A Murine Model of Fetal / Neonatal Alloimmune Thrombocytopenia

Abstract

Transgenic mice comprising T30A, S32P, Q33L, N39D and M470Q mutations in GPIIIa are described, as well as methods of making the transgenic mice and methods of using the transgenic mice to screen test compounds.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] not applicable.

[0003] Reference to sequence listings submitted via the EFS website

[0004] The contents of the 29.0 kb ASCII text file of the sequence listing named "160180_00134_ST25.txt" were created on November 4, 2019 and submitted electronically through the EFS website, and the application is incorporated herein by reference in its entirety. Background Art

[0005] Alloantibodies to platelet-specific antigens cause three clinically significant bleeding disorders: Blood transfusion back purple Vitiligo (PTP), hemorrhage Small board lose Note none effect (RPT) and fetus / new born Son Same species waived Epidemic Blood Small board FNAIT (variously referred to in the literature as NATP or NAIT)* For a review, see References 1 ). PTP is a rare syndrome in which multiparous women inexplicably clear not only the transfused platelets but also their own platelets after receiving a transfusion, resulting in severe thrombocytopenia, ecchymoses, and petechiae. RPT is seen in patients who have received multiple platelet transfusions and remains a clinical challenge, leading to bleeding complications and prolonged hospital stay. RPT can be divided into immune and non-immune causes. Immune causes include alloimmunization to HLA and / or platelet-specific antigens due to previous pregnancy, transfusion, and / or transplant exposure. Non-immune causes include fever, sepsis, splenomegaly, disseminated intravascular coagulation (DIC), bleeding, veno-occlusive disease (VOD), graft-versus-host disease (GVHD), and medications based on studies in patients with acute myeloid leukemia (AML) or hematopoietic progenitor cell transplantation. 54 Unlike PTP or RPT, FNAIT is a fairly common condition that results in severe fetal and / or neonatal thrombocytopenia in approximately 1 / 1000 to 1 / 2000 live births. 2，3 While many infants fully recover, FNAIT is a leading cause of severe thrombocytopenia in fetuses and neonates, with nearly half experiencing bleeding severe enough to require transfusions of “antigen-negative” platelets. 4 However, the most devastating consequences of FNAIT are intracranial hemorrhage and intrauterine death as early as 20-24 weeks of gestation. 2，5，6Despite advances in treatment, FNAIT remains the leading cause of intracranial hemorrhage in term infants. 4，7-10 , often resulting in lifelong disability.

[0006] Over the past 60 years, work in many laboratories has identified more than 30 different heritable people Blood Small plate Specificity Same species The HPA system (HPA 1-30) is located on five different glycoproteins and is currently recognized by the International Society of Blood Transfusion (ISBT) Platelet Nomenclature Committee and the ISTH 11 Among them, HPA-1a (also known as Pl A1 ) epitope is the most common epitope inducing PTP and FNAIT and is responsible for approximately 80% of cases in which alloantibodies are detected 12 However, there is a need in the art for improved models for studying HPA-1a / 1b epitopes and for improved diagnostic, preventive, and therapeutic methods for PTP and FNAIT. Summary of the invention

[0007] Some major aspects of the present invention are summarized below. Additional aspects are described in the detailed description, examples, drawings, and claims sections of the present disclosure. The description in each section of the present disclosure is intended to be read together with the other sections. In addition, the various embodiments described in each section of the present disclosure may be combined in various different ways, and any and all such combinations of the embodiments are intended to fall within the scope of the present invention.

[0008] In a first aspect, provided herein is a transgenic mouse whose genome comprises a nucleic acid encoding a variant platelet membrane glycoprotein IIIa (GPIIIa) having at least 95% identity to SEQ ID NO: 25, wherein the variant GPIIIa comprises mutations T30A, S32P, Q33L, N39D, and M470Q in SEQ ID NO: 25. In some embodiments, the mouse expresses a variant GPIIIa comprising the sequence shown in SEQ ID NO: 26. In some embodiments, the variant GPIIIa further comprises a mutation V22M relative to SEQ ID NO: 25. In some embodiments, the variant GPIIIa can bind to an anti-HPA-1a antibody.

[0009] In a second aspect, the present invention provides an in vitro method for identifying a molecule that can specifically bind to a variant platelet membrane glycoprotein IIIa (GPIIIa), the method comprising: contacting a candidate molecule with a platelet from a transgenic mouse as described herein; and determining whether the candidate molecule binds to the platelet; wherein if the candidate molecule binds to the platelet from the transgenic mouse but not to the platelet from the wild-type mouse, the candidate molecule can specifically bind to the variant GPIIIa. In some embodiments, the candidate molecule is selected from the group consisting of an antibody, Fv, F(ab), F(ab'), F(ab')2, and a single-chain form of any of the foregoing.

[0010] In a third aspect, provided herein is an in vivo method for identifying a molecule capable of preventing an anti-HPA-1a alloimmune response in a female mouse, the method comprising: administering a candidate molecule to a test mouse, wherein the test mouse bears a pup heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) complexed with a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is negative for anti-HPA-1a antibodies; and measuring the anti-HPA-1a antibody titer of the test mouse; wherein if the anti-HPA-1a antibody titer of the test mouse is undetectable by a single antigen bead assay at two weeks postpartum, the candidate molecule is capable of preventing an anti-HPA-1a alloimmune response. In some embodiments, the anti-HPA-1a antibody titer in the test mouse is undetectable at six weeks postpartum. In some embodiments, the candidate molecule is selected from the group consisting of an antibody, an Fv, a F(ab), a F(ab′), a F(ab′)2, and a single chain form of any of the foregoing.

[0011] In a fourth aspect, provided herein is an in vivo method for identifying a molecule capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets, the method comprising: administering a candidate molecule to a test mouse, wherein the test mouse bears a pup heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) in combination with a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25; and measuring fetal or neonatal platelet count; wherein if the fetal or neonatal platelet count of the test mouse pup is higher than the fetal or neonatal platelet count of the control mouse pup, the candidate molecule is capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets. In some embodiments, bleeding is reduced or prevented in pups of test mice compared to pups of control mice.In some embodiments, the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab'), F(ab')2, and single chain forms of any of the foregoing.

[0012] In a fifth aspect, the present invention provides an in vivo method for identifying a molecule capable of inhibiting the passage of anti-HPA-1a alloantibodies across the placenta of pregnant mice, the method comprising: administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with a pup heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) complexed with a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25; and measuring fetal or neonatal anti-HPA-1a antibody titer; wherein if the fetal or neonatal antibody titer of the test mouse pup is lower than the fetal or neonatal antibody titer of the control mouse pup, then the candidate molecule is capable of inhibiting the passage of anti-HPA-1a alloantibodies across the placenta of the pregnant mouse. In some embodiments, bleeding is reduced or prevented in pups of test mice compared to pups of control mice.In some embodiments, the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab'), F(ab')2, and single chain forms of any of the foregoing.

[0013] In a sixth aspect, provided herein is a variant platelet membrane glycoprotein IIIa (GPIIIa) comprising the amino acid sequence shown in SEQ ID NO:26.

[0014] In a seventh aspect, the present invention provides an in vitro method for identifying a molecule capable of competing with an anti-HPA-1a antibody for binding to a variant GPIIIa as described herein, the method comprising: contacting the variant GPIIIa with the anti-HPA-1a antibody to form a GPIIIa-antibody complex, wherein the variant GPIIIa is immobilized on a substrate, and wherein the anti-HPA-1a antibody comprises a label; contacting the GPIIIa-antibody complex with a candidate molecule in a solution; and determining whether the candidate molecule competes with the anti-HPA-1a antibody for binding to the variant GPIIIa by detecting the amount of the label on the substrate or in the solution; wherein If the amount of label detected on the substrate after the GPIIIa-antibody complex is contacted with the candidate molecule decreases compared to the amount of label detected on the substrate before the GPIIIa-antibody complex is contacted with the candidate molecule, then the candidate molecule is capable of competing with the anti-HPA-1a antibody for binding to the variant GPIIIa; or wherein the amount of label in the solution after the GPIIIa-antibody complex is contacted with the candidate molecule increases compared to the amount of label in the solution before the GPIIIa-antibody complex is contacted with the candidate molecule, then the candidate molecule is capable of competing with the anti-HPA-1a antibody for binding to the variant GPIIIa. In some embodiments, the anti-HPA-1a antibody is monoclonal antibody 26.4. In some embodiments, the label is selected from the group consisting of a fluorophore, a radioisotope, a chemiluminescent probe, and a bioluminescent probe. In some embodiments, the substrate is selected from the group consisting of beads, resins, particles, membranes, and gels. In some embodiments, the candidate molecule is selected from the group consisting of antibodies, Fv, F(ab), F(ab′), F(ab′)2, and single-chain forms of any of the foregoing.

[0015] In an eighth aspect, the present invention provides a method for preparing the transgenic mouse described herein, the method comprising: injecting into the cytoplasm of a fertilized mouse oocyte i) Cas9 nuclease or a nucleotide encoding the Cas9 nuclease; ii) a gRNA targeting mouse ITGB3 exon 3; iii) a gRNA targeting mouse ITGB3 exon 10; iv) a single-stranded homology-directed repair (HDR) template oligonucleotide encoding T30A, S32P, Q33L and N39D mutations in GPIIIa relative to SEQ ID NO: 25; and ii) a single-stranded HDR template oligonucleotide encoding an M470Q mutation in GPIIIa relative to SEQ ID NO: 25; implanting a two-cell stage embryo produced by the injected oocyte into the oviduct of a pseudopregnant female mouse; and screening mice born by the pseudopregnant female mouse for mice with T30A, S32P, Q33L, N39D and M470Q mutations in GPIIIa relative to SEQ ID NO: 25. In some embodiments, the gRNA targeting ITGB3 exon 10 comprises SEQ ID NO: 7. In some embodiments, the single-stranded HDR template oligonucleotide encoding the M470Q mutation additionally encodes a diagnostic restriction site. In some embodiments, the single-stranded HDR template oligonucleotide encoding the M470Q mutation additionally encodes one or more silent mutations of ITGB3 exon 10 to silence repeated digestion of ITGB3 by Cas9 at exon 10. In some embodiments, the single-stranded HDR template oligonucleotide encoding the M470Q mutation comprises SEQ ID NO: 8. In some embodiments, the gRNA targeting ITGB3 exon 3 comprises SEQ ID NO: 1. In some embodiments, the single-stranded HDR template oligonucleotides encoding T30A, S32P, Q33L, and N39D mutations additionally encode diagnostic restriction sites. In some embodiments, the single-stranded HDR template oligonucleotide encoding T30A, S32P, Q33L, and N39D mutations further encodes one or more silent mutations in ITGB3 exon 3 to silence repeated digestion of ITGB3 by Cas9 at exon 3. In some embodiments, the single-stranded HDR template oligonucleotide encoding T30A, S32P, Q33L, and N39D mutations comprises SEQ ID NO:4.

[0016] In a ninth aspect, provided herein is a transgenic mouse whose genome comprises a nucleic acid encoding a variant platelet membrane glycoprotein IIIa (GPIIIa) having at least 95% identity to SEQ ID NO: 27, wherein the variant GPIIIa comprises mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25. In some embodiments, the mouse expresses a variant GPIIIa comprising the sequence shown in SEQ ID NO: 27. In some embodiments, the variant GPIIIa can bind to an anti-HPA-1a antibody.

[0017] In a tenth aspect, provided herein are mice pregnant with wild-type platelet membrane glycoprotein IIIa (GPIIIa) complexed with heterozygous pups of variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25. In some embodiments, the mouse is positive for anti-HPA-1a antibodies. In some embodiments, the mouse is immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1A-1B The three-dimensional structure of the human GPIIIa PSI and EGF1 domains is shown. Note that the PSI domain is located between the hybrid domain of GPIIIa and the EGF1 domain and controls the HPA-1a (P1 A1 ) epitope expressed polymorphic amino acid 33 is directly opposite to the EGF1 domain that is linearly distant but conformationally close. Alanine to Cys 435 Mutation (by cytosine 13 The disulfide bonds connecting the EGF1 domain to the PSI domain) have previously been shown to result in loss of binding of some but not all parental anti-HPA-1a alloantibodies, leading to the speculation that non-polymorphic amino acids in EGF1 constitute part of the epitope of these so-called type II antibodies.

[0019] Figures 2A-2FCRISPR-mediated generation of APLD humanized transgenic mice is shown. Figure 2A: Three-dimensional structure of the GPIIIa PSI domain showing the locations of residues mutated in the murine protein to humanize the 22-40 amino acid loop. Figure 2B: Schematic diagram of the ITGB3 locus showing the locations of the gRNA binding site (red bars), the protospacer adjacent motif (PAM) sequence (magenta bars), and the Cas9 cleavage site (pointed by red arrows). A 200 bp APLD homology-directed repair (HDR) template was designed to introduce the four desired amino acid substitutions (mutant nucleotides labeled in red) and a diagnostic BamH1 restriction site (silent mutant nucleotides labeled in blue), which was flanked by 80 nucleotide homology arms. The HDR template also introduced nucleotides encoding silent mutations (green) to prevent re-cleavage by Cas9. FIG2C: The 20 bp gRNA designed to target the Cas9 nuclease to the ITGB3 gene shown in panel B was cloned into the BbsI site of the CRISPR vector px459, which also encodes Cas9 and puromycin resistance genes. The px459 plasmid was microinjected into the pronuclei of C57BL / 6N fertilized eggs together with the HDR template to generate humanized APLD mice. FIG2D: PCR strategy designed to report the incorporation of the HDR template within the 717 bp region surrounding the target site of the murine ITGB3 gene. The introduced BamH1 is marked with a blue box. FIG2E: Genotyping of two representative pups: Genomic DNA from the tail of the pups was PCR amplified and digested with BamH1 to identify the correctly targeted APLD allele. The PCR product of pup #1 cut with BamH1 demonstrated the successful incorporation of the HDR oligonucleotide. The arrow indicates the expected BamH1 digestion product. FIG2F : The ITGB3 locus surrounding the genome editing site was PCR amplified from genomic DNA of pup #1 and subjected to DNA sequence analysis, confirming precise homozygous integration of the human sequence into both alleles of murine ITGB3.

[0020] Figure 3A-3BThe APLD humanized murine PSI domain is shown to support binding of some, but not all, human anti-HPA-1a allotype antisera. Figure 3A: Flow cytometric analysis of binding of the HPA-1a selective murine mAb SZ21 to human and mouse platelets. Note that SZ21 binds to human HPA-1a-positive human platelets, but not to HPA-1b-positive human platelets, demonstrating its allotype selectivity, and binds to APLD, but not to wild-type murine platelets. The PSI domain-specific mAb PSIB1, used as a positive control for GPIIb-IIIa expression, binds to all PSI domains, regardless of species or HPA allotype, as shown. Figure 3B: Antigen capture ELISA analysis of binding of anti-HPA-1a parental allotype antisera to human and murine forms of GPIIb-IIIa. Five different human FNAIT allotype antisera were incubated with human or murine platelets of the indicated phenotypes. The platelet / antibody complexes were then lysed with detergent and added to microtiter wells that had been coated with either anti-mouse CD41 to capture immune complexes from mouse platelets or mAb AP2 to capture immune complexes from human platelets. Note that human alloantisera 2, 3, and 4 reacted similarly with human GPIIb-IIIa and APLD mouse GPIIb-IIIa, whereas alloantisera 1 and 5 did not react with mouse APLD GPIIb-IIIa, suggesting that the predominance of HPA-1a-specific alloantibodies present in these polyclonal sera has a more complex epitope requirement. As expected, none of the FNAIT alloantisera reacted with wild-type mouse GPIIb-IIIa.

[0021] Figure 4A-4B Structural requirements for binding to type II anti-HPA-1a antibodies are shown. Figure 4A: Flow cytometric analysis of HPA-1a-specific monoclonal antibody reactivity with human and mouse platelets. Platelets from the indicated species and with the indicated phenotype reacted with mAbs SZ21, 26.4, and B2G1. Note that type II mAb 26.4 requires humanization of murine GPIIIa from Met to Gln at residue 470 of the EGF1 domain, which is spatially close to the PSI domain, as shown in Figure 4B. Another type II HPA-1a-specific mAb B2G1 still did not react with APLDQ platelets, highlighting the complexity of binding specificity that may exist in the polyclonal humoral response to the Leu33Pro polymorphism that controls HPA-1a epitope formation.

[0022] Figures 5A-5CMultiple amino acids in I-EGF1 are shown to contribute to the binding of type II anti-HPA-1a antibodies. Figure 5A: Comparison of human and mouse PSI and I-EGF1 domain sequences with differences highlighted in red. Note in particular the APLD sequence of the PSI domain and the differences in Q470M, H446P, G463D, and P464Q in EGF1. Figure 5B: Structural model of the variable region of antibody B2G1 bound to the β3 PSI and I-EGF1 domains. The antibody is shown as a tan surface with CDR loops as indicated, while the side chains of integrin β3 residues at the antigen-antibody interface are shown as sticks and dots. Note that the interface interacting residues include not only the polymorphic amino acid 33, but also the P in the PSI domain. 32 and I-EGF1 446 and Q 470 . Also note that G 463 and P 464 Figure 5C Top: HEK293 cells transiently transfected with plasmids expressing human GPIIb and murine GPIIIa isoforms mutated to express the indicated humanized amino acid substitutions were incubated with the indicated antibodies and analyzed by flow cytometry. The PSI domain-specific mAb PSIB1 was used as a control for transfection efficiency. Note that mAb 26.4 requires Q for binding 470 , while B2G1 requires Q 470 and H 446 , as predicted by the docking model in Figure 5B. Figure 5C Bottom: Flow cytometric analysis of HEK293 cells transfected with plasmids expressing human GPIIb and human GPIIIa isoforms mutated to express the indicated mouse amino acids using the indicated antibodies. Note Q 470 →M mutation leads to loss of binding of both 26.4 and B2G1, while H 446 →P amino acid substitutions only affect B2G1.

[0023] Figures 6A-6DCRISPR-mediated generation of APLDQ humanized transgenic mice is shown. Figure 6A: Three-dimensional structure of the GPIIIa PSI domain showing the position of residue M470 mutated to Q in the EGF1 domain of the APLD murine GPIIIa protein. Figure 6B: Schematic diagram of the ITGB3 locus showing the location of the gRNA binding site (red column), the protospacer adjacent motif (PAM) sequence (magenta column), and the Cas9 cleavage site (pointed by red arrows). A 167 bp homology-directed repair (HDR) template was designed to introduce an M to Q amino acid substitution (mutated nucleotides marked in red), flanked by 82 and 77 nucleotide homology arms. The HDR template also introduced silent mutations (nucleotides indicated in green) to prevent re-cleavage by Cas9. Figure 6C: Cas-9 protein, gRNA, and HDR template were microinjected into the cytoplasm of APLD C57BL / 6N fertilized eggs to generate humanized APLDQ mice. FIG6D : PCR amplification of the ITGB3 locus surrounding the genome editing site from genomic DNA of pups and DNA sequence analysis confirmed precise heterozygous integration of the HDR sequence into one allele of murine ITGB3.

[0024] Figure 7 Antigen capture ELISA analysis of anti-HPA-1a maternal alloantisera binding to human and murine forms of GPIIb-IIIa is shown. 16 different human FNAIT alloantisera or PTP alloantisera were incubated with human or murine platelets of the indicated phenotype. The platelet / antibody complexes were then lysed with detergent and added to microtiter wells that had been coated with anti-mouse CD41 to capture immune complexes from mouse platelets or with mAb AP2 to capture immune complexes from human platelets. Note that human FNAIT alloantisera 2, 3, 4, 7, 11, 12, 13 and PTP alloantisera 2 and 3 reacted similarly with human GPIIb-IIIa and APLD mouse GPIIb-IIIa, whereas human FNAIT alloantisera 1, 5, 9, 10 reacted poorly with mouse APLD GPIIb-IIIa, suggesting that the predominance of HPA-1a-specific alloantibodies present in these polyclonal sera has a more complex epitope requirement. As expected, none of the FNAIT alloantisera reacted with wild-type mouse GPIIb-IIIa.

[0025] Figure 8It was shown that type II, but not type I, anti-HPA-1a isotype antibodies inhibited PAC-1 binding to human αIIbβ3. HEK293FT cells were transfected with wild-type human αIIbβ3 plus EGFP. Cells were pre-incubated with type I mAb SZ21, type II mAbs B2G1 and 26.4, or purified IgG fractions from a previously characterized type I PTP antiserum (PTP-1) or previously characterized type II FNAIT antiserum (FNAIT-5 and FNAIT-9). After pre-incubation, the fibrinogen ligand mimetic mAb PAC-1 was added to a flask containing 0.2 mM Ca +2 and 2 mM Mn +2 . EGFP-positive cells were analyzed for PAC-1 binding by flow cytometry. PAC-1 binding was normalized to total β3 surface expression and expressed as a percentage of buffer control. Data are mean ± SD (n ≥ 2). Note that both monoclonal and polyclonal type II antibodies inhibited PAC-1 binding to varying degrees, whereas type I antibodies had essentially no effect.

[0026] Fig. 9 Display and APLD + / + Pre-immunized wild type females mated to males gave birth to severely thrombocytopenic pups. Mating control #1 was a WT non-immunized Balb / c female crossed to an APLD C57BL / 6 male. Mating control #2 was an immune Balb / c female crossed to a WTC57BL / 6 male.

[0027] Figures 10A-10D showed that fetal / neonatal thrombocytopenia persisted in at least five subsequent pregnancies despite females being isoimmunized only once. Maternal anti-APLDβ3 integrin antibodies caused thrombocytopenia and bleeding in pups.

[0028] Fig.11 Display, similar to Fig. 9 In the APLD model shown in , pre-immunized wild-type females mated to APLDQ males gave birth to severely thrombocytopenic pups. Mating control #1 was a WT non-immunized Balb / c female crossed to an APLD C57BL / 6 male. Mating control #2 was an immune Balb / c female crossed to a WT C57BL / 6 male.

[0029] Figures 12A-12D Shown in Fig.11 Thrombocytopenia and hemorrhage persisted in pups in up to four pregnancies in the matings outlined in Maternal anti-APLDβ3 integrin antibodies caused thrombocytopenia and hemorrhage in pups.

[0030] Fig.134 μg / ml mAb 26.4 was shown to effectively inhibit the binding of murine polyclonal anti-APLDQ antibodies to murine APLDQ platelets in vitro. All concentrations tested between 2 μg / ml and 16 μg / ml effectively inhibited binding.

[0031] Fig.14 IVIG and mAb 26.4 treatment regimens are shown. Treatment with 1 g / kg of human IVIG introduced IV on days 10 and 17 post-mating increased platelet counts in pups born to APLDQ alloimmunized females. Similarly, treatment with mAb 26.4 (30 μg / mouse) in the form of PG-LALA introduced on days 10 and 17 post-mating increased platelet counts in pups born to APLDQ alloimmunized females.

[0032] Fig.15 It was shown that both IVIG and PG-LALA 26.4 effectively increased platelet counts in APLDQ alloimmunized female mouse pups.

[0033] Incorporated by Reference

[0034] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. DETAILED DESCRIPTION

[0035] FNAIT and PTP are bleeding disorders caused by alloantibodies to platelet-specific antigens. A1 ) epitope is the most common human platelet alloantigen initiating PTP and FNAIT, responsible for approximately 80% of cases with detectable alloantibodies. The HPA-1a / -1b alloantigen system is controlled by the Leu33Pro polymorphism in platelet membrane glycoprotein (GP) IIIa (= β3 integrin subunit of the αIIbβ3 platelet fibrinogen receptor) 13，14 , Pro 33 Individuals homozygous for HPA-1b also carry the HLA-DRB3*0101 allele of the major histocompatibility complex (MHC), which is most susceptible to Leu 33 (HPA-1a) forms alloimmune responses 15-17 The polymorphic amino acid 33 is located within a heavily disulfide-bonded structure called the plexin, semaphorin, integrin (PSI) domain, which itself is located between the hybrid GPIIIa 18 and integrin protein epidermal growth factor 1 (EGF, I-EGF1) domains (see Figure 1A-1BInterestingly, while some parental anti-HPA-1a alloantibodies classified as type I antibodies typically bind to mutant forms of GPIIIa in which the disulfide bond linking the PSI and EGF1 domains has been disrupted, others (type II) lose reactivity. 19 , suggesting that (1) alloimmune responses to HPA-1a are heterogeneous and (2) for at least some parental anti-HPA-1a antibodies, sequences within the EGF domain that are linearly spaced may be required to form a high-affinity antibody binding site on GPIIIa (e.g. Figure 1A-1B shown).

[0036] Based on analysis of three-dimensional structural data of GPIIIa in the molecular region surrounding polymorphic amino acid 33, transgenic mice expressing murine GPIIIa isoforms containing selected humanized residues within the PSI and EGF1 domains are described herein. Binding of a series of monoclonal and polyclonal HPA-1a-specific antibodies to GPIIIa isoforms containing selected humanized residues is also described. This binding demonstrates the complex heterogeneity of the polyclonal alloimmune response to this clinically important human platelet alloantigen system. High-resolution mapping of this alloimmune response may improve the diagnosis of FNAIT and should facilitate the rational design, selection and / or screening of prophylactic and therapeutic anti-HPA-1a drugs.

[0037] Currently, there is no animal model of FNAIT that accurately reflects the binding of a wide range of monoclonal and polyclonal antibodies from anti-HPA-1a antisera to GPIIIa as seen in human FNAIT. In addition, there is no animal model of FNAIT suitable for the design, selection and screening of preventive and therapeutic agents. This is due to sequence and structural differences in murine GPIIIa compared to human GPIIIa, resulting in altered binding of monoclonal and polyclonal antibodies.

[0038] Transgenic mice comprising humanized mutations of GPIIIa are provided herein. Due to the mutations of GPIIIa, the mice express variant GPIIIa that bind to monoclonal and polyclonal antibodies from anti-HPA-1a antiserum. Cells and tissues derived from transgenic mice are also provided herein. The wild-type mouse GPIIIa sequence is included herein as SEQ ID NO:25. The transgenic mouse GPIIIa sequence comprises at least T30A, S32P, Q33L, N39D, and M470Q mutations in GPIIIa (SEQ ID NO:25), resulting in variant GPIIIa capable of binding to anti-HPA-1a antibodies, and in some embodiments, variant GPIIIa capable of binding to monoclonal and polyclonal anti-HPA-1a antibodies. In some embodiments, the variant GPIIIa sequence comprises at least one M470Q mutation and a mutation of amino acid residues 22-40 of SEQ ID NO:25, wherein amino acid residues 22-40 are replaced by the sequence MCAWCSDEALPLGSPRCD (SEQ ID NO:28), which corresponds to the loop region in the PSI domain and is adjacent to the EGF1 and EGF2 domains of human GPIIIa. In one embodiment, the variant GPIIIa is capable of binding to monoclonal antibody 26.4. In some embodiments, the transgenic mouse expresses a variant GPIIIa comprising the amino acid sequence of SEQ ID NO:26. In some embodiments, the transgenic mouse expresses a variant GPIIIa comprising the amino acid sequence of SEQ ID NO:27.

[0039] Mouse GPIIIa (SEQ ID NO:25)

[0040] ESNICTTRGVNSCQQCLAVSPVCAWCSDETLSQGSPRCNLKENLLKDNCAPESIEFPVSEAQILEARPLSSKGSGSSAQITQVSPQRIALRLRPDDSKIFSLQVRQVEDYPVDIYYLMDLSFSMKDDLSSIQTLGTKLASQMRKLTSNLRIGFGAFVDKPVSPYMYISPPQAIKNPCYNMKNACLPMFGYKHVLTLTDQVSRFNEEVKKQSVSRNRDAPEGGFDAIMQATVCDEKIGWRNDASHLLVFTTDAKTHIALDGRLAGIVLPNDGHCHIGTDNHYSASTTMDYPSLGLMTEKLSQKNINLIFAVTENVVSLYQNYSELIPGTTVGVLSDDSSNVLQLIVDAYGKIRSKVELEVRDLPEELSLSFNATCLNNEVIPGLKSCVGLKIGDTVSFSIEAKVRGCPQEKEQSFTIKPVGFKDSLTVQVTFDCDCACQAFAQPSSPRCNNGNGTFECGVCRCDQGWLGSMCECSEEDYRPSQQEECSPKEGQPICSQRGECLCGQCVCHSSDFGKITGKYCECDDFSCVRYKGEMCSGHGQCNCGDCVCDSDWTGYYCNCTTRTDTCMSTNGLLCSGRGNCECGSCVCVQPGSYGDTCEKCPTCPDACSFKKECVECKKFNRGTLHEENTCSRYCRDDIEQVKELTDTGKNAVNCTYKNEDDCVVRFQYYEDTSGRAVLYVVEEPECPKGPDILVVLLSVMGAILLIGLATLLIWKLLITIHDRKEFAKFEEERARAKWDTANNPLYKEATSTFTNITYRGT

[0041] Humanized murine GPIIIa variant 1 (SEQ ID NO:26)

[0042] ESNICTTRGVNSCQQCLAVSPVCAWCSDEALPLGSPRCDLKENLLKDNCAPESIEFPVSEAQILEARPLSSKGSGSSAQITQVSPQRIALRLRPDDSKIFSLQVRQVEDYPVDIYYLMDLSFSMKDDLSSIQTLGTKLASQMRKLTSNLRIGFGAFVDKPVSPYMYISPPQAIKNPCYNMKNACLPMFGYKHVLTLTDQVSRFNEEVKKQSVSRNRDAPEGGFDAIMQATVCDEKIGWRNDASHLLVFTTDAKTHIALDGRLAGIVLPNDGHCHIGTDNHYSASTTMDYPSLGLMTEKLSQKNINLIFAVTENVVSLYQNYSELIPGTTVGVLSDDSSNVLQLIVDAYGKIRSKVELEVRDLPEELSLSFNATCLNNEVIPGLKSCVGLKIGDTVSFSIEAKVRGCPQEKEQSFTIKPVGFKDSLTVQVTFDCDCACQAFAQPSSPRCNNGNGTFECGVCRCDQGWLGSQCECSEEDYRPSQQEECSPKEGQPICSQRGECLCGQCVCHSSDFGKITGKYCECDDFSCVRYKGEMCSGHGQCNCGDCVCDSDWTGYYCNCTTRTDTCMSTNGLLCSGRGNCECGSCVCVQPGSYGDTCEKCPTCPDACSFKKECVECKKFNRGTLHEENTCSRYCRDDIEQVKELTDTGKNAVNCTYKNEDDCVVRFQYYEDTSGRAVLYVVEEPECPKGPDILVVLLSVMGAILLIGLATLLIWKLLITIHDRKEFAKFEEERARAKWDTANNPLYKEATSTFTNITYRGT

[0043] Humanized murine GPIIIa variant 2 (SEQ ID NO:27)

[0044] ESNICTTRGVNSCQQCLAVSPMCAWCSDEALPLGSPRCDLKENLLKDNCAPESIEFPVSEAQILEARPLSSKGSGSSAQITQVSPQRIALRLRPDDSKIFSLQVRQVEDYPVDIYYLMDLSFSMKDDLSSIQTLGTKLASQMRKLTSNLRIGFGAFVDKPVSPYMYISPPQAIKNPCYNMKNACLPMFGYKHVLTLTDQVSRFNEEVKKQSVSRNRDAPEGGFDAIMQATVCDEKIGWRNDASHLLVFTTDAKTHIALDGRLAGIVLPNDGHCHIGTDNHYSASTTMDYPSLGLMTEKLSQKNINLIFAVTENVVSLYQNYSELIPGTTVGVLSDDSSNVLQLIVDAYGKIRSKVELEVRDLPEELSLSFNATCLNNEVIPGLKSCVGLKIGDTVSFSIEAKVRGCPQEKEQSFTIKPVGFKDSLTVQVTFDCDCACQAFAQPSSPRCNNGNGTFECGVCRCDQGWLGSQCECSEEDYRPSQQEECSPKEGQPICSQRGECLCGQCVCHSSDFGKITGKYCECDDFSCVRYKGEMCSGHGQCNCGDCVCDSDWTGYYCNCTTRTDTCMSTNGLLCSGRGNCECGSCVCVQPGSYGDTCEKCPTCPDACSFKKECVECKKFNRGTLHEENTCSRYCRDDIEQVKELTDTGKNAVNCTYKNEDDCVVRFQYYEDTSGRAVLYVVEEPECPKGPDILVVLLSVMGAILLIGLATLLIWKLLITIHDRKEFAKFEEERARAKWDTANNPLYKEATSTFTNITYRGT

[0045] As used herein, the term "variant" refers to a polypeptide having one or more amino acid substitutions, deletions and / or insertions compared to a reference sequence. For example, SEQ ID NO: 26 is a variant of SEQ ID NO: 25. Variant GPIIIa may have an amino acid sequence that is, for example, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 25, and comprises T30A, S32P, Q33L, N39D and M470Q mutations relative to SEQ ID NO: 25. In some embodiments, variant GPIIIa comprises T30A, S32P, Q33L, N39D and M470Q mutations relative to SEQ ID NO: 25 and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, up to 15, up to 20, up to 25 or up to 30 additional amino acid substitutions relative to SEQ ID NO: 25. In some embodiments, amino acid substitutions are conservative substitutions.

[0046] As used herein, the term "conservative substitution" refers to the replacement of one or more amino acids by another biologically similar residue. Examples include substitutions of amino acid residues with similar characteristics, such as small amino acids, acidic amino acids, polar amino acids, basic amino acids, hydrophobic amino acids, and aromatic amino acids. For further information on phenotypically silent substitutions in peptides and proteins, see, for example, Bowie et al., Science 247: 1306-1310 (1990). In the following table, conservative substitutions of amino acids are grouped according to physicochemical properties; I: neutral and / or hydrophilic, II: acids and amides, III: basic, IV: hydrophobic, V: aromatic bulky amino acids.

[0047] Table I

[0048] I II III IV V A N H M F S D R L Y T E K I W P Q V G C

[0049] In the table below, conservative substitutions of amino acids are grouped according to physicochemical properties; VI: neutral or hydrophobic, VII: acidic, VIII: basic, IX: polar, X: aromatic.

[0050] Table II

[0051] VI VII VIII IX X A D H M F L E R S Y I K T W V N H P Q G C

[0052] Methods for identifying conservative nucleotide and amino acid substitutions that do not affect protein function are well known in the art (see, e.g., Brummell et al., Biochem. 32: 1180-1187 (1993); Kobayashi et al., Protein Eng. 12(10): 879-884 (1999); and Burks et al., Proc. Natl. Acad. Sci. USA 94: 412-417 (1997)).

[0053] In the context of two or more nucleic acids or polypeptides, the term "identity" or "identity" percentage refers to two or more sequences or subsequences that are identical or have a specified percentage of identical nucleotides or amino acid residues when compared and aligned (if necessary, introducing gaps) to obtain maximum correspondence, without considering any conservative amino acid substitutions as part of the sequence identity. The identity percentage can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain amino acid or nucleotide sequence alignments are known in the art.

[0054] One such non-limiting example of a sequence alignment algorithm is described in Karlin et al., Proc. Natl. Acad. Sci., 87:2264-2268 (1990), as modified in Karlin et al., Proc. Natl. Acad. Sci., 90:5873-5877 (1993) and incorporated into the NBLAST and XBLAST programs (Altschul et al., Nucleic Acids Res., 25:3389-3402 (1991)). In certain embodiments, Gapped BLAST may be used as described in Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997). BLAST-2, WU-BLAST-2 (Altschul et al., Methods in Enzymology, 266: 460-480 (1996)), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are additional public software programs that can be used for sequence alignment. In certain embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g., using the NWSgapdna.CMP matrix, a gap weight of 40, 50, 60, 70 or 90, and a length weight of 1, 2, 3, 4, 5 or 6). In certain alternative embodiments, the GAP program in the GCG software package in combination with the algorithm of Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using the BLOSUM62 matrix or the PAM250 matrix, and the gap weight is 16, 14, 12, 10, 8, 6 or 4, and the length weight is 1, 2, 3, 4, 5). Alternatively, in certain embodiments, the algorithm of Myers and Miller (CABIOS 4: 11-17 (1989)) is used to determine the percent identity between nucleotide or amino acid sequences. For example, the ALIGN program (version 2.0) can be used and PAM120 with a residue table (gap length penalty of 12 and gap penalty of 4) can be used to determine the percent identity. Those skilled in the art can determine the appropriate parameters for maximum alignment by specific alignment software. In certain embodiments, the default parameters of the alignment software are used.Other resources for calculating identity include methods described in Computational Molecular Biology (Lesk, ed., 1988); Biocomputing: Informatics and Genome Projects (Smith, ed., 1993); Computer Analysis of Sequence Data, Part 1 (Griffin and Griffin, eds., 1994); Sequence Analysis in Molecular Biology (G. von Heinje, 1987); Sequence Analysis Primer (Gribskov et al., eds., 1991); and Carillo et al., SIAM J. Applied Math., 48:1073 (1988).

[0055] As used herein, "transgenic animal" refers to a non-human animal, such as a mammal, typically a rodent, such as a rat or a mouse, wherein one or more (preferably all) cells of the animal contain a transgene as described herein. Other examples of transgenic animals include non-human primates, sheep, dogs, cattle, goats, chickens, amphibians, etc. As used herein, "transgenic" refers to exogenous DNA that is integrated into the genome of cells in which the transgenic animal develops and is therefore retained in the genome of the mature animal, thereby directing the expression of the encoded gene product in one or more cell types or tissues of the transgenic animal. Knockout animals are included in the definition of transgenic animals.

[0056] Methods for producing transgenic animals, particularly animals such as mice, by embryo manipulation and electroporation or microinjection of pluripotent stem cells or oocytes are known in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, U.S. Pat. No. 4,873,191, U.S. Serial No. 10 / 006,611, "Transgenic Mouse Methods and Protocols (Methods in Molecular Biology)" edited by Hofker and van Deursen (Humana Press, Totowa, NJ, 2002); and "Manipulating the Mouse Embryo" edited by Nagy et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2002), the entire contents of which are incorporated herein by reference.

[0057] Generally, transgenic mice as described herein are prepared by injecting a vector prepared as described herein into the pronucleus or cytoplasm of a fertilized mouse oocyte and used to generate transgenic mice having T30A, S32P, Q33L, N39D, and M470Q mutations in GPIIIa relative to SEQ ID NO: 25 in all cells using standard transgenic techniques, such as described in "Transgenic Mouse Methods and Protocols (Methods in Molecular Biology)," edited by Hofker and van Deursen (Humana Press, Totowa, NJ, 2002); U.S. Pat. Nos. 4,736,866 and 4,870,009, U.S. Pat. Nos. 4,873,191 and 6,791,006, and in Hogan, "Manipulating the Mouse Embryo," edited by Nagy et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2002).

[0058] Methods for gene mutation are known in the art. See, for example, U.S. Pat. No. 7,022,893 to Takeda et al. and U.S. Pat. No. 6,218,595 to Giros et al., and U.S. Pat. No. 6,344,596 to W. Velander et al. (American Grey Cross); U.S. Pat. No. 6,339,183 to TT Sun (New York University); U.S. Pat. No. 6,331,658 to D. Cooper and E. Koren; U.S. Pat. No. 6,255,554 to H. Lubon et al. (American National Grey Cross; Virginia Polytechnic Institute); U.S. Pat. No. 6,204,431 to P. Prieto et al. (Abbott Laboratories); U.S. Pat. No. 6,166,288 to L. Diamond et al. (Nextran Inc., Princeton, NJ); U.S. Pat. No. 5,959,171 to JM Hyttinin et al. (Pharming No. 5,639,457 to G. Brem; No. 5,639,940 to I. Garner et al. (Pharmaceutical Proteins Ltd.; Zymogenetics Inc); No. 5,589,604 to W. Drohan et al. (American Grey Cross); No. 5,602,306 to Townes et al. (UAB Research Foundation); No. 4,736,866 to Leder and Stewart (Harvard); and No. 4,873,316 to Meade and Lonberg (Biogen).

[0059] In some embodiments, CRISPR / Cas9-mediated homology-directed repair (HDR) is used to produce transgenic mice as described herein. For example, see Wang et al. ("One-step generation of mice carrying mutations in multiple genes by CRISPR / Cas-mediated genome editing", Cell, 2013, 153 (4): 910-918). In order to mutate GPIIIa and produce transgenic mice, a carrier encoding i) Cas9 nuclease and ii) a guide RNA (gRNA) targeting a region of interest and located before the protospacer adjacent motif (PAM) site is injected into the pronucleus or cytoplasm of a fertilized mouse oocyte and a single-stranded oligodeoxynucleotide (ssODN) homology-directed repair template. In some embodiments, the separated gRNA, ssODN HDR template and Cas9 nuclease are injected into the pronucleus or cytoplasm of a fertilized mouse oocyte. In some embodiments, the carrier comprises a reporter gene or a selective marker.

[0060] In some embodiments, the gRNA targets mouse ITGB3 exon 3, and the ssODN HDR template encodes GPIIIa T30A, S32P, Q33L, and N39D mutations. In some embodiments, the gRNA targeting mouse ITGB3 exon 3 has the sequence 5'-TTCTCCTTCAGGTTACATCG-3' (SEQ ID NO: 1). In some embodiments, the ssODN HDR template encoding GPIIIa T30A, S32P, Q33L, and N39D mutations has the sequence 5'-GCCAGGGGGAGGTGACTTACCAGGCAGGAGGCACAGCCGCC CTAGCTCTGATGTTGACCTTTCCCTCGGGCTCTTCTCTTCATAGGCCTTGCCTCTGGGATCCCCACGCTGTGACCTGAAGGAGAACCTGCTGAAGGACAATTGTGCTCCAGAGTCTATTGAGTTCCCAGTCAGTGAGGCCCAGATCCTGGAGGCTAGGC-3' (SEQ ID NO: 4). In some embodiments, the ssODN HDR template encodes a silent mutation that introduces a diagnostic restriction site. In some embodiments, the ssODN HDR template encodes a silent mutation of a target gene of interest to silence repeated digestion of the resulting mutant gene by Cas9.

[0061] The mouse ITGB3 gene sequence is available from NCBI Gene ID: 16416 and GenBank NC_000077.6. The genomic nucleotide mutations corresponding to the A30, P32, L33, D39 and Q470 mutations in ITGB3 are summarized in Figures 2B and 6B.

[0062] In some embodiments, the gRNA targets ITGB3 exon 10 and the ssODN HDR template encodes the GPIIIa M470Q mutation. In some embodiments, the gRNA targeting mouse ITGB3 exon 10 has the sequence 5'-CTCCTCAGAGCACTCACACA-3' (SEQ ID NO: 7). In some embodiments, the ssODN HDR template encoding the GPIIIa M470Q mutation has the sequence 5'-AGCCTTCCAGCCCACGCTGCAACAATGGGAACGGGACTTTT GAGTGTGGGGTGTGCCGCTGTGACCAGGGCTGGCTGGGGTCCC AATGCGAGTGCTCTGAGGAGGATTACCGACCCTCTCAGCAGGAAGAGTGCAGCCCCAAGGAGGGCCAGCCCATCTGCAGCCA-3' (SEQ ID NO: 8). In some embodiments, the ssODN HDR template encodes a silent mutation that introduces a diagnostic restriction site. In some embodiments, the ssODN HDR template encodes a silent mutation of the target gene of interest to silence repeated digestion of the resulting mutant gene by Cas9.

[0063] Based on the presence of T30A, S32P, Q33L, N39D and M470Q mutations in GPIIIa, transgenic grouping animals can be identified. The presence of mutations can be directly detected, for example, by PCR amplification or sequencing of the GPIIIa gene target region. The transgenic grouping animals can then be mated with other animals carrying transgenes. In addition, transgenic animals carrying T30A, S32P, Q33L, N39D and M470Q mutations in GPIIIa can be further mated with other transgenic animals carrying other transgenes.

[0064] The transgenic animals described herein and cells and tissues derived from the transgenic animals can be used to identify and study factors that can bind to variant GPIIIa (e.g., monoclonal or polyclonal anti-HPA-1a antibodies or fragments thereof). In some embodiments, the transgenic animals described herein can be used to characterize test factors useful in the treatment or prevention of RPT, PTP or FNAIT, for example, by monitoring platelet count, platelet concentration, bleeding or the pharmacokinetics of the test factor.

[0065] Screening methods

[0066] The invention provides in vitro and in vivo screening methods. One embodiment is an in vitro method for identifying a molecule that can specifically bind to variant glycoprotein IIIa (GPIIIa). In one aspect of this embodiment, a candidate molecule is contacted with platelets from transgenic mice, the genome of which comprises a nucleic acid encoding variant GPIIIa, wherein the variant GPIIIa comprises mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25. If the candidate molecule is combined with platelets from transgenic mice, but not with platelets from wild-type mice or mice that do not comprise variant GPIIIa, then it can be considered that the candidate molecule specifically binds to variant GPIIIa.

[0067] Platelet binding can be measured qualitatively or quantitatively by known methods, including flow cytometry, immunohistochemistry, radioimmunoassay, ELISA, fluorescence resonance energy transfer (FRET), biolayer interferometry, and surface plasmon resonance.

[0068] Another in vitro method can identify molecules that can compete with the anti-HPA-1a antibody for binding to the variant GPIIIa of the present invention. In one embodiment, the method comprises (a) contacting the variant GPIIIa with the anti-HPA-1a antibody to form a GPIIIa-antibody complex, wherein the variant GPIIIa is immobilized on a substrate and wherein the anti-HPA-1a antibody comprises a label; (b) contacting the GPIIIa-antibody complex with a candidate molecule in solution; and (c) determining whether the candidate molecule competes with the anti-HPA-1a antibody for binding to the variant GPIIIa by detecting the amount of label on the substrate or in the solution. The candidate molecule competes with the antibody by binding to the variant GPIIIa and preventing the antibody from binding. A positive result in this assay indicates that the binding site of the candidate molecule to GPIIIa overlaps with or comprises an epitope on GPIIIa to which the antibody binds. In a specific embodiment, the variant GPIIIa comprises the amino acid sequence shown in SEQ ID NO: 26.

[0069] A "label" is a detectable compound that can be conjugated directly or indirectly to a molecule to produce a labeled molecule. The label can be detectable by itself (e.g., radioisotope labeling or fluorescent labeling), or can be indirectly detected, such as by catalyzing chemical changes of a detectable substrate compound or composition (e.g., enzyme labeling) or by other indirect detection means (e.g., biotinylation). In one embodiment, the label is selected from the group consisting of a fluorophore, a radioisotope, a chemiluminescent probe, and a bioluminescent probe.

[0070] The inhibition (i.e., competition) of the binding of the anti-HPA-1a antibody by the candidate molecule can be determined by detecting the presence or absence of the label. For example, if the method is performed by chromatography, the presence of the label in the eluate indicates that the candidate molecule competes for binding to the variant GPIIIa; the absence of the label indicates that the antibody is retained / bound to the immobilized GPIIIa (i.e., no competition or limited competition). Alternatively, the substrate to which the antibody is immobilized can be analyzed for the presence of the label, wherein the presence of the label indicates limited or no competition by the candidate molecule, and the absence of the label indicates that the candidate molecule has bound to GPIIIa and prevented the binding of the antibody (i.e., competition).

[0071] In certain embodiments, the HPA-1a antibody is a monoclonal antibody selected from the group consisting of PSIB1, SZ21, and 26.4. In a specific embodiment, the anti-HPA-1a antibody is 26.4.

[0072] Variant GPIIIa can be fixed on any porous or non-porous substrate known in the art. Non-limiting examples of fixed substrates include beads, resins, particles, membranes and gels. The substrate can be composed of a variety of materials, including agarose, alginate, glass and magnetic materials. Any known method can be used to achieve fixation, such as adsorption, affinity tag binding or covalent bonding.

[0073] In the in vivo methods provided herein, there is a method for identifying a molecule capable of preventing an anti-HPA-1a alloimmune response in a female mouse. In one embodiment, the method comprises administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with a pup heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) combined with a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is negative for anti-HPA-1a antibodies; and measuring the anti-HPA-1a antibody titer of the test mouse. If the anti-HPA-1a antibody titer in the test mouse is undetectable at delivery, one week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, eight weeks, nine weeks, and / or ten weeks postpartum, the candidate molecule is capable of preventing an anti-HPA-1a alloimmune response.

[0074] The present invention also provides an in vivo method for identifying a molecule capable of inhibiting the passage of anti-HPA-1a alloantibodies across the placenta of pregnant mice. In one embodiment, the method comprises administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with a pup heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) combined with a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25, and measuring fetal or neonatal anti-HPA-1a antibody titers. If the fetal or neonatal antibody titer of the test mouse pup is lower than the fetal or neonatal antibody titer of the control mouse pup, the candidate molecule is capable of inhibiting the passage of anti-HPA-1a alloantibodies across the placenta of the pregnant mouse.

[0075] Also provided is an in vivo method for identifying a molecule capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets. In one embodiment, the method comprises administering a candidate molecule to a test mouse, wherein the test mouse is pregnant with a pup heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) in combination with a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is immunized prior to pregnancy with (i) platelets from a transgenic mouse as described herein or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25; and measuring fetal or neonatal platelet counts. If the fetal or neonatal platelet count of the test mouse pup is higher than the fetal or neonatal platelet count of the control mouse pup, then the candidate molecule is capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets.

[0076] As used herein, "control mice" refers to mice that include the same conditions as the compared test mice and are evaluated in the same manner and the same time frame as the compared test mice, except that the control mice are not treated with the candidate molecule. For example, when the test mice are immunized with platelets from the transgenic mice of the present invention or with the GPIIIa variants of the present invention before pregnancy, the control mice are pre-immunized under the same conditions. Similarly, in the method of the present invention, wherein the test mice are pregnant with wild-type GPIIIa complexes containing mutant GPIIIa heterozygous with respect to SEQ ID NO: 25 T30A, S32P, Q33L, N39D and M470Q, the control mice are also pregnant with heterozygous pups. In the case of measuring certain parameters and / or comparing results between the test mice and the control mice, the measurements or evaluations are performed under the same conditions using the same techniques / assays. In order to obtain pregnancy of heterozygous pups, wild-type female mice are mated with transgenic male mice of the present invention.

[0077] A variety of candidate molecules can be screened according to the methods of the present invention. As used herein, a "candidate molecule" can be any chemical compound. Examples of candidate compounds include macromolecules such as peptides, polypeptides, protein complexes, glycoproteins, antibodies, oligonucleotides and nucleic acids, and small molecules such as amino acids, nucleotides, organic compounds, inorganic compounds and organometallic compounds. Candidate molecules can be naturally occurring, synthetic, or can include both natural and synthetic components.

[0078] The antibodies used or screened in the methods of the present invention may include human antibodies, humanized antibodies, chimeric antibodies, monoclonal antibodies, polyclonal antibodies, recombinant antibodies, bispecific antibodies, multispecific antibodies and antigen-binding fragments thereof. Antigen-binding fragments include Fv, F(ab), F(ab') and F(ab')2. Also included are single-chain forms of each of the aforementioned antibodies and antigen-binding fragments.

[0079] In some embodiments, the candidate molecule can be a member of a library, such as an inorganic or organic chemical library, a peptide library, an oligonucleotide library, an antibody library, or a mixed molecule library. In some embodiments, the method includes screening small molecules, such as members of a natural product or a combinatorial chemical library.

[0080] In the case where the candidate molecule is part of a library (e.g., a library comprising antibodies or antigen-binding fragments thereof), the variant GPIIIa of the present invention can be used for epitope binning assays. Epitope binning is a competitive immunoassay that can be used to characterize and sort a library of monoclonal antibodies against a target antigen (e.g., a protein comprising an amino acid sequence shown in SEQ ID NO: 26). Antibodies against similar targets are tested against all other antibodies in the library in a paired manner to determine whether the antibodies block each other from binding to the antigen epitope. For all other antibodies in the library, a competitive blocking pattern for each antibody is created. Closely related epitope binning maps indicate antibodies that have the same or closely related epitopes and are "picked" together. (See, e.g., Brooks BD, Curr. Drug Discovery Technol. 11: 109-112 (2014); Estep P. et al., MAbs 5: 270-278 (2013)). Epitope binning is also referred to in the art as epitope mapping or epitope characterization.

[0081] Candidate molecules can be administered by methods known in the art, for example, by any of oral, parenteral, inhalation or topical routes. Parenteral administration includes, for example, intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal and vaginal administration. Oral dosage forms include, for example, solid, liquid and suspension formulations. Oral gavage is a preferred form of oral administration. Nasal aerosol or inhalation dosage forms can be prepared, for example, as saline solutions, using benzyl alcohol or other suitable preservatives, absorption promoters to improve bioavailability and / or other conventional solubilizers or dispersants. Candidate molecules can be administered in compositions comprising buffers (e.g., acetate, phosphate or citrate buffers), optionally surfactants (e.g., polysorbates), optionally stabilizers (e.g., human albumin), etc. The form and characteristics of the carrier or diluent can be determined by the amount of the active ingredient combined therewith, the route of administration and other well-known variables. According to the structure and properties of the candidate molecule, those skilled in the art can easily determine the appropriate route and dosage form. The dosage of the candidate molecule can be determined empirically by the technician.

[0082] According to the methods of the invention, the candidate molecule can be administered one or more times before, during, and after pregnancy. For example, the candidate molecule can be administered one or more times between 1 to 14 days before mating, between 1 to 24 days after mating, and / or between 1 to 28 days after mating. In one embodiment, the candidate molecule is administered on day 10 and day 17 after mating. One of ordinary skill can determine the dosing regimen empirically, depending on the candidate molecule and the specific effect it is being screened for.

[0083] In some methods of the invention, female mice are immunized with variant GPIIIa before pregnancy to induce the production of anti-HPA-1a antibodies. In some embodiments, the immunization comprises administering platelets from transgenic mice expressing variant GPIIIa, the variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25. In some embodiments, the immunization comprises administering variant GPIIIa (e.g., comprising mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25). It is administered by known methods, preferably by injection. For example, one or more immunizations may be performed between 1 and 14 days before mating, during the gestation period of mice, or after the birth of the pups. In some embodiments, one or more pre-immunizations are performed between 1 and 14 days before mating.

[0084] In certain methods of the invention, maternal, fetal and / or neonatal anti-HPA-1a antibody titers are measured. Antibody titers can be measured in samples from adult mice, neonatal mice, or fetal mice. Antibody titers can be measured by known methods, including chemiluminescent microparticle immunoassay (CMIA), enzyme immunoassay (EIA), radioimmunoassay (RIA), fluorescence activated cell sorting (FACS), lateral flow chromatography, enzyme-linked immunosorbent assay (ELISA), etc. For example, antibody titers can be measured by coating a suitable antigen (e.g., HPA-1a) containing a label onto a surface (e.g., beads, microplates, or microparticles), reacting the antigen with the sample to be analyzed, and then measuring the intensity of the label. Indirect immunoassays can also be used. In one embodiment, antibody titers are measured using a single antigen bead assay. In one embodiment, antibody titers are expressed as mean fluorescence intensity (MFI) values.

[0085] According to the screening assay, antibody titer can be assessed at one or more time points. For example, antibody titer can be measured between 1 to 14 days before female mice mating, between 1 to 24 days after mating, and / or between 1 to 28 days postpartum. For example, antibody titer can be measured immediately after childbirth, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 hours after childbirth, and / or 1, 2, 3, 4, 5 and / or 6 days after childbirth, and / or 1, 2, 3 and / or 4 days after childbirth. For example, the antibody titer of the fetus can be measured at the 10th, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 and / or 22 days of pregnancy. In some embodiments, antibody titers are measured in adult, neonatal or fetal mice at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 20, 24, 30, 36, 42 and / or 48 hours, and / or 1, 2, 3, 4, 5 and / or 6 days, and / or 1, 2, 3 or 4 weeks after administration of the candidate molecule to the mother.

[0086] In some methods of the present invention, the fetus or neonate platelet count in the blood collected from the fetus of dissection or from the neonate is measured. Platelet count can be manually calculated using a hemocytometer, or can be measured by an automated method using, for example, optical light scattering / fluorescence analysis, flow cytometry or impedance analysis. According to screening assays, platelet count can be determined at one or more time points. For example, it can be immediately after delivery, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 hours after delivery, and / or 1, 2, 3, 4, 5 and / or 6 days after delivery, and / or 1, 2, 3 and / or 4 days after delivery to measure the platelet count of a neonate cub. For example, the platelet count of a fetus can be measured at the 10th, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 and / or 22 days of pregnancy. In some embodiments, the platelet count of the fetus or neonatal pup is measured at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 20, 24, 30, 36, 42 and / or 48 hours, and / or 1, 2, 3, 4, 5 and / or 6 days, and / or 1, 2, 3 or 4 weeks after administration of the candidate molecule to the mother.

[0087] In some aspects of the invention, a fetus or newborn is assessed for bleeding. "Hemorrhage" as used herein means the accumulation of blood in the body cavity, limbs, or skull of a fetus or newborn. In one embodiment, the hemorrhage is an intracranial hemorrhage. The hemorrhage can be visually assessed in a dissected fetus or newborn.

[0088] Assessment protocols can be determined by one skilled in the art, such as measurement of antibody titers, platelet counts, bleeding, etc., and can be determined empirically, depending on the candidate molecule and the particular effect for which it is being screened.

[0089] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention applies. All definitions defined and used herein should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or the ordinary meanings of the defined terms.

[0090] All references, patents and patent applications disclosed herein are incorporated by reference into each cited subject, and in some cases, the subject can cover the entire content of the entire file. In addition, any manufacturer's instructions or catalogues of any product quoted or mentioned herein are incorporated by reference. The documents incorporated by reference into this article or any teaching therein can be used in the practice of the present invention. The documents incorporated by reference into this article are not recognized as prior art.

[0091] The indefinite articles "a" and "an" as used in the specification and claims should be understood to mean "at least one" unless explicitly stated otherwise.

[0092] The phrase "and / or" used herein in the specification and claims should be understood to mean "either or both" of the elements so combined, i.e., the elements are present jointly in some cases and separately in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner, i.e., "one or more" of the elements so combined. In addition to the elements specifically indicated by the "and / or" clause, other elements may optionally be present, whether related or unrelated to those specifically indicated. Thus, as a non-limiting example, when used in conjunction with an open language such as "comprising", a reference to "A and / or B" may refer to only A (optionally including elements other than B) in one embodiment; may refer to only B (optionally including elements other than A) in another embodiment; may refer to both A and B (optionally including other elements) in yet another embodiment, etc.

[0093] As used in the specification and claims herein, "or" should be understood to have the same meaning as "and / or" defined above. For example, when separating items in a list, "or" or "and / or" should be understood to be inclusive, i.e., including at least one, and also including more than one several or a series of elements, and optionally other unlisted items. Only when the opposite term (such as "only one" or "just one") is clearly expressed or when used in the claims, "consisting of..." will refer to including exactly one element in several or a series of elements. In general, the term "or" used herein should only be understood to represent exclusive alternatives (i.e., "one or the other, but not two") before exclusive terms such as "any", "one of", "only one" or "just one". When used in the claims, "consisting essentially of..." should have the common meaning used in the field of patent law.

[0094] Whenever an embodiment is described with the wording "comprising," other similar embodiments described with the terms "consisting of" and / or "consisting essentially of" are included.

[0095] As used herein, the terms "about" or "approximately" with respect to a number generally include numbers within 5% in either direction (greater or less than) of that number unless otherwise stated or obvious from the context (unless such a number exceeds 100% of possible values).

[0096] Numerical ranges include the numbers that define the range, and any single value provided herein can be used as the endpoint of a range that includes other single values ​​provided herein. For example, a set of values ​​(such as 1, 2, 3, 8, 9, and 10) is also a disclosure of numerical ranges such as 1-10, 1-8, 3-9. Similarly, the disclosed range is a disclosure of each single value covered by the range. For example, the range of 5-10 is also a disclosure of 5, 6, 7, 8, 9, and 10.

[0097] The invention has been described in terms of one or more preferred embodiments, and it should be understood that numerous equivalents, substitutions, variations and modifications, aside from those explicitly stated, are possible and within the scope of the invention.

[0098] Example

[0099] Example 1

[0100] Embodiments described herein demonstrate the generation of a mouse model of FNAIT using CRISPR / Cas9-mediated homology-directed repair. Specifically, this embodiment demonstrates the generation of transgenic mice comprising T30A, S32P, Q33L, N39D and M470Q mutations relative to SEQ ID NO: 25 in GPIIIa.

[0101] Materials and methods

[0102] Antibodies - This study used antibodies against Leu of human GPIIIa 33 Three antibodies specific for allelic isoforms: mouse monoclonal antibody (mAb) SZ21 20 、Human mAb 26.4 21 (derived from immortalized B cells from an HPA-1a alloimmunized woman whose infant had FNAIT), and B2G1 22 (Humanized IgG, derived from a scFv fragment isolated by phage display from an HPA-1a alloimmunized woman.) Human maternal anti-HPA-1a antiserum was provided by Drs. Richard Aster, Dan Bougie, and Brian Curtis (Blood Research Institute, Blood Center of Wisconsin, Milwaukee, WI). Murine mAb PSIB1, binds to both human and mouse β3 integrin PSI domains, and its binding is not affected by the Leu33Pro polymorphism 23 , kindly provided by Dr. Heyu Ni (University of Toronto). Recognizes a complex-dependent epitope on GPIIb-IIIa but does not interfere with HPA-1a antibody binding 24 mAb AP2 was provided by Dr. Robert Montgomery (Blood Research Institute, Blood Center of Wisconsin).

[0103] One-step generation of mice expressing an APLD humanized form of murine GPIIIa-gRNA was designed using the CRISPR design tool (crispr.mit.edu) to minimize off-target effects and selected before the 5′-NGG protospacer adjacent motif (PAM). To generate a vector co-expressing Cas9 and a sgRNA targeting ITGB3 exon 3 (TTCTCCTTCAGGTTACATCG, SEQ ID NO: 1), a pair of oligonucleotides (5′-CACCGTTCTCCTTCAGGTTACATCG-3′ (SEQ ID NO: 2) and 5′-AAACCGATGTAACCTGAAGGAGAAC-3′ (SEQ ID NO: 3)) were annealed and cloned into the BbsI site of the Cas9 expression plasmid px459 (Addgene, Cambridge, MA). A single-stranded oligodeoxynucleotide (ssODN) 200 nucleotides in length having the sequence 5'-GCCAGGGGGAGGTGACTTACCAGGCAGGAGGCACAGCCGCCCTAGCTCTG-ATGTTGACCTTTCCCTCGGGCTCTTCTCTTCATAGGCCTTGCCTCTGGGATCCCCACGCTGTGACCTGAAGGAGAACCTGCTGAAGGACAATTGTGCTCCAGAGTCTATTGAGTTCCCAGTCAGTGAGGCCCAGATCCTGGAGGCTAGGC-3' (SEQ ID NO:4) was synthesized by Integrated DNA Technologies (IDT, Coralville, IA). This oligonucleotide corresponds to the antisense strand of the mouse β3 gene and contains 5 nucleotide substitutions, resulting in the introduction of 4 human amino acid substitutions in the PSI domain of the mouse β3 integrin subunit. The ssODN also contained four silent mutations, two of which introduced a diagnostic BamH1 restriction site into the plasmid and two mutated sequences to avoid repetitive digestion of the humanized murine β3 gene by Cas9.

[0104] C57BL / 6N female mice were superovulated and mated with C57BL / 6N male mice, and fertilized eggs were collected from the oviduct. The px459 plasmid (10ng / μl) and ssODN (5ng / μl) were injected into the pronucleus of the fertilized oocyte. The injected fertilized eggs were cultured overnight at 37°C in 5% CO2 and 95% humidified air in a single potassium optimized medium (KSOM) containing amino acids. The two-cell stage embryos were then transferred to the oviduct of pseudopregnant female mice. The genomic DNA separated from the tail of the pups was genotyped by PCR and subsequent sequence analysis. The region around the target locus was amplified using GPIIIa fw1:5′-AACCATGGAAGGACCATGAC-3′ (SEQ ID NO: 5) and GPIIIa rev1:5′-CACCCCAGTCCTATCCTG-TG-3′ (SEQ ID NO: 6). PCR reactions were performed using Herculase II Fusion Polymerase (Agilent, Waldbronn, Germany). PCR products were purified using QiaQuick spin columns, digested with BamHI (New England Biolabs Inc., Ipswich, MA), analyzed on a 2% agarose gel, and sequenced to confirm that DNA double-strand breaks had been accurately repaired.

[0105] One-step generation of mice expressing an APLDQ humanized form of murine GPIIIa - A CRISPR / Cas9 microinjection cocktail including gRNA (CTCCTCAGAGCACTCACACA, (SEQ ID NO: 7)), ssODN 5'-AGCCTTCCAGCCCACGCTGCAACAATGGGAACGGGACTTTTGAGTGTGGGGTGTGCCGCTGTGACCAGGGCTGGCTGGGGTCCCAATGCGAGTGCTCTGAGGAGGATTACCGACCCTCTCAGCAGGAAGAGTGCAGCCCCAAGGAGGGCCAGCCCATCTGCAGCCA-3' (SEQ ID NO: 8) and Cas-9 protein was injected into the cytoplasm of fertilized APLD GPIIIa oocytes ( Figures 6A-6D ). Microinjected mice were screened for the presence of the desired point mutation by PCR and subsequent sequencing analysis. The region surrounding the target locus was amplified using GPIIIafw2: 5'-GAGAAGGAGCAGTCTTTCACTATCAAGCC-3' (SEQ ID NO: 9) and GPIIIarev2: 5'-GCAGGAGAAGTCATCGCACTCAC-3' (SEQ ID NO: 10).

[0106] Introduction of amino acid substitutions into mouse and human GPIIIa plasmids - the cDNA expression vector encoding mouse GPIIIa, pCMV3-mouse ITGB3, was purchased from Creative Biogene (Shirley, NY). Nucleotide substitutions were introduced into the plasmid using the Quick-Change site-directed mutagenesis kit (Stratagene, La Jolla, CA) to convert to T 30 →A, S 32 →P, Q 33 →L and N 39 →D, generate a plasmid encoding mouse GPIIIa (containing a fully humanized PSI domain, called APLD mouse GPIIIa). Use this as a template to encode M in the mouse EGF1 domain. 470 and P 446 , respectively, introducing additional mutations into the codons of 470 and H 446 , and the resulting constructs were called APLDQ, APLDH, and APLDQH. 463 P 464 →DQ, H 446 →P and Q 470 →M mutation was introduced into the human ITGB3 expression vector pcDNA3-human ITGB3 to generate a plasmid encoding human GPIIIa, which has a D in the human EGF1 domain. 463 Q 464 , P 446 or M 470 The primers used to introduce these mutations are listed in Table 1. All constructs and mutations were confirmed by nucleotide sequencing.

[0107] Table 1: Oligonucleotide primers used for site-directed mutagenesis

[0108]

[0109]

[0110] The altered sequences are indicated in bold.

[0111] Expression of wild-type and mutant αllbβ3 isoforms - HEK 293FT cells were transfected with plasmids encoding human αIIb together with plasmids encoding wild-type or mutant mouse or human GPIIIa. One day before transfection, HEK 293FT cells were grown in 6-well plates in DMEM containing 10% FBS but without antibiotics to obtain 80%-90% confluency at the time of transfection. Cells were transfected with 1 μg of each plasmid in 250 μL Opti-MEM I reduced serum medium and 5 μL Lipofectamine 2000 (Invitrogen). After transfection, cells were grown at 37°C for another 48 hours to allow protein expression.

[0112] Flow cytometry - Flow cytometric analysis of antibodies bound to transiently transfected HEK293 cells was performed 48 hours after transfection using a FACSCanto II or Accuri C6 flow cytometer (BD Biosciences). Untransfected cells were used as negative controls. Antibody binding was detected using FITC-labeled goat (Fab')2 anti-human IgG, FITC-labeled goat (Fab')2 anti-mouse IgG, where appropriate. Data were analyzed using FlowJo software (Tree Star Inc., Ashland, OR).

[0113] Inhibition of PAC-1 binding to human α by anti-HPA-1a alloantibodies IIb Binding of αIIbβ3 - HEK293FT cells were transfected with wild-type human αIIbβ3 plus EGFP. Cells were preincubated with mAbs SZ21, B2G1, or 26.4 (at 2.5 μg / ml), or with purified total IgG from normal control, PTP, or FNAIT samples (at a 1:50 dilution) for 30 min at room temperature before addition of 0.2 mM Ca +2 and 2 mM Mn +2 The cells were then incubated for an additional 30 min after addition of 2.5 μg / ml PAC-1. The cells were stained with mouse mAb AP3 to detect total β3 surface expression to normalize binding and competition data. EGFP-positive cells were analyzed by flow cytometry after staining with Alexa Fluor 647-conjugated goat anti-mouse IgM (for PAC-1) or Alexa Fluor 647-conjugated goat anti-mouse IgG (for AP3). The mean fluorescence intensity (MFI) of PAC-1 binding was normalized to β3 expression and expressed as a percentage of the control in the absence of anti-HPA-1a isotype antibody.

[0114] Improved antigen capture ELISA - 8 × 10 7Washed human or mouse platelets were incubated with human FNAIT isotype antiserum (diluted 1:5) at room temperature for 1 hour, washed, and then lysed in 200 μl of ice-cold lysis buffer [20 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1 mM ethylenediaminetetraacetic acid, 10 mM N-ethylmaleimide] containing a protease inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA). The lysate was added to microtiter wells coated with anti-mouse CD41 (eBioscience, San Diego, CA) to capture immune complexes from mouse platelets, or mAb AP2 to capture immune complexes from human platelets. Bound immune complexes were detected using alkaline phosphatase-conjugated anti-human IgG (Jackson ImmunoResearch Laboratories, West Grove, PA).

[0115] Molecular modeling and docking - generation of models of the B2G1 Fab variable region using the Rosetta Antibody Protocol 25-29。 The ClusPro protein-protein docking server was used to dock the 30 The crystal structure of the PSI and I-EGF1 domains (PDB code: 3FCS) was docked into the CDR loop region of the antibody B2G1 31-35 Residues A30, P32, and L33 were defined as the docking site for integrin β3. Non-complementarity determining regions were automatically masked using the “Antibody mode” 36 .

[0116] Statistical Analysis—Data are shown as mean ± SEM. Statistical comparisons were performed using an unpaired two-tailed Student's t-test. Differences were considered statistically significant at P < 0.05.

[0117] result

[0118] Reconstruction of the HPA-1a epitope in the PSI domain of mouse platelet GPIIIa Figure 1A-1B As shown in Figure 2A, the polymorphic amino acid Leu 33 It is located at the end of a long flexible loop extending from the PSI domain of GPIIIa. Previous studies incorporating a series of amino acid substitutions into a small construct consisting of murine GPIIIa N-terminal residues 1-66 demonstrated the need for humanized T30 A 、S32 P 、Q33 L and N39 D(as shown in Figure 2A) to reconstitute the binding of the type I HPA-1a selective mAb SZ21 to at least several human polyclonal anti-HPA-1a alloantisera 37 Based on these data, a CRISPR strategy was designed (Figure 2B) to introduce a repair template into exon 3 of the murine ITGB3 locus, which encodes these four amino acid substitutions. From 60 fertilized eggs microinjected with plasmid constructs encoding the gRNA, Cas9 endonuclease, and APLD HDR template shown in Figure 2B (Figure 2C), one female offspring gave the appropriate confirmed genotype (Figures 2D-2F) and was named APLD mouse.

[0119] Specific amino acids within the EGF1 domain of GPIIIa are required to support binding of type II HPA-1a antibodies - previous studies have shown that immune responses to HPA-1a are polyclonal and heterogeneous, requiring some isogenic antisera containing subsets, and that in addition to the polymorphic amino acid 33, discontinuous sequences within the region of the EGF1 domain to be characterized that are linearly distant are required 19，38 As shown in Figure 3A, the prototype type I HPA-1a-specific mAb SZ21 readily bound to APLD but not to wild-type murine GPIIIa (muGPIIIa), confirming the reconstruction of its epitope within the murine PSI domain. To gain further insight into the structural requirements necessary for binding of the antibody population that may be present in the more complex polyclonal human maternal anti-HPA-1a alloantisera, we examined the ability of five different human FNAIT alloantisera to bind to muGPIIIa, APLD muGPIIIa, or human GPIIIa immobilized in microtiter wells. As shown in Figure 3B, three of the five representative alloantisera reacted with APLD muGPIIIa, while the other two did not, consistent with the fact that these alloantisera contained a large number of so-called type II anti-HPA-1a alloantibodies that require residues outside the humanized PSI domain for binding. 19 The reactivity and specificity of other human anti-HPA-1a alloantisera are consistent with the concept of Figure 7 shown.

[0120] To determine the structural requirements for type II anti-HPA-1a antibody binding, we tested the binding of the prototype type II antibody mAb 26.4 to murine APLD platelets. As shown in Figure 4A, similar to human alloantisera 1 and 5 in Figure 3B, mAb 26.4 was unable to bind to murine platelets expressing APLD GPIIIa. Close inspection of the interface between the PSI and EGF1 domains (Figure 4B) revealed that a loop extending from the EGF1 domain of human GPIIIa binds amino acids Q 470 Leu 33This residue is the methionine (Ser 469 is conserved in both species). To determine Q 470 To determine whether it forms part of the epitope recognized by type II anti-HPA-1a antibodies, starting from our APLD mice, we further improved the sequence of murine GPIIIa by introducing HDR that would change M470→Q in the murine EGF1 domain (see Methods). mAb 26.4 now readily binds to platelets from the second generation of HPA-1a humanized transgenic mice, which we named APLD Q mice (Fig. 4A). In contrast, binding of mAb SZ21 was not enhanced by additional humanization of the EGF1 domain, consistent with its classification as a type I antibody with the epitope contained entirely within the PSI domain. Unexpectedly, platelets from APLDQ mice did not react at all with an HPA-1a-specific mAb (termed B2G1) isolated by phage display from HPA-1a alloimmunized women. 22 , demonstrating an additional unexpected complexity in antibody subpopulation specificity that may exist in the polyclonal maternal anti-HPA-1a alloantisera.

[0121] Figure 5A highlights the amino acid differences between the mouse and human PSI and EGF1 domains of GPIIIa. As shown, in addition to the Q470M difference, which is spatially close to the polymorphic residue 33, there are six additional amino acid differences in EGF1 between the two species. Molecular docking analysis of B2G1 with the EGF1 and PSI domains of GPIIIa (Figure 5B) revealed that of these seven amino acids, only H 446 and Q 470 Together with L 33 Together they are located at the antibody / antigen interface. Therefore, the expression of the APLDQ isoform of mouse GPIIIa carries an additional Pro 446 →His amino acid substitutions support B2G1 binding. In contrast, substitutions of human H 446 leads to a complete loss of B2G1 binding, whereas if Q 470 Substitution of the methionine residues resulted in both B2G1 and mAb 26.4 losing reactivity with human GPIIIa. In contrast, no HPA-1a-specific antibodies were affected by the G463D and P464Q mutations (Fig. 5C), consistent with their absence from the antibody / antigen interface (Fig. 5B). Taken together, these data demonstrate that a variable number of spatially proximal non-polymorphic amino acids form multiple epitopes, each centered around polymorphic residue 33, which together comprise the target recognition site recognized by a subset of polyclonal antibodies present in anti-HPA-1a antisera.

[0122] discuss

[0123] Early studies aimed at characterizing the molecular nature of the HPA-1a epitope found that trypsin or chymotrypsin proteolytic fragments of GPIIIa (size ranged from 17 kDa to 39 to 66 kDa 40 ) can bind to HPA-1a specific alloantibodies. Later studies by Beer and Coller 41 The 66 kDa polypeptide was found to be composed of a 17 kDa amino-terminal fragment of GPIIIa (now known to contain the PSI domain) disulfide-bonded to a larger 50 kDa fragment containing residues 348-654 (now known to contain the EGF1 domain). 13，14 Subsequently, a small synthetic peptide surrounding this polymorphic residue was synthesized, but it was unable to bind to HPA-1a alloantibodies. 42 , probably due to the inability of the linear peptide to fold and adopt a suitable tertiary conformation, since 7 cysteine ​​residues in the first 55 amino acids of GPIIIa form a complex disulfide-bonded knot-like structure. Interestingly, a slightly larger recombinant protein consisting of the first 66 amino acids of GPIIIa (i.e., the complete PSI domain) produced in prokaryotic λgt22 phage plaques was able to react with four different anti-HPA-1a sera from PTP patients. 43 , thereby localizing the HPA-1a epitope to the amino-terminal 7 kDa of GPIIIa around the polymorphic amino acid 33.

[0124] Two studies published in the mid-1990s suggested that the HPA-1 epitopes recognized by a subset of HPA-1a antibodies might be more complex. Valentin et al used site-directed mutagenesis to disrupt the disulfide bond connecting the PSI domain of GPIIIa to the EGF1 domain and found that although some anti-HPA-1a isoantibodies continued to bind well, nearly a third of the antibodies had lost some or all reactivity with the mutant protein. 19 Based on these findings, the authors proposed that HPA-1a antibodies can be classified as either type I or type II based on their dependence on noncontiguous linear sequences present in the PSI and EGF1 domains. Stafford and colleagues 44 This concept is supported by the findings of Honda et al., who found that approximately 20% of 121 maternal anti-HPA-1a alloantibodies reacted only with recombinant fragments of GPIIIa when they contained both the PSI and EGF1 domains. 38The presence of type II antibodies was detected, which reacted with chimeric proteins consisting of Xenopus GPIIIa molecules containing various fragments of the human GPIIIa sequence only when the Xenopus protein contained human amino acids 26-38 and amino acids 287-490.

[0125] Epitopes from an antibody perspective: HPA-1a antibody titers alone were found not always to correlate with the severity of clinical outcomes 45，46 , and additionally classified HPA-1a-specific alloantibodies into type I and type II, which disappointingly provided neither diagnostic nor prognostic advantages 44 However, recently, Santoso and colleagues reported that a specific population of anti-HPA-1a alloantibodies preferentially binds to GPIIIa when complexed with the integrin subunit αv (rather than αIIb) present on endothelial cells and that such antibodies are strongly associated with the development of intracranial hemorrhage in FNAIT. 47 . These findings have several important implications. First, these findings strongly suggest that identifying and distinguishing distinct populations of anti-HPA-1a antibodies consistently present in all maternal polyclonal anti-HPA-1a antisera may be key to predicting thrombocytopenia and bleeding risk in FNAIT cases. Second, these findings demonstrate that the influence of local conformation around polymorphic amino acid residue 33 has a profound impact on determining the core target recognition site for alloantibody binding and its subsequent effector outcomes. We found that binding of two different type II monoclonal anti-HPA-1a antibodies can be distinguished from each other by their requirements for different amino acids within the EGF1 domain of GPIIIa ( Figures 5A-5C ), further supporting the notion that antibody / epitope recognition involves more than just polymorphic amino acids and may vary between antibody subsets that comprise virtually any alloimmune response. Mapping of polyclonal immune responses against HPA-1a using cells expressing mouse GPIIIa (containing specific mouse→human amino acid substitutions), together with the increasing number of HPA-1a-specific monoclonal antibodies, may allow for high-resolution analysis of alloantibody subsets, providing predictive diagnostic benefit. Interestingly, preliminary studies ( Figure 8 ) showed that type I and type II alloantibody populations had distinct effects on the ability of platelets to interact with their ligands. Although type I antibodies had minimal effects, type II antibodies significantly blocked the binding of the fibrinogen mimetic PAC-1 to the GPIIb-IIIa complex, likely by inhibiting the extension of GPIIIa during integrin activation. 48 Additional research in this area is the subject of extensively planned clinical studies.

[0126] Individual antibody populations within a given polyclonal serum have different surface morphology requirements, explaining why they are able to induce different pathophysiological effects. In the field of histocompatibility testing, there is increasing evidence that, in addition to genotypic matching of cell surface antigens, phenotypic determination of the recipient antibody / epitope repertoire, including those epitopes presented by residues clustered together at discrete positions on the molecular surface, may be an important predictor of transplant success. 49 Structure-based matching has been validated as a strategy to improve platelet transfusion support in patients with refractory thrombocytopenia 50，51 Therefore, precise medically based diagnostic protocols will be needed that take into account not only polymorphic differences but also the contact area of ​​alloantibody subpopulations in order to provide a more precise dissection of the polyclonal nature of the immune response and thus more accurately predict the risk of thrombocytopenia, bleeding, and intracranial hemorrhage.

[0127] The polyclonal nature of the response generated by the clinically important Leu33Pro polymorphism in GPIIIa is complex and remains a fascinating area of ​​research with implications for both prevention and treatment. Given the polyclonal nature of HPA-1-specific antibodies and the likelihood that any maternal antiserum contains antibodies from different angles to the polymorphic amino acid 33 and that bind with different morphological distributions and different affinities due to the involvement of additional residues, we suspect that a cocktail of HPA-1-specific mAbs, rather than any single mAb, may be required to block binding of polyclonal maternal antibodies and prevent clearance of fetal platelets from the circulation. 446 and Q 470 ) is necessary and sufficient for binding of type II anti-HPA-1a alloantibodies, which does not exclude the possibility that residues within or outside of EGF1 may be required to support binding of type II alloantibodies that remain to be characterized. For example, D within the PSI domain has been reported to 39 and R at the hybrid / PSI interface 93 Both affect the binding of human anti-HPA-1a antibodies 37，52 , whereas other antibodies are specific for the bent conformation of integrins, probably due to their requirement for both the PSI and EGF1 domains, as described in this study. 53 Our atomic-level dissection demonstrates the presence of increasingly broad antibody subsets within the allosera of HPA-1a alloimmunized individuals, highlighting the challenge of developing single agents with narrow epitope specificity to inhibit alloantibody-mediated platelet destruction. Prophylactic delivery of humanized anti-HPA-1a-specific mAbs introduced into the maternal circulation during pregnancy or shortly after delivery could be used to clear neonatal platelets that have passed through the mother's body, thereby preventing or mitigating the development of alloimmune responses in the first place.

[0128] Example 2

[0129] Intraperitoneal injection of anti-HPA-1a mAb induced severe thrombocytopenia in APLDQ mice but not in wild-type mice. Furthermore, when platelets from APLDQ mice were introduced into wild-type mice, they elicited a strong polyclonal immune response that was specific for, and importantly limited to, the epitopes generated by these humanized residues, demonstrating that the APLDQ humanized form of murine GPIIIa is immunogenic in mice. Wild-type female mice preimmunized with APLDQ platelets and mated with APLDQ male mice gave birth to severely thrombocytopenic pups, many of which displayed a concomitant bleeding phenotype ( Fig.11 and Figures 12A-12D However, mAb 26.4 effectively inhibited the binding of mouse polyclonal anti-APLDQ antibody to mouse APLDQ platelets ( Fig.13 ).

[0130] IVIG (intravenous immunoglobulin) is a highly purified globulin preparation obtained from the pooled plasma of 1000 to 15,000 healthy donors per batch. IVIG targets cellular immune compartments at multiple levels, including innate and adaptive immune cells. IVIG interacts primarily with dendritic cells, macrophages, and granulocytes by activating and inhibiting FcγRs. The first case of maternal IVIG infusion for the treatment of FNAIT was reported in 1988 (Bussel JB et al., New Engl J Med. 1988; 319(21): 1374-8), after which IVIG quickly became the standard antenatal treatment strategy for FNAIT. A recent systematic review showed that weekly IVIG administration, with or without the addition of corticosteroids, is the first-line antenatal management of FNAIT and helps reduce or mitigate the effects of FNAIT on the infant and reduce the severity of thrombocytopenia (Dian Winkelhorst et al. BLOOD. 2017; 129(11): 1538-1547).

[0131] Intravenous administration of immunoglobulin G (IVIG) or mAb 26.4 to pregnant female mice on days 10 and 17 post coitum reduced the concentration of anti-APLDQ alloantibodies in the maternal and fetal circulation and, importantly, normalized platelet counts in pups ( Fig.14 and Fig.15 ). In summary, these data establish a novel murine model of FNAIT that recapitulates many clinically important features of FNAIT.

[0132] References

[0133] 1.Newman PJ,McFarland JG,Aster RH.The AlloimmuneThrombocytopenias.In:Loscalzo J,Schafer AI,eds.Thrombosis and Hemorrhage:Lippincott Williams and Wilkins;2003:441-456.

[0134] 2.Williamson LM,Hackett G,Rennie J,et al.The natural history offetomatemal alloimmunization to the platelet-specific antigen HPA-la(PlAl,Zwa)as detefmined by antenatal screening.Blood.1998;92(7):2280-2287.

[0135] 3.Kjeldsen-Kragh J,Killie MK,Tomter G,et al.A screening andintervention program aimed to reduce mortality and serious morbidityassociated with severe neonatal alloimmune thrombocytopenia.Blood.2007;110(3):833-839.

[0136] 4.Bussel J.Diagnosis and management of the fetus and neonate withalloimmune thrombocytopenia.J Thromb Haemost.2009;7Suppl 1:253-257.

[0137] 5.Giovangrandi Y,Daffos F,Kaplan C,Forestier F,Mac AJ,Moirot M.Veryearly intracranial haemorrhage in alloimmune fetalthrombocytopenia.Lancet.1990;336(8710):310.

[0138] 6.Mueller-Eckhardt C,Kiefel V,Grubert A,et al.348cases of suspectedneonatal alloimmune thrombocytopenia.Lancet.1989;1:363-366.

[0139] 7.Bonacossa IA,Jocelyn LJ.Alloimmune thrombocytopenia of the newborn:neurodevelopmental sequelaa.Am J Perinatol.1996;13(4):211-215.

[0140] 8.Dreyfus M,Kaplan C,Verdy E,Schlegel N,Durand-Zaleski I,TcherniaG.Frequency of immune thrombocytopenia in newborns:a prospective study.ImmuneThrombocytopenia Working Group.Blood.1997;89(12):4402-4406.

[0141] 9.Spencer JA,BurowS RF.Feto-maternal alloimmune thrombocytopenia:aliterature review and statistical analysis.Aust N ZJ Obstet Gynaecol.2001;41(1):45-55.

[0142] 10.Turner ML,Bessos H,Fagge T,et al.Prospective epidemiologic studyof the outcome and cost-efffectiveness of antenatal screening to derectneonatal alloimmune thrombocytopenia due to anti-HPA-1a.Transfusion.2005;45(12):1945-1956.

[0143] 11.Curtis BR,McFarland JG.Human platelet antigens-2013.Vox Sang.2014;106(2):93-102.

[0144] 12.Davoren A,Curtrtis BR,Aster RH,McFarland JG.Human plateletantigen-specific alloantibodies implicated in 1162 cases of neonatalalloimmune thrombocytopenia.Transfusion.2004;44(8):1220-1225.

[0145] 13.Newman PJ,Derbes RS,Aster RH.The human platelet alloantigens,PlA1and PlA2,are associated with a leucine33 / proline33 amino acid polymorphism inmembrane glycoprotein IIIa,and are distinguishable by DNAtyping.JClinInvest.1989;83:1778-1781.

[0146] 14.Goldberger A,Kolodziej M,Poncz M,Bennett JS,Newman PJ.Effect ofsingle amino acid substitutions on the formation of the PlA and Bakalloantigenic epitopes.Blood.1991;78:681-687.

[0147] 15.Valentin N,Vergracht A,Bignon JD,et al.HLA-DRw52a is involved inalloimmunization against PlA1 antigen.HumImmunol.1990;27:73-79.

[0148] 16.Maslanka K,Yassai M,Gorski J.Molecular identification of T cellsthat respond in a primary bulk culture to a peptide derived from a plateletglycoprotein implicated in neonatal alloimmune thrombocytopenia.JClinInvest.1996;98:1802-1808.

[0149] 17.Ahlen MT,Husebekk A,Killie MK,Skogen B,Stuge TB.T-cell responsesassociated with neonatal alloimmune thrombocytopenia:isolation of HPA-1a-specific,HLA-DRB3*0101-restricted CD4+ T cells.Blood.2009;113(16):3838-3844.

[0150] 18.Xiao T,Takagi J,Coller BS,Wang JH,Springer TA.Structural basis forallostery in integrins and binding to fibrinogen-mimetictherapeutics.Nature.2004;432(7013):59-67.

[0151] 19.Valentin N,Visentin GP,Newman PJ.Involvement of the cysteine-richdomain of glycoprotein IIIa in the expression of the human plateletalloantigen,PlA1:evidence for heterogeneity in the humoralresponse.Blood.1995;85(11):3028-3033.

[0152] 20.Weiss EJ,Goldschmidt-Clermont PJ,Grigoryev D,Jin Y,Kickler TS,BrayPF.A monoclonal antibody(SZ21)specific for platelet GPIIIa distinguishes PlA1from PlA2.Tissue Antigens.1995;46(5):374-381.

[0153] 21.Eksteen M,Tiller H,Averina M,et al.Charaeterization of a humanplatelet antigen-1a-specific monoclonal antibody derived from a B cell from awoman alloimmunized in pregnancy.J Immunol.2015;194(12):5751-5760.

[0154] 22.Griffin HM,Ouwehand WH.A human monoclonal antibody specific forthe leueine-33(PlA1,HPA-1a)form of platelet glycoprotein IIIa from a V genephage display library.Blood.1995;86(12):4430-4436.

[0155] 23.Zhu G,Zhang Q,Reddy EC,et al.The integrin PSI domain has anendogenous thiol isomerase function and is a novel target forantiplatelettherapy.Blood.2017;129(13):1840-1854.

[0156] 24.Pidard D,Montgomery RR,Bennett JS,Kunicki TJ.Interaction of AP-2,amonoclonal antibody specific for the human platelet glycoprotein IIb-IIIacomplex,with intact platelets.JBiolChem.1983;258:12582-12586.

[0157] 25.Sivasubramanian A,Sirear A,Chaudhury S,Gray JJ.Toward high-resolution homology modeling of antibody Fv regions and application toantibody-antigen docking.Proteins.2009;74(2):497-514.

[0158] 26.Marze NA,Lyskov S,Gray JJ.Improved prediction of antibody VL-VHorientation.Protein Eng Des Sel.2016;29(10):409-418.

[0159] 27.Weitzner BD,Gray JJ.Aceurate Structure Prediction of CDR H3 LoopsEnabled by a Novel Structure-Based C-Terminal Constraint.J Immunol.2017;198(1):505-515.

[0160] 28.Weitzner BD,Jeliazkov JR,Lyskov S,et alModeling and docking ofantibody structures with Rosetta.Nat Protoc.2017;12(2):401-416.

[0161] 29.Lyskov S,Chou FC,Conchuir SO,et al.Serverification of molecularmodeling applications:the Rosetta Online Server that Includes Everyone(ROSIE).PLoS One.2013;8(5):e63906.

[0162] 30.Zhu J,Luo BH,Xiao T,Zhang C,Nishida N,Springer TA.Structure of acomplete integrin ectodomain in a physiologic resting state and activationand deactivation by applied forces.Mol Cell.2008;32(6):849-861.

[0163] 31.Comeau SR,Gatchell DW,Vajda S,Camacho CJ.ClusPro:an automateddocking and discrimination method for the prediction of proteincomplexes.Bioinformatics.2004;20(1):45-50.

[0164] 32.Comeau SR,Gatehell DW,Vajda S,Camacho CJ.ClusPro:afully automatedalgorithm for protein-protein docking.Nucleic Acids Res.2004;32(Web Serverissue):W96-99.

[0165] 33.Kozakov D,Brenke R,Comeau SR,Vajda S.PIPER:an FFT-based proteindocking program with pairwise potentials.Proteins.2006;65(2):392-406.

[0166] 34.Kozakov D,Beglov D,Bohnuud T,et al.How good is automated proteindocking?Proteins.2013;81(12):2159-2166.

[0167] 35.Kozakov D,Hall DR,Xia B,et al.The ClusPro web server for protein-protein docking.Nat Protoc.2017;12(2):255-278.

[0168] 36.Brenke R,Hall DR,Chuang GY,et alApplication of asymmetricstatistical potentials to antibody-protein docking.Bioinformatics.2012;28(20):2608-2614.

[0169] 37.Barron-Casella EA,Nebbia G,Rogers OC,King KE,Kickler TS,CasellaJF.Construction of a human platelet alloantigen-1a epitope(s)within murineglycoprotein IIIa:identification of residues critical to the conformation ofthe antibody binding site(s).Blood.1999;93(9):2959-2967.

[0170] 38.Honda S,Honda Y,Bauer B,Ruan C,Kunicki TJ.The impact of three-dimensional structure on the expression of PlA alloantigens on human integrinbeta 3Blood.1995;86(1):234-242.

[0171] 39.Newman PJ,Martin LS,Knipp MA,Kahn RA.Studies on the nature of thehuman platelet alloantigen,PlA1:localization to a 17,000-daltonpolypeptide.MolImmunol.1985;22:719-729.

[0172] 40.Kornecki E,Chung SY,Holt JC,Ciemiewski CS,Tuszynski GP,Niewiarowski S.Identification of PlAl alloantigen domain on a 66kDa proteinderived from glycoprotein IIIa of human platelets.BiochimBiophysActa.1985;818(3):285-290.

[0173] 41.Beer J,Coller BS.Evidence that platelet glycoprotein IIIa has alarge disulfide-bonded loop that is susceptible to proteolyticcleavage.JBiolChem.1989;264:17564-17573.

[0174] 42.Flug F,Espinola R,Liu LX,et al.A 13-met peptide straddling theleucine33 / proline33 polymorphism in glycoprotein IIIa does not define thePlA1 epitope.Blood.1991;77:1964-1969.

[0175] 43.Bowditch RD,Tani PH,Halloran CE,Frelinger AL,III,McMillan R,Ginsberg MH.Localization of a PlA1 epitope to the amino terminal 66 residuesof platelet glycoprotein IIIa.Blood.1992;79:559-562.

[0176] 44.Stafford P,Ghevaert C,Campbell K,et al.Immunologic and structuralanalysi s of eight noval domain-deletion beta3 integrin peptides designed fordetection of HPA-1 antibodies.J Thromb Haemost.2008;6(2):366-375.

[0177] 45.Ghevaert C,Campbell K,Stafford P,et al.HPA-1a antibody potency andbioactivity do not predict severity of fetomatemal alloimmune thrombocytopenia.Transfusion.2007;47(7):1296-1305.

[0178] 46.Killie MK,Husebekk A,Kaplan C,Taaning E,Skogen B.Matemal humanplatelet antigen-la antibody level correlates with the platelet count in thenewborns:a retrospective study.Transfusion.2007;47(1):55-58.

[0179] 47.Santoso S,Wihadmadyatami H,Bakchoul T,et al.Antiendothelialalphavbeta3 Antibodies Are a Major Cause of Intracranial Bleeding in Fetal / Neonatal Alloimmune Thrombocytopenia.Arterioscler Thromb Vasc Biol.2016;36(8):1517-1524.

[0180] 48.Zhou D,Thinn AMM,Zhao Y,Wang Z,Zhu J.Structure of an extendedbeta3 integrin.Blood.2018;132(9):962-972.

[0181] 49.Duquesnoy RJ.The eplet load concept in clinicaltransplantation.Pediatr Transplant.2016;20(7):884-885.

[0182] 50.Duquesnoy RJ.Structural epitope matching for HLA-alloimmunizedthrombocytopenic patients:a new strategy to provide more effective platelettransfusion support?Transfusion.2008;48(2):221-227.

[0183] 51.Brooks EG,MacPherson BR,Fung MK.Validation of HLAMatchmakeralgorithm in identifying acceptable HLA mismatches for thrombocytopenicpatients refractory to platelet transfusions.Transfusion.2008;48(10):2159-2166.

[0184] 52. Watkins NA, Schaffner-Reckinger E, Allen DL, et al. HPA-1a phenotype-genotype discrepancy reveals a naturally occurring Arg93Gln substitution in the platelet beta 3 integrin that disrupts the HpA-1a epitope. Blood. 2002; 99(5): 1833-1839.

[0185] 53. Thinn AMM, Wang Z, Zhou D, Zhao Y, Curtis BR, Zhu J. Autonomousconforrnational regulation of beta3 integrin and the conformation-dependentproperty of HPA-1a alloantibodies. Proc Natl Acad Sci US A. 2018.

[0186] 54. Hod E1, Schwartz J., Platelet transfusion refractoriness Br JHaematol. 2008 Jul; 142(3): 348-60. Epub 2008 May 28. Sequence Listing <110> VERSITI BLOOD RESEARCHINSTITUTE FOUNDATION, INC. Newman, Peter J. H. Zhi (Huiying) <120> A Murine Model of Fetal / Neonatal Alloimmune Thrombocytopenia <130> 160180.00134 <160> 48 <170> PatentIn Version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 1 ttctccttca ggttacatcg 20 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 2 caccgttctc cttcaggtta catcg 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 3 aaaccgatgt aacctgaagg agaac 25 <210> 4 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 4 gccaggggga ggtgacttac caggcaggag gcacagccgc cctagctctg atgttgacct 60 ttccctcggg ctcttctctt cataggcctt gcctctggga tccccacgct gtgacctgaa 120 ggagaacctg ctgaaggaca attgtgctcc agagtctatt gagttcccag tcagtgaggc 180 ccagatcctg gaggctaggc 200 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 5 aaccatggaa ggaccatgac 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 6 caccccagtc ctatcctg 18 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 7 ctcctcagag cactcacaca 20 <210> 8 <211> 166 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 8 agccttccag cccacgctgc aacaatggga acgggacttt tgagtgtggg gtgtgccgct 60 gtgaccaggg ctggctgggg tcccaatgcg agtgctctga ggaggattac cgaccctctc 120 agcaggaaga gtgcagcccc aaggagggcc agcccatctg cagcca 166 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 9 gagaaggagc agtctttcac tatcaagcc 29 <210> 10 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 10 gcaggagaag tcatcgcact cac 23 <210> 11 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 11 gtgctcagat gaggccttgc ctctgggctc accccgatg 39 <210> 12 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 12 catcggggtg agcccagagg caaggcctca tctgagcac 39 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 13 gggctcaccc cgatgtgacc tgaaggagaa cctg 34 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 14 caggttctcc ttcaggtcac atcggggtga gccc 34 <210> 15 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 15 gaccagggct ggctggggtc ccagtgtgag tgctctgagg agg 43 <210> 16 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 16 cctcctcaga gcactcacac tgggacccca gccagccctg gtc 43 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 17 gaccccagcc agccagggcc acagcggcac ac 32 <210> 18 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 18 ggtgtgccgc tgtggccctg gctggctggg gtcc 34 <210> 19 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 19 gggcctggct ggctgggatc catgtgtgag tgctcagagg aggac 45 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 20 gtcctcctct gagcactcac acatggatcc cagccagcca ggccc 45 <210> twenty one <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> twenty one ctgaacctaa tagccctcgc tgcaacaatg g 31 <210> twenty two <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> twenty two ccattgttgc agcgagggct attaggttca g 31 <210> twenty three <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> twenty three gtggggtatg ccgttgtgac cagggctggc tgggatccca g 41 <210> twenty four <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> twenty four ctgggatccc agccagccct ggtcacaacg gcataccccca c 41 <210> 25 <211> 762 <212> PRT <213> House mouse (Mus musculus) <400> 25 Glu Ser Asn Ile Cys Thr Thr Arg Gly Val Asn Ser Cys Gln Gln Cys 1 5 10 15 Leu Ala Val Ser Pro Val Cys Ala Trp Cys Ser Asp Glu Thr Leu Ser 20 25 30 Gln Gly Ser Pro Arg Cys Asn Leu Lys Glu Asn Leu Leu Lys Asp Asn 35 40 45 Cys Ala Pro Glu Ser Ile Glu Phe Pro Val Ser Glu Ala Gln Ile Leu 50 55 60 Glu Ala Arg Pro Leu Ser Ser Lys Gly Ser Gly Ser Ser Ala Gln Ile 65 70 75 80 Thr Gln Val Ser Pro Gln Arg Ile Ala Leu Arg Leu Arg Pro Asp Asp 85 90 95 Ser Lys Ile Phe Ser Leu Gln Val Arg Gln Val Glu Asp Tyr Pro Val 100 105 110 Asp Ile Tyr Tyr Leu Met Asp Leu Ser Phe Ser Met Lys Asp Asp Leu 115 120 125 Ser Ser Ile Gln Thr Leu Gly Thr Lys Leu Ala Ser Gln Met Arg Lys 130 135 140 Leu Thr Ser Asn Leu Arg Ile Gly Phe Gly Ala Phe Val Asp Lys Pro 145 150 155 160 Val Ser Pro Tyr Met Tyr Ile Ser Pro Pro Gln Ala Ile Lys Asn Pro 165 170 175 Cys Tyr Asn Met Lys Asn Ala Cys Leu Pro Met Phe Gly Tyr Lys His 180 185 190 Val Leu Thr Leu Thr Asp Gln Val Ser Arg Phe Asn Glu Glu Val Lys 195 200 205 Lys Gln Ser Val Ser Arg Asn Arg Asp Ala Pro Glu Gly Gly Phe Asp 210 215 220 Ala Ile Met Gln Ala Thr Val Cys Asp Glu Lys Ile Gly Trp Arg Asn 225 230 235 240 Asp Ala Ser His Leu Leu Val Phe Thr Thr Asp Ala Lys Thr His Ile 245 250 255 Ala Leu Asp Gly Arg Leu Ala Gly Ile Val Leu Pro Asn Asp Gly His 260 265 270 Cys His Ile Gly Thr Asp Asn His Tyr Ser Ala Ser Thr Thr Met Asp 275 280 285 Tyr Pro Ser Leu Gly Leu Met Thr Glu Lys Leu Ser Gln Lys Asn Ile 290 295 300 Asn Leu Ile Phe Ala Val Thr Glu Asn Val Val Ser Leu Tyr Gln Asn 305 310 315 320 Tyr Ser Glu Leu Ile Pro Gly Thr Thr Val Gly Val Leu Ser Asp Asp 325 330 335 Ser Ser Asn Val Leu Gln Leu Ile Val Asp Ala Tyr Gly Lys Ile Arg 340 345 350 Ser Lys Val Glu Leu Glu Val Arg Asp Leu Pro Glu Glu Leu Ser Leu 355 360 365 Ser Phe Asn Ala Thr Cys Leu Asn Asn Glu Val Ile Pro Gly Leu Lys 370 375 380 Ser Cys Val Gly Leu Lys Ile Gly Asp Thr Val Ser Phe Ser Ile Glu 385 390 395 400 Ala Lys Val Arg Gly Cys Pro Gln Glu Lys Glu Gln Ser Phe Thr Ile 405 410 415 Lys Pro Val Gly Phe Lys Asp Ser Leu Thr Val Gln Val Thr Phe Asp 420 425 430 Cys Asp Cys Ala Cys Gln Ala Phe Ala Gln Pro Ser Ser Pro Arg Cys 435 440 445 Asn Asn Gly Asn Gly Thr Phe Glu Cys Gly Val Cys Arg Cys Asp Gln 450 455 460 Gly Trp Leu Gly Ser Met Cys Glu Cys Ser Glu Glu Asp Tyr Arg Pro 465 470 475 480 Ser Gln Gln Glu Glu Cys Ser Pro Lys Glu Gly Gln Pro Ile Cys Ser 485 490 495 Gln Arg Gly Glu Cys Leu Cys Gly Gln Cys Val Cys His Ser Ser Asp 500 505 510 Phe Gly Lys Ile Thr Gly Lys Tyr Cys Glu Cys Asp Asp Phe Ser Cys 515 520 525 Val Arg Tyr Lys Gly Glu Met Cys Ser Gly His Gly Gln Cys Asn Cys 530 535 540 Gly Asp Cys Val Cys Asp Ser Asp Trp Thr Gly Tyr Tyr Cys Asn Cys 545 550 555 560 Thr Thr Arg Thr Asp Thr Cys Met Ser Thr Asn Gly Leu Leu Cys Ser 565 570 575 Gly Arg Gly Asn Cys Glu Cys Gly Ser Cys Val Cys Val Gln Pro Gly 580 585 590 Ser Tyr Gly Asp Thr Cys Glu Lys Cys Pro Thr Cys Pro Asp Ala Cys 595 600 605 Ser Phe Lys Lys Glu Cys Val Glu Cys Lys Lys Phe Asn Arg Gly Thr 610 615 620 Leu His Glu Glu Asn Thr Cys Ser Arg Tyr Cys Arg Asp Asp Ile Glu 625 630 635 640 Gln Val Lys Glu Leu Thr Asp Thr Gly Lys Asn Ala Val Asn Cys Thr 645 650 655 Tyr Lys Asn Glu Asp Asp Cys Val Val Arg Phe Gln Tyr Tyr Glu Asp 660 665 670 Thr Ser Gly Arg Ala Val Leu Tyr Val Val Glu Glu Pro Glu Cys Pro 675 680 685 Lys Gly Pro Asp Ile Leu Val Val Leu Leu Ser Val Met Gly Ala Ile 690 695 700 Leu Leu Ile Gly Leu Ala Thr Leu Leu Ile Trp Lys Leu Leu Ile Thr 705 710 715 720 Ile His Asp Arg Lys Glu Phe Ala Lys Phe Glu Glu Glu Arg Ala Arg 725 730 735 Ala Lys Trp Asp Thr Ala Asn Asn Pro Leu Tyr Lys Glu Ala Thr Ser 740 745 750 Thr Phe Thr Asn Ile Thr Tyr Arg Gly Thr 755 760 <210> 26 <211> 762 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 26 Glu Ser Asn Ile Cys Thr Thr Arg Gly Val Asn Ser Cys Gln Gln Cys 1 5 10 15 Leu Ala Val Ser Pro Val Cys Ala Trp Cys Ser Asp Glu Ala Leu Pro 20 25 30 Leu Gly Ser Pro Arg Cys Asp Leu Lys Glu Asn Leu Leu Lys Asp Asn 35 40 45 Cys Ala Pro Glu Ser Ile Glu Phe Pro Val Ser Glu Ala Gln Ile Leu 50 55 60 Glu Ala Arg Pro Leu Ser Ser Lys Gly Ser Gly Ser Ser Ala Gln Ile 65 70 75 80 Thr Gln Val Ser Pro Gln Arg Ile Ala Leu Arg Leu Arg Pro Asp Asp 85 90 95 Ser Lys Ile Phe Ser Leu Gln Val Arg Gln Val Glu Asp Tyr Pro Val 100 105 110 Asp Ile Tyr Tyr Leu Met Asp Leu Ser Phe Ser Met Lys Asp Asp Leu 115 120 125 Ser Ser Ile Gln Thr Leu Gly Thr Lys Leu Ala Ser Gln Met Arg Lys 130 135 140 Leu Thr Ser Asn Leu Arg Ile Gly Phe Gly Ala Phe Val Asp Lys Pro 145 150 155 160 Val Ser Pro Tyr Met Tyr Ile Ser Pro Pro Gln Ala Ile Lys Asn Pro 165 170 175 Cys Tyr Asn Met Lys Asn Ala Cys Leu Pro Met Phe Gly Tyr Lys His 180 185 190 Val Leu Thr Leu Thr Asp Gln Val Ser Arg Phe Asn Glu Glu Val Lys 195 200 205 Lys Gln Ser Val Ser Arg Asn Arg Asp Ala Pro Glu Gly Gly Phe Asp 210 215 220 Ala Ile Met Gln Ala Thr Val Cys Asp Glu Lys Ile Gly Trp Arg Asn 225 230 235 240 Asp Ala Ser His Leu Leu Val Phe Thr Thr Asp Ala Lys Thr His Ile 245 250 255 Ala Leu Asp Gly Arg Leu Ala Gly Ile Val Leu Pro Asn Asp Gly His 260 265 270 Cys His Ile Gly Thr Asp Asn His Tyr Ser Ala Ser Thr Thr Met Asp 275 280 285 Tyr Pro Ser Leu Gly Leu Met Thr Glu Lys Leu Ser Gln Lys Asn Ile 290 295 300 Asn Leu Ile Phe Ala Val Thr Glu Asn Val Val Ser Leu Tyr Gln Asn 305 310 315 320 Tyr Ser Glu Leu Ile Pro Gly Thr Thr Val Gly Val Leu Ser Asp Asp 325 330 335 Ser Ser Asn Val Leu Gln Leu Ile Val Asp Ala Tyr Gly Lys Ile Arg 340 345 350 Ser Lys Val Glu Leu Glu Val Arg Asp Leu Pro Glu Glu Leu Ser Leu 355 360 365 Ser Phe Asn Ala Thr Cys Leu Asn Asn Glu Val Ile Pro Gly Leu Lys 370 375 380 Ser Cys Val Gly Leu Lys Ile Gly Asp Thr Val Ser Phe Ser Ile Glu 385 390 395 400 Ala Lys Val Arg Gly Cys Pro Gln Glu Lys Glu Gln Ser Phe Thr Ile 405 410 415 Lys Pro Val Gly Phe Lys Asp Ser Leu Thr Val Gln Val Thr Phe Asp 420 425 430 Cys Asp Cys Ala Cys Gln Ala Phe Ala Gln Pro Ser Ser Pro Arg Cys 435 440 445 Asn Asn Gly Asn Gly Thr Phe Glu Cys Gly Val Cys Arg Cys Asp Gln 450 455 460 Gly Trp Leu Gly Ser Gln Cys Glu Cys Ser Glu Glu Asp Tyr Arg Pro 465 470 475 480 Ser Gln Gln Glu Glu Cys Ser Pro Lys Glu Gly Gln Pro Ile Cys Ser 485 490 495 Gln Arg Gly Glu Cys Leu Cys Gly Gln Cys Val Cys His Ser Ser Asp 500 505 510 Phe Gly Lys Ile Thr Gly Lys Tyr Cys Glu Cys Asp Asp Phe Ser Cys 515 520 525 Val Arg Tyr Lys Gly Glu Met Cys Ser Gly His Gly Gln Cys Asn Cys 530 535 540 Gly Asp Cys Val Cys Asp Ser Asp Trp Thr Gly Tyr Tyr Cys Asn Cys 545 550 555 560 Thr Thr Arg Thr Asp Thr Cys Met Ser Thr Asn Gly Leu Leu Cys Ser 565 570 575 Gly Arg Gly Asn Cys Glu Cys Gly Ser Cys Val Cys Val Gln Pro Gly 580 585 590 Ser Tyr Gly Asp Thr Cys Glu Lys Cys Pro Thr Cys Pro Asp Ala Cys 595 600 605 Ser Phe Lys Lys Glu Cys Val Glu Cys Lys Lys Phe Asn Arg Gly Thr 610 615 620 Leu His Glu Glu Asn Thr Cys Ser Arg Tyr Cys Arg Asp Asp Ile Glu 625 630 635 640 Gln Val Lys Glu Leu Thr Asp Thr Gly Lys Asn Ala Val Asn Cys Thr 645 650 655 Tyr Lys Asn Glu Asp Asp Cys Val Val Arg Phe Gln Tyr Tyr Glu Asp 660 665 670 Thr Ser Gly Arg Ala Val Leu Tyr Val Val Glu Glu Pro Glu Cys Pro 675 680 685 Lys Gly Pro Asp Ile Leu Val Val Leu Leu Ser Val Met Gly Ala Ile 690 695 700 Leu Leu Ile Gly Leu Ala Thr Leu Leu Ile Trp Lys Leu Leu Ile Thr 705 710 715 720 Ile His Asp Arg Lys Glu Phe Ala Lys Phe Glu Glu Glu Arg Ala Arg 725 730 735 Ala Lys Trp Asp Thr Ala Asn Asn Pro Leu Tyr Lys Glu Ala Thr Ser 740 745 750 Thr Phe Thr Asn Ile Thr Tyr Arg Gly Thr 755 760 <210> 27 <211> 762 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 27 Glu Ser Asn Ile Cys Thr Thr Arg Gly Val Asn Ser Cys Gln Gln Cys 1 5 10 15 Leu Ala Val Ser Pro Met Cys Ala Trp Cys Ser Asp Glu Ala Leu Pro 20 25 30 Leu Gly Ser Pro Arg Cys Asp Leu Lys Glu Asn Leu Leu Lys Asp Asn 35 40 45 Cys Ala Pro Glu Ser Ile Glu Phe Pro Val Ser Glu Ala Gln Ile Leu 50 55 60 Glu Ala Arg Pro Leu Ser Ser Lys Gly Ser Gly Ser Ser Ala Gln Ile 65 70 75 80 Thr Gln Val Ser Pro Gln Arg Ile Ala Leu Arg Leu Arg Pro Asp Asp 85 90 95 Ser Lys Ile Phe Ser Leu Gln Val Arg Gln Val Glu Asp Tyr Pro Val 100 105 110 Asp Ile Tyr Tyr Leu Met Asp Leu Ser Phe Ser Met Lys Asp Asp Leu 115 120 125 Ser Ser Ile Gln Thr Leu Gly Thr Lys Leu Ala Ser Gln Met Arg Lys 130 135 140 Leu Thr Ser Asn Leu Arg Ile Gly Phe Gly Ala Phe Val Asp Lys Pro 145 150 155 160 Val Ser Pro Tyr Met Tyr Ile Ser Pro Pro Gln Ala Ile Lys Asn Pro 165 170 175 Cys Tyr Asn Met Lys Asn Ala Cys Leu Pro Met Phe Gly Tyr Lys His 180 185 190 Val Leu Thr Leu Thr Asp Gln Val Ser Arg Phe Asn Glu Glu Val Lys 195 200 205 Lys Gln Ser Val Ser Arg Asn Arg Asp Ala Pro Glu Gly Gly Phe Asp 210 215 220 Ala Ile Met Gln Ala Thr Val Cys Asp Glu Lys Ile Gly Trp Arg Asn 225 230 235 240 Asp Ala Ser His Leu Leu Val Phe Thr Thr Asp Ala Lys Thr His Ile 245 250 255 Ala Leu Asp Gly Arg Leu Ala Gly Ile Val Leu Pro Asn Asp Gly His 260 265 270 Cys His Ile Gly Thr Asp Asn His Tyr Ser Ala Ser Thr Thr Met Asp 275 280 285 Tyr Pro Ser Leu Gly Leu Met Thr Glu Lys Leu Ser Gln Lys Asn Ile 290 295 300 Asn Leu Ile Phe Ala Val Thr Glu Asn Val Val Ser Leu Tyr Gln Asn 305 310 315 320 Tyr Ser Glu Leu Ile Pro Gly Thr Thr Val Gly Val Leu Ser Asp Asp 325 330 335 Ser Ser Asn Val Leu Gln Leu Ile Val Asp Ala Tyr Gly Lys Ile Arg 340 345 350 Ser Lys Val Glu Leu Glu Val Arg Asp Leu Pro Glu Glu Leu Ser Leu 355 360 365 Ser Phe Asn Ala Thr Cys Leu Asn Asn Glu Val Ile Pro Gly Leu Lys 370 375 380 Ser Cys Val Gly Leu Lys Ile Gly Asp Thr Val Ser Phe Ser Ile Glu 385 390 395 400 Ala Lys Val Arg Gly Cys Pro Gln Glu Lys Glu Gln Ser Phe Thr Ile 405 410 415 Lys Pro Val Gly Phe Lys Asp Ser Leu Thr Val Gln Val Thr Phe Asp 420 425 430 Cys Asp Cys Ala Cys Gln Ala Phe Ala Gln Pro Ser Ser Pro Arg Cys 435 440 445 Asn Asn Gly Asn Gly Thr Phe Glu Cys Gly Val Cys Arg Cys Asp Gln 450 455 460 Gly Trp Leu Gly Ser Gln Cys Glu Cys Ser Glu Glu Asp Tyr Arg Pro 465 470 475 480 Ser Gln Gln Glu Glu Cys Ser Pro Lys Glu Gly Gln Pro Ile Cys Ser 485 490 495 Gln Arg Gly Glu Cys Leu Cys Gly Gln Cys Val Cys His Ser Ser Asp 500 505 510 Phe Gly Lys Ile Thr Gly Lys Tyr Cys Glu Cys Asp Asp Phe Ser Cys 515 520 525 Val Arg Tyr Lys Gly Glu Met Cys Ser Gly His Gly Gln Cys Asn Cys 530 535 540 Gly Asp Cys Val Cys Asp Ser Asp Trp Thr Gly Tyr Tyr Cys Asn Cys 545 550 555 560 Thr Thr Arg Thr Asp Thr Cys Met Ser Thr Asn Gly Leu Leu Cys Ser 565 570 575 Gly Arg Gly Asn Cys Glu Cys Gly Ser Cys Val Cys Val Gln Pro Gly 580 585 590 Ser Tyr Gly Asp Thr Cys Glu Lys Cys Pro Thr Cys Pro Asp Ala Cys 595 600 605 Ser Phe Lys Lys Glu Cys Val Glu Cys Lys Lys Phe Asn Arg Gly Thr 610 615 620 Leu His Glu Glu Asn Thr Cys Ser Arg Tyr Cys Arg Asp Asp Ile Glu 625 630 635 640 Gln Val Lys Glu Leu Thr Asp Thr Gly Lys Asn Ala Val Asn Cys Thr 645 650 655 Tyr Lys Asn Glu Asp Asp Cys Val Val Arg Phe Gln Tyr Tyr Glu Asp 660 665 670 Thr Ser Gly Arg Ala Val Leu Tyr Val Val Glu Glu Pro Glu Cys Pro 675 680 685 Lys Gly Pro Asp Ile Leu Val Val Leu Leu Ser Val Met Gly Ala Ile 690 695 700 Leu Leu Ile Gly Leu Ala Thr Leu Leu Ile Trp Lys Leu Leu Ile Thr 705 710 715 720 Ile His Asp Arg Lys Glu Phe Ala Lys Phe Glu Glu Glu Arg Ala Arg 725 730 735 Ala Lys Trp Asp Thr Ala Asn Asn Pro Leu Tyr Lys Glu Ala Thr Ser 740 745 750 Thr Phe Thr Asn Ile Thr Tyr Arg Gly Thr 755 760 <210> 28 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 28 Met Cys Ala Trp Cys Ser Asp Glu Ala Leu Pro Leu Gly Ser Pro Arg 1 5 10 15 Cys Asp <210> 29 <211> 62 <212> DNA <213> Mus musculus <400> 29 ctcttctctt catagacttt gtctcagggc tcaccccgat gtaacctgaa ggagaacctg 60 ct 62 <210> 30 <211> 62 <212> DNA <213> House mouse (Mus musculus) <400> 30 agcaggttct ccttcaggtt acatcggggt gagccctgag acaaagtcta tgaagagaag 60 ag 62 <210> 31 <211> 10 <212> PRT <213> House mouse (Mus musculus) <400> 31 Thr Leu Ala Gln Gly Ser Pro Arg Cys Asn 1 5 10 <210> 32 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 32 Ala Leu Pro Leu Gly Ser Pro Arg Cys Asp 1 5 10 <210> 33 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 33 aggcgttgcc tctggggatcc ccacgatgtg acc 33 <210> 34 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 34 agactttgtc tcagggctca ccccgatgta acc 33 <210> 35 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 35 aggcgttgcc tctgggatcc ccacgctgtg acc 33 <210> 36 <211> 57 <212> PRT <213> Homo sapiens <400> 36 Gly Pro Asn Ile Cys Thr Thr Arg Gly Val Ser Ser Cys Gln Gln Cys 1 5 10 15 Leu Ala Val Ser Pro Met Cys Ala Trp Cys Ser Asp Glu Ala Leu Pro 20 25 30 Leu Gly Ser Pro Arg Cys Asp Leu Lys Glu Asn Leu Leu Lys Asp Asn 35 40 45 Cys Ala Pro Glu Ser Ile Glu Phe Pro 50 55 <210> 37 <211> 57 <212> PRT <213> House mouse (Mus musculus) <400> 37 Glu Ser Asn Ile Cys Thr Thr Arg Gly Val Asn Ser Cys Gln Gln Cys 1 5 10 15 Leu Ala Val Ser Pro Val Cys Ala Trp Cys Ser Asp Glu Thr Leu Ser 20 25 30 Gln Gly Ser Pro Arg Cys Asn Leu Lys Glu Asn Leu Leu Lys Asp Asn 35 40 45 Cys Ala Pro Glu Ser Ile Glu Phe Pro 50 55 <210> 38 <211> 40 <212> PRT <213> Homo sapiens <400> 38 Cys Asp Cys Ala Cys Gln Ala Gln Ala Glu Pro Asn Ser His Arg Cys 1 5 10 15 Asn Asn Gly Asn Gly Thr Phe Glu Cys Gly Val Cys Arg Cys Gly Pro 20 25 30 Gly Trp Leu Gly Ser Gln Cys Glu 35 40 <210> 39 <211> 40 <212> PRT <213> Mus musculus <400> 39 Cys Asp Cys Ala Cys Gln Ala Phe Ala Gln Pro Ser Ser Pro Arg Cys 1 5 10 15 Asn Asn Gly Asn Gly Thr Phe Glu Cys Gly Val Cys Arg Cys Asp Gln 20 25 30 Gly Trp Leu Gly Ser Met Cys Glu 35 40 <210> 40 <211> 50 <212> DNA <213> House mouse (Mus musculus) <400> 40 ccagggctgg ctggggtcca tgtgtgagtg ctctgaggag gattaccgac 50 <210> 41 <211> 50 <212> DNA <213> House mouse (Mus musculus) <400> 41 gtcggtaatc ctcctcagag cactcacaca tggaccccag ccagccctgg 50 <210> 42 <211> 4 <212> PRT <213> House mouse (Mus musculus) <400> 42 Ser Met Cys Glu 1 <210> 43 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 43 Ser Gln Cys Glu 1 <210> 44 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 44 tcccaatgcg ag 12 <210> 45 <211> 10 <212> PRT <213> House mouse (Mus musculus) <400> 45 Trp Leu Gly Ser Met Cys Glu Cys Ser Glu 1 5 10 <210> 46 <211> 33 <212> DNA <213> House mouse (Mus musculus) <400> 46 gctggctggg gtccatgtgt gagtgctctg agg 33 <210> 47 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 47 Trp Leu Gly Ser Gln Cys Glu Cys Ser Glu 1 5 10 <210> 48 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 48 gctggctggg gtcccaatgc gagtgctctg agg 33

Claims

1. An in vivo screening method for identifying molecules capable of preventing anti-HPA-1a alloimmune responses in female mice, the method comprising measuring anti-HPA-1a antibody titers in test mice; wherein the candidate molecule is administered to the test mice; wherein the test mouse bears pups that are heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) and a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25, and wherein the test mouse is negative for anti-HPA-1a antibodies; and Wherein if the anti-HPA-1a antibody titer of the test mice is undetectable by single antigen bead assay at two weeks postpartum, the candidate molecule is capable of preventing anti-HPA-1a alloimmune response.

2. An in vivo screening method for identifying molecules capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets, the method comprising measuring fetal or neonatal platelet counts in test mice; wherein the candidate molecule is administered to the test mice; wherein the test mice are pregnant with pups that are heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) and variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25; wherein the test mice are immunized before pregnancy with (i) platelets from transgenic mice or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25, wherein the genome of the transgenic mice comprises a variant platelet GPIIIa encoding the mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25; and Wherein if the fetal or neonatal platelet count of the test mouse pups is higher than the fetal or neonatal platelet count of the control mouse pups, then the candidate molecule is capable of inhibiting the binding of anti-HPA-1a alloantibodies to fetal or neonatal platelets.

3. An in vivo screening method for identifying molecules capable of inhibiting the passage of anti-HPA-1a alloantibodies across the placenta of pregnant mice, the method comprising measuring the titer of anti-HPA-1a antibodies in the fetus or neonate of the test mouse; wherein the candidate molecule is administered to the test mice; wherein the test mice are pregnant with pups that are heterozygous for wild-type platelet membrane glycoprotein IIIa (GPIIIa) and variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D, and M470Q relative to SEQ ID NO: 25; wherein the test mice are immunized before pregnancy with (i) platelets from transgenic mice or (ii) a variant GPIIIa comprising mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25, wherein the genome of the transgenic mice comprises a variant platelet GPIIIa encoding the mutations T30A, S32P, Q33L, N39D and M470Q relative to SEQ ID NO: 25; and Wherein if the fetal or neonatal antibody titer of the test mouse pups is lower than the fetal or neonatal antibody titer of the control mouse pups, then the candidate molecule is capable of inhibiting the passage of anti-HPA-1a alloantibodies across the placenta of the pregnant mouse.

4. The method of any one of claims 1 to 3, wherein the candidate molecule is selected from the group consisting of an antibody, a Fv, a F(ab), a F(ab'), a F(ab') 2 and the group consisting of single-stranded forms of any of the foregoing.

Images