Nucleic acid aptamer for specifically recognizing soybean antigen beta-conglycinin

Abstract

This invention provides a nucleic acid aptamer for recognizing soybean antigen β-conglycinin, the aptamer having the nucleotide sequence shown in SEQ ID NO:1. Using the nucleic acid aptamer of this invention not only exhibits good sensitivity and specificity, but also significantly improves the detection efficiency of soybean antigen β-conglycinin and reduces detection costs. Therefore, this method is suitable for batch detection of soybean antigen proteins in soybeans and their deep-processed products in the food and feed industries.

Description

Technical Field

[0001] This invention relates to a nucleic acid aptamer, and more particularly to a nucleic acid aptamer for specifically recognizing the soybean antigen β-conglycinin. Background Technology

[0002] Soybean seeds have a high protein content, typically around 38% in cultivated varieties and up to 50% in wild and semi-wild soybeans. Analyzing their amino acid composition and essential amino acid content, soybean protein is one of the few nutritionally superior alternatives to animal protein. However, soybeans contain various anti-nutritional factors, including trypsin inhibitors, lectins, isoflavones, and soybean antigens. Soybean antigens, in particular, are proteins in soybeans that can cause allergic reactions in humans and young animals, hindering the widespread application of soybean protein in the food and feed industries. Especially in livestock production, young animals such as piglets and calves are prone to allergic reactions such as diarrhea, stunted growth, and intestinal mucosal cell hyperplasia after consuming diets containing soybeans. Therefore, finding accurate, simple, low-cost, and rapid methods for detecting soybean antigen proteins is of significant practical importance for evaluating food and feed safety.

[0003] Existing research indicates that soybean protein is classified into 2S, 7S, 11S, and 15S globulins based on their sedimentation coefficients, with 7S and 11S globulins accounting for approximately 87% of the total soybean protein content. 7S globulins mainly include β-conglycinin, γ-conglycinin, and basic 7S globulin. β-conglycinin is one of the major soybean antigens. β-conglycinin accounts for more than 50% of soybean 7S globulins and is composed of three subunits with different physicochemical properties: α′ (76 kDa), α (72 kDa), and β (54 kDa).

[0004] Currently, the main methods for detecting soybean antigen proteins include SDS-PAGE, enzyme-linked immunosorbent assay (ELISA), Western blotting, and high-performance liquid chromatography (HPLC). SDS-PAGE is only for qualitative analysis, and the results are difficult to replicate. Western blotting offers a certain degree of accuracy, but it is time-consuming and costly, limiting its application in routine production testing. HPLC is time-consuming and the equipment is relatively expensive, making it unsuitable for practical production applications. ELISA, which allows for both qualitative and quantitative analysis, is widely accepted due to its simplicity, speed, and suitability for batch testing. However, it has unavoidable drawbacks: complex antibody serum preparation, incomparability between different laboratories, and low sensitivity and accuracy. Therefore, while all methods possess a certain level of efficiency and sensitivity, their respective limitations are significant, particularly their high cost and time consumption, making them unsuitable for rapid analysis of large quantities of samples in production and unsuitable for large-scale testing in the food and feed industries.

[0005] Hongmin Jia et al. used high performance liquid chromatography to analyze the content of the antigenic epitope Glym 5.0101 in soybean β-conglycinin. Although it has the advantages of high accuracy and batch detection, it is too time-consuming and the instrument is relatively expensive in actual use, making it unsuitable for practical operation.

[0006] Patent CN 104897902 A et al. use an indirect ELISA method with polyclonal antibody serum to analyze the content of soybean β-conglycinin. Although this method has been widely recognized due to its advantages such as simple operation, speed and suitability for batch detection, it also has unavoidable disadvantages: antibody serum needs to be prepared repeatedly, different laboratories cannot be compared, and the sensitivity and accuracy are low.

[0007] Patent CN101441222A discloses a monoclonal antibody and its kit for detecting β-conglycinin. This method uses the amino acid sequence of the antigenic epitope PRPQHPERE as a basis to obtain a monoclonal antibody through immunization and further develops a detection method for β-conglycinin. While this method has advantages such as high specificity and sensitivity, it still suffers from drawbacks such as complex antibody serum preparation and the inability to make incomparable data between different laboratories.

[0008] Wang Yin et al. used an antigen-antibody kit (ELISA method) to detect the content of antigenic proteins such as β-conglycinin in soybean protein products. Their research found that excessively high drying temperatures and prolonged drying times could cause protein denaturation and Maillard reactions, leading to inaccurate detection of the true content of antigenic proteins such as β-conglycinin and resulting in false negatives in the antigen-antibody method.

[0009] Academician Li Defa delivered a report entitled "Research Progress on Anti-nutritional Factors in Soybeans" at the 2018 Feed Predigestion Nutrition Forum. He mentioned that the content of the β-conglycinin subunit exhibited the greatest variation, and the ELISA detection method established using monoclonal antibodies prepared targeting the subunit's antigenic site might yield results that deviate significantly from theoretical values.

[0010] Based on the above situation, the search for a highly accurate, simple, rapid, and low-cost detection method for soybean antigen proteins has become an urgent need for the industry to evaluate food and feed safety. Unlike monoclonal and biclonal antibodies, nucleic acid aptamers, with their complex spatial structures, possess a higher affinity and more specific ability to bind to target molecules. In particular, nucleic acid aptamers have diverse secondary structures, such as hairpins, stems, loops, protrusions, and G-quadruplexes, while antibodies only contain α-helices and β-sheets. Furthermore, antibodies bind to antigenic determinants based on a "lock-and-key" model, and their affinity depends on the number of antigenic determinants recognized. Nucleic acid aptamers, on the other hand, recognize targets from the surface based on their three-dimensional configuration, and their multivalent aptamers can further enhance affinity. Therefore, nucleic acid aptamers have a superior ability to bind to targets compared to antibodies, and their affinity constant (Kd) can be as low as nmol or even pmol. Because nucleic acid aptamers are synthesized chemically and are easily modified, they can be scaled up to a certain extent, while maintaining structural and property consistency between different batches. Nucleic acid aptamers do not require in vivo immunization, simplifying the production process and reducing the consumption of laboratory animals, thus lowering costs. Chemically synthesized nucleic acid aptamers are less susceptible to viral and bacterial contamination and are not easily degraded under extreme temperature and pH conditions. Currently, a large number of nucleic acid aptamers capable of recognizing different targets have been screened, allowing for selective binding to specific proteins, cells, or even single amino acids for application in detection fields.

[0011] References:

[0012] [1] Tian Kun, et al., Structure and properties of soybean protein isolate. Progress in Chemistry. 2008, 20(4):565-573.

[0013] [2]Xiaoqun M,Donghai W,and Xiuzhi S.Physicochemical properties ofβandα'αsubunits isolated from soybeanβ-conglycinin.J Agric Food Chem, 2011,59(4):1217-1222.

[0014] [3]Hongmin J,Tianjiao Z,Hong Z,et al.Quantification of Gly m 5.0101insoybean and soy products by Liquid Chromatography-Tandem MassSpectrometry. Molecules,2019,24:1-15.

[0015] [4] CN 104897902 A. A method for detecting soybean antigen β-conglycinin.

[0016] [5] CN 101441222 A. Method for detecting β-conglycinin and its specific antibody and kit.

[0017] [6] Wang Yin, et al., A new method for effective detection of antigenic proteins in fermented soybean meal. Feed Industry. 2013, 34(6):52-55.

[0018] [7] Li Defa, Research progress on anti-nutritional factors in soybean. Sourced from the Internet. Summary of the Invention

[0019] The inventors of this invention have discovered a nucleic acid aptamer that can recognize soybean antigen β-conglycinin. Using the nucleic acid aptamer of this invention not only has good sensitivity and specificity, but also greatly improves the detection efficiency of soybean antigen β-conglycinin and reduces the detection cost. Therefore, this method is suitable for batch detection of soybean antigen proteins in soybeans and their deep-processed products in the food and feed industries.

[0020] Therefore, the first objective of this invention is to provide a nucleic acid aptamer that can recognize the soybean antigen β-conglycinin.

[0021] The aptamer provided by the present invention has the nucleotide sequence shown in SEQ ID NO:1.

[0022] In one specific embodiment of the present invention, one end of the aptamer is labeled with a specific biomolecule.

[0023] In one specific embodiment of the present invention, the biomacromolecule is bound as a marker at the 5' end of the nucleic acid aptamer.

[0024] In one specific embodiment of the present invention, the marker is biotin, phycoerythrin, or avidin.

[0025] A second objective of this invention is to provide a method for identifying soybean antigen β-conglycinin.

[0026] The method provided by this invention includes recognizing soybean antigen β-conglycin using a nucleic acid aptamer of the first aspect.

[0027] In one specific embodiment of the present invention, the method includes contacting the nucleic acid aptamer of the first aspect of the present invention or a product containing the nucleic acid aptamer of the first aspect with the sample to be tested.

[0028] In some specific embodiments of the present invention, the product comprising the nucleic acid aptamer of the first aspect is a fluorescent sensor.

[0029] In some specific embodiments of the present invention, the sample to be tested is preferably soybean meal, fermented soybean meal, other soybean processing products (e.g., soybean flour, puffed soybean flour, defatted soybean flour, soybean protein concentrate, soybean peptide powder) and extracts of the above substances.

[0030] A third aspect of the present invention aims to provide a product for identifying soybean antigen β-conglycinin.

[0031] The product provided by this invention includes the nucleic acid aptamer of the first aspect.

[0032] In some specific embodiments of the present invention, the product is a fluorescence sensor.

[0033] The fourth aspect of this invention aims to provide the use of nucleic acid aptamers for recognizing soybean antigen β-conglycinin.

[0034] The fifth aspect of the present invention is to provide a method for detecting the content of soybean antigen β-conglycin in soybean meal.

[0035] The method provided by the present invention includes detecting the soybean meal using a nucleic acid aptamer of the first aspect.

[0036] In some specific embodiments of the present invention, the method includes the steps of binding a fluorescent dye, such as SYBR Green I, acridine orange, or quantum dots to a nucleic acid aptamer of the first aspect, and the step of using the nucleic acid aptamer bound with the fluorescent dye to detect the soybean meal. Attached Figure Description

[0037] Figure 1 The results show the fermented soybean meal products with higher drying temperatures detected by electrophoresis. Lane 1 is the marker, lane 2 shows the detection results of unfermented soybean meal, and lanes 3-5 show the detection results of samples 1-3, respectively.

[0038] Figure 2 The standard curve of β-conjugated glycin concentration gradient is shown. Detailed Implementation

[0039] The present invention will now be described in detail. The descriptions of the technical features described below are based on representative embodiments and specific examples of the present invention, but the present invention is not limited to these embodiments and specific examples. It should be noted that:

[0040] In this specification, the range of values ​​referred to as "value A to value B" refers to the range including the endpoint values ​​A and B.

[0041] In this specification, the numerical range indicated by "above" or "below" refers to the numerical range that includes the stated number.

[0042] In this specification, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0043] In this specification, the terms "optional" or "optional" are used to indicate the use or omission of certain substances, components, procedures, application conditions, etc.

[0044] All unit names used in this manual are international standard unit names, and unless otherwise stated, the "%" used refers to weight or mass percentage content.

[0045] Unless otherwise stated in this specification, "multiple (types)" means having two or more types.

[0046] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "implementation," etc., refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to that embodiment, which are included in at least one of the embodiments described herein and may or may not be present in other embodiments. Furthermore, it should be understood that these elements may be combined in any suitable manner in various embodiments.

[0047] The inventors of this invention have discovered a nucleic acid aptamer capable of recognizing soybean antigen β-conglycinin. Using the nucleic acid aptamer of this invention not only provides good sensitivity and specificity but also significantly improves the detection efficiency of soybean antigen β-conglycinin and reduces detection costs. Therefore, this method is suitable for batch detection of soybean antigen proteins in soybeans and their deep-processed products in the food and feed industries.

[0048] Therefore, the first objective of this invention is to provide a nucleic acid aptamer that can recognize the soybean antigen β-conglycinin.

[0049] The aptamer provided by the present invention has the nucleotide sequence shown in SEQ ID NO:1.

[0050] Those skilled in the art will recognize that certain specific biomolecules can be used as labeling reagents, for example:

[0051] Biotin can bind to biological macromolecules such as proteins and antibodies. It can not only maintain the biological activity of macromolecules, but also has a multi-level amplification effect when used in combination with avidin, making it widely used in qualitative and quantitative detection and localization observation of trace antigens and antibodies.

[0052] Phycoerythrin: Under specific wavelength excitation, phycoerythrin emits strong fluorescence, with an intensity 30-100 times that of fluorescein. It has excellent light absorption properties and a high quantum yield, and exhibits a wide excitation and emission range in the visible spectrum.

[0053] Avidin is a basic glycoprotein composed of four identical subunits extracted from ovalbumin. It is heat-resistant and resistant to the action of various proteolytic enzymes. Especially after binding with biotin, its stability is even better and is not affected by reagent concentration, pH environment, or organic solvents such as protein denaturants. It is widely used in quantitative and qualitative detection and localization observation of trace antigens, antibodies and receptors.

[0054] Therefore, in one specific embodiment of the present invention, one end of the aptamer is labeled with a specific biomolecule.

[0055] In one specific embodiment of the present invention, the biomacromolecule is bound as a marker at the 5' end of the nucleic acid aptamer.

[0056] In one specific embodiment of the present invention, the marker is biotin, phycoerythrin, or avidin.

[0057] A second objective of this invention is to provide a method for identifying soybean antigen β-conglycinin.

[0058] The method provided by this invention includes recognizing soybean antigen β-conglycin using a nucleic acid aptamer of the first aspect.

[0059] In one specific embodiment of the present invention, the method includes contacting the nucleic acid aptamer of the first aspect of the present invention or a product containing the nucleic acid aptamer of the first aspect with the sample to be tested.

[0060] In some specific embodiments of the present invention, the product comprising the nucleic acid aptamer of the first aspect is a fluorescent sensor.

[0061] In some specific embodiments of the present invention, the sample to be tested is soybean meal, fermented soybean meal, other soybean processing products, and extracts of the above substances.

[0062] Other soybean processed products may include, but are not limited to, soybean flour, puffed soybean flour, defatted soybean flour, soybean protein concentrate, and soybean peptide powder.

[0063] The extract is an extract of soybean meal, fermented soybean meal, or other soybean processed products, including but not limited to water extract, carbonate buffer extract, phosphate buffer extract, and Tris-HCl extract.

[0064] A third aspect of the present invention aims to provide a product for identifying soybean antigen β-conglycinin.

[0065] The product provided by this invention includes the nucleic acid aptamer of the first aspect.

[0066] In some specific embodiments of the present invention, the product is a fluorescence sensor.

[0067] The fourth aspect of this invention aims to provide the use of nucleic acid aptamers for recognizing soybean antigen β-conglycinin.

[0068] The fifth aspect of the present invention is to provide a method for detecting the content of soybean antigen β-conglycin in soybean meal.

[0069] The method provided by the present invention includes detecting the soybean meal using a nucleic acid aptamer of the first aspect.

[0070] In some specific embodiments of the present invention, the method includes the steps of binding a fluorescent dye, such as SYBR Green I, acridine orange, and quantum dots (quantum dots, also known as semiconductor nanocrystals, are nanoparticles composed of elements from groups II to VI or III to V, with a diameter of less than 10 nm, thousands of times smaller than the volume of ordinary cells) to a nucleic acid aptamer of the first aspect, and the step of using the nucleic acid aptamer bound with the fluorescent dye to detect the soybean meal.

[0071] In some specific embodiments of the present invention, the soybean meal is unfermented soybean meal, fermented soybean meal, or an extract of the above-mentioned soybean meal.

[0072] In the following embodiments of the present invention, the following are used

[0073] The formulation of the standard working solution for the fluorescent dye SYBR GreenI is as follows: SYBR GreenI (10000×) nucleic acid dye was purchased from Shanghai Sangon Biotech Co., Ltd. Before use, it was diluted 100 times with double-distilled water to prepare the standard working solution, and then stored at -4℃ for later use.

[0074] The stock solution for the target substance is formulated as follows: β-conglycin is dissolved and prepared to a concentration of 100 μg / mL using double-distilled water, which is the stock solution for the target substance.

[0075] Exonuclease I was purchased from Shanghai Sangon Biotech Co., Ltd.

[0076] The exonuclease 10× buffer formulation is as follows: 670mM glycine-KOH (pH 9.5, 25℃), 67mM MgCl2, 10mM MTT;

[0077] The preparation method of β-conglycinin is as follows: First, soybean 7S globulin is separated by isoelectric point precipitation, and then further purified using a butyl hydrophobic column (HiTrap Butyl-s FF) to obtain β-conglycinin. For the preparation of 7S globulin, please refer to "Research on the Fractionation and Separation Process of Soybean Protein" by Qu Jiani; for the purification of β-conglycinin, please refer to "Isolation and Purification of Soybean 7S Globulin Subunits" by Yu Shaojing.

[0078] Example

[0079] The present invention will be described below through specific embodiments, but the present invention is not limited to these embodiments.

[0080] Example 1: Artificial synthesis of the specific nucleic acid aptamer Apt1

[0081] The specific nucleic acid aptamer Apt1 and its complementary sequence for β-conglycin were synthesized by Shanghai Sangon Biotech Co., Ltd., and the Apt1 sequence is as follows:

[0082] AACACGACGGCCCTGTGTCCATCACAGTGTGTGCATGTGGGC (SEQ ID NO: 1).

[0083] Example 2: Establishment of a fluorescent sensor method for detecting β-conglycinin using the Apt1 aptamer.

[0084] 1) Construction of aptamer fluorescence system

[0085] First, the Apt 1 aptamer and its complementary sequence were diluted to a concentration of 10 μM using a Tris-HCl buffer (50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl2, pH 7.5). Then, 50 μL of the 10 μM Apt 1 aptamer and 50 μL of the 10 μM complementary sequence cDNA were added to a 1.5 mL centrifuge tube. After vortexing to homogenize, the tube was placed in a water bath and heated at 95 °C for 10 min to decochet the DNA. Finally, the heated nucleic acid mixture was cooled to room temperature and annealed, then diluted 100-fold with double-distilled water to obtain 50 nM of double-stranded DNA (dsDNA) synthesized from the Apt 1 aptamer and its complementary sequence. This dsDNA was stored overnight at 4 °C for later use.

[0086] 2) Establishment of fluorescence detection method

[0087] Add 15 μL of SYBR Green I standard working solution to 100 μL of prepared dsDNA (50 nM) solution and vortex at room temperature for 7 min. Next, prepare a 100 μg / mL target analyte stock solution using double-distilled water. Add 5, 10, 15, 25, 35, 45, and 55 μL of the stock solution to the mixture to achieve final target analyte (β-conglycin) concentrations of 1, 2, 3, 5, 7, 9, and 11 μg / mL, respectively. Then add 25 U of exonuclease I and 50 μL of 10× exonuclease buffer, and bring the volume to 500 μL using a Tris-HCl buffer solution (pH 7.5, formulation: 50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl2, pH 7.5). Place the mixture in a water bath and incubate at 37°C for 30 min. Finally, the exonuclease reaction was stopped by water bathing at 80℃ for 15 minutes, and the fluorescence value at 525nm was detected at room temperature.

[0088] 3) Determination of standard curve

[0089] β-conglycinin was diluted to concentrations of 1, 2, 3, 5, 6, 9, and 11 μg / mL, and its fluorescence value at 525 nm was measured. A standard curve was then plotted (results are shown in the figure). Figure 2 As shown in the figure, the results indicate that when β-conglycinin is in the concentration range of 1-9 μg / mL, the protein concentration has a good linear relationship with the fluorescence value curve. A standard curve was plotted within this range to show the following relationship between β-conglycinin concentration and absorbance:

[0090] y = -72.629x + 7449.1

[0091] Where x is the concentration of β-conglycinin, y is the fluorescence value at 525 nm, and R 2 =0.9825.

[0092] The above test was repeated 4 times, and the results showed the standard curve R. 2 All values ​​are greater than 0.98.

[0093] 4) Sample testing

[0094] β-Conoglycin was diluted to obtain concentrations of 10, 1, 0.1, 0.001, and 0.0001 μg / mL, respectively. -1Five different concentrations of β-conglycin were used as the target analyte. Detection reactions were performed with different concentrations of the target analyte, and the detection sensitivity for different mass concentrations was calculated. The test results showed that the sensitivity of this method for detecting β-conglycin reached 1 μg / mg.

[0095] The above results show that the present invention not only has good sensitivity and specificity, but also greatly improves the detection efficiency of soybean antigen β-conglycinin and reduces the detection cost. Therefore, the method is suitable for batch detection of soybean antigen protein in soybeans and their deep-processed products in the food and feed industries.

[0096] Example 3: Detection of β-conglycinin in fermented soybean meal products dried at high temperatures

[0097] Samples 1, 2, and 3 were all fermented soybean meal products from the domestic market, with unfermented soybean meal used as a control. The β-conglycinin content in the samples was detected by electrophoresis, the aptamer Apt1 method, and an antibody method (commercially available ELISA kit), respectively. The soybean meal result was used as 100% standard, and other result values ​​were divided by the soybean meal result to obtain the degradation rate of β-conglycinin.

[0098] The electrophoresis procedure is as follows: Take 3 grams of the pulverized sample (passed through a 60-mesh sieve) into an Erlenmeyer flask, add an appropriate amount of sample extract, mix well, and then shake at 37°C for 2 hours. Centrifuge at 10,000 rpm for 10 minutes, take the supernatant, add it to the loading buffer, and boil in a water bath for 5 minutes for SDS-PAGE electrophoresis. Take about 6-10 μL of each sample solution and add it to the gel tank. Turn on the regulated power switch and set the voltage to 120V for electrophoresis. After electrophoresis, place the gel in a container with staining solution for 2 hours, and then add destaining solution for destaining until the background color of the gel is the initial white and the bands are clearly visible.

[0099] The procedure for aptamer Apt1 is as follows: Take an appropriate amount of pulverized sample that has passed through a 60-mesh sieve, put 3 grams into an Erlenmeyer flask, add an appropriate amount of sample extract and mix well, then shake at 37°C for 2 hours, centrifuge at 10000 rpm for 10 minutes, take the supernatant, dilute with double-distilled water and test according to Example 2.

[0100] The antibody method is as follows: Take an appropriate amount of the sample, pulverize it and pass it through a 60-mesh sieve, and extract and detect it according to the kit instructions.

[0101] Electrophoretic analysis results as follows Figure 1 The detection results of the three methods are shown in the table below:

[0102]

[0103] The results above show that, using electrophoresis as the standard evaluation method for fermentation effect (i.e., protein degradation effect), Sample 1 showed better fermentation effect, with most of β-conglycin being degraded. Samples 2 and 3 showed poorer fermentation effect, with a large amount of β-conglycin remaining. Both the aptamer Apt1 method and the antibody method can characterize the actual degradation ratio of β-conglycin in unfermented soybean meal and Sample 1 to a certain extent. However, the aptamer method is closer to the electrophoresis results, i.e., the theoretical degradation ratio. The results of the aptamer Apt1 method for Samples 2 and 3 are closer to the electrophoresis results, i.e., the theoretical degradation ratio, while the antibody method results differ significantly from the theoretical degradation ratio, and even show the opposite trend to the electrophoresis results, exhibiting "false negative" results.

[0104] Example 4: The content of β-conglycinin was detected after adding different amounts of β-conglycinin to fermented soybean meal with good fermentation effect.

[0105] Based on the results of Example 3, the fermentation effect of Sample 1 was better. Therefore, β-conglycinin target substances with concentrations of 50, 10, and 5 mg / g were added to Sample 1 (referred to as Sample 1-1, 1-2, and 1-3, respectively). Soybean meal from Example 3 was used as a control for detecting the target substance. The aptamer Apt1 method was used for detection, and electrophoresis was used as a control method to detect the relative content of β-conglycinin. The results are shown in the table below.

[0106]

[0107] The results in the table above show that the results of the aptamer method and the electrophoresis method are basically consistent after adding different amounts of β-conglycin to fermented soybean meal sample 1 with good fermentation effect, and the gradient trend is consistent.

Claims

1. A nucleic acid aptamer for recognizing soybean antigen β-conglycinin, characterized in that, The nucleotide sequence of the aptamer is shown in SEQ ID NO:1; the sequence of SEQ ID NO:1 is: AACACGACGGCCCTGTGTCCATCACAGTGTGTGCATGTGGGC.

2. The nucleic acid aptamer as described in claim 1, characterized in that, One end of the aptamer is labeled with a specific biomolecule, which is bound to the 5' end of the nucleic acid aptamer as a marker. The marker is biotin, phycoerythrin, or avidin.

3. A method for recognizing soybean antigen β-conglycin using the nucleic acid aptamer according to claim 1 or 2.

4. The method as described in claim 3, characterized in that, The method includes contacting the nucleic acid aptamer of claim 1 or 2, or a product containing the nucleic acid aptamer of claim 1 or 2, with the sample to be tested.

5. The method as described in claim 4, characterized in that, The product comprising the nucleic acid aptamer according to claim 1 or 2 is a fluorescent sensor.

6. The method as described in claim 4, characterized in that, The sample to be tested is soybean meal, fermented soybean meal, other soybean processed products, and extracts of the above substances. The other soybean processed products are soybean flour, soybean protein concentrate, and soybean peptide powder.

7. A product for identifying soybean antigen β-conglycinin, characterized in that, The product includes the nucleic acid aptamer as described in claim 1 or 2.

8. The product as described in claim 7, characterized in that, The product in question is a fluorescence sensor.

9. Use of the nucleic acid aptamer according to claim 1 or 2 for recognizing soybean antigen β-conglycinin.

10. A method for detecting the content of soybean antigen β-conglycinin in soybean meal, characterized in that, The method uses the nucleic acid aptamer as described in claim 1 or 2 to detect the soybean meal.

11. The method as described in claim 10, characterized in that, The method includes the steps of binding a fluorescent dye to the nucleic acid aptamer of claim 1 or 2, and detecting the soybean meal using the nucleic acid aptamer bound with the fluorescent dye.

12. The method as described in claim 11, characterized in that, The fluorescent dye is SYBR Green I, acridine orange, or quantum dots.

Images