A biosensor for detecting exosomes based on the Cas13a system

Abstract

The present invention belongs to the field of biological detection technology, and provides a biosensor for detecting exosomes based on the Cas13a system, including: EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, Reporter probe and T7 RNA polymerase, Cas13a / crRNA as shown in nucleotide sequence SEQ NO:1-7; 5' end and 3' end of the Reporter probe are respectively connected to a fluorescent reporter group and a fluorescent quencher group. The sensor has a low detection limit, a simple construction method, stable performance, and low process cost, and is suitable for industrial production and detection requirements.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and specifically relates to a biosensor for detecting exosomes based on a Cas13a system. Background Art

[0002] Exosomes refer to small membrane vesicles (30-150nm) containing complex RNA and proteins. Nowadays, they specifically refer to discoid vesicles with a diameter of 40-100nm. In 1983, exosomes were first discovered in sheep reticulocytes, and Johnstone named them "exosomes" in 1987. A variety of cells can secrete exosomes under normal and pathological conditions. They are mainly derived from multivesicular bodies formed by the invagination of lysosomal microparticles in cells, and are released into the extracellular matrix after the fusion of the multivesicular outer membrane with the cell membrane. Exosomes are widely present in various body fluids, and can carry a variety of important biological functional molecules such as lipids, proteins, messenger RNAs, non-coding RNAs, and can participate in intercellular material exchange and information exchange.

[0003] Exosomes have broad application prospects in medicine. They can be used for trauma or cosmetic purposes, and their effects depend on the amount of exosomes. Currently reported methods for detecting exosomes include mass spectrometry and immunoassays, including western blot and enzyme-linked immunosorbent assay (ELISA), but these methods require cumbersome sample pretreatment, which limits their application in rapid detection of exosomes. Therefore, there is an urgent need for a fast, accurate, simple, and trace analysis method to detect exosomes. In recent years, DNA biosensor detection technology and Cas systems have received widespread attention and application due to their high sensitivity and specificity. Among them, the basic theoretical research of fluorescence luminescence technology has become increasingly mature, and it plays an increasingly important role in biology, medicine and other fields. Compared with other detection methods, fluorescence technology has significant advantages, such as high sensitivity, strong specificity and low price. Summary of the invention

[0004] In view of the problems in the prior art, the present invention provides a biosensor for detecting exosomes based on the Cas13a system, which has fast detection speed, simple operation, low price, low detection limit and high specificity.

[0005] To achieve the above purpose, the present invention adopts the following technical solution.

[0006] A biosensor for detecting exosomes based on the Cas13a system, comprising:

[0007] EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, Reporter probe and T7 RNA polymerase, Cas13a / crRNA having nucleotide sequences as shown in SEQ NO: 1-7;

[0008] The 5' end and 3' end of the reporter probe are connected to a fluorescent reporter group and a fluorescent quencher group respectively;

[0009] The nucleotide sequence of the crRNA is shown in SEQ NO: 8.

[0010] Preferably, the EpCAM-Apt and P1 probes are replaced by Apt-P1 probes, and the Apt-P1 probe is a double-stranded probe obtained by hybridization of EpCAM-Apt and P1 probes.

[0011] A kit for detecting exosomes comprising the above biosensor.

[0012] The kit also includes an exosome standard and a buffer solution.

[0013] A method for detecting exosomes using the above-mentioned biosensor or kit comprises the following steps:

[0014] (1) Artificially synthesizing EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, Reporter probe and crRNA; and obtaining Apt-P1 probe and Cas13a / crRNA;

[0015] (2) Mix the sample or exosome standard with the Apt-P1 probe in a buffer solution and react for 30 min; then add H1, H2, H3, and H4 and react for 30-130 min; then add T7 RNA polymerase and Cas13a / crRNA and react at 37°C for 30 min; then add the Reporter probe and react for 60 min; set the excitation wavelength to 485 nm and the emission wavelength to 520 nm to detect the fluorescence signal;

[0016] (3) Calculate the exosome content in the sample based on the fluorescence signal of the exosome standard.

[0017] The detection principle of the present invention is as follows:

[0018] The biosensor uses the following sequence:

[0019] EpCAM-Apt:

[0020] CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG

[0021] P1:

[0022] TCTCCAACGGTCTGTCCCTGCAACAGT

[0023] H1:

[0024] GGTTGCCAGACAGGGTAGACTACCGTAGCCCTGTCTGGACCACCCAAAAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCACUUUG

[0025] H2:

[0026] GTCTGTCCCATCTGATGGCATCGACTGCTACGGCTGCAGACAGACTCAAG

[0027] H3:

[0028] CTTGAGTCTGTCTGCAGCCGTAGCAGTGCTACGGTAGTCTACCCTGTCTGGACCACCCAAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCACUUUG

[0029] H4:

[0030] GGTTGCCAGACAGGGCAGACTGGGTAGACTACCGTAGC

[0031] Reporter probe:

[0032] FAM-TTAAAATT-BHQ1;

[0033] crRNA:

[0034] GACCACCCCAAAAAUGAAGGGGACUAAAACGUGGUAACCGUCCCCCUUGC

[0035] EpCAM-Apt and P1 probes are partially complementary in sequence, forming an arch probe Apt-P1; when the target is present, the target specifically binds to the Apt-P1 probe, releasing P1, which is complementary to the exposed portion of H1, opening H1, and the exposed portion is complementary to H2, opening H2 and exposing the terminal H3, forming a polymer structure, and the hairpin H4 is complementary to the polymer terminal, forming a cross-shaped polymer structure while replacing P1, realizing the P1 cycle, and achieving the amplification effect through the HCR reaction;

[0036] After adding T7 RNA polymerase, the cross-shaped polymer will be cut and several RNAs will be released. RNA will bind to Cas13a / crRNA to stimulate the cutting activity of Cas13a. After adding the Reporter probe, the activated Cas13a will cut the Reporter probe, causing the quenching group and the fluorescent group to separate and generate fluorescence, thereby quantitatively detecting the exosome content by measuring the fluorescence intensity.

[0037] The present invention has the following advantages:

[0038] The biosensor of the present invention utilizes the specific combination of nucleic acid aptamers and exosomes to achieve highly specific detection of the target; utilizes the HCR reaction to form a cross-shaped polymer structure, and at the same time, under the recycling of P1, exponential amplification is achieved, the detection signal is amplified, the sensitivity of the detection is improved, and ultra-sensitive detection of the target exosome is achieved; the detection limit can reach 1 μg / mL, and the detection limit is low. The construction of the sensor is simple, effectively avoiding the contamination that may be caused by adding samples in multiple steps, as well as the cumbersome sample pretreatment process, and has the advantages of simple operation and fast reaction speed; the main processes of the detection principle are all realized in a homogeneous phase, which improves the reaction speed, reduces the complexity of the operation, and realizes the rapid, simple, and sensitive detection of the target; the process cost of making the biosensor is low, which is suitable for the low-cost requirements of industrialization; and it is suitable for the actual requirements of medical detection of exosomes. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is the principle diagram of the present invention;

[0040] Figure 2 Optimization test result graph for H1 concentration;

[0041] Figure 3 Optimize the detection result graph for H2 concentration;

[0042] Figure 4 Optimize the detection result graph for H3 concentration;

[0043] Figure 5 Optimize the test result graph for reaction time;

[0044] Figure 6 This is the result of exosome concentration detection. DETAILED DESCRIPTION

[0045] The present invention will be further described below in conjunction with embodiments and drawings, but the present invention is not limited by the following embodiments.

[0046] Example 1 Screening of H1-H3 concentrations

[0047] (1) Exosomes from CCRF-CEM cells were isolated by differential centrifugation and then resuspended in PBS buffer;

[0048] (2) Artificially synthesized EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, Reporter probe and crRNA;

[0049] The solution of EpCAM-Apt, P1 probe is denatured at high temperature and renatured at room temperature to form Apt-P1 probe solution;

[0050] Cas13a and crRNA were mixed in 5×PBS buffer to form a Cas13a / crRNA complex with cleavage activity;

[0051] (3) Mix 4 μL of exosomes with Apt-P1 (1 μL, 5 μM) and 5× PBS buffer and react for 30 min;

[0052] Then H1 (1 μL, final concentrations were 0.4 μM, 0.6 μM, 0.8 μM, 1 μM, 1.2 μM, 1.4 μM), H2 (1 μL, 1 μM), H3 (1 μL, 1 μM), and H4 (1 μL, 1 μM) were added and reacted for 90 min;

[0053] Then, T7 RNA polymerase (1 μL, 1 μM) and Cas13a / crRNA (1 μL, 100 nM) were added and reacted at 37 °C for 30 min;

[0054] Then, the Reporter probe (1 μL, 1 μM) was added and reacted for 60 min;

[0055] The excitation wavelength was set to 485 nm and the emission wavelength to 520 nm to detect the fluorescence signal.

[0056] Results Figure 2 ,As can be seen from the figure, the detected fluorescence intensity peak increases with the ,increase of the concentration of H1. When the concentration exceeds 1.0 μM, the chemiluminescence ,intensity tends to stabilize, so the optimal concentration of H1 is 1.0 μM.

[0057] The same method was used to screen the concentrations of H2 and H3 probes, and the results were as follows: Figure 3 and Figure 4 ,As can be seen from the figure, the peak of fluorescence intensity increases with the increase of the concentration of H2 or H3. When the concentration exceeds 1.0 μM, the chemiluminescence intensity tends to be stable, so the optimal concentration of H2 and H3 are 1.0 μM.

[0058] Example 2 Screening of reaction time

[0059] The method in Example 1 was followed, except that:

[0060] (3) Mix 4 μL of exosomes with Apt-P1 (1 μL, 5 μM) and 5× PBS buffer and react for 30 min;

[0061] Then H1 (1 μL, 1 μM), H2 (1 μL, 1 μM), H3 (1 μL, 1 μM), and H4 (1 μL, 1 μM) were added and reacted for 30 min, 50 min, 70 min, 90 min, 110 min, and 130 min;

[0062] Then, T7 RNA polymerase (1 μL, 1 μM) and Cas13a / crRNA (1 μL, 100 nM) were added and reacted at 37 °C for 30 min;

[0063] Then, the Reporter probe (1 μL, 1 μM) was added and reacted for 60 min;

[0064] The excitation wavelength was set to 485 nm and the emission wavelength to 520 nm to detect the fluorescence signal.

[0065] Results Figure 5 As can be seen from the figure, the peak value of the detected fluorescence intensity increases with the extension of time. When the time exceeds 90 minutes, the chemiluminescence intensity tends to be stable, so the optimal reaction time is 90 minutes.

[0066] Example 3 Detection of exosomes by optimized sensor

[0067] (1) Exosomes from CCRF-CEM cells were separated by differential centrifugation and then resuspended in PBS buffer; the exosome samples were diluted to different concentrations (0 μg / mL, 1 μg / mL, 2 μg / mL, 3 μg / mL, 4 μg / mL, 5 μg / mL, 6 μg / mL);

[0068] (2) Artificially synthesized EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, Reporter probe and crRNA;

[0069] The solution of EpCAM-Apt, P1 probe is denatured at high temperature and renatured at room temperature to form Apt-P1 probe solution;

[0070] Cas13a and crRNA were mixed in 5×PBS buffer to form a Cas13a / crRNA complex with cleavage activity;

[0071] (3) Mix 4 μL of exosomes (0 μg / mL, 1 μg / mL, 2 μg / mL, 3 μg / mL, 4 μg / mL, 5 μg / mL, 6 μg / mL) with Apt-P1 (1 μL, 5 μM) and 5× PBS buffer and react for 30 min;

[0072] Then H1 (1 μL, 1 μM), H2 (1 μL, 1 μM), H3 (1 μL, 1 μM), and H4 (1 μL, 1 μM) were added and reacted for 90 min;

[0073] Then, T7 RNA polymerase (1 μL, 1 μM) and Cas13a / crRNA (1 μL, 100 nM) were added and reacted at 37 °C for 30 min;

[0074] Then, the Reporter probe (1 μL, 1 μM) was added and reacted for 60 min;

[0075] Set the excitation wavelength to 485 nm and the emission wavelength to 520 nm to detect the fluorescence signal;

[0076] (4) Results Figure 6 As can be seen from the figure, when the exosome concentration increases from 0 to 6 μg / mL, the fluorescence signal detected increases with the increase of the target concentration. The regression equation y=186.325+108.456x, R 2 =0.994, from which the detection limit of this scheme was calculated to be 1 μg / mL. Sequence Listing <110> University of Jinan <120> A biosensor for detecting exosomes based on the Cas13a system <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 48 <212> DNA <213> Artificial Sequence <400> 1 cactacagag gttgcgtctg tcccacgttg tcatgggggg ttggcctg 48 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <400> 2 tctccaacgg tctgtccctg caacagt 27 <210> 3 <211> 90 <212> DNA / RNA <213> Artificial Sequence <400> 3 ggttgccaga cagggtagac taccgtagcc ctgtctggac cacccccaaaa augaagggga 60 cuaaaaccua ccugcacugu aagcacuuug 90 <210> 4 <211> 50 <212> DNA <213> Artificial Sequence <400> 4 gtctgtccca tctgatggca tcgactgcta cggctgcaga cagactcaag 50 <210> 5 <211> 103 <212> DNA / RNA <213> Artificial Sequence <400> 5 cttgagtctg tctgcagccg tagcagtgct acggtagtct accctgtctg gaccacccca 60 aaaaugaagg ggacuaaaac cuaccugcac uguaagcacu uug 103 <210> 6 <211> 38 <212> DNA <213> Artificial Sequence <400> 6 ggttgccaga cagggcagac tgggtagact accgtagc 38 <210> 7 <211> 8 <212> DNA <213> Artificial Sequence <400> 7 ttaaaatt 8 <210> 8 <211> 50 <212> RNA <213> Artificial Sequence <400> 8 gaccacccca aaaaugaagg ggacuaaaac gugguaaccg ucccccuugc 50

Claims

1. A biosensor for detecting exosomes based on the Cas13a system, characterized in that include: EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, Reporter probe and T7 RNA polymerase, Cas13a / crRNA having nucleotide sequences as shown in SEQ NO: 1-7; The 5' end and 3' end of the reporter probe are connected to a fluorescent reporter group and a fluorescent quencher group respectively; The nucleotide sequence of the crRNA is shown in SEQ NO:

8.

2. The biosensor according to claim 1, characterized in that The EpCAM-Apt and P1 probes are replaced by Apt-P1 probes, and the Apt-P1 probe is a double-stranded probe obtained by hybridization of EpCAM-Apt and P1 probes.

3. A kit for detecting exosomes comprising the biosensor according to claim 1 or 2.

4. The kit according to claim 3, characterized in that: Also included are exosome standards and buffer solutions.

5. A method for detecting exosomes using the biosensor according to claim 1 or 2 or the kit according to claim 3 or 4, characterized in that: The following steps are involved: (1) Artificially synthesizing EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, Reporter probe and crRNA; and obtaining Apt-P1 probe and Cas13a / crRNA; (2) Mix the sample or exosome standard with the Apt-P1 probe in a buffer solution and react for 30 min; then add H1, H2, H3, and H4 and react for 30-130 min; then add T7 RNA polymerase and Cas13a / crRNA and react at 37 °C for 30 min; then add the Reporter probe and react for 60 min; set the excitation wavelength to 485 nm and the emission wavelength to 520 nm to detect the fluorescence signal; (3) Calculate the exosome content in the sample based on the fluorescence signal of the exosome standard.

Images