Composition, kit, and sequencing library construction method for detecting BRCA all-exon gene mutations
By designing specific amplification primer pairs and optimizing primer dosage, the problems of low sensitivity and accuracy in detecting BRCA1/2 gene mutations in FFPE samples were solved, and efficient BRCA whole-exome gene mutation detection was achieved.
Patent Information
- Application Number
- CN202210257233.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-03-16
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2042-03-16
AI Technical Summary
Existing BRCA1/2 gene mutation detection products have problems with low sensitivity and accuracy in FFPE samples, especially coverage and uniformity problems caused by improper design of multiple amplification primers.
Specific amplification primer pairs were designed to target all exon coding regions and exon-intron boundaries of the BRCA1 and BRCA2 genes. The amplicon length was 120bp-200bp and was applied to DNA templates extracted from FFPE samples. Through multiplex PCR specific amplification and universal amplification, the primer dosage ratio was optimized to improve template utilization and amplification uniformity.
The sequencing results achieved a uniformity of 99% and a capture efficiency of 97%, improving the sensitivity and accuracy of BRCA whole-exome gene mutation detection in FFPE samples.
Smart Images

Figure CN114686589B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular diagnostic technology, and in particular to a composition, a kit, and a sequencing library construction method for detecting BRCA all-exon gene mutations. Background Art
[0002] BRCA1 / 2 are two tumor suppressor genes located on human chromosomes 17 and 13, respectively. They encode tumor suppressor proteins that play a crucial role in gene transcription, DNA damage repair, and cell proliferation. When these genes mutate, their protein products fail to function properly, leading to defects in homologous recombination repair mechanisms. This can cause other genetic alterations in cells, potentially leading to cancer. Breast and ovarian cancer are the most common cancers in women, with extremely high mortality rates. Cancer risk is influenced by both external environmental and behavioral factors, as well as internal genetic factors. Studies have shown that hereditary breast cancer accounts for 5-10% of all breast cancers. Approximately 90% of these patients have mutations in either the BRCA1 or BRCA2 gene. Carriers of BRCA1 or BRCA2 mutations have a 60-85% risk of developing breast cancer, and a 39-44% and 11-18% risk of developing ovarian cancer, respectively. Other studies have shown that 40-50% of hereditary breast cancers are caused by BRCA1 mutations. Therefore, developing a BRCA1 / 2 detection kit that is highly targeted, sensitive, and universal to achieve early diagnosis and screening of breast cancer / ovarian cancer, prognosis monitoring, and personalized medication guidance is the key to preventing the occurrence of breast cancer / ovarian cancer or improving patients' survival rate and quality of life. Its development is urgent and of great significance.
[0003] BRCA1 and BRCA2 gene mutations are diverse, involving nearly 10,000 variant sites. These mutations are dispersed throughout the exons, with no evidence of mutation hotspots. High-throughput next-generation sequencing (NGS) technology, due to its efficiency and speed, and its ability to simultaneously detect mutations in all exons of the BRCA1 and BRCA2 genes, as well as in adjacent upstream and downstream regions, has become a common method for BRCA1 / 2 gene mutation detection. Currently, most commercially available products that utilize NGS for all-exon BRCA1 and BRCA2 gene detection rely on multiplex amplification to construct libraries covering the entire BRCA1 / 2 exon for subsequent NGS sequencing. The key to these products lies in the design of specific primers for multiplex amplification. The optimal multiplex amplification primer sequence structure and combination must be designed based on the characteristics of the DNA extracted from the sample and the differences in amplification efficiency between primers. During FFPE sample preparation, genomic DNA undergoes varying degrees of fragmentation due to the effects of heat and formalin. Due to inherent design issues, existing products for mutation detection in FFPE samples suffer from issues with coverage and uniformity, resulting in low sensitivity and accuracy. Summary of the Invention
[0004] To overcome the shortcomings of the prior art, one of the objectives of the present invention is to provide a composition for detecting BRCA all-exon gene mutations. Specific amplification primer pairs are designed to target all exon coding regions of the BRCA1 and BRCA2 genes, as well as the ±20bp boundary between exons and introns. The resulting amplicons range in length from 120bp to 200bp, enabling targeted capture of small DNA templates. This can be applied to DNA templates extracted from FFPE samples, thereby improving template utilization.
[0005] A second object of the present invention is to provide a kit for detecting BRCA all-exon gene mutations, comprising the composition of the present invention.
[0006] A third object of the present invention is to provide a method for constructing a sequencing library for detecting BRCA whole-exon gene mutations, comprising using the composition of the present invention to perform multiplex PCR specific amplification, wherein the sequencing results of the sequencing library show a uniformity (0.2x) of 99% and a capture efficiency of 97%.
[0007] In order to achieve the above objectives, the technical solutions adopted by the present invention are as follows:
[0008] A composition for detecting BRCA all-exon gene mutations includes specific amplification primers, which include 216 pairs of specific amplification primer pairs, wherein the 5' to 3' ends of the forward primer and the reverse primer of each pair of specific amplification primer pairs sequentially include a universal sequence and a specific sequence; the specific sequence of the forward primer of each pair of specific amplification primer pairs is such as SEQ ID NO.n (n is any integer from 1 to 216), and the specific sequence of the corresponding reverse primer is such as SEQ ID NO.n+216 (n is any integer from 1 to 216).
[0009] Furthermore, the usage ratio of each specific amplification primer pair is shown in Table 1 below:
[0010] Table 1
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017] Preferably, the universal sequence for the forward and reverse primers of each pair of specific amplification primers is an adapter sequence compatible with a gene sequencing platform. In a specific embodiment of the present invention, the universal sequence is an adapter sequence compatible with the Illumina second-generation sequencing platform. Specifically, the universal sequence for the forward primer of each pair of specific amplification primers is SEQ ID NO. 433; the corresponding universal sequence for the reverse primer is SEQ ID NO. 434.
[0018] In order to achieve further amplification of the product amplified by the specific amplification primer, the above-mentioned composition also includes a forward universal amplification primer and a reverse universal amplification primer; the 3' end of the forward universal amplification primer includes a sequence complementary to the universal sequence of the specific amplification primer forward primer; the 3' end of the reverse universal amplification primer includes a sequence complementary to the universal sequence of the specific amplification primer reverse primer.
[0019] Preferably, in a specific embodiment of the present invention, the sequence of the forward universal amplification primer is SEQ ID NO.435:
[0020] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGAGCTCTTCCGATCT;
[0021] The sequence of the reverse universal amplification primer is SEQ ID NO.436:
[0022] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGA; where NNNNNNNN is an 8bp index sequence.
[0023] A kit for detecting BRCA all-exome gene mutations comprises the above-mentioned composition and further comprises a PCR amplification reagent containing DNA polymerase and dNTP solution.
[0024] The method for constructing a sequencing library for BRCA whole-exome gene mutation detection includes the following steps:
[0025] 1) Specific amplification: using the extracted human genomic DNA as a template and the 216 pairs of specific amplification primers in the above composition as primers, multiplex PCR amplification is performed to obtain specific amplification products;
[0026] 2) Universal amplification: After purifying the specific amplification product prepared in step 1), amplification is performed using the forward universal amplification primer and the reverse universal amplification primer in the above composition as primers, and the library is prepared after purification.
[0027] The specific process of step 1) specific amplification includes dividing 216 pairs of specific amplification primers into two groups and performing multiplex PCR amplification separately, and then mixing the specific amplification products of each group; wherein SEQ ID NO.n (n is any integer from 1 to 108) and SEQ ID NO.n+216 (n is any integer from 1 to 108) are the first group; SEQ ID NO.n (n is any integer from 109 to 216) and SEQ ID NO.n+216 (n is any integer from 109 to 216) are the second group.
[0028] Preferably, the above-mentioned human genomic DNA is human genomic DNA extracted from FFPE tissue.
[0029] Beneficial effects of the present invention:
[0030] 1) The specific amplification primer pairs in the composition for detecting BRCA all-exon gene mutations of the present invention target regions including the entire coding region; the exon-intron boundary ± 20 bp; the 5UTR region: the full length of exon 2 + at least 20 bp of intron 1; the 3UTR region: at least 20 bp after the stop codon; and the union of the coding regions of all transcripts;
[0031] 2) The specific amplification primer pair of the present invention amplifies human genomic DNA as a template, and the length of the amplicon obtained ranges from 120 bp to 200 bp. It can target and capture small DNA template fragments and be applied to DNA templates extracted from FFPE samples to improve template utilization.
[0032] 3) Furthermore, the present invention optimizes the usage ratio of each specific amplification primer pair to improve the amplification uniformity of each primer in multiplex PCR amplification. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 This is the bioanalyzer result diagram of the library prepared in Example 1. DETAILED DESCRIPTION
[0034] The technical solutions of the present invention will be clearly and completely described below in conjunction with specific embodiments. However, it should be understood by those skilled in the art that the embodiments described below are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work are within the scope of protection of the present invention.
[0035] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples are all commercially available.
[0036] The template used in the following examples is a human genomic DNA template extracted from FFPE samples using a known extraction method.
[0037] Example 1
[0038] This example provides a method for constructing a sequencing library for BRCA whole-exome gene mutation detection. The specific steps are as follows:
[0039] 1) Specific amplification:
[0040] Two sets of specific amplification primers were used to perform multiplex PCR amplification reactions using extracted human genomic DNA (50 ng) as a template. The two sets of primers were respectively used in test tube A and test tube B. The concentration of the DNA template was fixed to 10 ng / μl, and the concentration of the first set of primers or the second set of primers was 200 μM. The specific amplification system is shown in Table 2 below:
[0041] Table 2
[0042] First set of primers or second set of primers 6ul KAPA 2G Fast multiplex mix 15ul DNA template 5ul Nuclease-free water 4ul Total volume 30ul
[0043] The amplification reaction conditions are shown in Table 3 below:
[0044] Table 3
[0045]
[0046] The forward primer and the reverse primer of each specific primer pair include a universal sequence and a specific sequence from 5' to 3' end, respectively; the specific sequence of the forward primer of the first set of specific amplification primer pairs is such as SEQ ID NO.n (n is any integer from 1 to 108), and the specific sequence of the corresponding reverse primer is such as SEQ ID NO.n+216 (n is any integer from 1 to 108);
[0047] The specific sequence of the forward primer of the second set of specific primers is such as SEQ ID NO.n (n is any integer from 109 to 216), and the specific sequence of the corresponding reverse primer is such as SEQ ID NO.n+216 (n is any integer from 109 to 216);
[0048] The universal sequence of the forward primer of each pair of specific amplification primers is SEQ ID NO. 433; the universal sequence of the corresponding reverse primer is SEQ ID NO. 434;
[0049] The usage ratio of each specific primer pair is shown in Table 1 above:
[0050] 2) Purification of specific amplification products:
[0051] 15 μl of the amplified products from tubes A and B were taken and mixed before purification. The specific steps include:
[0052] A: Take 39 μl of purified magnetic beads equilibrated at room temperature for 30 minutes and add them to 30 μl of mixed amplification product. Vortex to mix thoroughly.
[0053] B: Let stand at room temperature for 5 minutes, place on a magnetic stand, let stand for 3 minutes, and then remove the supernatant;
[0054] C: Add 180 μl of 80% ethanol, let it stand for 30 seconds, and then remove the supernatant;
[0055] D: Repeat step C once;
[0056] E: Let stand at room temperature until the ethanol is fully evaporated, then add 20ul of nuclease-free water and vortex to mix.
[0057] F: Let it stand at room temperature for 2 minutes, place it on a magnetic stand for 3 minutes, and collect the supernatant to obtain the purified specific amplification product;
[0058] 3) Universal amplification:
[0059] The purified specific amplification product was subjected to universal amplification. The amplification reaction system is shown in Table 4 below:
[0060] Table 4
[0061] Purified specific amplification product 13ul KAPA 2G Fast multiplex mix 15ul Forward universal amplification primer 1ul Reverse universal amplification primer 1ul Total volume 30ul
[0062] The sequence of the forward universal amplification primer is SEQ ID NO.435; the sequence of the reverse universal amplification primer is SEQ ID NO.436;
[0063] The reaction conditions are shown in Table 5 below:
[0064] Table 5
[0065]
[0066] 4) Purification of universal amplification products. The specific steps include:
[0067] A: Take 30ul of magnetic beads equilibrated at room temperature for 30min and add them to 30ul of amplification product, then vortex to mix.
[0068] B: Let stand at room temperature for 5 minutes, place on a magnetic stand, let stand for 3 minutes, and then remove the supernatant;
[0069] C: Add 180 μl of 80% ethanol, let it stand for 30 seconds, and then remove the supernatant;
[0070] D: Repeat operation C once;
[0071] E: Let stand at room temperature until the ethanol is fully evaporated, then add 25ul of nuclease-free water and vortex to mix;
[0072] F: Let it stand at room temperature for 2 minutes, place it on a magnetic stand for 3 minutes, and collect the supernatant to obtain the purified universal amplification product;
[0073] 5) Sequencing library quality control: The library was tested by Agilent 2100 bioanalyzer, and the main peak was around 290 bp, with no other obvious abnormal peaks, such as Figure 1 shown.
[0074] Comparative Example 1
[0075] This comparative example provides a method for constructing a sequencing library for detecting BRCA all-exon gene mutations. The difference from Example 1 is that the sequence structure and dosage ratio of some specific amplification primer pairs are adjusted, as shown in Table 6 below:
[0076] Table 6
[0077]
[0078]
[0079] Add the specific amplification primer pairs shown in Table 7 below:
[0080] Table 7
[0081]
[0082] The dosage ratio of each specific amplification primer pair was adjusted to be equal, and the rest was the same as in Example 1.
[0083] Comparative Example 2
[0084] This comparative example provides a method for constructing a sequencing library for detecting BRCA all-exon gene mutations. The difference from Example 1 is that the sequence structure and dosage ratio of some specific amplification primer pairs are adjusted, as shown in Table 8 below:
[0085] Table 8
[0086]
[0087]
[0088]
[0089] Other details are the same as in Example 1.
[0090] Test example
[0091] Experimental method: Sequencing libraries of the same sample were prepared according to the library construction methods provided in Example 1, Comparative Example 1, and Comparative Example 2, respectively. Each construction method corresponds to a parallel experiment of 10 samples; the 10 prepared sample libraries were mixed in equal mass ratios, and then quantified by qPCR. Pooling was performed on the sequencing machine according to the required data volume of a single library.
[0092] Statistical Analysis of Sequencing Results: The quality of target region capture sequencing data is primarily evaluated using the following metrics: capture specificity and target region coverage uniformity. The proportion of data falling within the target region to the total data is the capture specificity, or capture efficiency. High capture efficiency means high sequencing data utilization. The capture efficiency calculation formula is: target ratio = reads on target / mapped reads (see "High-Throughput Sequencing Technology," page 120). For capture sequencing data, if we calculate the depth of each site in the target region, we will find that the depth distribution follows a Poisson distribution. For data with good uniformity, if we measure the average depth at 100X, most regions will have depths close to 100X, and the depth distribution graph will show a narrow peak. For data with poor uniformity, the site depth distribution will be more dispersed, resulting in a broad peak. Draw a vertical line at 20% of the average depth. The integrated area to the left of the vertical line represents the proportion of sites with depths below 20% of the average depth. This shows that data with good uniformity will have fewer sites below the 20% mean depth, indicating higher coverage at the 20% mean depth. On the other hand, data with poor uniformity will have a large percentage of sites below the 20% mean depth. Therefore, we use coverage at the 20% mean depth to evaluate data uniformity. The 20% mean depth is calculated as: amplicons above 0.2 x meanamplicon depth / all amplicons.
[0093] Test results: The sequencing results of the sequencing libraries prepared by the library construction methods provided in Comparative Example 1, Comparative Example 1, and Comparative Example 2 are shown in Table 9 below:
[0094] Table 9
[0095]
[0096] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made thereto. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109] Sequence Listing <110> Zhengzhou Antu Bioengineering Co., Ltd. <120> Composition, kit, and sequencing library construction method for detecting BRCA all-exon gene mutations <160> 520 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 agtggtggtggtagtgggtt 20 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 atgcatccctgtgtaagtgca 21 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <400> 3 actttcttcagaagctccaccc 22 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <400> 4 ccaaagaatgcaaatttataatccaga 27 <210> 5 <211> 26 <212> DNA <213>Artificial Sequence <400> 5 aataagataaactagtttttgccagt 26 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <400> 6 ttctgaaagtctaggagctgagg 23 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 agaatgtgaaaagctatttttccaa 25 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <400> 8 tgtgagaataatataaattatatggct 27 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 acaaaaagtaagaactagcaagact 25 <210> 10 <211> 21 <212>DNA <213> Artificial Sequence <400> 10 agcaaatcagaagccctttga 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <400> 11 tgccacgtatttctagcctacc 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <400> 12 aacttctccagtggcttcttca 22 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <400> 13 ggactggaaatacatactgtttgct 25 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <400> 14 accgaaagaccaaaaatcagaact 24 <210> 15 <211> 23 <212> DNA <213>Artificial Sequence <400> 15 atttagtgaatgtgattgatggt 23 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <400> 16 tctcaggatcttgattataaagaagca 27 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <400> 17 tgtcacccagtacaacattcaa 22 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 tgtcagacaagctcaaaggt 20 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <400> 19 actacttcaatttcaaaaataactgtc 27 <210> 20 <211> 24 <212> DNA <213>Artificial Sequence <400> 20 tggtttatgttcttgcagaggaga 24 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <400> 21 tcacagttttggaggtagcttca 23 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <400> 22 tgagcaagcctcagtcaattaa 22 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <400> 23 tgcagaagagtacatttgaagtgc 24 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <400> 24 gaagtttgctggcctgttga 20 <210> 25 <211> 27 <212> DNA <213> Artificial Sequence <400> 25 aggtacatccaataagtttatcttcaa 27 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <400> 26 ctgctgccagtagaaattctcat 23 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 ctcaagaagcatgtcatggt 20 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <400> 28 accagaagaattgcataacttttcct 26 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <400> 29 aacccgaacgtgatgaaaaga 21 <210> 30 <211> 21 <212> DNA <213>Artificial Sequence <400> 30 acagagaggcctgtaaagacc 21 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <400> 31 agcaaaaagtcctgcaacttgt 22 <210> 32 <211> 26 <212> DNA <213> Artificial Sequence <400> 32 tgtatgaaaataattcaaacagtact 26 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <400> 33 ctggtattgagccagtattgaaga 24 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <400> 34 ccacctgcatttaggatagcc 21 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <400> 35 agtgaagaaattttacaacataacca 26 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <400> 36 tctgtccaggtatcagatgcttc 23 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence <400> 37 cgtactccagaacatttaatatccc 25 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <400> 38 acttcctcgtgttgataagaga 22 <210> 39 <211> 23 <212> DNA <213> Artificial Sequence <400> 39 aggaaccaaagtgtcacttgttg 23 <210> 40 <211> 27 <212> DNA <213> Artificial Sequence <400> 40 ttcagaaaactactttgaaacagaagc 27 <210> 41 <211> 27 <212> DNA <213> Artificial Sequence <400> 41 tgagaaataaaactgatattatttgcc 27 <210> 42 <211> 21 <212> DNA <213> Artificial Sequence <400> 42 aagcttgaatttttccccggc 21 <210> 43 <211> 24 <212> DNA <213> Artificial Sequence <400> 43 tttgtgtatttacagtaacatgga 24 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <400> 44 aacgtcaagagatacagaatcca 23 <210> 45 <211> 24 <212> DNA <213> Artificial Sequence <400> 45 acttgattactacaggcagaccaa 24 <210> 46 <211> 27 <212> DNA <213> Artificial Sequence <400> 46 tgagattcatcagtttaacaaaaacaa 27 <210> 47 <211> 23 <212> DNA <213> Artificial Sequence <400> 47 acaagtcttcagaatgccagaga 23 <210> 48 <211> 27 <212> DNA <213> Artificial Sequence <400> 48 gtgtgatacatgtttactttaaattgt 27 <210> 49 <211> 25 <212> DNA <213> Artificial Sequence <400> 49 aggaaagtttatggactggaaaagg 25 <210> 50 <211> 24 <212> DNA <213> Artificial Sequence <400> 50 agttgttgaattcagtatcatcct 24 <210> 51 <211> 21 <212> DNA <213> Artificial Sequence <400> 51 gctatggaatgtgcctttcct 21 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <400> 52 tggaaagggatgacacagct 20 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <400> 53 gacagttggtcagaagattattct 24 <210> 54 <211> 27 <212> DNA <213> Artificial Sequence <400> 54 tgatatctgtaatagaattgaatacat 27 <210> 55 <211> 21 <212>DNA <213> Artificial Sequence <400> 55 cgcaatgaaagagaggaagaa 21 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <400> 56 aacaagacagcaagttcgtgc 21 <210> 57 <211> 21 <212> DNA <213> Artificial Sequence <400> 57 tttttgttctgattgcttttt 21 <210> 58 <211> 23 <212> DNA <213> Artificial Sequence <400> 58 ctgctgaacaaaaggaacaaggt 23 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <400> 59 atttggcgtccatcatcaga 20 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <400> 60 gtgcttgttagtttatggaatctcc 25 <210> 61 <211> 26 <212> DNA <213> Artificial Sequence <400> 61 cctttcttgcatcttaaaattcatct 26 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <400> 62 agtggcgaccagaatccaaa 20 <210> 63 <211> 22 <212> DNA <213> Artificial Sequence <400> 63 tcggcatgtttgacaattggta 22 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <400> 64 actgcatgcaaatgatccca 20 <210> 65 <211> 25 <212> DNA <213> Artificial Sequence <400> 65 tcagatgtcttctcctaattgtgag 25 <210> 66 <211> 22 <212> DNA <213> Artificial Sequence <400> 66 tgagtagactgcctttacctcc 22 <210> 67 <211> 26 <212> DNA <213> Artificial Sequence <400> 67 tggaaagtaattcaatagctgacgaa 26 <210> 68 <211> 19 <212> DNA <213> Artificial Sequence <400> 68 gcctggaaaggccactttg 19 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <400> 69 cccatgcaaaaggaccccat 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <400> 70 acttactgtgccaagggtga 20 <210> 71 <211> 27 <212> DNA <213> Artificial Sequence <400> 71 tggaacttggaaatttcataaaaatcc 27 <210> 72 <211> 25 <212> DNA <213> Artificial Sequence <400> 72 actccactatgtaagacaaaggctg 25 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <400> 73 tgagggagggagctttacct 20 <210> 74 <211> 27 <212> DNA <213> Artificial Sequence <400> 74 ggggagaaatagtattatacttacaga 27 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <400> 75 gcctcgcctcatgtggtttt 20 <210> 76 <211> 26 <212> DNA <213> Artificial Sequence <400> 76 tccagaatgttgttaagtcttagtca 26 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <400> 77 gctggactctgggcagattc 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <400> 78 cccagactcttccagctgtt 20 <210> 79 <211> 22 <212> DNA <213> Artificial Sequence <400> 79 tctgcagacacctcaaacttgt 22 <210> 80 <211> 22 <212> DNA <213> Artificial Sequence <400> 80 aggctcagatacaaacacagct 22 <210> 81 <211> 22 <212> DNA <213> Artificial Sequence <400> 81 aggggaaggaaagaattttgct 22 <210> 82 <211> 24 <212> DNA <213> Artificial Sequence <400> 82 agcaaacctaagaatgtgggatac 24 <210> 83 <211> 26 <212> DNA <213> Artificial Sequence <400> 83 agctcacttctataaatagactgggg 26 <210> 84 <211> 23 <212> DNA <213> Artificial Sequence <400> 84 tgcctcatttgtttggaagaacc 23 <210> 85 <211> 24 <212> DNA <213> Artificial Sequence <400> 85 cctggttactgcagtcatttaagc 24 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <400> 86 gcagggaagctcttcatcct 20 <210> 87 <211> 23 <212> DNA <213> Artificial Sequence <400> 87 cagaacaaacctgagatgcatga 23 <210> 88 <211> 24 <212> DNA <213> Artificial Sequence <400> 88 cctctgtttctacctagttctgct 24 <210> 89 <211> 23 <212> DNA <213> Artificial Sequence <400> 89 tcccatttctctttcaggtgaca 23 <210> 90 <211> 21 <212>DNA <213> Artificial Sequence <400> 90 ttcgttgcctctgaactgaga 21 <210> 91 <211> 24 <212> DNA <213> Artificial Sequence <400> 91 tggactttgtttctttaaggaccc 24 <210> 92 <211> 23 <212> DNA <213> Artificial Sequence <400> 92 actgtggttaacttcatgtccca 23 <210> 93 <211> 23 <212> DNA <213> Artificial Sequence <400> 93 agtgctaacttccagtaacgaga 23 <210> 94 <211> 24 <212> DNA <213> Artificial Sequence <400> 94 ggaaggctaggattgacaaattct 24 <210> 95 <211> 23 <212> DNA <213>Artificial Sequence <400> 95 tccatgagttgtaggtttctgct 23 <210> 96 <211> 21 <212> DNA <213> Artificial Sequence <400> 96 gcctggtagaagacttcctcc 21 <210> 97 <211> 22 <212> DNA <213> Artificial Sequence <400> 97 ctccgtttggttagttccctga 22 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <400> 98 catggcttaagttggggagg 20 <210> 99 <211> 25 <212> DNA <213> Artificial Sequence <400> 99 tcatctacctcatttagaacgtcca 25 <210> 100 <211> 22 <212> DNA <213> Artificial Sequence <400> 100 ttctctgagcatggcagtttct 22 <210> 101 <211> 25 <212> DNA <213> Artificial Sequence <400> 101 cagccttttctacattcattctgtc 25 <210> 102 <211> 21 <212> DNA <213> Artificial Sequence <400> 102 cccactctcttttcagtgcct 21 <210> 103 <211> 27 <212> DNA <213> Artificial Sequence <400> 103 tggcaaaactataagataaggaatcca 27 <210> 104 <211> 21 <212> DNA <213> Artificial Sequence <400> 104 caggaggactgcttctagcct 21 <210> 105 <211> 22 <212> DNA <213> Artificial Sequence <400> 105 tcctgagttttcatggacagca 22 <210> 106 <211> 23 <212> DNA <213> Artificial Sequence <400> 106 gcttccaacctagcatcattacc 23 <210> 107 <211> 21 <212> DNA <213> Artificial Sequence <400> 107 tgaaggacaaaaacaaaagct 21 <210> 108 <211> 26 <212> DNA <213> Artificial Sequence <400> 108 ggacactctaagattttctgcatagc 26 <210> 109 <211> 21 <212> DNA <213> Artificial Sequence <400> 109 gtaccccagagcatcacttgg 21 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <400> 110 aagcgtgaggggacagattt 20 <210> 111 <211> 24 <212> DNA <213> Artificial Sequence <400> 111 tcgtaggtaaaaatgcctattgga 24 <210> 112 <211> 23 <212> DNA <213> Artificial Sequence <400> 112 cacaaatttgtctgtcactggtt 23 <210> 113 <211> 25 <212>DNA <213> Artificial Sequence <400> 113 cgaaccaaacctatttaaaactcca 25 <210> 114 <211> 24 <212> DNA <213> Artificial Sequence <400> 114 gacataaaagtcttcgcacagtga 24 <210> 115 <211> 27 <212> DNA <213> Artificial Sequence <400> 115 gctttttattcttagaatactagaaat 27 <210> 116 <211> 22 <212> DNA <213> Artificial Sequence <400> 116 tccttaatgatcagggcatttc 22 <210> 117 <211> 23 <212> DNA <213> Artificial Sequence <400> 117 ttgcattctagtgataatataca 23 <210> 118 <211> 27 <212> DNA <213> Artificial Sequence <400> 118 gtgcattgagagtttttatactagtga 27 <210> 119 <211> 21 <212> DNA <213> Artificial Sequence <400> 119 gctgcaaagaccacattggaa 21 <210> 120 <211> 25 <212> DNA <213> Artificial Sequence <400> 120 actcatttgtatctgaagtggaacc 25 <210> 121 <211> 20 <212> DNA <213> Artificial Sequence <400> 121 tggagcccagatggagaaaa 20 <210> 122 <211> 27 <212> DNA <213> Artificial Sequence <400> 122 attaaatgaggaaacagtggtaaataa 27 <210> 123 <211> 26 <212> DNA <213> Artificial Sequence <400> 123 gcaagtttttcaggtcatatgactga 26 <210> 124 <211> 23 <212> DNA <213> Artificial Sequence <400> 124 ctgtagctttgaagaatgcaggt 23 <210> 125 <211> 24 <212> DNA <213> Artificial Sequence <400> 125 gtccttaactagctcttttgggac 24 <210> 126 <211> 19 <212> DNA <213> Artificial Sequence <400> 126 gtcatgcctgcaggaagga 19 <210> 127 <211> 24 <212> DNA <213> Artificial Sequence <400> 127 tcctacttccaaggatgttctgtc 24 <210> 128 <211> 20 <212>DNA <213> Artificial Sequence <400> 128 tgagctgttgccacctgaaa 20 <210> 129 <211> 25 <212> DNA <213> Artificial Sequence <400> 129 ggaacttcatgaaacagacttgact 25 <210> 130 <211> 26 <212> DNA <213> Artificial Sequence <400> 130 aggtcaagatttaaaatcggacatct 26 <210> 131 <211> 27 <212> DNA <213> Artificial Sequence <400> 131 tctctgaacataacattaagaagagca 27 <210> 132 <211> 26 <212> DNA <213> Artificial Sequence <400> 132 tccaagcaggattttaattcaaacca 26 <210> 133 <211> 20 <212> DNA <213> Artificial Sequence <400> 133 atgccccatcgattggtcag 20 <210> 134 <211> 19 <212> DNA <213> Artificial Sequence <400> 134 tggcacaaaactgaatgtt 19 <210> 135 <211> 23 <212> DNA <213> Artificial Sequence <400> 135 atgactactggcacttttgttga 23 <210> 136 <211> 23 <212> DNA <213> Artificial Sequence <400> 136 ctgatcagcacaacatatgtctt 23 <210> 137 <211> 23 <212> DNA <213> Artificial Sequence <400> 137 tgggaaaaatattagtgtcgcca 23 <210> 138 <211> 26 <212> DNA <213> Artificial Sequence <400> 138 tgaggaaacagacatagttaaacaca 26 <210> 139 <211> 25 <212> DNA <213> Artificial Sequence <400> 139 tggacaaagtgaaaaacctttttga 25 <210> 140 <211> 22 <212> DNA <213> Artificial Sequence <400> 140 gtgccacctaagctcttaagtg 22 <210> 141 <211> 24 <212> DNA <213> Artificial Sequence <400> 141 gtgagtcagacttcattacttgaa 24 <210> 142 <211> 25 <212> DNA <213> Artificial Sequence <400> 142 agctattcctaccattctgatgagg 25 <210> 143 <211> 27 <212> DNA <213> Artificial Sequence <400> 143 acaaactgtaaatgaagatatttgcgt 27 <210> 144 <211> 26 <212> DNA <213> Artificial Sequence <400> 144 acaacgagaataaatcaaaaatttgc 26 <210> 145 <211> 26 <212> DNA <213> Artificial Sequence <400> 145 tgtgatgttagtttggaaacttcaga 26 <210> 146 <211> 22 <212> DNA <213> Artificial Sequence <400> 146 agtaccaagcaagtcttttcca 22 <210> 147 <211> 26 <212> DNA <213> Artificial Sequence <400> 147 ttccattttagaaagttccttacaca 26 <210> 148 <211> 24 <212> DNA <213> Artificial Sequence <400> 148 ggttcttcagaaaataatcactct 24 <210> 149 <211> 27 <212> DNA <213> Artificial Sequence <400> 149 tggtaaaactgaaactttttctgatgt 27 <210> 150 <211> 22 <212> DNA <213> Artificial Sequence <400> 150 ccaagtcatgccacacattctc 22 <210> 151 <211> 24 <212> DNA <213> Artificial Sequence <400> 151 agaaccctcaatcaaaagaaactt 24 <210> 152 <211> 21 <212> DNA <213> Artificial Sequence <400> 152 tgtctgccgaatacccaagtc 21 <210> 153 <211> 25 <212> DNA <213> Artificial Sequence <400> 153 taggcacaataaaagatcgaagatt 25 <210> 154 <211> 21 <212> DNA <213> Artificial Sequence <400> 154 gggtctgcaacaaaggcatat 21 <210> 155 <211> 24 <212> DNA <213> Artificial Sequence <400> 155 caagcaatttagcagtttcaggac 24 <210> 156 <211> 22 <212> DNA <213> Artificial Sequence <400> 156 tggaggaaaacagacaaaagca 22 <210> 157 <211> 21 <212> DNA <213> Artificial Sequence <400> 157 gccaggggttgtgctttttaa 21 <210> 158 <211> 20 <212> DNA <213> Artificial Sequence <400> 158 aacatccactctgcctcgaa 20 <210> 159 <211> 27 <212> DNA <213> Artificial Sequence <400> 159 tctaaacattgcataaaaattaacagc 27 <210> 160 <211> 20 <212> DNA <213> Artificial Sequence <400> 160 caggtgtggatccaaagctt 20 <210> 161 <211> 25 <212> DNA <213> Artificial Sequence <400> 161 gtggaattctagagtcacacttcct 25 <210> 162 <211> 23 <212> DNA <213> Artificial Sequence <400> 162 acttacagatgggtggtatgctg 23 <210> 163 <211> 22 <212> DNA <213>Artificial Sequence <400> 163 cctgaccctagaccttttcctc 22 <210> 164 <211> 21 <212> DNA <213> Artificial Sequence <400> 164 tgtgcctggcctgatacaatt 21 <210> 165 <211> 26 <212> DNA <213> Artificial Sequence <400> 165 tgcttggttctttagttttagttgct 26 <210> 166 <211> 23 <212> DNA <213> Artificial Sequence <400> 166 tgaagagcagttaagagccttga 23 <210> 167 <211> 26 <212> DNA <213> Artificial Sequence <400> 167 taaatgataatcacttcttccattgc 26 <210> 168 <211> 25 <212> DNA <213>Artificial Sequence <400> 168 tcttgcaacttcaaaatctaaaagt 25 <210> 169 <211> 27 <212> DNA <213> Artificial Sequence <400> 169 tcacttcagcaaatttttagatccaga 27 <210> 170 <211> 23 <212> DNA <213> Artificial Sequence <400> 170 cccctttcgtctatttgtcagac 23 <210> 171 <211> 22 <212> DNA <213> Artificial Sequence <400> 171 ttctgtgttttctgctagtcca 22 <210> 172 <211> 26 <212> DNA <213> Artificial Sequence <400> 172 tggaaacataaatatgtgggtttgca 26 <210> 173 <211> 22 <212> DNA <213>Artificial Sequence <400> 173 ttcaatgaaaagttactttgat 22 <210> 174 <211> 25 <212> DNA <213> Artificial Sequence <400> 174 acttcaaagtcttgtaaaggggaga 25 <210> 175 <211> 21 <212> DNA <213> Artificial Sequence <400> 175 tggcaccaaatacgaaacacc 21 <210> 176 <211> 24 <212> DNA <213> Artificial Sequence <400> 176 aacgacgttgtactacatctctga 24 <210> 177 <211> 20 <212> DNA <213> Artificial Sequence <400> 177 caggtaggtgtccagctcct 20 <210> 178 <211> 20 <212> DNA <213> Artificial Sequence <400> 178 actgacaggtgccagtcttg 20 <210> 179 <211> 20 <212> DNA <213> Artificial Sequence <400> 179 ttgctgtcactcatctgcct 20 <210> 180 <211> 22 <212> DNA <213> Artificial Sequence <400> 180 gtggtggggtgagatttttgtc 22 <210> 181 <211> 27 <212> DNA <213> Artificial Sequence <400> 181 agcaaatacatttttaactatatgact 27 <210> 182 <211> 22 <212> DNA <213> Artificial Sequence <400> 182 ttctgaggtgttaaagggagga 22 <210> 183 <211> 24 <212> DNA <213> Artificial Sequence <400> 183 acctgttttcataacaacatgagt 24 <210> 184 <211> 21 <212> DNA <213> Artificial Sequence <400> 184 tgaagctgtcaattctggctt 21 <210> 185 <211> 20 <212> DNA <213> Artificial Sequence <400> 185 ccaacacgagctgactctgg 20 <210> 186 <211> 27 <212> DNA <213> Artificial Sequence <400> 186 cagagtaaaatcaaagtgtttgttcca 27 <210> 187 <211> 23 <212> DNA <213> Artificial Sequence <400> 187 gcaaaaaactggagaaagtatgg 23 <210> 188 <211> 21 <212> DNA <213>Artificial Sequence <400> 188 ccagaaccaccatctttcagt 21 <210> 189 <211> 21 <212> DNA <213> Artificial Sequence <400> 189 cctcaagggcagaagagtcac 21 <210> 190 <211> 22 <212> DNA <213> Artificial Sequence <400> 190 acacgctttttacctgagtggt 22 <210> 191 <211> 20 <212> DNA <213> Artificial Sequence <400> 191 cttccaagcccgttcctctt 20 <210> 192 <211> 25 <212> DNA <213> Artificial Sequence <400> 192 gtgaagaaaacaagctagcagaaca 25 <210> 193 <211> 21 <212> DNA <213> Artificial Sequence <400> 193 acggtgctatgcctagtagac 21 <210> 194 <211> 20 <212> DNA <213> Artificial Sequence <400> 194 ggctaggactcctgctaagc 20 <210> 195 <211> 25 <212> DNA <213> Artificial Sequence <400> 195 caggatgcttacaattacttccagg 25 <210> 196 <211> 22 <212> DNA <213> Artificial Sequence <400> 196 aatattgcttgagctggcttct 22 <210> 197 <211> 23 <212> DNA <213> Artificial Sequence <400> 197 aagtggtggtatacgatatgggt 23 <210> 198 <211> 19 <212> DNA <213> Artificial Sequence <400> 198 gaccaaccacaggaaagcc 19 <210> 199 <211> 21 <212> DNA <213> Artificial Sequence <400> 199 aaaacggagcaaatgactggc 21 <210> 200 <211> 20 <212> DNA <213> Artificial Sequence <400> 200 atgctgcacactgactcaca 20 <210> 201 <211> 24 <212> DNA <213> Artificial Sequence <400> 201 accctttctccacttaacatgaga 24 <210> 202 <211> 24 <212> DNA <213> Artificial Sequence <400> 202 aggtgcatttgttaacttcagctc 24 <210> 203 <211> 25 <212> DNA <213> ArtificialSequence <400> 203 ttgcaattcagtacaattaggtggg 25 <210> 204 <211> 22 <212> DNA <213> Artificial Sequence <400> 204 aagcagattctttttcgagtga 22 <210> 205 <211> 24 <212> DNA <213> Artificial Sequence <400> 205 ctgatgtaggtctccttttacgct 24 <210>206 <211> 25 <212> DNA <213> Artificial Sequence <400> 206 tctctactgatttggagtgaactct 25 <210> 207 <211> 24 <212> DNA <213> Artificial Sequence <400> 207 tcatcacttctggaaaaccactca 24 <210> 208 <211> 24 <212> DNA <213> ArtificialSequence <400> 208 gtccgcctatcattacatgtttcc 24 <210> 209 <211> 21 <212> DNA <213> Artificial Sequence <400> 209 catggctccacatgcaagttt 21 <210> 210 <211> 27 <212> DNA <213> Artificial Sequence <400> 210 taactaaataggaaaataccagcttca 27 <210> 211 <211> 23 <212> DNA <213> Artificial Sequence <400> 211 acccaattcaatgtagacagacg 23 <210> 212 <211> 20 <212> DNA <213> Artificial Sequence <400> 212 tttggcacggtttctgtagc 20 <210> 213 <211> 21 <212> DNA <213> Artificial Sequence <400> 213 actccaaacctgtgtcaagct 21 <210> 214 <211> 26 <212> DNA <213> Artificial Sequence <400> 214 gaacgctatgttattaaataatttct 26 <210> 215 <211> 25 <212> DNA <213> Artificial Sequence <400> 215 ggtcaattctgttcatttgcatagg 25 <210> 216 <211> 20 <212> DNA <213> Artificial Sequence <400> 216 cagggttcacaacgccttac 20 <210> 217 <211> 19 <212> DNA <213> Artificial Sequence <400> 217 cggggctcgaatttgcttg 19 <210> 218 <211> 22 <212> DNA <213> Artificial Sequence <400> 218 tgtcaatacctgctttgttgca 22 <210> 219 <211> 26 <212> DNA <213> Artificial Sequence <400> 219 tgctctttgaatattattggagttga 26 <210> 220 <211> 21 <212> DNA <213> Artificial Sequence <400> 220 agaagtggacaggaaacatca 21 <210> 221 <211> 27 <212> DNA <213> Artificial Sequence <400> 221 aaaaggggaaaattgttaagttttatt 27 <210> 222 <211> 25 <212> DNA <213> Artificial Sequence <400> 222 tgacaattatcaacctcatctgctc 25 <210> 223 <211> 26 <212> DNA <213> Artificial Sequence <400> 223 acaacaacaacaaaaaaacctgtagt 26 <210> 224 <211> 24 <212> DNA <213> Artificial Sequence <400> 224 tcttctaggacatttggcattgac 24 <210> 225 <211> 27 <212> DNA <213> Artificial Sequence <400> 225 tgctacatttgaatctaatggatcagt 27 <210> 226 <211> 27 <212> DNA <213> Artificial Sequence <400> 226 ggtcacatgaagaaatatgcaataggg 27 <210> 227 <211> 20 <212> DNA <213> Artificial Sequence <400> 227 ttgcctgctttactgcaaga 20 <210> 228 <211> 21 <212> DNA <213> Artificial Sequence <400> 228 ccagtccactttcagaggctt 21 <210> 229 <211> 23 <212> DNA <213> Artificial Sequence <400> 229 tttgttttctttttcaaagtgga 23 <210> 230 <211> 22 <212> DNA <213> Artificial Sequence <400> 230 aggaatcgtcatctataaaact 22 <210> 231 <211> 27 <212> DNA <213> Artificial Sequence <400> 231 acatgtttcatttctagaacatttcct 27 <210> 232 <211> 26 <212> DNA <213> Artificial Sequence <400> 232 gccaagacctcttcttttatatctga 26 <210> 233 <211> 25 <212> DNA <213> Artificial Sequence <400> 233 ttgcctctagaaatcatgactaggt 25 <210> 234 <211> 24 <212> DNA <213> Artificial Sequence <400> 234 ttgaaggtgatgctactctcatgt 24 <210> 235 <211> 25 <212> DNA <213> Artificial Sequence <400> 235 ccatggtagagttcttgaaaatggg 25 <210> 236 <211> 21 <212> DNA <213> Artificial Sequence <400> 236 agagtcctgcccatttgttca 21 <210> 237 <211> 26 <212> DNA <213> Artificial Sequence <400> 237 tgccaaggtatttacaatttcaacac 26 <210> 238 <211> 24 <212> DNA <213> Artificial Sequence <400> 238 agttctgtaatttctgccttttgg 24 <210> 239 <211> 24 <212> DNA <213> Artificial Sequence <400> 239 caactgtaccttcaaattgcttgc 24 <210> 240 <211> 22 <212> DNA <213> Artificial Sequence <400> 240 acagtttcacagctttttgcag 22 <210> 241 <211> 27 <212> DNA <213> Artificial Sequence <400> 241 ttcagtatttctcttgtaattttcagt 27 <210> 242 <211> 21 <212> DNA <213> Artificial Sequence <400> 242 tccctccttcataaactggcc 21 <210> 243 <211> 23 <212>DNA <213> Artificial Sequence <400> 243 ttcttctggtttctgatcaaaga 23 <210> 244 <211> 26 <212> DNA <213> Artificial Sequence <400> 244 gtcactagttgatttccagtaccaac 26 <210> 245 <211> 25 <212> DNA <213> Artificial Sequence <400> 245 gatggctaaaactggtgatttcact 25 <210> 246 <211> 26 <212> DNA <213> Artificial Sequence <400> 246 ttgatgttttgagattttcagtttgt 26 <210> 247 <211> 25 <212> DNA <213> Artificial Sequence <400> 247 ccatcaaatattccttctctaagcc 25 <210> 248 <211> 22 <212> DNA <213> Artificial Sequence <400> 248 ttttgagagatatcctgaatca 22 <210> 249 <211> 20 <212> DNA <213> Artificial Sequence <400> 249 tgcagggtgaagagctagtc 20 <210> 250 <211> 21 <212> DNA <213> Artificial Sequence <400> 250 tccaatgcctcgtaacaacct 21 <210> 251 <211> 24 <212> DNA <213> Artificial Sequence <400> 251 tcccacaagtatttgcagatgaga 24 <210> 252 <211> 27 <212> DNA <213> Artificial Sequence <400> 252 acgtatagcagtattttcttctcttgt 27 <210> 253 <211> 22 <212>DNA <213> Artificial Sequence <400> 253 atcaaattcctctaacactccc 22 <210> 254 <211> 25 <212> DNA <213> Artificial Sequence <400> 254 tgtttgtcttgttgaaattgagaga 25 <210> 255 <211> 26 <212> DNA <213> Artificial Sequence <400> 255 tctgaatctttggagtaagtagaaca 26 <210> 256 <211> 26 <212> DNA <213> Artificial Sequence <400> 256 tctcctcttctttttccaattcttga 26 <210> 257 <211> 24 <212> DNA <213> Artificial Sequence <400> 257 agtgctttttgaagcctttaagga 24 <210> 258 <211> 25 <212> DNA <213> Artificial Sequence <400> 258 accttttacttgaaagaataaccaa 25 <210> 259 <211> 19 <212> DNA <213> Artificial Sequence <400> 259 cgaaagggtacacaggtaa 19 <210> 260 <211> 24 <212> DNA <213> Artificial Sequence <400> 260 tcatttcttgtagcagaaacttga 24 <210> 261 <211> 22 <212> DNA <213> Artificial Sequence <400> 261 tcatcagagccatgtccatcaa 22 <210> 262 <211> 26 <212> DNA <213> Artificial Sequence <400> 262 accatcaggacattatttaacaacgg 26 <210> 263 <211> 20 <212> DNA <213> Artificial Sequence <400> 263 gagggaacttggcctcctac 20 <210> 264 <211> 27 <212> DNA <213> Artificial Sequence <400> 264 actttccttaccaaaataatcttcagt 27 <210> 265 <211> 22 <212> DNA <213> Artificial Sequence <400> 265 gagaagaaagagggatgaggga 22 <210> 266 <211> 23 <212> DNA <213> Artificial Sequence <400> 266 gccagtttccatatgatccatct 23 <210> 267 <211> 24 <212> DNA <213> Artificial Sequence <400> 267 catggaagtcacagactacacaga 24 <210> 268 <211> 20 <212> DNA <213> Artificial Sequence <400> 268 gggaggatctaactgggcct 20 <210> 269 <211> 27 <212> DNA <213> Artificial Sequence <400> 269 acttctagaatttaactgaatcaatga 27 <210> 270 <211> 21 <212> DNA <213> Artificial Sequence <400> 270 tccatcactgaaaagcgatga 21 <210> 271 <211> 27 <212> DNA <213> Artificial Sequence <400> 271 ttgttctcatattagaaataacaatgt 27 <210> 272 <211> 23 <212> DNA <213> Artificial Sequence <400> 272 gccagagagtctaaaacagcttc 23 <210> 273 <211> 22 <212>DNA <213> Artificial Sequence <400> 273 tccatggccttcctaatttcca 22 <210> 274 <211> 22 <212> DNA <213> Artificial Sequence <400> 274 ttttgttagtaaggtcattttt 22 <210> 275 <211> 22 <212> DNA <213> Artificial Sequence <400> 275 ccggtagttgttgatactgagt 22 <210> 276 <211> 21 <212> DNA <213> Artificial Sequence <400> 276 tccacctcagaacaagatggc 21 <210> 277 <211> 26 <212> DNA <213> Artificial Sequence <400> 277 gcttaataatgtcctcattaaggtct 26 <210> 278 <211> 22 <212> DNA <213> Artificial Sequence <400> 278 atgtgtggtgatgctgaaaagt 22 <210> 279 <211> 24 <212> DNA <213> Artificial Sequence <400> 279 tctaagaaaataagtggaaaagct 24 <210> 280 <211> 25 <212> DNA <213> Artificial Sequence <400> 280 acgatggcctccatatatacttctt 25 <210> 281 <211> 25 <212> DNA <213> Artificial Sequence <400> 281 tgcagttcttttggtcatcaatctc 25 <210> 282 <211> 23 <212> DNA <213> Artificial Sequence <400> 282 tggagtcatctgaggagaattca 23 <210> 283 <211> 20 <212> DNA <213> Artificial Sequence <400> 283 gcctgggaactctcctgttc 20 <210> 284 <211> 20 <212> DNA <213> Artificial Sequence <400> 284 cgagagtgggtgttggacag 20 <210> 285 <211> 25 <212> DNA <213> Artificial Sequence <400> 285 agtcctactttgacactttgaatgc 25 <210> 286 <211> 20 <212> DNA <213> Artificial Sequence <400> 286 agagtgtagggtagagggcc 20 <210> 287 <211> 20 <212> DNA <213> Artificial Sequence <400> 287 tctgcccagggacttaggtc 20 <210> 288 <211> 21 <212> DNA <213> Artificial Sequence <400> 288 cttctctccattcccctgtcc 21 <210> 289 <211> 25 <212> DNA <213> Artificial Sequence <400> 289 aggaagcttctctttctcttatcct 25 <210> 290 <211> 25 <212> DNA <213> Artificial Sequence <400> 290 agcacttcctgattttgttttcaac 25 <210> 291 <211> 20 <212> DNA <213> Artificial Sequence <400> 291 tgctcgtgtacaagtttgcc 20 <210> 292 <211> 21 <212> DNA <213> Artificial Sequence <400> 292 ggaagaaagtgtgagcaggga 21 <210> 293 <211> 21 <212> DNA <213>Artificial Sequence <400> 293 cctggaatctggaatcagcct 21 <210> 294 <211> 21 <212> DNA <213> Artificial Sequence <400> 294 cacaattggtggcgatggttt 21 <210> 295 <211> 27 <212> DNA <213> Artificial Sequence <400> 295 cctgaattatcactatcagaacaaagc 27 <210> 296 <211> 25 <212> DNA <213> Artificial Sequence <400> 296 acaactccatgttttctaaaaggcc 25 <210> 297 <211> 20 <212> DNA <213> Artificial Sequence <400> 297 catgggagccagccttctaa 20 <210> 298 <211> 23 <212> DNA <213> Artificial Sequence <400> 298 agtgaaacaagcgtctctgaaga 23 <210> 299 <211> 20 <212> DNA <213> Artificial Sequence <400> 299 agggagttggtctgagtgac 20 <210> 300 <211> 20 <212> DNA <213> Artificial Sequence <400> 300 ttggcaaaggcatctcagga 20 <210> 301 <211> 20 <212> DNA <213> Artificial Sequence <400> 301 agagcttccctgcttccaac 20 <210> 302 <211> 22 <212> DNA <213> Artificial Sequence <400> 302 gctgtttttagcaaaagcgtcc 22 <210> 303 <211> 25 <212> DNA <213>Artificial Sequence <400> 303 gcaacctgaggtctataaacaaagt 25 <210> 304 <211> 21 <212> DNA <213> Artificial Sequence <400> 304 acagtgagcacaattagccgt 21 <210> 305 <211> 27 <212> DNA <213> Artificial Sequence <400> 305 actcattactccaaataaacatggact27 <210> 306 <211> 26 <212> DNA <213> Artificial Sequence <400> 306 gagtctaatatcaagcctgtacagac 26 <210> 307 <211> 24 <212> DNA <213> Artificial Sequence <400> 307 tggaagaaagtgaacttgatgctc 24 <210> 308 <211> 21 <212> DNA <213>Artificial Sequence <400> 308 agcactctagggaaggcaaaa 21 <210> 309 <211> 25 <212> DNA <213> Artificial Sequence <400> 309 aagtgtctaataatgctgaagaccc 25 <210> 310 <211> 20 <212> DNA <213> Artificial Sequence <400> 310 tgcaactggagccaagaaga 20 <210> 311 <211> 23 <212> DNA <213> Artificial Sequence <400> 311 tcatgcgcttgaactagtagtca 23 <210> 312 <211> 25 <212> DNA <213> Artificial Sequence <400> 312 tcagaatgagaaaaatcctaaccca 25 <210> 313 <211> 23 <212>DNA <213> Artificial Sequence <400> 313 agccacagataatacaagagcgt 23 <210> 314 <211> 25 <212> DNA <213> Artificial Sequence <400> 314 gagaaaatagacttactggccagtg 25 <210> 315 <211> 25 <212> DNA <213> Artificial Sequence <400> 315 tccttggataacactaaatagcagc 25 <210> 316 <211> 21 <212> DNA <213> Artificial Sequence <400> 316 gcaaggagccaacataacaga 21 <210> 317 <211> 21 <212> DNA <213> Artificial Sequence <400> 317 cagctgagaggcatccagaaa 21 <210> 318 <211> 24 <212> DNA <213>Artificial Sequence <400> 318 ttgatcttggtcatttgacagttc 24 <210> 319 <211> 22 <212> DNA <213> Artificial Sequence <400> 319 gtgtccaactctctaaccttgg 22 <210> 320 <211> 26 <212> DNA <213> Artificial Sequence <400> 320 aaaagatgaagtttctatcatccaaa 26 <210> 321 <211> 23 <212> DNA <213> Artificial Sequence <400> 321 tcaggagcctacaagaaagtacg 23 <210> 322 <211> 26 <212> DNA <213> Artificial Sequence <400> 322 caaaaggaagtaaattaaattgttct 26 <210> 323 <211> 22 <212> DNA <213>Artificial Sequence <400> 323 ttgagcctcatttattttcttt 22 <210> 324 <211> 24 <212> DNA <213> Artificial Sequence <400> 324 atgaagttgtcattttataaacct 24 <210> 325 <211> 24 <212> DNA <213> Artificial Sequence <400> 325 cagataaattaaaactgcgactgc24 <210> 326 <211> 21 <212> DNA <213> Artificial Sequence <400> 326 gcagagacaaaagggcaagaa 21 <210> 327 <211> 22 <212> DNA <213> Artificial Sequence <400> 327 gtactgggtttttagcaagcat 22 <210> 328 <211> 26 <212> DNA <213> ArtificialSequence <400> 328 tgttgtttttatgttcagattcttct 26 <210> 329 <211> 26 <212> DNA <213> Artificial Sequence <400> 329 tgcctaaattcctagtttgtagttct 26 <210> 330 <211> 25 <212> DNA <213> Artificial Sequence <400> 330 agaacaaatatatgtaggaaaatgt 25 <210> 331 <211> 20 <212> DNA <213> Artificial Sequence <400> 331 cagggcaaaggtataacgct 20 <210> 332 <211> 20 <212> DNA <213> Artificial Sequence <400> 332 aagggtgggtggtgtagcta 20 <210> 333 <211> 24 <212> DNA <213> Artificial Sequence <400>333 acaaggcattccaaaattgttagc 24 <210> 334 <211> 21 <212> DNA <213> Artificial Sequence <400> 334 tgacttgcagcttctctttga 21 <210> 335 <211> 20 <212> DNA <213> Artificial Sequence <400> 335 gcgtttgcttcatggaaaat 20 <210> 336 <211> 23 <212> DNA <213> Artificial Sequence <400> 336 ctgaaagggttagttgagaccat 23 <210> 337 <211> 25 <212> DNA <213> Artificial Sequence <400> 337 ccactgtttcctcatttaatggctt 25 <210> 338 <211> 23 <212> DNA <213> Artificial Sequence <400> 338 gacctgaaaaacttgcattgaaa 23 <210> 339 <211> 18 <212> DNA <213> Artificial Sequence <400> 339 tctgtgtggtggtggctg 18 <210> 340 <211> 21 <212> DNA <213> Artificial Sequence <400> 340 gcttcaaactgggctgaacag 21 <210> 341 <211> 21 <212> DNA <213>Artificial Sequence <400> 341 acagagaatcagcttctgggg 21 <210> 342 <211> 25 <212> DNA <213> Artificial Sequence <400> 342 tctgggattgaaagtcagtatcact 25 <210> 343 <211> 26 <212> DNA <213> Artificial Sequence <400> 343 agcacatacatcttgattcttttcca 26 <210> 344 <211> 25 <212> DNA <213> Artificial Sequence <400> 344 tgtctgagaaaagttcttcagagtc 25 <210> 345 <211> 26 <212> DNA <213> Artificial Sequence <400> 345 acctagagtcatttttatatgctgct 26 <210> 346 <211> 26 <212> DNA <213> Artificial Sequence <400> 346 agcttgatttccttatttgaagctgt 26 <210> 347 <211> 23 <212> DNA <213> Artificial Sequence <400> 347 acactactctgtaaatgtgcaga 23 <210> 348 <211> 27 <212> DNA <213> Artificial Sequence <400> 348 gaagtggtctttaagatagtcatctgg 27 <210> 349 <211> 20 <212> DNA <213> Artificial Sequence <400> 349 aaaagcccctaaaccccact 20 <210> 350 <211> 26 <212> DNA <213> Artificial Sequence <400> 350 aacattgaaacaacagaatcatgaca 26 <210> 351 <211> 24 <212>DNA <213> Artificial Sequence <400> 351 acaaacagtatcatttttacttga 24 <210> 352 <211> 27 <212> DNA <213> Artificial Sequence <400> 352 agcagttaactgttctttatttgaagt 27 <210> 353 <211> 27 <212> DNA <213> Artificial Sequence <400> 353 tgtctgtttcctcataacttagaatgt 27 <210> 354 <211> 21 <212> DNA <213> Artificial Sequence <400> 354 cccgctagctgtatgaaaacc 21 <210> 355 <211> 20 <212> DNA <213> Artificial Sequence <400> 355 tttggggcagctgtgatctc 20 <210> 356 <211> 25 <212> DNA <213>Artificial Sequence <400> 356 actgaataaggggactgatttgtgt 25 <210> 357 <211> 23 <212> DNA <213> Artificial Sequence <400> 357 tttcggagagatgatttttgtca 23 <210> 358 <211> 23 <212> DNA <213> Artificial Sequence <400> 358 gcatttgcatcttttacattgga 23 <210> 359 <211> 22 <212> DNA <213> Artificial Sequence <400> 359 tgtgaaacacaaacgattttac 22 <210> 360 <211> 22 <212> DNA <213> Artificial Sequence <400> 360 gaaactttctccaatccagaca 22 <210> 361 <211> 21 <212>DNA <213> Artificial Sequence <400> 361 aacacttgtcttgcgttttgt 21 <210> 362 <211> 25 <212> DNA <213> Artificial Sequence <400> 362 tccagagaaagcagatgaatttacc 25 <210> 363 <211> 23 <212> DNA <213> Artificial Sequence <400> 363 tctgagtttacacagtgctctgg 23 <210> 364 <211> 26 <212> DNA <213> Artificial Sequence <400> 364 ccatttttacgtttttaggtgaagcc 26 <210> 365 <211> 23 <212> DNA <213> Artificial Sequence <400> 365 ttggcagtttagaatctgtcagt 23 <210> 366 <211> 27 <212> DNA <213>Artificial Sequence <400> 366 acactttaaaaatagtgattggcaaca 27 <210> 367 <211> 25 <212> DNA <213> Artificial Sequence <400> 367 ggtcagaatattatataccatacct 25 <210> 368 <211> 20 <212> DNA <213> Artificial Sequence <400> 368 tgcttgcatacttcagtgcg20 <210> 369 <211> 26 <212> DNA <213> Artificial Sequence <400> 369 ataaaacgggaagtgttaacttctta 26 <210> 370 <211> 26 <212> DNA <213> Artificial Sequence <400> 370 acaaatgagatttagacagaaattct 26 <210> 371 <211> 24 <212> DNA <213>Artificial Sequence <400> 371 tcctaacacactgttcaactctgt 24 <210> 372 <211> 25 <212> DNA <213> Artificial Sequence <400> 372 cctaaaggttcttcttcacactttg 25 <210> 373 <211> 19 <212> DNA <213> Artificial Sequence <400> 373 tgcctggctgtggaaagac19 <210> 374 <211> 25 <212> DNA <213> Artificial Sequence <400> 374 gccatttgtagatactagttaatga 25 <210> 375 <211> 22 <212> DNA <213> Artificial Sequence <400> 375 cctttccatcattggagggtat 22 <210> 376 <211> 25 <212> DNA <213>Artificial Sequence <400> 376 gcctgtattttagttgaagaagcac 25 <210> 377 <211> 24 <212> DNA <213> Artificial Sequence <400> 377 tgtcagaaacacagagaacaagtg 24 <210> 378 <211> 21 <212> DNA <213> Artificial Sequence <400> 378 gattctggggcttcaagaggt21 <210> 379 <211> 27 <212> DNA <213> Artificial Sequence <400> 379 ttgtatcaaaagaaagaaatatatggt 27 <210> 380 <211> 21 <212> DNA <213> Artificial Sequence <400> 380 gggcctccacatattttgctg 21 <210> 381 <211> 20 <212> DNA <213>Artificial Sequence <400> 381 aaagctctgcaccatcttgc 20 <210> 382 <211> 20 <212> DNA <213> Artificial Sequence <400> 382 atacgcaacttccacacggt 20 <210> 383 <211> 26 <212> DNA <213> Artificial Sequence <400> 383 tttgaagttgcaagatgataaattct 26 <210> 384 <211> 26 <212> DNA <213> Artificial Sequence <400> 384 tggagattccataaactaacaagcac 26 <210> 385 <211> 23 <212> DNA <213> Artificial Sequence <400> 385 agagattttaaaagacaatgttt 23 <210> 386 <211> 24 <212> DNA <213> Artificial Sequence <400> 386 cagcaaataaagtaagaaggcctg 24 <210> 387 <211> 25 <212> DNA <213> Artificial Sequence <400> 387 aagctatttccttgatactggactg 25 <210> 388 <211> 21 <212> DNA <213> Artificial Sequence <400> 388 acagtctttagttggggtgga 21 <210> 389 <211> 22 <212> DNA <213> Artificial Sequence <400> 389 ggaaacagacttccttttggcc 22 <210> 390 <211> 20 <212> DNA <213> Artificial Sequence <400> 390 gtgcagccggagaaacaaat 20 <210> 391 <211> 21 <212> DNA <213>Artificial Sequence <400> 391 accagacaaaagagcttgggt 21 <210> 392 <211> 21 <212> DNA <213> Artificial Sequence <400> 392 ctggaaaggttaagcgtcaat 21 <210> 393 <211> 24 <212> DNA <213> Artificial Sequence <400> 393 agtccaggagaatgaattgacact 24 <210> 394 <211> 23 <212> DNA <213> Artificial Sequence <400> 394 agatcaactggaatggatggtac 23 <210> 395 <211> 20 <212> DNA <213> Artificial Sequence <400> 395 acaaaggccttggtgtgtgt 20 <210> 396 <211> 21 <212> DNA <213> ArtificialSequence <400> 396 tcctgatgggttgtgtttggt 21 <210> 397 <211> 22 <212> DNA <213> Artificial Sequence <400> 397 agcacgttcttctgctgtatgt 22 <210> 398 <211> 25 <212> DNA <213> Artificial Sequence <400> 398 aatcctttgagtgtttttcattctg 25 <210> 399 <211> 23 <212> DNA <213> Artificial Sequence <400> 399 aactagtattctgagctgtgtgc 23 <210> 400 <211> 23 <212> DNA <213> Artificial Sequence <400> 400 accatcttcaacctctgcattga 23 <210> 401 <211> 26 <212> DNA <213> Artificial Sequence <400> 401 actttgtaattcaacattcatcgttg 26 <210> 402 <211> 24 <212> DNA <213> Artificial Sequence <400> 402 tcaagaggagctcattaaggttgt 24 <210> 403 <211> 23 <212> DNA <213> Artificial Sequence <400> 403 ccctataagccagaatccagaag 23 <210> 404 <211> 21 <212> DNA <213> Artificial Sequence <400> 404 ttttgaacagtacccgttccc 21 <210> 405 <211> 27 <212> DNA <213> Artificial Sequence <400> 405 gcttctcaaagtatttcattttcttgg 27 <210> 406 <211> 22 <212> DNA <213> Artificial Sequence <400> 406 cagtcctgccaatgagaagaaa 22 <210> 407 <211> 23 <212> DNA <213> Artificial Sequence <400> 407 gtgaattggaagacttgactgca 23 <210> 408 <211> 24 <212> DNA <213> Artificial Sequence <400> 408 cgagtgtctgtctaagaacacaga 24 <210> 409 <211> 20 <212> DNA <213> Artificial Sequence <400> 409 atttggctcagggttaccga 20 <210> 410 <211> 23 <212> DNA <213> Artificial Sequence <400> 410 acttagaacagcctatgggaagt 23 <210> 411 <211> 25 <212> DNA <213> Artificial Sequence <400> 411 gggctccagtattaatgaaataggt 25 <210> 412 <211> 24 <212> DNA <213> Artificial Sequence <400> 412 tctgctagaggaaaactttgagga 24 <210> 413 <211> 22 <212> DNA <213> Artificial Sequence <400> 413 agccagttgataatgccaaatg 22 <210> 414 <211> 20 <212> DNA <213> Artificial Sequence <400> 414 tgcaacattctctgcccact 20 <210> 415 <211> 24 <212> DNA <213> Artificial Sequence <400> 415 tgacacagaaggctttaagtatcc 24 <210> 416 <211> 25 <212> DNA <213> Artificial Sequence <400> 416 tgcaaactgaaagatctgtagagag 25 <210> 417 <211> 24 <212> DNA <213> Artificial Sequence <400> 417 tgcacctggttcttttactaagtg 24 <210> 418 <211> 20 <212> DNA <213> Artificial Sequence <400> 418 acaaccaaatgccagtcagg 20 <210> 419 <211> 25 <212> DNA <213> Artificial Sequence <400> 419 agcagcagtataagcaatatggaac 25 <210> 420 <211> 22 <212> DNA <213> Artificial Sequence <400> 420 tggcagttcaaaagactcctga 22 <210> 421 <211> 23 <212> DNA <213> Artificial Sequence <400> 421 tgggaaaacctatcggaagaagg 23 <210> 422 <211> 24 <212> DNA <213> Artificial Sequence <400> 422 gggagtctgaatcaaatgccaaag 24 <210> 423 <211> 21 <212> DNA <213> Artificial Sequence <400> 423 tctgaatgctgatcccctgtg 21 <210> 424 <211> 23 <212> DNA <213> Artificial Sequence <400> 424 agaacagcagtttattactcact 23 <210> 425 <211> 23 <212> DNA <213> Artificial Sequence <400> 425 tgacaattcagtttttgagtacc 23 <210> 426 <211> 26 <212> DNA <213> Artificial Sequence <400> 426 tttcaacaagtacatttttttaaccc 26 <210> 427 <211> 21 <212> DNA <213> Artificial Sequence <400> 427 acagaactggccaacaattgc 21 <210> 428 <211> 24 <212> DNA <213> Artificial Sequence <400> 428 acatttttctctaactgcaaacat 24 <210> 429 <211> 27 <212> DNA <213> Artificial Sequence <400> 429 agtgtccttaaaaggttgataatcact 27 <210> 430 <211> 22 <212> DNA <213> Artificial Sequence <400> 430 tgcatgctgaaacttctcaacc 22 <210> 431 <211> 22 <212> DNA <213> Artificial Sequence <400> 431 tggatttatctgctcttcgcgt 22 <210> 432 <211> 22 <212> DNA <213> Artificial Sequence <400> 432 aaaggtagtagagtcccgggaa 22 <210> 433 <211> 23 <212> DNA <213> Artificial Sequence <400> 433 cctacacgacgctcttccgatct 23 <210> 434 <211> 24 <212> DNA <213> Artificial Sequence <400> 434 gttccttggcacccgagaattcca 24 <210> 435 <211> 70 <212> DNA <213> Artificial Sequence <400> 435 aatgatacggcgaccaccgagatctacacnnnnnnnnacactctttccctacacgacgct 60 cttccgatct 70 <210> 436 <211> 59 <212> DNA <213> Artificial Sequence <400> 436 caagcagaagacggcatacgagatnnnnnnnngtgactggagttccttggcacccgaga 59 <210> 437 <211> 20 <212> DNA <213> Artificial Sequence <400>437 agtggtggtggtagtgggtt 20 <210> 438 <211> 20 <212> DNA <213> Artificial Sequence <400> 438 cgggcaaggacctttctctc 20 <210> 439 <211> 20 <212> DNA <213> Artificial Sequence <400> 439 aaactagtttttgccagttt 20 <210> 440 <211> 25 <212> DNA <213> Artificial Sequence <400> 440 aacatttctagtattctaagaataa 25 <210> 441 <211> 27 <212> DNA <213> Artificial Sequence <400> 441 agctatttttccaatcatgatgaaagt 27 <210> 442 <211> 21 <212> DNA <213> Artificial Sequence <400> 442 tcaaaacaacaacaacaaaaa 21 <210> 443 <211> 22 <212> DNA <213> Artificial Sequence <400> 443 tgccacgtatttctagcctacc 22 <210> 444 <211> 20 <212> DNA <213> Artificial Sequence <400> 444 ttgcctgctttactgcaaga 20 <210> 445 <211> 22 <212> DNA <213> Artificial Sequence <400> 445 agctgacgaagaacttgcattg 22 <210> 446 <211> 20 <212> DNA <213> Artificial Sequence <400> 446 gtactggcctgggaactctc 20 <210> 447 <211> 20 <212> DNA <213> Artificial Sequence <400> 447 caaaggctggtgctggaact 20 <210> 448 <211> 21 <212> DNA <213> Artificial Sequence <400> 448 tccttctctccattcccctgt 21 <210> 449 <211> 20 <212> DNA <213> Artificial Sequence <400> 449 tgcaaaggacaccacacaca 20 <210> 450 <211> 19 <212> DNA <213> Artificial Sequence <400> 450 ggtgaagcagcatctgggt 19 <210> 451 <211> 21 <212> DNA <213> Artificial Sequence <400> 451 tttttgcagaatccaaactga 21 <210> 452 <211> 22 <212> DNA <213> Artificial Sequence <400> 452 gacagttctgcatacatgtaac 22 <210> 453 <211> 23 <212> DNA <213> Artificial Sequence <400> 453 agaaaagaagaagaagaagaaga 23 <210> 454 <211> 23 <212> DNA <213> Artificial Sequence <400> 454 aactctcctgaacatctaaaaga 23 <210> 457 <211> 20 <212> DNA <213> Artificial Sequence <400> 457 ccagtaccccagagcatcac 20 <210> 458 <211> 20 <212> DNA <213> Artificial Sequence <400> 458 gagctcgctgagacttcctg 20 <210> 459 <211> 19 <212> DNA <213> Artificial Sequence <400> 459 agaagcgtgaggggacaga 19 <210> 460 <211> 18 <212> DNA <213> Artificial Sequence <400> 460 ctggactgggactgcgga 18 <210> 461 <211> 24 <212> DNA <213> Artificial Sequence <400> 461 caagcattggaggaatatcgtagg 24 <210> 462 <211> 20 <212> DNA <213> Artificial Sequence <400> 462 agaaaacactttctcggtgt 20 <210> 463 <211> 24 <212> DNA <213> Artificial Sequence <400> 463 actgttctgggtcacaaatttgtc 24 <210> 464 <211> 22 <212> DNA <213> Artificial Sequence <400> 464 cagattcttctgcaggttcaga 22 <210> 465 <211> 26 <212> DNA <213> Artificial Sequence <400> 465 acgaaccaaacctatttaaaactcca 26 <210> 466 <211> 26 <212> DNA <213> Artificial Sequence <400> 466 tgcctaaattcctagtttgtagttct 26 <210> 467 <211> 25 <212> DNA <213> Artificial Sequence <400> 467 cttagaatactagaaatgttaataa 25 <210> 468 <211> 26 <212> DNA <213> Artificial Sequence <400> 468 ttgtcaaattctcaattactaagtca 26 <210> 469 <211> 22 <212> DNA <213> Artificial Sequence <400> 469 agagcagcatcttgaatctcat 22 <210> 470 <211> 27 <212> DNA <213> Artificial Sequence <400> 470 tctctttaggtgattctcttattctga 27 <210> 471 <211> 26 <212> DNA <213> Artificial Sequence <400> 471 tgtttcctaggcacaataaaagatcg 26 <210> 472 <211> 24 <212> DNA <213> Artificial Sequence <400> 472 atgttcatttataaaaacgagact 24 <210> 473 <211> 24 <212> DNA <213> Artificial Sequence <400> 473 cgtatggcgtttctaaacattgca 24 <210> 474 <211> 20 <212> DNA <213> Artificial Sequence <400> 474 agggtatgagccatccacca 20 <210> 475 <211> 24 <212> DNA <213> Artificial Sequence <400> 475 atgataatcacttcttccattgca 24 <210> 476 <211> 27 <212> DNA <213> Artificial Sequence <400> 476 agatgataaattctgtatctctttcct 27 <210> 477 <211> 21 <212> DNA <213> Artificial Sequence <400> 477 aagatgtcagataccacagca 21 <210> 478 <211> 20 <212> DNA <213> Artificial Sequence <400> 478 aagccagaatccagaaggcc 20 <210> 479 <211> 20 <212> DNA <213> Artificial Sequence <400> 479 aagggaaagaggagaggcac 20 <210> 480 <211> 22 <212> DNA <213> Artificial Sequence <400> 480 gtggggcattcctttttgaaca 22 <210> 481 <211> 21 <212> DNA <213> Artificial Sequence <400> 481 gtcactctgagaggatagccc 21 <210> 482 <211> 19 <212> DNA <213> Artificial Sequence <400> 482 gacacagcaagttgcagcg 19 <210> 483 <211> 20 <212> DNA <213> Artificial Sequence <400> 483 ctgggagtccgcctatcatt 20 <210> 484 <211> 21 <212> DNA <213> Artificial Sequence <400> 484 acagcatgagaacagcagttt 21 <210> 485 <211> 23 <212> DNA <213> Artificial Sequence <400> 485 aggaaaataccagcttcatagac 23 <210> 486 <211> 22 <212> DNA <213> Artificial Sequence <400> 486 aacccttttaattaagaaaact 22 <210> 485 <211> 19 <212> DNA <213> Artificial Sequence <400> 485 cctccccagggttcacaac 19 <210> 486 <211> 22 <212> DNA <213> Artificial Sequence <400> 486 aaaggtagtagagtcccgggaa 22 <210> 487 <211> 24 <212> DNA <213> Artificial Sequence <400> 487 tcaggctttacttctaattctagt 24 <210> 488 <211> 20 <212> DNA <213> Artificial Sequence <400> 488 tgtttcatgggaagtcaaaa 20 <210> 489 <211> 24 <212> DNA <213> Artificial Sequence <400> 489 agcatatctactgtttacacccca 24 <210> 490 <211> 18 <212> DNA <213> Artificial Sequence <400> 490 cccaggaggcagacactg 18 <210> 491 <211> 18 <212> DNA <213> Artificial Sequence <400> 491 cagtcccagtccagcgtg 18 <210> 492 <211> 19 <212> DNA <213> Artificial Sequence <400> 492 cggggctcgaatttgcttg 19 <210> 493 <211> 21 <212> DNA <213> Artificial Sequence <400> 493 ggctggagtacaatagcacaa 21 <210> 494 <211> 20 <212> DNA <213> Artificial Sequence <400> 494 gtgaaaccatgtctctacta 20 <210> 495 <211> 24 <212> DNA <213> Artificial Sequence <400> 495 acagtactgtatctacccactctc 24 <210> 496 <211> 24 <212> DNA <213> Artificial Sequence <400> 496 tctgtcttttccctatagtgtggg 24 <210> 497 <211> 21 <212> DNA <213> Artificial Sequence <400> 497 gctacttgggagactgaggtg 21 <210> 498 <211> 24 <212> DNA <213> Artificial Sequence <400> 498 aacttaaatttttcaacagctact 24 <210> 499 <211> 24 <212> DNA <213> Artificial Sequence <400> 499 aacaccacaaagagataagtcagg 24 <210> 500 <211> 22 <212> DNA <213>Artificial Sequence <400> 500 gaaacaaactcccacataccac 22 <210> 501 <211> 22 <212> DNA <213> Artificial Sequence <400> 501 tctttgccacgtatttctagcc 22 <210> 502 <211> 24 <212> DNA <213> Artificial Sequence <400> 502 tttttgataccctgaaatgaagaa 24 <210> 503 <211> 22 <212> DNA <213> Artificial Sequence <400> 503 agctgacgaagaacttgcattg 22 <210> 504 <211> 20 <212> DNA <213> Artificial Sequence <400> 504 gtactggcctgggaactctc 20 <210> 505 <211> 20 <212>DNA <213> Artificial Sequence <400> 505 ccagtaccccagagcatcac 20 <210> 506 <211> 20 <212> DNA <213> Artificial Sequence <400> 506 gagctcgctgagacttcctg 20 <210> 507 <211> 21 <212> DNA <213> Artificial Sequence <400> 507 gtgaggggacagatttgtgac 21 <210> 508 <211> 21 <212> DNA <213> Artificial Sequence <400> 508 gcagagacaaaagggcaagaa 21 <210> 509 <211> 24 <212> DNA <213> Artificial Sequence <400> 509 caagcattggaggaatatcgtagg 24 <210> 510 <211> 20 <212> DNA <213>Artificial Sequence <400> 510 agaaaacactttctcggtgt 20 <210> 511 <211> 24 <212> DNA <213> Artificial Sequence <400> 511 actgttctgggtcacaaatttgtc 24 <210> 512 <211> 22 <212> DNA <213> Artificial Sequence <400> 512 cagattcttctgcaggttcaga 22 <210> 513 <211> 21 <212> DNA <213> Artificial Sequence <400> 513 attttcccctttttttacccc 21 <210> 514 <211> 26 <212> DNA <213> Artificial Sequence <400> 514 aaggtataacgctattgtcaaattct 26 <210> 515 <211> 23 <212> DNA <213>Artificial Sequence <400> 515 cagaaccaccatctttcagtaat 23 <210> 516 <211> 21 <212> DNA <213> Artificial Sequence <400> 516 gggcattcctttttgaacagt 21 <210> 517 <211> 20 <212> DNA <213> Artificial Sequence <400> 517 ctgggagtccgcctatcatt 20 <210> 518 <211> 21 <212> DNA <213> Artificial Sequence <400> 518 acagcatgagaacagcagttt 21 <210> 519 <211> 20 <212> DNA <213> Artificial Sequence <400> 519 cttacgcctctcaggttccg 20 <210> 520 <211> 21 <212> DNA <213> Artificial Sequence <400> 520 caccctctgctctgggtaaag 21
Claims
1. A method for constructing a sequencing library for BRCA whole-exome gene mutation detection, characterized in that: The method comprises amplifying the amplicon product using a specific amplification primer and then amplifying the amplicon product using a universal amplification primer to prepare the library; The specific amplification primers include 216 pairs of specific amplification primer pairs, wherein the 5' to 3' ends of the forward primer and the reverse primer of each pair of specific amplification primer pairs sequentially include a universal sequence and a specific sequence; the specific sequence of the forward primer of each pair of specific amplification primer pairs is such as SEQ ID NO.n, and the specific sequence of the corresponding reverse primer is such as SEQ ID NO.n+216; wherein n is any integer from 1 to 216; The universal primer pair comprises a forward universal amplification primer and a reverse universal amplification primer; the 3' end of the forward universal amplification primer comprises a sequence complementary to the universal sequence of the specific amplification forward primer; the 3' end of the reverse universal amplification primer comprises a sequence complementary to the universal sequence of the specific amplification reverse primer.
2. The method for constructing a BRCA whole-exome gene mutation detection sequencing library according to claim 1, wherein: The usage ratio of each pair of specific amplification primers is shown in the following table:
3. The method for constructing a BRCA whole-exon gene mutation detection sequencing library according to claim 1 or 2, wherein: The universal sequence of the forward primer and the reverse primer of each pair of specific amplification primers is an adapter sequence adapted to the gene sequencing platform.
4. The method for constructing a BRCA whole-exome gene mutation detection sequencing library according to claim 3, wherein: The universal sequence of the forward primer of each pair of specific amplification primers is SEQ ID NO.433; the universal sequence of the corresponding reverse primer is SEQ ID NO.
434.
5. The method for constructing a BRCA whole-exome gene mutation detection sequencing library according to claim 4, wherein: The sequence of the forward universal amplification primer is SEQ ID NO.435: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT; the sequence of the reverse universal amplification primer is SEQ ID NO.436: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGA; where NNNNNNNN is an 8bp index sequence.
6. The method for constructing a sequencing library for BRCA whole-exome gene mutation detection according to claim 5, wherein: The following steps are included: 1) Specific amplification: Using the extracted human genomic DNA as a template, multiplex PCR amplification was performed using 216 pairs of specific amplification primers to obtain specific amplification products; 2) Universal amplification: After purifying the specific amplification product prepared in step 1), amplification is performed using a forward universal amplification primer and a reverse universal amplification primer as primers, and the library is prepared after purification.
7. The method for constructing a sequencing library for BRCA whole-exome gene mutation detection according to claim 6, wherein: The specific process of step 1) specific amplification includes dividing 216 pairs of specific amplification primers into two groups and performing multiplex PCR amplification separately, and then mixing the specific amplification products of each group; wherein SEQ ID NO.n and SEQ ID NO.n+216 are the first group; wherein n is any integer from 1 to 108; SEQ ID NO.n and SEQ ID NO.n+216 are the second group; wherein n is any integer from 109 to 216; The human genomic DNA is human genomic DNA extracted from FFPE tissue.
Citation Information
Patent Citations
Multiplex PCR primer for amplifying BRCA1 / 2 gene and design method of multiplex PCR primer
CN106367481A
BRCA1 / 2 mutation detection composition, kit and library construction method
CN111269980A