagaggt gcggcggcag ccaatcagag cggcgcgctc cgaaagtttc 600 cttttatggc gaggcggcgg cggcggcggc cctataaaaa gcgaagcgcg cggcgggcgg 660 gagtcgctgc gttgccttcg ccccgtgccc cgctccgcgc cgcctcgcgc cgcccgcccc 720 ggctctgact gaccgcgtta ctcccacagg tgagcgggcg ggacggccct tctcctccgg 780 gctgtaatta gcgcttggtt taatgacggc tcgtttcttt tctgtggctg cgtgaaagcc 840 ttaaagggct ccgggagggc cctttgtgcg ggggggagcg gctcgggggg tgcgtgcgtg 900 tgtgtgtgcg tggggagcgc cgcgtgcggc ccgcgctgcc cggcggctgt gagcgctgcg 960 ggcgcggcgc ggggctttgt gcgctccgcg tgtgcgcgag gggagcgcgg ccgggggcgg 1020 tgccccgcgg tgcggggggg ctgcgagggg aacaaaggct gcgtgcgggg tgtgtgcgtg 1080 ggggggtgag cagggggtgt gggcgcggcg gtcgggctgt aacccccccc tgcacccccc 1140 tccccgagtt gctgagcacg gcccggcttc gggtgcgggg ctccgtgcgg ggcgtggcgc 1200 ggggctcgcc gtgccgggcg gggggtggcg gcaggtgggg gtgccgggcg gggcggggcc 1260 gcctcgggcc ggggagggct cgggggaggg gcgcggcggc cccggagcgc cggcggctgt 1320 cgaggcgcgg cgagccgcag ccattgcctt ttatggtaat cgtgcgagag ggcgcaggga 1380 cttcctttgt cccaaatctg gcggagccga aatctgggag gcgccgccgc accccctcta 1440 gcgggcgcgg gcgaagcggt gcggcgccgg caggaaggaa atgggcgggg agggccttcg 1500 tgcgtcgccg cgccgccgtc cccttctcca tctccagcct cggggctgcc gcagggggac 1560 ggctgccttc gggggggacg gggcagggcg gggttcggct tctggcgtgt gaccggcggc 1620 tctagagcct ctgctaacca tgttcatgcc ttctctttt tcctacagat ccttaattaa 1680 ctaggctacg cgcgccacca tgcccaagaa gaagcgcaag gtgggacgcg tctgcaggat 1740 atcaagcttg cggtaccgcg ggccgggat cgccaccatg gatagaagt acagcatcgg 1800 cctggccatc ggcaccact ctgtgggctg ggccgtgatc accgacgagt acaggtgcc 1860 cagcaagaaa ttcaggtgc tgggcacac cgaccggcac agcatcaga agaacctgat 1920 cggcgccctg ctgttcgaca gcggagaac agccgaggcc acccggctga aggagaccgc 1980 cagagaga tacaccagac ggagaccg gatctgctat ctgcagaga tctcacagca 2040 cgagatggcc aaggtggacg acagctctt ccacagactg gaagagtcct tcctggtgga 2100 agaggataag aagcacgagc ggcacccat cttcggcac atcgtggacg aggtggccta 2160 ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 2220 ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 2280 cctgatcgag ggcgacctga accccgacaa cagcgacgtg ggalagctgt tcatccagct 2340 ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 2400 caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 2460 gctgcccggc gagaagaaga atggcctgtt cggcaacctg attgccctga gcctgggcct 2520 gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 2580 ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 2640 cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 2700 gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2760 ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2820 agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacatcgatg gcggagccag 2880 ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2940 actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 3000 cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 3060 tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 3120 cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 3180 gagcgaggaa accatcacccc cctggaactt cgaggaagtg gtggacaagg gcgccagcgc 3240 ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 3300 gcccaagcac agcctgctgt acgagtactt caccgtgtac aacgagctga ccaaagtgaa 3360 atacgtgacc gaggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaagccat 3420 cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 3480 cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 3540 cgcctccctg ggcacatacc acgatctgct gaaaattatc areacaagg acttcctgga 3600 3660 cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3720 gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3780 cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3840 cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3900 ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3960 cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 4020 gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 4080 gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 4140 caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 4200 cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 4260 ggacatcaac cggctgtccg actacgatgt ggacgctatc gtgcctcaga gctttctgaa 4320 ggacgactcc atcgataaca aagtgctgac tcggagcgac aagaaccggg gcaagagcga 4380 4440 tgccaagctg attacccaga ggaagttcga caatctgacc aaggccgaga gaggcggcct 4500 gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 4560 4620 actgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 4680 ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4740 cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4800 cgtgtacggc gactacaagg tgtacgacgt gcggaagaatg atcgccaaga gcgagcagga 4860 aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4920 cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4980 aacaggcgag atcgtgtggg ataagggccg ggactttgcc accgtgcgga aagtgctgtc 5040 tatgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 5100 gtctatcctg cccaagagga acagcgacaa gctgatcgcc agaaagaagg actgggaccc 5160 tagaaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 5220 agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 5280 catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 5340 agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 5400 cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 5460 gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 5520 ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaaacact acctggacga 5580 gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 5640 caaggtgctg agcgcctaca acaagcacag agacaagcct atcagagagc aggccgagaa 5700 tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5760 caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5820 ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5880 cgcctatccc tatgacgtgc ccgattatgc cagcctgggc agcggctccc ccaagaaaaa 5940 acgcaaggtg gaagatccta agaaaaagcg gaagtggac ggcattggta gtgggagcaa 6000 cggcagcagc ggatccaacg gtccgactga cgccgcggaa gaagaacttt tgagcaaga 6060 ttatcatctt gagaacgaag tggctcgtct taagaaaggt tctggcagtg gagagaaact 6120 gctttcaaag aattaccacc tggaaatga ggtagctaga ctgaaaaagg ggagcggaag 6180 tgggaggag ttgctgagca aaaattatca tttggagaac gaagtagcac gactaaagaa 6240 agggtccgga tcgggtgagg agttactctc gaaaaattat catctcgaaa acgaagtggc 6300 tcggctaaaa aagggcagtg gttctggaga agagctatta tctaaaaact accacctcga 6360 6420 ttatcatctt gagaacgagg tagcgcgttt gaagaagggt tccggctcag gagaggaact 6480 gctctcgaag aactatcatc ttgaaaatga ggtcgctcga ttaaaaaagg gatcgggcag 6540 tggtgaggaa ctactttcaa agaattacca cctcgaaaac gaagtagctc gattaaaagaa 6600 aggttcaggg tcgggtgaag aattactgag taaaaattat catctggaaa atgaggtagc 6660 gagactaaaa aaggggagtg gttctggcga ggaattgcta tcgaaaaatt atcatcttga 6720 gaacgaagtt gctaggctca aaaagggctc aggctcaggc accgcggtaa acataggtgg 6780 tggaaccggt ccgatggatc tacagcggcc gcaaggtgga ggtggaccca agaagaagcg 6840 caaggtggga agcggagcta ctaacttcag cctgctgaag caggctgggag acgtgggaga 6900 gaacctgga cctgcaccag gaagtatgag cgagctgatt aaggaaca tgcacatgaa 6960 gctgtacatg ggccccgaca tcgtgatgac ccagagcccc agcagcctga gcgccagcgt 7020 gggcgaccgc gtgaccatca cctgccgcag cagcaccggc gccgtgacca ccagcaacta 7080 cgccagctgg gtgcaggaga agcccggcaa gctgttcaag ggcctgatcg gcggcaccaa 7140 caaccgcgcc cccggcgtgc ccagccgctt cagcggcagc ctgatcggcg acaaggccac 7200 cctgaccatc agcagcctgc agcccgagga cttcgccacc tacttctgcg ccctgtggta 7260 cagcaaccac tgggtgttcg gccagggcac caaggtggag ctgaagcgcg gcggcggcgg 7320 cagcggcggc ggcggcagcg gcggcggcgg cagcagcggc ggcggcagcg aggtgaagct 7380 gctggagagc ggcggcggcc tggtgcagcc cggcggcagc ctgaagctga gctgcgccgt 7440 gagcggcttc agcctgaccg actacggcgt gaactgggtg cgccaggccc ccggccgcgg 7500 cctggagtgg atcggcgtga tctggggcga cggcatcacc gactacaaca gcgccctgaa 7560 ggaccgcttc atcatcagca aggagaacgg caagaacacc gtgtacctgc agatgagcaa 7620 ggtgcgcagc gacgacaccg ccctgtacta ctgcgtgacc ggcctgttcg actactgggg 7680 ccagggcacc ctggtgaccg tgagcagcta cccatacgat gttccagatt acgctggtgg 7740 aggcggaggt tctggggag gaggtagtgg cggtggtggt tcaggaggcg gcggaagccc 7800 taagaaaaag aggaaggtgg cggccgctgg atccccttca gggcagatca gcaaccaggc 7860 cctggctctg gcccctagct ccgctccagt gctggcccag actatggtgc cctctagtgc 7920 tatggtgcct ctggcccagc cacctgctcc agcccctgtg ctgaccccag gaccacccca 7980 gtcactgagc gctccagtgc ccaagtctac acaggccggc gaggggactc tgagtgaagc 8040 tctgctgcac ctgcagttcg acgctgatga ggacctggga gctctgctgg ggaacagcac 8100 cgatcccgga gtgttcacag atctggcctc cgtggacaac tctgagtttc agcagctgct 8160 gaatcagggc gtgtccatgt ctcatagtac agccgaacca atgctgatgg agtaccccga 8220 agccattacc cggctggtga ccggcagcca gcggcccccc gaccccgctc caactcccct 8280 gggaaccagc ggcctgccta atgggctgtc cggagatgaa gacttctcaa gcatcgctga 8340 tatggacttt agtgccctgc tgtcacagat ttcctctagt gggcagggag gaggtggaag 8400 cggcttcagc gtggacacca gtgccctgct ggacctgttc agcccctcgg tgaccgtgcc 8460 cgacatgagc ctgcctgacc ttgacagcag cctggccagt atccaagagc tcctgtctcc 8520 ccaggagccc cccaggcctc ccgaggcaga gaacagcagc ccggattcag ggaagcagct 8580 ggtgcactac acagcgcagc cgctgttcct gctggacccc ggctccgtgg acaccgggag 8640 caacgacctg ccggtgctgt ttgagctggg agagggctcc tacttctccg aaggggacgg 8700 cttcgccgag gaccccacca tctccctgct gacaggctcg gagcctccca aagccaagga 8760 ccccactgtc tccgctagcg agggcagagg aagtctgcta acatgcgatt acaaagacga 8820 tgacgataag taaaatcaac ctctggatta caaaatttgt gaaagattga ctggtattct 8880 taactatgtt gctcctttta cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc 8940 tattgcttcc cgtatggctt tcattttctc ctccttgtat aaatcctggt tgctgtctct 9000 ttatgaggag ttgtggcccg ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga 9060 cgcaaccccc actggttggg gcattgccac cacctgtcag ctcctttccg ggactttcgc 9120 tttccccctc cctattgcca cggcggaact catcgccgcc tgccttgccc gctgctggac 9180 aggggctcgg ctgttgggca ctgacaattc cgtggtgttg tcggggaaat catcgtcctt 9240 tccttggctg ctcgcctgtg ttgccacctg gattctgcgc gggacgtcct tctgctacgt 9300 cccttcggcc ctcaatccag cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc 9360 tcttccgcgt cttcgccttc gccctcagac gagtcggatc tccctttggg ccgcctcccc 9420 gcatcgatac cgtcgatcct gtgccttcta gttgccagcc atctgttgtt tgcccctccc 9480 ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 9540 aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 9600 acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 9660 tgg 9663 <210> 147 <211> 1082 <212> DNA <213> Artificial Sequence <400> 147 gtcccctcca ccccacagtg gggcgattcg catattaagg tgacgcgtgt ggcctcgaac 60 accgagcgac cctgcagcga cccgcttaac tggaacgcgt gccaccatgg tgagcaaggg 120 cgaggaggat aacatggcca tcatcaagga gttcatgcgc ttcaaggtgc acatggaggg 180 ctccgtgaac ggccacgagt tcgagatcga gggcgagggc gagggccgcc cctacgaggg 240 cacccagacc gccaagctga aggtgaccaa gggtggcccc ctgcccttcg cctgggacat 300 cctgtcccct cagttcatgt acggctccaa ggcctacgtg aagcaccccg ccgacatccc 360 cgactacttg aagctgtcct tccccgaggg cttcaagtgg gagcgcgtga tgaacttcga 420 ggacggcggc gtggtgaccg tgacccagga ctcctccctg caggacggcg agttcatcta 480 caaggtgaag ctgcgcggca ccaacttccc ctccgacggc cccgtaatgc agaagaagac 540 catgggctgg gaggcctcct ccgagcggat gtaccccgag gacggcgccc tgaagggcga 600 gatcaagcag aggctgaagc tgaaggacgg cggccactac gacgctgagg tcaagaccac 660 ctacaaggcc aagaagcccg tgcagctgcc cggcgcctac aacgtcaaca tcaagttgga 720 catcacctcc cacaacgagg actacaccat cgtggaacag tacgaacgcg ccgagggccg 780 ccactccacc ggcggcatgg acgagctgta caagtaaacc ggttaggggc ccgtttaaac 840 ccgctgatca gcctcgactg tgccttctag ttgccagcca tctgttgttt gcccctcccc 900 cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga 960 aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg tggggcagga 1020 cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg tgggctctat 1080 gg 1082 <210> 148 <211> 1053 <212> DNA <213> Artificial Sequence <400> 148 gtcccctcca ccccacagtg gggcgataga gggtatataa tggaagctcg acttccagct 60 ctggaacgcg tgccaccatg gtgagcaagg gcgaggagga taacatggcc atcatcaagg 120 agttcatgcg cttcaaggtg cacatggagg gctccgtgaa cggccacgag ttcgagatcg 180 agggcgaggg cgagggccgc ccctacgagg gcacccagac cgccaagctg aaggtgacca 240 agggtggccc cctgcccttc gcctgggaca tcctgtcccc tcagttcatg tacggctcca 300 aggcctacgt gaagcacccc gccgacatcc ccgactactt gaagctgtcc ttccccgagg 360 gcttcaagtg ggagcgcgtg atgaacttcg aggacggcgg cgtggtgacc gtgacccagg 420 actcctccct gcaggacggc gagttcatct acaaggtgaa gctgcgcggc accaacttcc 480 cctccgacgg ccccgtaatg cagaagaaga ccatgggctg ggaggcctcc tccgagcgga 540 tgtaccccga ggacggcgcc ctgaagggcg agatcaagca gaggctgaag ctgaaggacg 600 gcggccacta cgacgctgag gtcaagacca cctacaaggc caagaagccc gtgcagctgc 660 ccggcgccta caacgtcaac atcaagttgg acatcacctc ccacaacgag gactacacca 720 tcgtggaaca gtacgaacgc gccgagggcc gccactccac cggcggcatg gacgagctgt 780 acaagtaaac cggttagggg cccgtttaaa cccgctgatc agcctcgact gtgccttcta 840 gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca 900 ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc 960 attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata 1020 gcaggcatgc tggggatgcg gtgggctcta tgg 1053 <210> 149 <211> 1409 <212> DNA <213> Artificial Sequence <400> 149 gtcccctcca ccccacagtg gggcgatctt caagaattcc tcgagtttac tccctatcag 60 tgatagagaa cgtatgaaga gtttactccc tatcagtgat agagaacgta tgcagacttt 120 actccctatc agtgatagag aacgtataag gagtttactc cctatcagtg atagagaacg 180 tatgaccagt ttactcccta tcagtgatag agaacgtatc tacagtttac tccctatcag 240 tgatagagaa cgtatatcca gtttactccc tatcagtgat agagaacgta taagctttag 300 gcgtgtacgg tgggcgccta taaaagcaga gctcgtttag tgaaccgtca gatcgcctgg 360 agcaattcca caacactttt gtcttatacc aactttccgt accacttcct accctcgtaa 420 aacgcgtgcc accatggtga gcaagggcga ggaggataac atggccatca tcaaggagtt 480 catgcgcttc aaggtgcaca tggagggctc cgtgaacggc cacgagttcg agatcgaggg 540 cgagggcgag ggccgcccct acgagggcac ccagaccgcc aagctgaagg tgaccaaggg 600 tggccccctg cccttcgcct gggacatcct gtcccctcag ttcatgtacg gctccaaggc 660 ctacgtgaag caccccgccg acatccccga ctacttgaag ctgtccttcc ccgagggctt 720 caagtgggag cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga cccaggactc 780 ctccctgcag gacggcgagt tcatctacaa ggtgaagctg cgcggcacca acttcccctc 840 cgacggcccc gtaatgcaga agaagaccat gggctgggag gcctcctccg agcggatgta 900 ccccgaggac ggcgccctga agggcgagat caagcagagg ctgaagctga aggacggcgg 960 ccactacgac gctgaggtca agaccaccta caaggccaag aagcccgtgc agctgcccgg 1020 cgcctacaac gtcaacatca agttggacat cacctcccac aacgaggact acaccatcgt 1080 ggaacagtac gaacgcgccg agggccgcca ctccaccggc ggcatggacg agctgtacaa 1140 gtaaaccggt taggggcccg tttaaacccg ctgatcagcc tcgactgtgc cttctagttg 1200 ccagccatct gttgtttgcc cctcccccgt gccttccttg accctggaag gtgccactcc 1260 cactgtcctt tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc 1320 tattctgggg ggtggggtgg ggcaggacag caagggggag gattgggaag acaatagcag 1380 gcatgctggg gatgcggtgg gctctatgg 1409 <210> 150 <211> 1081 <212> DNA <213> Artificial Sequence <400> 150 gtcccctcca ccccacagtg gggcgaggta ggcgtgtacg gtgggaggcc tatataagca 60 gagctcgttt agtgaaccgt cagatcgcct ggaacgcgtg ccaccatggt gagcaagggc 120 gaggaggata acatggccat catcaaggag ttcatgcgct tcaaggtgca catggagggc 180 tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 240 acccagaccg ccaagctgaa ggtgaccaag ggtggcccccc tgcccttgc ctgggacatc 300 ctgtcccctc agttcatgta cggctccaag gcctacgtga agcaccccgc cgacatcccc 360 gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 420 gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac 480 aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc 540 atgggctggg aggcctcctc cgagcggatg taccccgagg acggcgccct gaagggcgag 600 atcaagcaga ggctgaagct gaagcaggc ggccactacg acgctgaggt caagaccacc 660 tacaaggcca agaagcccgt gcagctgccc ggcgcctaca acgtcaacat caagttggac 720 atcacctccc acaacgagga ctacaccatc gtggaacagt acgaacgcgc cgagggccgc 780 cactccaccg gcggcatgga cgagctgtac aagtaaccg gttaggggcc cgtttaaacc 840 cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc 900 gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa 960 attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac 1020 agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt gggctctatg 1080 g 1081 <210> 151 <211> 119 <212> DNA <213> Artificial Sequence <400> 151 gtcccctcca ccccacagtg ggggtcccct ccaccccaca gtggggacgt agctagcggt 60 aggcgtgtac ggtgggaggc ctatataagc agagctcgtt tagtgaaccg tcagatcgc 119 <210> 152 <211> 124 <212> DNA <213> Artificial Sequence <400> 152 gtcccctcca ccccacagtg gggacgtagt cccctccacc ccacagtggg gacgtagcta 60 gcggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg aaccgtcaga 120 tcgc 124 <210> 153 <211> 134 <212> DNA <213> Artificial Sequence <400> 153 gtcccctcca ccccacagtg gggacgtaaa gggtttacgt cccctccacc ccacagtggg 60 gacgtagcta gcggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 120 aaccgtcaga tcgc 134 <210> 154 <211> 154 <212> DNA <213> Artificial sequence <400> 154 gtcccctcca ccccacagtg gggacgtaac aaccactacc tgagcgtgca gggtttacgt 60 cccctccacc ccacagtggg gacgtagcta gcggtaggcg tgtacggtgg gaggcctata 120 taagcagagc tcgtttagtg aaccgtcaga tcgc 154 <210> 155 <211> 169 <212> DNA <213> Artificial sequence <400> 155 gtcccctcca ccccacagtg gggacgtaac aaccactaca gaccccaacg agaactgagc 60 gtgcagggtt tacgtcccct ccaccccaca gtggggacgt agctagcggt aggcgtgtac 120 ggtgggaggc ctatataagc agagctcgtt tagtgaaccg tcagatcgc 169 <210> 156 <211> 219 <212> DNA <213> Artificial sequence <400> 156 gtcccctcca ccccacagtg gggacgtaac aaccactaca gaccctgaaa tggactatgt 60 agaagacaaa ctgtccagtg aatttgtctt caatccaacg agaactgagc gtgcagggtt 120 tacgtcccct ccaccccaca gtggggacgt agctagcggt aggcgtgtac ggtgggaggc 180 ctatataagc agagctcgtt tagtgaaccg tcagatcgc 219 <210> 157 <211> 110 <212> DNA <213> Artificial sequence <400> 157 ctgacgatac cgcgtgatgt gggtgcgaat acgcgtagtc cggctagcgg taggcgtgta 60 cggtgggagg cctatataag cagagctcgt ttagtgaacc gtcagatcgc 110 <210> 158 <211> 150 <212> DNA <213> Artificial sequence <400> 158 ctgacgatac cgcgtgatgt gggtgcgaat acgcgtagtc cgttgcgtat atacgcggtc 60 ctgacgatac cgcgtgatgt gggctagcgg taggcgtgta cggtgggagg cctatataag 120 cagagctcgt ttagtgaacc gtcagatcgc 150 <210> 159 <211> 210 <212> DNA <213> Artificial Sequence <400> 159 ctgacgatac cgcgtgatgt gggtgcgaat acgcgtagtc cgttgcgtat atacgcgatc 60 ctgacgatac cgcgtgatgt gggtgcgaat acgcgtagtc cgttgcgtat atacgcggtc 120 ctgacgatac cgcgtgatgt gggctagcgg taggcgtgta cggtgggagg cctatataag 180 cagagctcgt ttagtgaacc gtcagatcgc 210 <210> 160 <211> 270 <212> DNA <213> Artificial Sequence <400> 160 ctgacgatac cgcgtgatgt gggtgcgaat acgcgtagtc cgttgcgtat atacgcggtc 60 ctgacgatac cgcgtgatgt gggctagcgg taggcgtgta cgccgatatt aatcgggatc 120 ctgacgatac cgcgtgatgt gggtgcgaat acgcgtagtc cgttgcgtat atacgcggtc 180 ctgacgatac cgcgtgatgt gggctagcgg taggcgtgta cggtgggagg cctatataag 240 cagagctcgt ttagtgaacc gtcagatcgc 270 <210> 161 <211> 13597 <212> DNA <213> Artificial Sequence <400> 161 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 240 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360 tagtcatcgc tattaccatg gtcgaggtga gccccacgtt ctgcttcact ctccccatct 420 cccccccctc cccaccccca attttgtatt tatttatttt ttaattattt tgtgcagcga 480 tgggggcggg gggggggggg gggcgcgcgc caggcggggc ggggcggggc gaggggcggg 540 gcggggcgag gcggagaggt gcggcggcag ccaatcagag cggcgcgctc cgaaagtttc 600 cttttatggc gaggcggcgg cggcggcggc cctataaaaa gcgaagcgcg cggcgggcgg 660 gagtcgctgc gttgccttcg ccccgtgccc cgctccgcgc cgcctcgcgc cgcccgcccc 720 ggctctgact gaccgcgtta ctcccacagg tgagcgggcg ggacggccct tctcctccgg 780 gctgtaatta gcgcttggtt taatgacggc tcgtttcttt tctgtggctg cgtgaaagcc 840 ttaaagggct ccgggagggc cctttgtgcg ggggggagcg gctcgggggg tgcgtgcgtg 900 tgtgtgtgcg tggggagcgc cgcgtgcggc ccgcgctgcc cggcggctgt gagcgctgcg 960 ggcgcggcgc ggggctttgt gcgctccgcg tgtgcgcgag gggagcgcgg ccgggggcgg 1020 tgccccgcgg tgcggggggg ctgcgagggg aacaaaggct gcgtgcgggg tgtgtgcgtg 1080 ggggggtgag cagggggtgt gggcgcggcg gtcgggctgt aacccccccc tgcacccccc 1140 tccccgagtt gctgagcacg gcccggcttc gggtgcgggg ctccgtgcgg ggcgtggcgc 1200 ggggctcgcc gtgccgggcg gggggtggcg gcaggtgggg gtgccgggcg gggcggggcc 1260 gcctcgggcc ggggagggct cgggggaggg gcgcggcggc cccggagcgc cggcggctgt 1320 cgaggcgcgg cgagccgcag ccattgcctt ttatggtaat cgtgcgagag ggcgcaggga 1380 cttcctttgt cccaaatctg gcggagccga aatctgggag gcgccgccgc accccctcta 1440 gcgggcgcgg gcgaagcggt gcggcgccgg caggaaggaa atgggcgggg agggccttcg 1500 tgcgtcgccg cgccgccgtc cccttctcca tctccagcct cggggctgcc gcagggggac 1560 ggctgccttc gggggggacg gggcagggcg gggttcggct tctggcgtgt gaccggcggc 1620 tctagagcct ctgctaacca tgttcatgcc ttcttctttt tcctacagat ccttaatatg 1680 ggccccgaca tcgtgatgac ccagagcccc agcagcctga gcgccagcgt gggcgaccgc 1740 gtgaccatca cctgccgcag cagcaccggc gccgtgacca ccagcaacta cgccagctgg 1800 gtgcaggaga agcccggcaa gctgttcaag ggcctgatcg gcggcaccaa caaccgcgcc 1860 cccggcgtgc ccagccgctt cagcggcagc ctgatcggcg acaaggccac cctgaccatc 1920 agcagcctgc agcccgagga cttcgccacc tacttctgcg ccctgtggta cagcaaccac 1980 tgggtgttcg gccagggcac caaggtggag ctgaagcgcg gcggcggcgg cagcggcggc 2040 ggcggcagcg gcggcggcgg cagcagcggc ggcggcagcg aggtgaagct gctggagagc 2100 ggcggcggcc tggtgcagcc cggcggcagc ctgaagctga gctgcgccgt gagcggcttc 2160 agcctgaccg actacggcgt gaactgggtg cgccaggccc ccggccgcgg cctggagtgg 2220 atcggcgtga tctggggcga cggcatcacc gactacaaca gcgccctgaa ggaccgcttc 2280 atcatcagca aggacaacgg caagaacacc gtgtacctgc agatgagcaa ggtgcgcagc 2340 gacgacaccg ccctgtacta ctgcgtgacc ggcctgttcg actactgggg ccagggcacc 2400 ctggtgaccg tgagcagcta cccatacgat gttccagatt acgctggtgg aggcggaggt 2460 tctgggggag gaggtagtgg cggtggtggt tcaggaggcg gcggaagccc taagaaaaag 2520 aggaaggtgg cggccgctgg atccccttca gggcagatca gcaaccaggc cctggctctg 2580 gcccctagct ccgctccagt gctggcccag actatggtgc cctctagtgc tatggtgcct 2640 ctggcccagc cacctgctcc agcccctgtg ctgaccccag gaccacccca gtcactgagc 2700 gctccagtgc ccaagtctac acaggccggc gaggggactc tgagtgaagc tctgctgcac 2760 ctgcagttcg acgctgatga ggacctggga gctctgctgg ggaaccac cgatcccgga 2820 gtgttcacag atctggcctc cgtggacaac tctgagtttc agcagctgct gaatcagggc 2880 gtgtccatgt ctcatagtac agccgaacca atgctgatgg agtaccccga agccattacc 2940 cggctggtga ccggcagcca gcggcccccc gaccccgctc caactcccct gggaaccagc 3000 ggcctgccta atgggctgtc cggagatgaa gacttctcaa gcatcgctga tatggacttt 3060 agtgccctgc tgtcacagat ttcctctagt gggcagggag gaggtggaag cggcttcagc 3120 gtggacacca gtgccctgct ggacctgttc agcccctcgg tgaccgtgcc cgacatgagc 3180 ctgcctgacc ttgacagcag cctggccagt atccaagagc tcctgtctcc ccaggagccc 3240 cccaggcctc ccgaggcaga gaacagcagc ccggattcag ggaagcagct ggtgcactac 3300 acagcgcagc cgctgttcct gctggacccc ggctccgtgg acaccgggag caacgacctg 3360 ccggtgctgt ttgagctggg agagggctcc tacttctccg aaggggacgg cttcgccgag 3420 gaccccacca tctccctgct gacaggctcg gagcctccca aagccaagga ccccactgtc 3480 tccgctagcg agggcagagg aagtctgcta acatgcgatt acaaagacga tgacgataag 3540 taaaatcaac ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt 3600 gctcctttta cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc 3660 cgtatggctt tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag 3720 ttgtggcccg ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc 3780 actggttggg gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc 3840 cctattgcca cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg 3900 ctgttgggca ctgacaattc cgtggtgttg tcggggaaat catcgtcctt tccttggctg 3960 ctcgcctgtg ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc 4020 ctcaatccag cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt 4080 cttcgccttc gccctcagac gagtcggatc tccctttggg ccgcctcccc gcatcgatac 4140 cgtcgatcct gtgccttcta gttgccagcc atctgttgtt tgcccctccc ccgtgccttc 4200 cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg aaattgcatc 4260 gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg acagcaaggg 4320 ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta tgggaattcc 4380 gaagttttaa ttaacgatcc tagttattaa tagtaatcaa ttacggggtc attagttcat 4440 agcccatata tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg 4500 cccaacgacc cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata 4560 gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta 4620 catcaagtgt atcatatgcc aagtacgcccc cctattgacg tcaatgacgg taaatggccc 4680 gcctggcatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac 4740 gtattagtca tcgctattac catggtcgag gtgagcccca cgttctgctt cactctcccc 4800 atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 4860 gcgatgggg cgggggggggg ggggggggcg gcgccaggcg gggcggggcg gggcgagggg 4920 cggggcgggg cgaggcggag aggtgcggcg gcagccaatc agagcggcgc gctccgaaag 4980 tttcctttta tggcgaggcg gcggcggcgg cggccctata aaaagcgaag cgcgcggcgg 5040 gcgggagtcg ctgcgttgcc ttcgccccgt gccccgctcc gcgccgcctc gcgccgcccg 5100 ccccggctct gactgaccgc gttactccca caggtgagcg ggcgggacgg cccttctcct 5160 ccgggctgta attagcgctt ggtttaatga cggctcgttt cttttctgtg gctgcgtgaa 5220 agccttaaag ggctccggga gggccctttg tgcggggggg agcggctcgg ggggtgcgtg 5280 cgtgtgtgtg tgcgtgggga gcgccgcgtg cggcccgcgc tgcccggcgg ctgtgagcgc 5340 tgcgggcgcg gcgcggggct ttgtgcgctc cgcgtgtgcg cgaggggagc gcggccgggg 5400 gcggtgcccc gcggtgcggg ggggctgcga ggggaacaaa ggctgcgtgc ggggtgtgtg 5460 cgtggggggg tgagcagggg gtgtgggcgc ggcggtcggg ctgtaacccc cccctgcacc 5520 cccctccccg agttgctgag cacggcccgg cttcgggtgc ggggctccgt gcggggcgtg 5580 gcgcggggct cgccgtgccg ggcggggggt ggcggcaggt gggggtgccg ggcggggcgg 5640 ggccgcctcg ggccggggag ggctcggggg aggggcgcgg cggccccgga gcgccggcgg 5700 ctgtcgaggc gcggcgagcc gcagccattg ccttttatgg taatcgtgcg agagggcgca 5760 gggacttcct ttgtcccaaa tctggcggag ccgaaatctg ggaggcgccg ccgcaccccc 5820 tctagcgggc gcgggcgaag cggtgcggcg ccggcaggaa ggaaatgggc ggggagggcc 5880 ttcgtgcgtc gccgcgcgc cgtccccttc tccatctcca gcctcggggc tgccgcaggg 5940 ggacggctgc cttcgggggg gacggggcag ggcggggttc ggcttctggc gtgtgaccgg 6000 cggctctaga gcctctgcta accatgttca tgccttcttc ttttcctac agatccttaa 6060 ttaactaggc tacgcgcgcc accatgccca agaagaagcg caaggtggga cgcgtctgca 6120 ggatatcaag cttgcggtac cgcgggccg ggatcgccac catggacaag aagtacagca 6180 tcggcctggc catcggcacc aactctgtgg gctgggccgt gatcaccgac gagtacaagg 6240 tgcccagcaa gaaattcaag gtgctgggca acaccgaccg gcacagcatc aagaagaacc 6300 tgatcggcgc cctgctgttc gacagcggag aaacagccga ggccacccgg ctgaagagaa 6360 ccgccagaag aagatacacc agacggaaga accggatctg ctatctgcaa gagatcttca 6420 gcaacgagat ggccaaggtg gacgacagct tcttccacag actggaagag tccttcctgg 6480 tggaagagga taagaagcac gagcggcacc ccatcttcgg caacatcgtg gacgaggtgg 6540 cctaccacga gaagtacccc accatctacc acctgagaaa gaaactggtg gacagcaccg 6600 acaaggccga cctgcggctg atctatctgg ccctggccca catgatcaag ttccggggcc 6660 acttcctgat cgagggcgac ctgaaccccg acaacagcga cgtggacaag ctgttcatcc 6720 agctggtgca gacctacaac cagctgttcg aggaaaaccc catcaacgcc agcggcgtgg 6780 acgccaaggc catcctgtct gccagactga gcaagagcag acggctggaa aatctgatcg 6840 cccagctgcc cggcgagaag aagaatggcc tgttcggcaa cctgattgcc ctgagcctgg 6900 gcctgacccc caacttcaag agcaacttcg acctggccga ggatgccaaa ctgcagctga 6960 gcaaggacac ctacgacgac gacctggaca acctgctggc ccagatcggc gaccagtacg 7020 ccgacctgtt tctggccgcc aagaacctgt ccgacgccat cctgctgagc gacatcctga 7080 gagtgaacac cgagatcacc aaggcccccc tgagcgcctc tatgatcaag agatacgacg 7140 agcaccacca ggacctgacc ctgctgaaag ctctcgtgcg gcagcagctg cctgagaagt 7200 acaaagagat tttcttcgac cagagcaaga acggctacgc cggctacatc gatggcggag 7260 ccagccagga agagttctac aagttcatca agcccatcct ggaaaagatg gacggcaccg 7320 aggaactgct cgtgaagctg aacagagagg acctgctgcg gaagcagcgg accttcgaca 7380 acggcagcat cccccaccag atccacctgg gagagctgca cgccattctg cggcggcagg 7440 aagattttta cccattcctg aaggacaacc gggaaaagat cgagaagatc ctgaccttcc 7500 gcatccccta ctacgtgggc cctctggcca ggggaaacag cagattcgcc tggatgacca 7560 gaaagagcga ggaaaccatc accccctgga acttcgagga agtggtggac aagggcgcca 7620 gcgcccagag cttcatcgag cggatgacca acttcgataa gaacctgccc aacgagaagg 7680 tgctgcccaa gcacagcctg ctgtacgagt acttcaccgt gtacaacgag ctgaccaaag 7740 tgaaatacgt gaccgaggga atgagaaagc ccgccttcct gagcggcgag cagaaaaaag 7800 ccatcgtgga cctgctgttc aagaccaacc ggaaagtgac cgtgaagcag ctgaaagagg 7860 actacttcaa gaaaatcgag tgcttcgact ccgtggaaat ctccggcgtg gaagatcggt 7920 tcaacgcctc cctgggcaca taccacgatc tgctgaaat tcaacggc aaggacttcc 7980 tggacaatga ggaaacgag gatactctg agatatcgt gctgaccctg acacgtttg 8040 aggacagaga gatgatcgag gaacggctga aaacctatgc ccacctgttc gacgacaag 8100 tgatgaagca gctgaagcgg cggataca ccggctgggg caggctgagc cggaagctga 8160 tcaacggcat ccgggacaag cagtccggca agacaatcct ggatttcctg aagtccgacg 8220 gcttcgccaa cagaaacttc atgcagctga tccacgacga cagcctgacc tttaaagagg 8280 acatccagaa agcccaggtg tccggccagg gcgatagcct gcacgagcac attgccaatc 8340 tggccggcag ccccgccatt agaagggca tcctgcagac agtgaggtg gtggacgagc 8400 tcgtgaaagt gatggggccgg cacaagccccg agaacatcgt gatcgaatg gccagagaga 8460 accagaccac ccagaaggga caggagaca gccgcgagag atgaagcgg atcgaagagg 8520 gcatcaaga gctgggcagc cagatcctga aagacaccc cgtggaaaac acccacctgc 8580 agaacgagaa gctgtacctg tactacctgc agaatggggcg ggatatgtac gtggaccagg 8640 aactggacat caaccggctg tccgactacg atgtggacgc tatcgtgcct cagagctttc tgaaggacga ctccatcgat aacaaagtgc tgactcggag cgacaagaac cggggcaaga gcgacaacgt gccctccga gaggtcgtga agagatga gaactctgg cgccagctgc tgaatgccaa gctgattacc cagaggaagt tcgacaatct gaccaaggcc gagagaggcg gcctgagcga actggataag gccggcttca tcaagagaca gctggtgga acccggcaga tcacaaagca cgtggcacag atcctggact cccggatgaa cactaagtac gacgagaacg acaaactgat ccggggaagtg aaagtgatca ccctgaagtc caagctggtg tccgatttcc 9120. ggaggattt ccagttttac aaagtgcgcg agatcaacaa ctaccaccac gcccacgacg cctacctgaa cgccgtcgtg ggaaccgccc tgatcaaaaa gtaccctaag ctggaaagcg agttcgtgta cggcgactac aaggtgtacg acgtgcgga gatgatcgcc aagagcgagc 9240 aggaatcgg caaggctacc gccaagtact tcttctacag caacatcatg aactttttca agaccgagat taccctggcc aacggcgaga tccggaagcg gcctctgatc gagacaaacg gcgaaacagg cgagatcgtg tgggataagg gccgggactt tgccaccgtg cggaaagtgc 9420 tgtctatgcc ccaagtgaat atcgtgaaaa agaccgaggt gcagacaggc ggcttcagca 9480 aagagtctat cctgcccaag aggaacagcg acaagctgat cgccagaaag aaggactggg 9540 accctaagaa gtacggcggc ttcgacagcc ccaccgtggc ctattctgtg ctggtggtgg 9600 ccaaagtgga aaagggcaag tccaagaaac tgaagagtgt gaaagagctg ctggggatca 9660 ccatcatgga aagaagcagc ttcgagaaga atcccatcga cttctggaa gccaagggct 9720 acaaagaagt gaaaaaggac ctgatcatca agctgcctaa gtactccctg ttcgagctgg 9780 aaaacggccg gaagagaatg ctggcctctg ccggcgaact gcagaaggga aacgaactgg 9840 ccctgccctc caaatatgtg aacttcctgt acctggccag cactatgag aagctgaagg 9900 gctcccccga ggataatgag cagaaacagc tgtttgtgga acagcacaaa cactacctgg 9960 acgagatcat cgagcagatc agcgagttct ccaagagagt gatcctggcc gacgctaatc 10020 tggacaaggt gctgagcgcc tacaacaagc acagagacaa gcctatcaga gagcaggccg 10080 agaatatcat ccacctgttt accctgacca atctgggagc ccctgccgcc ttcaagtact 10140 ttgacaccac catcgaccgg aagaggtaca ccagcaccaa agaggtgctg gacgccaccc 10200 tgatccacca gagcatcacc ggcctgtacg agacacggat cgacctgtct cagctgggag 10260 gccacgccta tccctatgac gtgcccgatt atgccagcct gggcagcggc tcccccaaga 10320 aaaaacgcaa ggtggagaat cctaagaaaa agcggaaagt ggacggcatt ggtagtggga 10380 10440 agaattatca tcttgagaac gaagtggctc gtcttaagaa aggttctggc agtggagaag 10500 aactgctttc aaagaattac cacctggaaa atgaggtagc tagactgaaa aaggggagcg 10560 gaagtggggga ggagttgctg agcaaaaaatt atcatttgga gaacgaagta gcacgactaa 10620 agaagggtc cggatcgggt gagagttac tctcgaaaaa ttatcatctc gaaacgaag 10680 tggctcggct aaaaaagggc agtggttctg gagaagagct attatctaaa aactaccacc 10740 tcgaaaatga ggtggcacgc ttaaaaaaagg gaagtggcag tggtgaagag ctactatcca 10800 agaattatca tcttgagaac gaggtagcgc gtttgaagaa gggttccggc tcaggagagg 10860 aactgctctc gaagaactat catcttgaaa atgaggtcgc tcgattaaaa aagggatcgg 10920 10980 agaaaggtc agggtcgggt gaagaattac tgagtaaaaa ttatcatctg gaaatgagg 11040 tagcgagact aaaaaaggg agtggttctg gcgaggaatt gctatcgaaa aattatcatc 11100 ttgagaacga agttgctagg ctcaaaaagg gctcaggctc aggcaccgcg gtaaacatag 11160 gtggtggaac cggtccgatg gatctacagc ggccgcaagg tggaggtgga cccaagaaga 11220 agcgcaaggt gggaagcgga gtaagattac aaagacgatg acgataagta aaatcaacct 11280 ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc tccttttacg 11340 ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg tatggctttc 11400 attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt gtggcccgtt 11460 gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac tggttggggc 11520 attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc tattgccacg 11580 gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct gttgggcact 11640 gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct cgcctgtgtt 11700 gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct caatccagcg 11760 gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct tcgccttcgc 11820 cctcagacga gtcggatctc cctttgggcc gcctccccgc atcgataccg tcgatcctgt 11880 gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga 11940 aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag 12000 taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga 12060 agacaatagc aggcatgctg gggatgcggt gggctctatg ggaattccga agttcctatt 12120 ctctagaaag tataggaact tcaggtctga agaggagttt acgtccagcg cgatgggtag 12180 gggaggcgct tttcccaagg cagtctggag catgcgcttt agcagccccg ctgggcactt 12240 ggcgctacac aagtggcctc tggcctcgca cacattccac atccaccggt aggcgccac cggctccgtt ctttggtggc cccttcgcgc caccttctac tcctccccta gtcaggaagt 12360 tcccccccgc cccgcagctc gcgtcgtgca ggacgtgaca aatggaagta gcacgtctca ctagtctcgt gcagatggac agcaccgctg agcatgga gcgggtaggc ctttggggca 12480. gcggccaata gcagctttgc tccttcgctt tctgggctca gaggctggga aggggtgggt ccggggggcgg gctcaggggc gggctcaggg gcggggcggg cgcccgaagg tcctccggag 12600. gcccggcatt ctgcacgctt caaaagcgca cgtctgccgc gctgttctcc tcttcctcat 12660 ctccggggcct ttcgacctgc agcctgttga caattaatca tcggcatagt atatcggcat father of the father of the father of the father of the father of the father of the father of the father of the father of the father of the father of the father cgccacccgc gacgacgtcc cgggccgt acgcaccctc gccgccgcgt tcgccgacta 12840 ccccgccacg cgccacaccg tcgatccgga ccgccacatc gagcgggtca ccgagctgca 12900 agaactcttc ctcacgcgcg tcgggctcga catcggcaag gtgtgggtcg cggacgacgg 12960 cgccgcggtg gcggtctgga ccacgccgga gagcgtcgaa gcgggggcgg tgttcgccga 13020 gatcggcccg cgcatggccg agttgagcgg ttcccggctg gccgcgcagc aacagatgga 13080 aggcctcctg gcgccgcacc ggcccaagga gcccgcgtgg ttcctggcca ccgtcggcgt 13140 ctcgcccgac caccagggca agggtctggg cagcgccgtc gtgctccccg gagtggaggc 13200 ggccgagcgc gccggggtgc ccgccttcct ggaaacctcc gcgccccgca acctcccctt 13260 ctacgagcgg ctcggcttca ccgtcaccgc cgacgtcgag gtgcccgaag gaccgcgcac 13320 ctggtgcatg acccgcaagc ccggtgcctg aaaacccgct gatcagcctc gactgtgcct 13380 tctagttgcc agccatctgt tgtttgcccc tcccccgtgc cttccttgac cctggaaggt 13440 gccactccca ctgtcctttc ctaataaaat gaggaaattg catcgcattg tctgagtagg 13500 tgtcattcta ttctgggggg tggggtgggg caggacagca agggggagga ttgggaagac 13560 aatagcaggc atgctgggga tgcggtgggc tctatgg 13597 <210> 162 <211> 2232 <212> DNA <213> Artificial Sequence <400> 162 aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60 aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120 tatcatgtct ggaaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat 180 cacaaatttc acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact 240 catcaatgta tcttatcatg tcctgaaact tgtttattgc agcttataat ggttacaaat 300 aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg 360 gtttgtccaa actcatcaat gtatcttatc atgtctggat cggaggacga ctattaatcg 420 ggatccgttt acgtcccctc caccccacag tggggacgta acaaatggac tatatcgtag 480 aagagtttac gtcccctcca ccccacagtg gggacgtatc caacgagaac tgagcgtgca 540 gggtttacgt cccctccacc ccacagtggg gacgtagcta gcggtaggcg tgtacggtgg 600 gaggcctata taagcagagc tcgtttagtg aaccgtcaga tcgcctggaa cgcgtgccac 660 catggtgagc aagggcgagg aggataacat ggccatcatc aaggagttca tgcgcttcaa 720 ggtgcacatg gagggctccg tgaacggcca cgagttcgag atcgagggcg agggcgaggg 780 ccgcccctac gagggcaccc agaccgccaa gctgaaggtg accaagggtg gccccctgcc 840 cttcgcctgg gacatcctgt cccctcagtt catgtacggc tccaaggcct acgtgaagca 900 ccccgccgac atccccgact acttgaagct gtccttcccc gagggcttca agtgggagcg 960 cgtgatgaac ttcgaggacg gcggcgtggt gaccgtgacc caggactcct ccctgcagga 1020 cggcgagttc atctacaagg tgaagctgcg cggcaccaac ttcccctccg acggccccgt 1080 aatgcagaag aagaccatgg gctgggaggc ctcctccgag cggatgtacc ccgaggacgg 1140 cgccctgaag ggcgagatca agcagaggct gaagctgaag gacggcggcc actacgacgc 1200 tgaggtcaag accacctaca aggccaagaa gcccgtgcag ctgcccggcg cctacaacgt 1260 caacatcaag ttggacatca cctcccacaa cgaggactac accatcgtgg aacagtacga 1320 acgcgccgag ggccgccact ccaccggcgg catggacgag ctgtacaagt aaaccggaat 1380 caacctctgg attacaaaat ttgtgaaaga ttgactggta ttcttaacta tgttgctcct 1440 tttacgctat gtggatacgc tgctttaatg cctttgtatc atgctattgc ttcccgtatg 1500 gctttcattt tctcctcctt gtataaatcc tggttgctgt ctctttatga ggagttgtgg 1560 cccgttgtca ggcaacgtgg cgtggtgtgc actgtgtttg ctgacgcaac ccccactggt 1620 tggggcattg ccaccacctg tcagctcctt tccgggactt tcgctttccc cctccctatt 1680 gccacggcgg aactcatcgc cgcctgcctt gcccgctgct ggacaggggc tcggctgttg 1740 ggcactgaca attccgtggt gttgtcgggg aagctgacgt cctttccatg gctgctcgcc 1800 tgtgttgcca cctggattct gcgcgggacg tccttctgct acgtcccttc ggccctcaat 1860 ccagcggacc ttccttcccg cggcctgctg ccggctctgc ggcctcttcc gcgtctccgc 1920 cttcgccctc agacgagtcg gatctccctt tggccgcctc cccgccaccg gttaggggcc 1980 cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 2040 cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 2100 aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 2160 ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 2220 gggctctatg gc 2232 <210> 163 <211> 2154 <212> DNA <213> Artificial sequence <400> 163 tcaaaaggag gggagagggg gtaaaaaaat gctgcactgt gcggcgaggc cggtgagtga 60 gcgacgcgga gccaatcagc gcccgccgtt ccgaaagttg ccttttatgg ctcgagtggc 120 cgctgtggcg tcctataaaa cccggcggcg caacgcgcag ccactgtcga gtcgcgtcca 180 cccgcgagca cagcttcttt gcagctcctt cgttgccggt ccacacccgc caccaggtaa 240 gcagggacgc cgggcccagc gggccttcgc tctctcgtgg ctagtacctc actgcagggt 300 cctgaggatc actcagaacg gacaccatgg gcgggtggag ggtggtgccg ggccgcggag 360 cggacactgg cacagccaac tttacgccta gcgtgtagac tctttgcagc cacattcccg 420 cggtgtagac actcgtgggc ccgctcccgc tcggtgcgtg gggcttgggg acacactagg 480 gtcgcggtgt gggcatttga tgagccggtg cggcttgcgg gtgttaaaag ccgtattagg 540 tccatcttga gatcacag tattgggaac cagacgctac gatcacgcct caatggcctc 600 tgggtctttg tccaaaccgg tttgcctatt cggcttgccg ggcgggcggg cgggcgggcg 660 ggcgcggcag ggccggctcg gccgggtggg ggctgggatg ccactgcgcg tgcgctctct 720 atcactgggc atcgaggcgc gtgtgcgcta gggagggagc tcttcctctc cccctcttcc 780 840 attgtttgaa tgaggcttca gtactttaca gaatcgttgc ctgcacatct tggaaacact 900 tgctgggatt acttcttcag gttaacccaa cagaaggctc gaagaggta tattgctgtt 960 gacagtgagc gcgacaagct ggagtacaac tacaatagtg aagccacaga tgtattgtag 1020 ttgtactcca gcttgtcatg cctactgcct cggacttcaa gggctacgat gtcccctcca 1080 ccccacagtg gtttaagagc tatgctggaa acagcatagc aagtttaaat aaggctagtc 1140 cgttatcaac ttgaaaaagt ggcaccgagt cggtgcgatc caagaaggta tattgctgtt 1200 gacagtgagc gcgaagatcc gccacaacat cgagatagtg aagccacaga tgtatctcga 1260 tgttgtggcg gatcttcatg cctactgcct cggacttcaa ggggctactt taggagcaat 1320 tatcttgttt actaaaactg aataccttgc tatctctttg atacattttt acaaagctga 1380 attaaaatgg tataaattaa atcactttgg cgcgccttga ggctgggagc gcggctgccc 1440 ggggttgggc gagggcgggg ccgttgtccg gaaggggcgg ggtcacagtg gcacgggcgc 1500 cttgtttgcg cttcctgctg ggtgtggtcg cctcccgcgc gcgcacaagc cgcccgtcgg 1560 cgcagtgtag gcggagcttg cgcccgtttg gggagggggc ggaggtctgg cttcctgccc 1620 taggtccgcc tccgggccag cgtttgcctt ttatggtaat aatgcggccg gtctgcgctt 1680 cctttgtccc ctgagcttgg gcgcgcgccc cctggcggct cgagcccgcg gcttgccgga 1740 agtgggcagg gcggcagcgg ctgctcttgg cggccccgag gtgactatag ccttcttttg 1800 tgtcttgata gttcgccatg gatgacgata tcgctgcgct ggtcgtcgac aacggctccg 1860 gcatgtgcaa agccggcttc gcgggcgacg atgctccccg ggctgtattc ccctccatcg 1920 tgggccgccc taggcaccag gtaagtgacc tgttactttg ggagtggcaa gcctggggtt 1980 ttcttgggga tcgatgccgg tgctaagaag gctgttccct tccacagggt gtgatggtgg 2040 gaatgggtca gaaggactcc tatgtgggtg acgaggccca gagcaagaga ggtatcctga 2100 ccctgaagta ccccattgaa catggcattg ttaccaactg ggacgacatg gaga 2154 <210> 164 <211> 1688 <212> DNA <213> Artificial Sequence <400> 164 tcaaaaggag gggagagggg gtaaaaaaat gctgcactgt gcggcgaggc cggtgagtga 60 gcgacgcgga gccaatcagc gcccgccgtt ccgaaagttg ccttttatgg ctcgagtggc 120 cgctgtggcg tcctataaaa cccggcggcg caacgcgcag ccactgtcga gtcgcgtcca 180 cccgcgagca cagcttcttt gcagctcctt cgttgccggt ccacacccgc caccaggtaa 240 gcagggacgc cgggcccagc gggccttcgc tctctcgtgg ctagtacctc actgcagggt 300 cctgaggatc actcagaacg gacaccatgg gcgggtggag ggtggtgccg ggccgcggag 360 cggacactgg cacagccaac tttacgccta gcgtgtagac tctttgcagc cacattcccg 420 cggtgtagac actcgtgggc ccgctcccgc tcggtgcgtg gggcttgggg acacactagg 480 gtcgcggtgt gggcatttga tgagccggtg cggcttgcgg gtgttaaaag ccgtattagg 540 tccatcttga gagtacacag tattgggaac cagacgctac gatcacgcct caatggcctc 600 tgggtctttg tccaaaccgg tttgcctatt cggcttgccg ggcgggcggg cgggcgggcg 660 ggcgcggcag ggccggctcg gccgggtggg ggctgggatg ccactgcgcg tgcgctctct 720 atcactgggc atcgaggcgc gtgtgcgcta gggagggagc tcttcctctc cccctcttcc 780 tagttagctg cgcgtgcgta aggtgaaata ttaattaagt gtcccctcca ccccacagtg 840 gtttaagagc tatgctggaa acagcatagc aagtttaaat aaggctagtc cgttatcaac 900 ttgaaaaagt ggcaccgagt cggtgctgat tatttcttgc agggcgcgcc ttgaggctgg 960 gagcgcggct gcccggggtt gggcgagggc ggggccgttg tccggaaggg gcggggtcac 1020 agtggcacgg gcgccttgtt tgcgcttcct gctgggtgtg gtcgcctccc gcgcgcgcac 1080 aagccgcccg tcggcgcagt gtaggcggag cttgcgcccg tttggggagg gggcggaggt 1140 ctggcttcct gccctaggtc cgcctccggg ccagcgtttg ccttttatgg taataatgcg 1200 gccggtctgc gcttcctttg tcccctgagc ttgggcgcgc gccccctggc ggctcgagcc 1260 cgcggcttgc cggaagtggg cagggcggca gcggctgctc ttggcggccc cgaggtgact 1320 atagccttct tttgtgtctt gatagttcgc catggatgac gatatcgctg cgctggtcgt 1380 cgacaacggc tccggcatgt gcaaagccgg cttcgcgggc gacgatgctc cccgggctgt 1440 attcccctcc atcgtgggcc gccctaggca ccaggtaagt gacctgttac tttgggagtg 1500 gcaagcctgg ggttttcttg gggatcgatg ccggtgctaa gaaggctgtt cccttccaca 1560 gggtgtgatg gtgggaatgg gtcagaagga ctcctatgtg ggtgacgagg cccagagcaa 1620 gagaggtatc ctgaccctga agtaccccat tgaacatggc attgttacca actgggacga 1680 catggaga 1688 <210> 165 <211> 1824 <212> DNA <213> Artificial Sequence <400> 165 tcaaaaggag gggagagggg gtaaaaaaat gctgcactgt gcggcgaggc cggtgagtga 60 gcgacgcgga gccaatcagc gcccgccgtt ccgaaagttg ccttttatgg ctcgagtggc 120 cgctgtggcg tcctataaaa cccggcggcg caacgcgcag ccactgtcga gtcgcgtcca 180 cccgcgagca cagcttcttt gcagctcctt cgttgccggt ccacacccgc caccaggtaa 240 gcagggacgc cgggcccagc gggccttcgc tctctcgtgg ctagtacctc actgcagggt 300 cctgaggatc actcagaacg gacaccatgg gcgggtggag ggtggtgccg ggccgcggag 360 cggacactgg cacagccaac tttacgccta gcgtgtagac tctttgcagc cacattcccg 420 cggtgtagac actcgtgggc ccgctcccgc tcggtgcgtg gggcttgggg acacactagg 480 gtcgcggtgt gggcatttga tgagccggtg cggcttgcgg gtgttaaaag ccgtattagg 540 tccatcttga gagtacacag tattgggaac cagacgctac gatcacgcct caatggcctc 600 tgggtctttg tccaaaccgg tttgcctatt cggcttgccg ggcgggcggg cgggcgggcg 660 ggcgcggcag ggccggctcg gccgggtggg ggctgggatg ccactgcgcg tgcgctctct 720 atcactgggc atcgaggcgc gtgtgcgcta gggagggagc tcttcctctc cccctcttcc 780 tagttagctg cgcgtgcgta aggtgaaata ttaattaaaa caaagcacca gtggtctagt 840 ggtagaatag taccctgcca cggtacagac ccgggttcga ttcccggctg gtgcagtccc 900 ctccacccca cagtggttta agagctatgc tggaaacagc atagcaagtt taaataaggc 960 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg caacaaagca ccagtggtct 1020 agtggtagaa tagtaccctg ccacggtaca gacccgggtt cgattcccgg ctggtgcagg 1080 cgcgccttga ggctgggagc gcggctgccc ggggttgggc gagggcgggg ccgttgtccg 1140 gaaggggcgg ggtcacagtg gcacgggcgc cttgtttgcg cttcctgctg ggtgtggtcg 1200 cctcccgcgc gcgcacaagc cgcccgtcgg cgcagtgtag gcggagcttg cgcccgtttg 1260 gggagggggc ggaggtctgg cttcctgccc taggtccgcc tccgggccag cgtttgcctt 1320 ttatggtaat aatgcggccg gtctgcgctt cctttgtccc ctgagcttgg gcgcgcgccc 1380 cctggcggct cgagcccgcg gcttgccgga agtgggcagg gcggcagcgg ctgctcttgg 1440 cggccccgag gtgactatag ccttcttttg tgtcttgata gttcgccatg gatgacgata 1500 tcgctgcgct ggtcgtcgac aacggctccg gcatgtgcaa agccggcttc gcgggcgacg 1560 atgctccccg ggctgtattc ccctccatcg tgggccgccc taggcaccag gtaagtgacc 1620 tgttactttg ggagtggcaa gcctggggtt ttcttgggga tcgatgccgg tgctaagaag 1680 gctgttccct tccacagggt gtgatggtgg gaatgggtca gaaggactcc tatgtgggtg 1740 acgaggccca gagcaagaga ggtatcctga ccctgaagta ccccattgaa catggcattg 1800 ttaccaactg ggacgacatg gaga 1824 <210> 166 <211> 4513 <212> DNA <213> Artificial Sequence <400> 166 cctgtcagtt aacggcagcc ggagtgcgca gccgccggca gcctcgctct gcccactggg 60 tggggcggga ggtaggtggg gtgaggcgag ctggacgtgc gggcgcggtc ggcctctggc 120 ggggcggggg aggggaggga gggtcagcga aagtagctcg cgcgcgagcg gccgcccacc 180 ctccccttcc tctgggggag tcgttttacc cgccgccggc cgggcctcgt cgtctgattg 240 gctctcgggg cccagaaaac tggcccttgc cattggctcg tgttcgtgca agttgagtcc 300 atccgccggc cagcgggggc ggcgaggagg cgctcccagg ttccggccct cccctcggcc 360 ccgcgccgca gagtctggcc gcgcgcccct gcgcaacgtg gcaggaagcg cgcgctgggg 420 gcggggacgg gcagtagggc tgagcggctg cggggcgggt gcaagcacgt ttccgacttg 480 agttgcctca agaggggcgt gctgagccag acctccatcg cgcactccgg ggagtggagg 540 gaaggagcga gggctcagtt gggctgtttt ggaggcagga agcacttgct ctcccaaagt 600 cgctctgagt tgttatcagt aagggagctg cagtggagta ggcggggaga aggccgcacc 660 cttctccgga ggggggaggg gagtgttgca atacctttct gggagttctc tgctgcctcc 720 tggcttctga ggaccgccct gggcctggga gaatcccttc cccctcttcc ctcgtgatct 780 gcaactccag tctttctaga ggcgcgcctg agggacagcc cccccccaaa gcccccaggg 840 atgtaattac gtccctcccc cgctaggggg cagcagcgag ccgcccgggg ctccgctccg 900 gtccggcgct ccccccgcat ccccgagccg gcagcgtgcg gggacagccc gggcacgggg 960 aaggtggcac gggatcgctt tcctctgaac gcttctcgct gctctttgag cctgcagaca 1020 cctggggga tacgggggaaa aggcctccac ggccactagt ctttcgtctt caagaattcc 1080 1140 agagaacgta tgcagacttt actccctatc agtgatagag aacgtataag gagtttactc 1200 1260 tacagtttac tccctatcag tgatagagaa cgtatatcca gtttactccc tatcagtgat 1320 agagaacgta taagctttag gcgtgtacgg tgggcgccta taaagcaga gctcgtttag 1380 tgaaccgtca gatcgcctgg agcaattcca caacactttt gtcttatacc aactttccgt 1440 accacttcct accctcgtaa aggtctagag gatgccgcgc tccttcctgg tcaggaagcc 1500 1560 gagctgttca ccggggtggt gcccatcctg gtcgagctgg acggcgacgt aaacggccac 1620 aagttcagcg tgtccggcga gggcgagggc gatgccacct acggcaagct gaccctgaag 1680 ttcatctgca ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac caccctgacc 1740 tacggcgtgc agtgcttcag ccgctacccc gaccacatga agcagcacga cttcttcaag 1800 tccgccatgc ccgaaggcta cgtccaggag cgcaccatct tcttcaagga cgacggcaac 1860 tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg catcgagctg 1920 aagggcatcg acttcaagga ggacggcaac atcctggggc acaagctgga gtacaactac 1980 aacagccaca acgtctatat catggccgac aagcagaaga acggcatcaa ggtgaacttc 2040 aagatccgcc acaacatcga ggacggcagc gtgcagctcg ccgaccacta ccagcagaac 2100 acccccatcg gcgacggccc cgtgctgctg cccgacaacc actacctgag cacccagtcc 2160 gccctgagca aagaccccaa cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc 2220 gccgccggga tcactctcgg catggacgag ctgtacaagt aaaacaaagc accagtggtc 2280 tagtggtaga atagtaccct gccacggtac agacccgggt tcgattcccg gctggtgcag 2340 tcccctccac cccacagtgg tttaagagct atgctggaaa cagcatagca agtttaaata 2400 aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcaacaa agcaccagtg 2460 gtctagtggt agaatagtac cctgccacgg tacagacccg ggttcgattc ccggctggtg 2520 cactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc cttccttgac 2580 cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg catcgcattg 2640 tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca agggggagga 2700 ttgggaagac aatagcaggc atgctgggga tgcggtgggc tctatggcat cgatatcatc 2760 tgcgatcgct ccggtgcccg tcagtgggca gagcgcacat cgcccacagt ccccgagaag 2820 ttggggggag gggtcggcaa ttgaacgggt gcctagagaa ggtggcgcgg ggtaaactgg 2880 gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata 2940 agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacagctg 3000 aagcttcgag gggctcgcat ctctccttca cgcgcccgcc gccctacctg aggccgccat 3060 ccacgccggt tgagtcgcgt tctgccgcct cccgcctgtg gtgcctcctg aactgcgtcc 3120 gccgtctagg taagtttaaa gctcaggtcg agaccgggcc tttgtccggc gctcccttgg 3180 agcctaccta gactcagccg gctctccacg ctttgcctga ccctgcttgc tcaactctac 3240 gtctttgttt cgttttctgt tctgcgccgt tacagatcca agctgtgacc ggcgcctact 3300 ctagagccgc catgtctaga ctggacaaga gcaaagtcat aaactctgct ctggaattac 3360 tcaatggagt cggtatcgaa ggcctgacga caaggaaact cgctcaaaag ctgggagttg 3420 agcagcctac cctgtactgg cacgtaga acaagcgggc cctgctcgat gccctgccaa 3480 tcgagatgct ggacaggcat catacccact cctgccccct ggaaggcgag tcatggcaag 3540 actttctgcg gaacaacgcc aagtcatacc gctgtgctct cctctcacat cgcgacgggg 3600 ctaaagtgca tctcggcacc cgcccaacag agaacagta cgaaaccctg gaaaatcagc 3660 tcgcgttcct gtgtcagcaa ggcttctccc tggagaacgc actgtacgct ctgtccgccg 3720 tgggccactt tacactgggc tgcgtattgg aggaacagga gcatcaagta gcaaaagagg 3780 aaagagagac acctaccacc gattctatgc ccccacttct gaaacaagca attgagctgt 3840 tcgaccggca gggagccgaa cctgccttcc ttttcggcct ggaactaatc atatgtggcc 3900 tggagaaaca gctaaagtgc gaaagcggcg ggccgaccga cgcccttgac gattttgact 3960 tagacatgct cccagccgat gcccttgacg actttgacct tgatatgctg cctgctgacg 4020 ctcttgacga ttttgacctt gacatgctcc ccgggacaca cgggtagggc gcgccagatg 4080 ggcgggagtc ttctgggcag gcttaaaggc taacctggtg tgtgggcgtt gtcctgcagg 4140 ggaattgaac aggtgtaaaa ttggagggac aagacttccc acagattttc ggttttgtcg 4200 ggaagttttt taataggggc aaataaggaa aatgggagga taggtagtca tctggggttt 4260 tatgcagcaa aactacaggt tattattgct tgtgatccgc ctcggagtat tttccatcga 4320 ggtagattaa agacatgctc acccgagttt tatactctcc tgcttgagat ccttactaca 4380 gtatgaaatt acagtgtcgc gagttagact atgtaagcag aattttaatc atttttaaag 4440 agcccagtac ttcatatcca tttctcccgc tccttctgca gccttatcaa aaggtatttt 4500 agaacactca ttt 4513

Claims

1. A detection system for endogenous nucleic acid in cells, characterized in that: include: (a) a target nucleic acid editing module, including: sgRNA and tRNA targeting the target nucleic acid of the reporter system; Wherein, the target nucleic acid editing module includes a structure as shown in Formula I, L1-(tRNA-sgRNA) n -tRNA-R1 (formula I) In the formula, L1 is the homology arm at the 5′ end; R1 is the homology arm at the 3′ end; tRNA is an endogenous mechanism that can successfully release a functional sgRNA, and the nucleotide sequence of the tRNA is shown in SEQ ID NO: 143 (AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA); sgRNA is a guide RNA; the sgRNA targets the 3' untranslated region (3' UTR) of the target nucleic acid, and the sequence of the sgRNA is shown in SEQ ID NO: 1-48; n is a positive integer ≥ 1; and (b) a target nucleic acid reporter module, comprising: a reporter nucleic acid construct, a dCas protein, and a transcription activator; Wherein, the reporter nucleic acid construct has a structure as shown in Formula II, (TS-I) m -TS-P1-Z2 (Formula II) In the formula, TS is the binding target site of the sgRNA; m is a positive integer ≥ 0; I is the spacer sequence between TS; P1 is an sgRNA-responsive promoter, which can respond to the complex formed by the upstream sgRNA, dCas9 and transcription activator whose expression is controlled by the endogenous transcript, and initiate the expression of the downstream reporter gene, and the sgRNA-responsive promoter is a miniCMV promoter; Z2 is the reporter gene sequence; The endogenous nucleic acid includes an endogenous gene or a long non-coding RNA (lncRNA); The endogenous cell gene is an endogenous low-abundance gene in the cell. The endogenous low-abundance gene in the cell refers to a gene whose expression level in the cell is <0.001 when relative quantification is performed using the Gapdh internal reference gene.

2. The detection system according to claim 1, characterized in that 6≤n≤8。 3. The detection system according to claim 1, characterized in that The endogenous cell gene can be selected from the following group: Ascl1, Neurog2, Lmx1b, Nkx2-2, Gata3, Hbb, Tubb3, Actb, Nanog, Esrrb, Sox2, Tet1, Neurog2, Lncenc1, Med7, Tert, Jag1, Slc7a11, Dancr, Firre, Pvt1, Tunar, Miat, or a combination thereof.

4. The detection system according to claim 1, characterized in that The target nucleic acid editing module includes a nucleotide sequence as shown in SEQID NO: 165 or 166.

5. The detection system according to claim 1, characterized in that 1≤m≤3。 6. The detection system according to claim 1, characterized in that m=2, that is, there are 3 TSs in Formula II.

7. A kit for detecting endogenous nucleic acid in cells, characterized in that: Comprising the detection system as claimed in claim 1.

8. A method for detecting whether a target endogenous nucleic acid exists in a cell sample, characterized in that: Includes steps: (i) introducing the detection system of claim 1 into a cell sample to be detected; and (ii) detecting the level of a reporter gene or its encoded product in a detection target nucleic acid reporter module in the detection system; The methods described are non-diagnostic and non-therapeutic.

9. The method according to claim 8, characterized in that The method includes dynamically detecting the level of target endogenous nucleic acid in a cell sample.

10. Use of the detection system according to claim 1, characterized in that: Used to prepare a kit, which is used to detect endogenous nucleic acids in cells.

Images