Marine DNA polymerase I

Abstract

The present invention relates to DNA polymerases. In particular, the present invention relates to a thermally unstable DNA polymerase of marine origin having high polymerase activity, strand displacement activity and 3'-5' exonuclease activity. In addition, the present invention provides a thermally unstable DNA polymerase having substantially no strand displacement activity.

Description

Technical Field

[0001] The present invention relates to DNA polymerases. In particular, the present invention relates to thermally unstable DNA polymerases of marine origin. In addition, the present invention provides thermally unstable DNA polymerases substantially free of strand displacement activity. The present invention also relates to the use of the DNA polymerases in various molecular biological processes. Background Art

[0002] Synthetic biology is a rapidly developing field and has been hailed as a possible solution to future bioeconomy and bioenergy challenges. The ultimate vision of synthetic biology is to create new cellular biological operating systems that are foreseeably capable of performing useful tasks. One of the key steps in the synthetic biology pipeline is the assembly of DNA fragments into larger functional constructs, which often involves multiplex assembly.

[0003] However, the current bottleneck is the lack of a robust room-temperature method to perform multiplex DNA assembly without time-consuming manual handling steps. Therefore, a new DNA assembly method that can circumvent the current obstacles is highly desirable.

[0004] Replication of genomic DNA is the primary function of DNA polymerase, which catalyzes the synthesis of polydeoxyribonucleotides from monodeoxyribonucleoside triphosphates (dNTPs).

[0005] In vitro, the properties of DNA polymerases are used for DNA synthesis, such as various DNA amplification processes, DNA assembly processes, and DNA molecule synthesis that reads a target (interested) DNA strand template to produce two new DNA strands matching the template.

[0006] Different types of polymerases have been found. For example, in Escherichia coli and other prokaryotes, known DNA polymerases are generally referred to as DNA polymerase IV. Each group differs in replication fidelity, thermal stability, elongation rate, and proofreading activity and efficiency. Some DNA polymerases are quite simple, while others are more complex, such as Escherichia coli polymerase III, which is composed of 20 different peptide subunits. When used in an in vitro DNA replication process, in addition to dNTPs, a primer (initial oligonucleotide) is also required, which carries a 3' terminal hydroxyl group that can be used as a starting point for chain growth, because DNA polymerase cannot start the de novo synthesis process from a single nucleotide. A primer can be a short or long DNA or RNA that carries a free 3'-OH group and provides a double-stranded structure for DNA polymerase by annealing to the complementary region of the template. The selected DNA polymerase works along the template and extends the primer in the 5'→3' direction.

[0007] Due to the polarity of the DNA strands, the replication of the two strands of the DNA molecule is bidirectional, producing two different products, the "leading" strand and the "lagging" strand, depending on the direction of template replication. The leading strand is synthesized as a single continuous strand, while the lagging strand is initially synthesized as small oligonucleotides, called Okazaki fragments, which are then linked to form a continuous strand. In vivo, small RNA molecules act as natural primers in the synthesis of both the leading strand and, especially, the lagging strand.

[0008] It is well known that DNA polymerase III continuously synthesizes Okazaki fragments on the leading and lagging strands, leaving gaps between the synthesized fragments, which are subsequently filled by DNA polymerase I.

[0009] In addition to DNA synthesis activity, DNA polymerases can also perform other enzymatic activities, such as 3'-5' exonuclease activity or strand displacement activity. The role of the strand displacement activity of DNA polymerases is to remove the starting RNA or primer before ligation. In vivo, the 3'-5' exonuclease activity of some DNA polymerases is important for genetic stability, correcting DNA polymerase errors, such as the generation of mismatched base pairs in the resulting DNA molecules, which are then corrected by the exonuclease function of the DNA polymerase.

[0010] Piotrowski, Y. et al., Molecular and Cell biology, 2019, pp. 1-11 and Singh, K. et al., J. of Biological Chemistry, 2007, vol. 282, no. 14, pp. 10594-10604 disclose mutant DNA polymerases with altered strand displacement activity.

[0011] In order to replace and correct mismatched base pairs, the proofreading activity of DNA polymerase must be able to remove the dNTP introduced by mistake, so the nuclease activity is related to the rupture of the phosphodiester bond in the phosphate backbone of the DNA molecule. The ability to remove mismatched dNTPs and thus degrade DNA is utilized in in vitro molecular biology in various ways. Sequence-specific DNA amplification has many applications in molecular biology, such as determining parent-child relationships, forensic investigations, and diagnostics. Many widely used DNA polymerases are stable at high temperatures (e.g., up to at least 70°C), so they can be used for DNA detection and analytical methods, such as polymerase chain reaction (PCR) or thermal cycle DNA sequencing. DNA polymerases suitable for such processes are generally referred to as thermostable DNA polymerases.

[0012] PCR is based on thermal cycling to denature the template DNA, anneal the primers, and extend the primers using a thermostable DNA polymerase that can withstand different temperature conditions and exponentially increase the amount of the target DNA through amplification. Other amplification methods are isothermal, i.e., performed at a constant temperature. Today, there are a variety of isothermal DNA amplification methods, such as strand displacement amplification (see, e.g., Walker GT. Empirical aspects of strand displacement amplification. PCR Methods Appl. 1993; 3: 1–6) and loop-mediated amplification (LAMP) (see, e.g., Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000; 28: E63). DNA polymerases for strand displacement amplification are commercially available, such as EquiPhi29TM DNA polymerase provided by ThermoFisher Scientific.

[0013] DNA polymerases are also used in DNA assembly processes, such as Gibson et al. described in Nature Methods, 2009, vol. 6, pp. 343-345. The method allows for the single-step isothermal assembly of nucleic acid molecules. However, the method requires that the process be carried out at 50°C.

[0014] However, a current bottleneck is the lack of a robust room temperature method to perform multiplex DNA assembly without time-consuming manual handling steps. For example, when using PCR products in a DNA assembly method, the products must be purified (undergo a clean-up procedure) before they can be used in the multiplex DNA assembly process. If multiple rounds of assembly are required, purification steps are also required. Therefore, a new DNA assembly method that can circumvent current obstacles is highly desirable.

[0015] Various enzymes of marine origin are known. For example, WO2017 / 162765 discloses a marine-derived thermostable DNA polymerase isolated from Psychrobacillus sp., which is active over a wide temperature range, including temperatures above room temperature.

[0016] WO2016026574 discloses a thermolabile exonuclease derived from a cold water environment, which is capable of degrading single-stranded DNA and can be inactivated within 15-20 minutes if exposed to temperatures below 65°C.

[0017] The inventors have identified DNA polymerase I by performing metagenomic analysis on marine environmental samples collected in the marine Arctic region near Svalbard. Unlike other known DNA polymerases, the isolated DNA polymerase of the present invention is inherently thermolabile, which makes the enzyme particularly useful in molecular biology processes, such as in various DNA amplification processes and DNA assembly processes. For example, the DNA polymerase of the present invention is rapidly and irreversibly inactivated at temperatures above 25°C, such as at temperatures above about 30°C, resulting in no need for any inactivation step prior to further processing of the product subjected to the DNA polymerase of the present invention.

[0018] Furthermore, the present inventors have demonstrated that the DNA polymerase of the present invention exerts a very robust polymerase activity compared to commercially available DNA polymerases such as the mesophilic Klenow enzyme from Escherichia coli and the thermophilic Bst polymerase from Bacillus stearothermophilus.

[0019] The robust polymerase activity and temperature-labile properties of the DNA polymerase of the present invention make it a very useful DNA polymerase for a wide range of DNA amplification processes that can be performed at room temperature and avoid the need for an inactivation step.

[0020] The DNA polymerase of the present invention also exerts 3'-5' exonuclease activity, thereby proofreading the replicated DNA molecules.

[0021] The DNA polymerase of the present invention also possesses strand displacement activity, making it an attractive polymerase for strand displacement amplification processes.

[0022] The present inventors have also synthesized modified variants of the DNA polymerase of the present invention, wherein the strand displacement activity of the DNA polymerase is substantially impaired or absent.

[0023] The modified DNA polymerases of the present invention having impaired strand displacement activity or lacking strand displacement activity are particularly useful in recombinogenic cloning processes, such as assembling two or more double-stranded nucleic acid molecules having single-stranded 5' overhangs. In particular, the modified DNA polymerases having impaired strand displacement activity or lacking strand displacement activity can be used in multiple DNA assembly methods, and can work at room temperature due to their thermal instability. Another advantage of the DNA polymerases of the present invention is that when used in DNA amplification or DNA assembly processes, as further shown below, it is believed that no inactivation step is required. Summary of the invention

[0024] According to a first aspect, an isolated DNA polymerase or an enzymatically active fragment thereof is provided, wherein the DNA polymerase exerts strand displacement activity, 3'-5' exonuclease activity, and wherein the DNA polymerase is irreversibly inactivated at a temperature above 25°C (more preferably at a temperature above about 30°C).

[0025] According to one embodiment of this aspect, a DNA polymerase is provided, wherein the strand displacement activity is reduced, impaired or inactivated.

[0026] According to a second aspect of the present invention, an isolated DNA polymerase or an enzymatically active fragment thereof is provided, wherein the DNA polymerase comprises the amino acid sequence of SEQ ID No. 1, or comprises an amino acid sequence having at least 60% sequence identity with SEQ ID No. 1 over the entire sequence length.

[0027] According to the third aspect of the present invention, an isolated DNA polymerase or an enzymatically active fragment thereof is provided, wherein the DNA polymerase comprises the amino acid sequence of SEQ ID No. 2, or comprises an amino acid sequence having at least 60% sequence identity with SEQ ID No. 2 over the entire sequence length.

[0028] The isolated DNA polymerase or enzymatically active fragment thereof according to the above aspects may comprise an amino acid sequence which has at least 70% identity with SEQ ID No.1 or SEQ ID No.2 over the entire sequence length, for example, has at least 80% sequence identity with SEQ ID No.1 or SEQ ID No.2 over the entire sequence length, for example, has at least 90% sequence identity with SEQ ID No.1 or SEQ ID No.2 over the entire sequence length.

[0029] According to a fourth aspect, there is provided an isolated DNA polymerase or an enzymatically active fragment thereof, wherein the amino acid sequence comprises at least one mutation in at least one of the amino acid regions corresponding to amino acid positions 431-447 and positions 519-523, the numbering being consistent (corresponding) with the amino acid numbering in SEQ ID NO.2, and wherein the DNA polymerase does not have strand displacement activity. For example, the DNA polymerase or an enzymatically active fragment thereof comprises at least one mutation in the amino acid positions corresponding to S449, A450, F451 and / or R521 of the amino acid sequences shown in SEQ ID No.1 and SEQ ID No.2.

[0030] According to a fifth aspect, an isolated DNA polymerase or an enzymatically active fragment thereof is provided, wherein the DNA polymerase comprises at least one mutation in the amino acid position corresponding to S449, A450, F451 and / or R521 of the amino acid sequence shown in SEQ ID No. 1 and SEQ ID No. 2, and wherein the at least one mutation is replaced by:

[0031] - at the position corresponding to S449, an amino acid having a hydrophobic side chain,

[0032] - at the position corresponding to A450, an amino acid having a negatively charged side chain,

[0033] - at the position corresponding to F451, an amino acid with a hydrophobic side chain, and / or

[0034] - At the position corresponding to R521, an amino acid having a hydrophobic side chain.

[0035] For example, according to one embodiment of the above aspects, the isolated DNA polymerase or its enzymatically active fragment may comprise an amino acid sequence, in which the amino acid at position 449 numbered according to SEQ ID No.1 or SEQ ID No.2 is selected from Ser, Ala, Gly, Val, Leu, and Ile.

[0036] In addition, according to one embodiment of the above aspect, the isolated DNA polymerase or its enzymatically active fragment may comprise an amino acid sequence, in which the amino acid at position 450 numbered according to SEQ ID No.1 or SEQ ID No.2 is selected from Ala, Gly, Val, Leu, Ile, Asp, Glu, Asn, Gln.

[0037] In addition, according to one embodiment of the above aspect, the isolated DNA polymerase or its enzymatically active fragment may comprise an amino acid sequence, in which the amino acid at position 451 numbered according to SEQ ID No.1 or SEQ ID No.2 is selected from Phe, Ala, Gly, Val, Leu, and Ile.

[0038] In addition, according to one embodiment of the above aspect, the isolated DNA polymerase or its enzymatically active fragment may comprise an amino acid sequence, in which the amino acid at position 521 numbered according to SEQ ID No.1 or SEQ ID No.2 is selected from Arg, Ala, Gly, Val, Leu, and Ile.

[0039] Furthermore, according to one embodiment of the above aspects, the isolated DNA polymerase or enzymatically active fragment thereof may comprise an amino acid sequence, wherein the amino acids at positions 449, 450, 451 and 521 are selected from:

[0040]

[0041] The prerequisite is that the amino acids at positions 449 (S449), 450 (A450), 451 (F451) and 521 (R521) are not Ser, Ala, Phe and Arg respectively at the same time.

[0042] Furthermore, according to one embodiment of the above aspects, the isolated DNA polymerase or enzymatically active fragment thereof may comprise an amino acid sequence, wherein the amino acids at positions 449, 450, 451 and 521 are selected from:

[0043] Amino acid position of SEQ ID No.1 Amino Acids 449 Ser, Ala 450 Ala、Asp 451 Phe、Ala 521 Arg、Ala

[0044] And the prerequisite is that the amino acids at positions 449 (S449), 450 (A450), 451 (F451) and 521 (R521) are not Ser, Ala, Phe and Arg respectively. In one embodiment according to any of the aforementioned aspects, the isolated DNA polymerase or enzymatically active fragment thereof is selected from a group of DNA polymerases comprising an amino acid sequence, in which:

[0045] - the amino acid at position 450 is Asp,

[0046] - the amino acids at positions 449 and 451 are Ala,

[0047] - the amino acids at positions 449 and 450 are Ala and Asp, respectively,

[0048] - the amino acids at positions 450 and 451 are Asp and Ala, respectively,

[0049] - the amino acids at positions 449, 450 and 451 are Ala, Asp and Ala, respectively,

[0050] - the amino acid at position 521 in SEQ ID No. 8 is Ala, and wherein the numbering is according to the amino acid numbering of SEQ ID No. 1, and wherein any of said DNA polymerases does not have strand displacement activity.

[0051] According to a sixth aspect, an isolated DNA polymerase or an enzymatically active fragment thereof is provided, wherein the DNA polymerase comprises an amino acid sequence selected from SEQ ID No. 3, 4, 5, 6, 7 and 8, or comprises an amino acid sequence having at least 60% (such as at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 97%, such as at least 98% or 99%) sequence identity with SEQ ID No. 3, 4, 5, 6, 7 and 8, respectively, over the entire sequence length, provided that

[0052] - the amino acid at position 450 in SEQ ID No. 3 is Asp,

[0053] - the amino acids at positions 449 and 451 in SEQ ID No. 4 are Ala,

[0054] - the amino acids at positions 449 and 450 in SEQ ID No.5 are Ala and Asp, respectively,

[0055] - the amino acids at positions 450 and 451 in SEQ ID No.6 are Asp and Ala, respectively,

[0056] - the amino acids at positions 449, 450 and 451 in SEQ ID No.7 are Ala, Asp and Ala, respectively,

[0057] - the amino acid at position 521 in SEQ ID No. 8 is Ala.

[0058] According to any of the above aspects, the present invention also provides a DNA polymerase or an enzymatically active fragment thereof, wherein the enzyme is irreversibly inactivated at a temperature above 25°C (eg, at a temperature above 30°C).

[0059] According to a seventh aspect, there is provided a composition comprising the isolated DNA polymerase or an enzymatically active fragment thereof according to any preceding aspect and a buffer.

[0060] According to any of the above aspects, the DNA polymerase is a large fragment DNA polymerase I lacking an N-terminal 5'-3'-exonuclease domain.

[0061] SEQ ID No. 1 and Seq ID No. 2 are examples of large fragment DNA polymerase sequences lacking the N-terminal 5'-3'-exonuclease domain.

[0062] According to a ninth aspect, a nucleic acid molecule is provided, which encodes an isolated DNA polymerase or an enzymatically active fragment thereof according to any of the above aspects. In one embodiment according to the above aspects, the nucleic acid molecule comprises the nucleic acid sequence of SEQ ID No. 9 or comprises a nucleic acid molecule having at least 60% sequence identity with SEQ ID No. 9 over the entire sequence length.

[0063] In one embodiment according to the above aspect, the nucleic acid molecule comprises a nucleic acid molecule encoding an amino acid sequence selected from SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQID No.8, or comprises a nucleic acid molecule encoding an amino acid sequence that has at least 60% sequence identity with SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8 respectively over the entire sequence length.

[0064] According to the tenth aspect, an expression vector is provided, which comprises a nucleic acid molecule encoding the isolated DNA polymerase or an enzymatically active fragment thereof according to the above aspects and a regulatory sequence necessary for transcribing and translating the protein sequence encoded by the nucleic acid molecule.

[0065] For example, the expression vector may comprise a nucleic acid sequence encoding an amino acid sequence selected from SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, and SEQ ID No.8, or a nucleic acid molecule encoding an amino acid sequence having at least 60% sequence identity with SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, and SEQ ID No.8, respectively, over the entire sequence length.

[0066] According to the eleventh aspect, a host cell is provided, which comprises one or more expression vectors as described above, or one or more nucleic acid molecules encoding the DNA polymerase of the present invention as described above.

[0067] According to the twelfth aspect, a method for preparing a DNA polymerase or an enzymatically active fragment thereof according to the present invention comprises the following steps:

[0068] a) culturing a host cell comprising one or more recombinant expression vectors according to the tenth aspect, or one or more nucleic acid molecules according to the ninth aspect, under conditions suitable for expression of the encoded DNA polymerase;

[0069] b) isolating or obtaining the DNA polymerase, such as large fragment DNA polymerase, from the host cell or from the culture medium or supernatant.

[0070] According to the thirteenth aspect, the present invention also relates to the use of the DNA polymerase (eg, large-fragment DNA polymerase) or enzymatically active fragment of the present invention in a nucleic acid amplification process, a sequencing reaction, a recombination cloning process or a multiplex DNA assembly process.

[0071] According to one embodiment of this aspect, the DNA polymerase of the present invention is used for strand displacement amplification.

[0072] Furthermore, according to a fourteenth aspect, there is provided a method for assembling two or more double-stranded (ds) DNA molecules, the method comprising the following steps:

[0073] (a) providing two or more dsDNA molecules to be assembled, wherein the dsDNA molecules comprise single-stranded (ss) DNA overhangs, wherein the ends of the overhangs comprising the two or more dsDNA molecules share a region of sequence identity;

[0074] (b) incubating the DNA molecule of (a) under conditions where the DNA molecule anneals through the overhanging portion;

[0075] (c) contacting the annealed molecules with a thermolabile DNA polymerase (e.g., large fragment DNA polymerase) or an enzymatically active fragment thereof according to any one of the first to sixth aspects, whereby the DNA polymerase fills in gaps remaining after annealing of the DNA molecules formed in step (b), wherein the DNA polymerase has reduced, impaired or inactivated strand displacement activity.

[0076] Steps (a) to (c) of the above method may be performed at a constant temperature. According to one embodiment, the method is performed at a temperature ranging from 20°C to 25°C.

[0077] According to another embodiment, the assembled DNA molecules of step (c) are further transferred into suitable host cells for proliferation.

[0078] According to a fifteenth aspect, a method is provided, wherein the overhangs of the two or more DNA molecules of step (a) of the above method are provided using a 3'-5' exonuclease, preferably a thermolabile exonuclease.

[0079] According to the sixteenth aspect, a method for nucleotide polymerization is provided, which is performed using the DNA polymerase of the present invention (such as a large fragment DNA polymerase) or an enzymatically active fragment thereof, the method comprising the following steps:

[0080] (a) providing a reaction mixture comprising a DNA polymerase of the present invention or an enzymatically active fragment thereof, a template nucleic acid molecule, an oligonucleotide primer capable of annealing to a portion of the template nucleic acid molecule, and one or more species of nucleotides; and

[0081] (b) incubating the reaction mixture under conditions where the oligonucleotide primer anneals to the template nucleic acid molecule and the DNA polymerase extends the oligonucleotide primer by polymerizing one or more nucleotides.

[0082] According to the seventeenth aspect, there is provided a method for amplifying nucleic acid, which is performed using a DNA polymerase (e.g., a large fragment DNA polymerase) or an enzymatically active fragment thereof, the method comprising the following steps:

[0083] (a) providing a reaction mixture comprising a DNA polymerase or an enzymatically active fragment thereof according to any one of aspects one to six, a template nucleic acid molecule, one or more oligonucleotide primers capable of annealing to a portion of the template nucleic acid molecule, and nucleotides;

[0084] (b) incubating the reaction mixture under conditions where the one or more oligonucleotide primers anneal to the template nucleic acid molecule and the DNA polymerase extends the one or more oligonucleotide primers by polymerizing one or more nucleotides to produce a polynucleotide. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Figure 1 The Klenow fragment (PDB code: 1D8Y), a polymerase homologous to the DNA polymerase of the present invention, is shown, showing the alpha helix identified by the arrow having three consecutive amino acid residues S449, A450 and F451, and also showing the position of residue R521, the C- and N-termini.

[0086] Figure 2 The DNA and amino acid sequences of the DNA polymerase of the present invention are shown.

[0087] Figure 3 The polymerase activity of the large-range DNA polymerase of the present invention is shown in comparison with the polymerase activity of the Klenow enzyme from E. coli and the thermophilic Bacillus stearothermophilus (Bst) polymerase.

[0088] Figure 4Shown are the results of an experiment in which the residual activity of the wild-type large-range DNA polymerase of the present invention was measured at 25°C after incubating the enzyme at different temperatures.

[0089] Figure 5 A comparison of the polymerase activity of the large-fragment DNA polymerase of the present invention at 25° C. is shown, wherein the large-fragment DNA polymerase is represented by wild-type (wt) DNA polymerase, A450D-mutant (SDF), S449A+F451A-mutant (AAA), S449A+A450D-mutant (ADF), A450D+F451A-mutant (SDA), S449A+A450D+F451A-mutant (ADA) and R521A-mutant.

[0090] Figure 6 A comparison of the strand displacement activity of the large-fragment DNA polymerase of the present invention at 25°C is shown, wherein the large-fragment DNA polymerase is represented by the wild-type (wt) DNA polymerase, A450D-mutant (SDF), S449A+F451A-mutant (AAA), S449A+A450D-mutant (ADF), A450D+F451A-mutant (SDA), S449A+A450D+F451A-mutant (ADA) and R521A-mutant. DETAILED DESCRIPTION

[0091] As described above, the inventors have identified a novel DNA polymerase of marine origin, which has advantageous properties that make the DNA polymerase and its variants useful in many molecular biological processes. In particular, it is advantageous that the enzyme can be used in processes carried out at room temperature, and it is easily inactivated, for example at temperatures above 25°C, for example above 30°C.

[0092] Unless specifically defined herein, all technical and scientific terms used have the same meanings as commonly understood by one of ordinary skill in the fields of genetics, biochemistry, and molecular biology.

[0093] All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, and suitable methods and materials are described herein. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, this specification (including definitions) shall prevail.

[0094] If a numerical limit or range is stated, the endpoints are included. Furthermore, all values ​​and subranges within the numerical limit or range are specifically included as if expressly written.

[0095] As shown below, the DNA polymerase of the present invention can be used to provide assembled target nucleic acid molecules with 5'-3' overhangs, for example to provide full sequence nucleic acid molecules and combine the molecules with vectors. Thus, the DNA polymerase can be used to assemble one or more target nucleic acid molecules in a vector or expression vector, wherein the desired (one or more) nucleic acid molecules and the vector have complementary 5'-3' overhangs.

[0096] That is, after contacting one or more target double-stranded nucleic acid molecules and a selected vector, both of which have 5'-3' overhangs (overhangs), for example, about 10-40 base pairs in length, the DNA polymerase of the present invention will fill in the required number of nucleotides to assemble the sequence in question. Due to the thermal instability of the DNA polymerase, the DNA polymerase will be inactivated in a short time, but will remain active for a sufficient time to, for example, assemble the nucleic acid molecule in question.

[0097] For example, the DNA polymerase of the invention may become inactive over time at 25°C, but has been shown to retain its activity for at least 60 minutes, which does not affect further process steps, such as when used in a multiplex DNA assembly method. According to one embodiment, when used in a multiplex DNA assembly method, the annealed DNA molecules are contacted with a DNA polymerase having reduced strand displacement activity, impaired or inactivated for a period of time in the range of 5-45 minutes, such as in the range of 10-30 minutes, such as in the range of 15-20 minutes.

[0098] The enzymes of the invention can be used in various processes carried out at room temperature.The term "room temperature" is an art-recognized term and includes temperatures in the range of 18°C ​​to 25°C.

[0099] According to another aspect, a DNA polymerase or an enzymatically active fragment thereof is provided, which comprises the amino acid sequence of SEQ ID No. 1 or SEQ ID No. 2, or comprises an amino acid sequence having at least 60% sequence identity with SEQ ID No. 1 over the entire sequence length.

[0100] The expression "enzymatically active fragment" of a DNA polymerase is understood to mean a DNA polymerase in which the activity of the polymerase is maintained, i.e. having the same or at least similar activity as a DNA polymerase having an amino acid sequence as shown in SEQ ID No. 1 to 8, despite the removal of one or more amino acids compared to the sequence shown in SEQ ID No. 1 to 8. A person skilled in the art will recognize that one or more amino acids may be removed, for example at the C-terminus or N-terminus of the amino acid sequence, without affecting the activity of the protein.

[0101] Compared with known DNA polymerases, the DNA polymerase of the present invention exerts excellent polymerase efficiency. Figure 3 As shown, the DNA polymerase of the present invention exhibits improved polymerase activity compared to the polymerase activity of the Klenow enzyme from Escherichia coli and the thermophilic Bacillus stearothermophilus (Bst) polymerase. Those skilled in the art will also recognize that real-time molecular beacon assays can be used to measure polymerase activity, such as those disclosed in Summerer, Methods Mol. Biol., 2008, 429, 225-235 or as shown in the following experimental section.

[0102] According to a second aspect, there is provided a DNA polymerase having substantially no strand displacement activity, and wherein the DNA polymerase has substantially no strand displacement activity and furthermore is irreversibly inactivated at a temperature above 25°C (e.g. a temperature above about 30°C). Figure 4 , showing that the modified DNA polymerase of the present invention has reduced strand displacement activity compared to the wild-type DNA polymerase. Those skilled in the art will recognize that well-known methods can be used to measure strand displacement activity, such as Piotrowski et al., 2019, BMC Mol Cell Biol, 20 (31) ( https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC6688381 / ) as described in the strand displacement activity assay.

[0103] The expression "substantially no strand displacement activity" is understood to mean that the displacement activity of the DNA polymerase is impaired or absent compared to the wild-type DNA polymerase having the amino acid sequence according to SEQ ID No. 2. For example, a person skilled in the art will recognize that a DNA polymerase having a displacement activity reduced to the extent of a DNA polymerase having the amino acid sequence of SEQ ID NO. 3-8 has an impaired strand displacement activity, i.e., substantially no strand displacement activity.

[0104] According to yet another aspect, the present invention provides a DNA polymerase (e.g., an isolated large fragment DNA polymerase) or an enzymatically active fragment thereof, which comprises the amino acid sequence of SEQ ID No.1 or an amino acid sequence having at least 60% sequence identity with SEQ ID No.1 over the entire sequence length.

[0105] According to another aspect, the present invention provides a DNA polymerase (e.g., an isolated large fragment DNA polymerase) or an enzymatically active fragment thereof, which comprises the amino acid sequence of SEQ ID No. 2 or an amino acid sequence having at least 60% sequence identity with SEQ ID No. 2 over the entire sequence length.

[0106] As described above, a DNA polymerase is provided, comprising amino acids according to SEQ ID No.1 or SEQ ID No.2 and comprising at least one mutation in the region corresponding to amino acid positions 431-447 and positions 519-523, the numbering being consistent with the amino acid numbering in SEQ ID NO.2, and wherein the DNA polymerase does not have strand displacement activity. The amino acids at positions 431 to 447 form three helices, which are believed to be associated with the strand displacement activity of the marine DNA polymerase identified in the present invention. According to one embodiment, a DNA polymerase is provided, comprising amino acids according to SEQ ID No.1 or SEQ ID No.2 and comprising at least one mutation in the region corresponding to amino acid positions G447-L453 and positions G519-A523, the numbering being consistent with the amino acid numbering in SEQ ID NO.2.

[0107] In particular, a DNA polymerase is provided, wherein mutations are introduced at positions 449, 450, 451 and / or 521.

[0108] The invention provides as examples wherein in particular the serine at position 449 is replaced by alanine, or wherein the alanine at position 450 is replaced by asparagine, or wherein the phenylalanine at position 451 is replaced by alanine, or wherein the arginine at position 521 is replaced by alanine.

[0109] Those skilled in the art will recognize that amino acids are grouped according to the chemical properties of the side chains. Amino acids are generally classified as hydrophobic or hydrophilic and / or have polar or non-polar side chains. Replacing one amino acid with another amino acid having the same biochemical properties is generally referred to as a conservative substitution. Those skilled in the art will recognize that conservative substitutions can be introduced into the amino acid sequence of a protein (e.g., an enzyme according to the present invention) without changing the activity of the enzyme. Therefore, it is expected that such modifications will constitute biologically equivalent products.

[0110] Conservative substitutions of amino acids include substitutions between amino acids within the following groups:

[0111] Val, Ile, Leu, Met (amino acids with hydrophobic side chains)

[0112] Phe, Tyr, Trp (amino acids with hydrophobic side chains)

[0113] Arg, His, Lys (amino acids with positively charged side chains)

[0114] Ala, Gly (amino acids with small side chains)

[0115] Ser, Thr (amino acids with uncharged side chains)

[0116] Asn, Gln (amino acids with uncharged side chains)

[0117] Asp, Glu (amino acids with negatively charged side chains)

[0118] Generally speaking, a conservative amino acid substitution refers to an amino acid substitution that does not change the relative charge or size characteristics of the protein in which the amino acid substitution is made, and thus rarely changes the three-dimensional structure of the protein, which is why the biological activity is not significantly changed.

[0119] Therefore, those skilled in the art will recognize that a DNA polymerase comprising an amino acid sequence according to SEQ ID No. 1 or SEQ ID No. 2, such as an isolated large fragment DNA polymerase, wherein the amino acid at position 449 is selected from Ser, Ala, Gly, Val, Leu, Ile and / or the amino acid at position 450 is selected from Ala, Gly, Val, Leu, Ile, Asp, Glu, Asn, Gln, and / or wherein the amino acid at position 451 is selected from Phe, Ala, Gly, Val, Leu, Ile, and / or wherein the amino acid at position 521 is selected from Arg, Ala, Gly, Val, Leu, Ile, provided that the amino acids at positions 449 (S449), 450 (A450), 451 (F451) and 521 (R521) are not Ser, Ala, Phe and Arg, respectively, can have the same or substantially the same polymerase activity and strand displacement activity as the DNA polymerase according to SEQ ID NOs. 3-8.

[0120] Furthermore, those skilled in the art will appreciate that one or more amino acids may be deleted, inserted or added without altering the activity of the DNA-polymerase.

[0121] It should therefore be understood that the present invention includes the DNA polymerase as disclosed in the appended claims, wherein such modifications (amino acid substitutions, deletions, insertions and additions) as described above can be introduced without substantially altering the activity of the polymerase, i.e. with respect to polymerase activity and strand displacement activity.

[0122] Furthermore, it will be understood by those skilled in the art that large fragment DNA polymerase I is a DNA polymerase that lacks the 5' to 3' exonuclease activity of intact DNA polymerase I but exhibits both 5' to 3' DNA polymerase activity and 3' to 5' exonuclease activity. An example of a well-known large fragment DNA polymerase I is the Klenow fragment.

[0123] According to another aspect, the present invention provides a DNA polymerase or an enzymatically active fragment thereof, which comprises an amino acid sequence selected from SEQ ID No. 3, 4, 5, 6, 7 and 8, or comprises an amino acid sequence having at least 60% sequence identity with SEQ ID No. 3, 4, 5, 6, 7 and 8 respectively over the entire sequence length.

[0124] According to another aspect, a DNA polymerase is provided, the amino acid sequence it comprises having at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 97%, such as at least 98% or 99% sequence identity with an amino acid sequence selected from SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8 over the entire sequence length.

[0125] In addition, the present invention also provides a nucleic acid molecule encoding an isolated DNA polymerase or an enzymatically active fragment thereof according to the present invention. According to one aspect, a nucleic acid molecule is provided, which comprises a nucleic acid molecule encoding an amino acid sequence selected from SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8, or a nucleic acid molecule encoding an amino acid sequence comprising an amino acid sequence having at least 60% sequence identity with SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8, respectively, over the entire sequence length.

[0126] According to another aspect, a nucleic acid molecule is provided, which comprises a sequence as shown in SEQ ID No.9 or a nucleic acid molecule having at least 80% sequence identity with SEQ ID No.9 over the entire sequence length, such as having at least 85%, such as at least 90%, such as at least 95%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity with SEQ ID No.9 over the entire sequence length.

[0127] Furthermore, those skilled in the art will appreciate that one or more amino acids may be deleted, inserted or added without altering the activity of the enzyme of the invention.

[0128] It is therefore to be understood that the present invention encompasses the DNA polymerase as disclosed in the appended claims, wherein such modifications (substitutions, deletions, insertions and additions of amino acids) as described above may be introduced without substantially altering the activity of the enzyme.

[0129] As used herein, with respect to both proteins and nucleic acid molecules or fragments thereof, when referring to "sequence identity", a sequence having at least x% identity to a second sequence means that x% represents the number of amino acids in the first sequence that are identical to the matching amino acids of the second sequence relative to the total length of the second amino acid sequence when the two sequences are optimally aligned by global alignment. The two sequences are optimally aligned when x is maximum. The alignment and determination of percent identity can be performed manually or automatically. Whenever sequence identity is mentioned herein, it is understood that the comparison is performed using the entire sequence depicted in SEQ ID NO.1-SEQ ID No.9, respectively.

[0130] It will be recognized by those skilled in the art that the comparison for determining the percentage amino acid sequence identity can be achieved in various ways within the technical scope of the art, for example, using publicly available computer software, such as ClustalOmega (Sievers F, Higgins DG (2018) Protein Sci 27: 135-145), Clustal W (Thomson et al., 1994, Nucleic Acid Res., 22, pp 4673-4680), Protein BLAST (from the National Center for Biotechnology Information (NCBI)) or commercially available software such as Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for measuring the comparison, including any algorithm required to achieve maximum comparison over the full length of the compared sequence. NCBIBLAST is another software example for determining amino acid sequence identity (MacWilliam et al., Nucleic Acids Res. 2013 Jul; 41 (Web Server issue): W597–W600).

[0131] Those skilled in the art will recognize that modifications that do not change the amino acid sequence can be introduced into the nucleic acid molecule, such as replacement of nucleotides, which results in the triplet affected by the replacement still encoding the same amino acid. For example, the amino acid isoleucine is encoded by the triplet (DNA codon) ATT, ATC and ATA. Next, the third nucleotide in the isoleucine triplet ATT is replaced from T to C or A without changing the resulting amino acid sequence. Such nucleotide modifications can be introduced by techniques well known to those skilled in the art (e.g., site-directed mutagenesis) to adapt the nucleic acid sequence to the codons preferably used by the host cell, thereby enhancing the expression of the enzyme.

[0132] Furthermore, nucleic acid molecules encoding polypeptides that facilitate isolation and purification may be added to the nucleotide sequences of the present invention without affecting the activity of the resulting DNA polymerase.

[0133] In addition, a nucleic acid molecule encoding a signal peptide that causes host cells to secrete a desired enzyme can also be linked to the nucleic acid sequence of the present invention.

[0134] The present invention also provides a composition comprising a DNA polymerase of the present invention or an enzymatically active fragment thereof. Compositions comprising the enzyme of the present invention may include a buffer for optimizing the activity of the enzyme. Those skilled in the art will recognize that the buffer used in the composition comprising the enzyme of the present invention may vary and be optimized according to the selected enzyme and the method wherein the enzyme is used. The enzyme of the present invention is retained under conditions commonly used in molecular biological processes (e.g., cloning processes, DNA assembly processes, and DNA amplification processes) well known to those skilled in the art, i.e., for example, with respect to the type and concentration of salt, pH conditions, etc. For example, well-known buffers may be used, such as Tris buffers, such as Tris buffers having a pH higher than about 8.0, such as pH in the range of 8.0 and 9.0. According to one aspect, the pH of the composition is within 8.5-9.0.

[0135] In addition, the skilled person will recognize that the type of salt and its concentration can be different. According to one aspect, the composition comprises one or more salts selected from NaCl and KCl. According to another aspect of the present invention, the composition comprises NaCl and KCl. According to another aspect, the composition comprises about 50mM or more of NaCl and about 50mM or more of KCl.

[0136] Preparation of DNA polymerase of the present invention

[0137] The DNA polymerases and enzymatically active fragments thereof or nucleic acid molecules encoding them of the present invention are purified or isolated from their natural (native) environment, or they are produced by recombinant DNA procedures well known to those skilled in the art.

[0138] The nucleic acid molecule encoding the DNA polymerase according to the present invention or encoding an enzymatically active fragment thereof can be synthesized by methods well known to those skilled in the art or by commercial suppliers well known to those skilled in the art (eg, Genscript, ThermoFisher Scientific, etc.).

[0139] The skilled person in the art is well aware of and familiar with the various available biotechnological techniques for expressing isolated or purified nucleic acid molecules for the preparation of recombinant proteins by heterologous expression in various host cell systems using conventional genetic engineering techniques and recombinant DNA expression systems, see for example "Recombinant Gene Expression Protocols, in Methods in Molecular Biology, 1997, Ed. Rocky S Tuan, Human Press (ISSN 1064-3745) or Sambrook et al., Molecular Cloning: A laboratory Manual (third edition), 2001, CSHL Press, (ISBN 978-087969577-4). For example, a nucleic acid molecule encoding an enzyme according to the invention or encoding an enzymatically active fragment thereof can be inserted into a suitable expression vector comprising all necessary transcriptional and translational regulatory sequences particularly suitable for directing the expression of the desired protein-encoding nucleic acid sequence in a suitable host cell. Suitable expression vectors are, for example, plasmids, cosmids, viruses or artificial yeast chromosomes (YACs).

[0140] For example, the DNA molecule to be expressed and used to prepare the DNA polymerase according to the invention can be inserted into a vector for propagating the sequence of interest or for expressing the coding sequence of the DNA polymerase of the invention. Fast Cloning is an example of a suitable method for this purpose.

[0141] According to one aspect of the present invention, there is provided a vector, such as an expression vector, comprising a nucleic acid molecule encoding a DNA polymerase or an enzymatically active fragment thereof according to the present invention.

[0142] According to a further aspect, a vector, such as an expression vector, is provided, which comprises a nucleic acid molecule encoding an amino acid sequence selected from SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8, or an amino acid sequence having at least about 60% sequence identity with SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8 over the entire sequence length, such as having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity over the entire sequence length.

[0143] According to another aspect, an expression vector is provided, comprising SEQ ID No. 9, or a nucleic acid molecule having at least 80% sequence identity with SEQ ID No. 9 over the entire sequence length, or a sequence having at least 80% sequence identity with SEQ ID No. 9 over the entire sequence length (such as having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID No. 9 over the entire sequence length).

[0144] The skilled person will recognize that the DNA polymerase according to the invention may be prepared using an expression vector comprising a nucleic acid molecule encoding the DNA polymerase according to the invention, wherein the molecule is operably linked to a promoter suitable for the host cell in question.

[0145] Those skilled in the art will also recognize that "promoter" as used herein refers to the DNA upstream (5'-start) region of a DNA coding sequence that controls and initiates transcription of a specific gene. The promoter controls the recognition and binding of RNA polymerase and other proteins to initiate transcription. "Operably connected" refers to the functional connection between a promoter and a second sequence, wherein the promoter sequence initiates and mediates the transcription of a DNA sequence corresponding to the second sequence. Typically, operably connected means that the connected nucleotide sequence is continuous. For example, a vector suitable for expressing a recombinant protein in a bacterial host cell may include a promoter suitable for a bacterial expression system, such as a T7 promoter.

[0146] The vectors according to the invention can be isolated using standard plasmid isolation techniques well known to those skilled in the art, for example using plasmid isolation kits from Qiagen TM QIAprep TM Spin Miniprep Kit or QIAGEN TM Plasmid Plus Maxi Kit.

[0147] Various commercially available host cells or viruses can be used. For example, bacterial host cells such as E. coli, BL21 cells or Rosetta 2 (DE3) cells (Novagen) can be used. Transformation of the expression vector can be performed by methods well known to those skilled in the art, such as using chemically competent cells.

[0148] After culturing the host cells in a suitable medium, the DNA polymerase of the present invention or an enzymatically active fragment thereof encoded by the expression vector will be produced in the host cells, and the resulting DNA polymerase can be collected and purified using methods well known to skilled artisans.

[0149] The expression vector may also include a signal sequence for secreting the expressed enzyme into the culture medium.

[0150] As mentioned above, recombinant DNA technology can be used to synthesize DNA polymerase of the present invention. Alternatively, a cell-free expression system is used to prepare DNA polymerase of the present invention, or it can be prepared using a chemical peptide synthesis method, for example, according to the desired amino acid sequence, by the stepwise condensation reaction of the carboxyl group of one amino acid with the amino group of another amino acid.

[0151] According to one aspect, a method for preparing a DNA polymerase of the present invention or an enzymatically active fragment thereof is provided, comprising the steps of: (i) culturing a host cell comprising one or more expression vectors of the present invention suitable for expressing the encoded DNA polymerase; and optionally (ii) isolating or obtaining the DNA polymerase from the host cell or from the culture medium (supernatant).

[0152] Those skilled in the art will recognize that there are several methods that can be used for separating and optionally purifying recombinantly expressed proteins from host cells or substratum. In order to separate and purify the expressed DNA polymerase obtained from fermented liquid, usually at first use one or more pre-treatments or clarification steps to remove large particles and biomass. The limiting examples of applicable pre-treatment steps are for example reverse osmosis, centrifugal, filtering method and diafiltration, or their combination. Then usually one or more enzymes that purify the acquisition in the multiple chromatographic methods known to the technician are obtained, for example by affinity chromatography, ion exchange chromatography, mixed mode chromatography, hydrophobic interaction chromatography, size exclusion chromatography or other chromatographic techniques, or their combination.

[0153] For example, enzymes expressed by suitable host cells can be purified using affinity chromatography, e.g., using MabSelect TM SuRe TM HiTrap MabSelect media and FPLC chromatography system TM SuRe TM Column, such as the BioRad NGC Discover equipped with a 5 mm UV flow cell TM 10Pro system. After loading the sample containing the enzyme to be purified, the column is usually washed once or multiple times with one or more applicable wash buffers, and the protein is then eluted using an applicable elution buffer. The enzyme obtained can be further purified using one or more of the chromatographic methods listed above.

[0154] Uses of the DNA polymerase of the present invention

[0155] Enzyme of the present invention can be used for any molecular biology process using DNA polymerase.Especially, the DNA polymerase can be used for DNA amplification method and DNA assembly process, particularly multiple DNA assembly process.The DNA polymerase is particularly conducive to use in the molecular biology process carried out at room temperature.In addition, the DNA polymerase of the present invention can also be used for the molecular biology process that preferably avoids the inactivation step.

[0156] The various methods known to be based on homologous recombination techniques can be used to assemble nucleic acid molecules. The DNA polymerase of the present invention is particularly useful for nucleic acid molecule assembly methods based on homologous recombination, and is suitable for assembling a large number of nucleic acid molecules. For example, the DNA polymerase of the present invention can be used for the DNA assembly process disclosed in EP1915446B1 or the in vitro recombination method disclosed in EP1929012B1.

[0157] In order to assemble multiple DNA molecules in the desired order, the ends to be assembled should share sequence identity to ensure annealing (hybridization) of the individual overhangs considered resulting from the exonuclease digestion step. The length of the overhangs is preferably sufficient to specifically hybridize with the complementary overhangs of the shared region of sequence identity, thereby allowing hybridization of single-stranded overhangs. As an illustration of the principle of annealing multiple dsDNA molecules, refer to SLIC: a method for sequence and ligation independent cloning by Li and Elledge, 2012, Gene Synthesis, pp 51-59, page 54. Figure 2 .

[0158] The DNA polymerase of the present invention is particularly suitable because the polymerization process can be carried out at room temperature. In addition, since the DNA polymerase of the present invention is thermolabile and inactivated at temperatures above about 25°C, the polymerization process can be easily stopped without the use of laborious inactivation steps. The fact that the DNA polymerase of the present invention exerts proofreading activity in the form of a 3'-5' exonuclease makes it suitable for high-fidelity amplification processes.

[0159] The DNA polymerases of the present invention having impaired strand displacement activity or lacking strand displacement activity are particularly useful in multiplex DNA assembly processes.

[0160] In addition, the DNA polymerase of the present invention is a large-fragment DNA polymerase lacking a 5'-3' exonuclease domain and having impaired strand displacement activity or lacking strand displacement activity, which is also particularly useful in multiplex DNA assembly processes.

[0161] Example

[0162] Example 1: Identification of DNA polymerase (MG pol I) and its modification by site-directed mutagenesis

[0163] After analyzing a metagenomic library originating from samples provided in the Arctic region near Svalbard, a DNA sequence encoding a polymerase according to SEQ ID No. 2 was identified.

[0164] Carrier Purchased from Invitrogen GeneArt gene synthesis service of Thermo Fisher Scientific, this vector contains a codon-optimized gene encoding a large fragment of the identified DNA polymerase (SEQ ID No. 9).

[0165] In order to provide modified enzymes, wherein the strand displacement activity of the identified enzyme is reduced, impaired or inactivated compared to the wild-type enzyme, multiple mutations were introduced into SEQ ID No. 9 using the QuikChange II site-directed mutagenesis kit (Agilent Technologies). The introduced modifications were confirmed by sequencing analysis.

[0166] Example 2: Preparation of recombinant DNA polymerase I (MG Pol I) of the present invention

[0167] In Rosetta 2 (DE3) cells Recombinant protein production of MG Pol I large fragment and its mutants was performed in . Cells were grown in Terrific broth / ampicillin (100 μg / ml) and cultured at OD 1 by addition of 0.1 mM IPTG. 600nm Gene expression was induced at 1.0. Protein production was performed overnight at 15°C. For protein purification, 1 / 2-1 culture pellet was resuspended in 50 mM HEPES pH 7.5 (at 25°C), 500 mM NaCl, 5% glycerol, 1 mM DTT, pH 7.5, 0.15 mg / ml lysozyme, 1 protease inhibitor tablet (Complete TM , Mini, EDTA-free protease inhibitor cocktail, Roche) and incubated on ice for 30 min. Cell disruption was performed by sonication with a VCX 750 (pulse 1.0 / 1.0, 15 min, amplitude 25%). 2+ - Affinity chromatography purification by centrifugation (48384g, 45 min, 4°C) and filtration The soluble fraction of the His6-tagged proteins present after Ni was removed. After a washing step with 50 mM HEPES, 500 mM NaCl, 35 mM imidazole, 5% glycerol, 1 mM DTT, pH 7.5, the proteins were eluted at an imidazole concentration of 250 mM and further transferred into 50 mM HEPES, 500 mM NaCl, 10 mM MgCl2, 5% glycerol, pH 7.5 by using a desalting column. The second step was the cleavage of the tag by TEV protease overnight at 4 °C in 50 mM Tris pH 8.0, 0.5 mM EDTA and 1 mM DTT. In order to separate the proteins from the His6-tag and the His6-tagged TEV protease, a second Ni was performed in the third step by applying 50 mM HEPES, 500 mM NaCl, 5% glycerol, 1 mM DTT, pH 7.5. 2+ - Affinity chromatography. The final protein solution was concentrated and stored with 50% glycerol at -20°C for activity assays.

[0168] Example 3: Measurement of polymerase activity of the enzyme of the present invention

[0169] In order to measure the polymerase activity of the enzyme of the present invention and also compare the novel enzyme with known DNA polymerases, a molecular beacon probe-based assay was used (modified from Summerer, Methods Mol. Biol., 2008, 429, 225-235). The molecular beacon template consists of a 23mer ring connected by a GC-rich 8mer stem region (sequence shown in italics) and a 43mer extension. Due to the ring formation, the fluorophores Dabcyl and FAM are in close proximity and are therefore quenched. After the primer annealed to the molecular beacon template is extended by DNA polymerase I, the stem is opened and the increase in the distance between the two fluorophores is measured by the recovery of FAM fluorescence (excitation 485nm, emission 518nm).

[0170] Molecular Beacon Template

[0171] 5′-GGCCCGT Dabcyl AGGAGGAAAGGACATCTTCTAGCAT FAM ACGGGCCGTCA-AGTTCATGGCCAGTCAAGTCGTCAGAAATTTCGCACCAC-3'(SEQ ID.No.10)

[0172] Primers

[0173] 5′-GTGGTGCGAAATTTCTGAC-3′(SEQ ID.No.11)

[0174] Molecular beacon substrate was generated by incubating 20 μl of 10 μM molecular beacon template and 15 μM primer in 10 mM Tris-HCl pH 8.0, 100 mM NaCl at 95°C for 5 minutes. The reaction was then allowed to cool at room temperature for 2 hours. The substrate solution was stored at -20°C at a final concentration of 10 μM.

[0175] Fifty microliter reactions consisted of 200 nM substrate and 200 μM dNTPs (equimolar amounts of dATP, dGTP, dCTP, and dTTP). The reaction further contained 5 mM MgCl2 in 50 mM Tris-HCl pH 8.5, 100 mM KCl, 1 mM DTT, 0.2 mg / ml BSA, and 2% glycerol. In a black 96-well fluorescence assay plate Activity assays were performed at 25°C in . The reaction was initiated by adding the protein solution (i.e. MGpol I and its variants). The increase in FAM fluorescence was measured as relative fluorescence units at appropriate time intervals by excitation at 485 nm and emission at 518 nm. Measurements were performed in a Gemini microplate reader (Molecular Devices).

[0176] The results are as follows Figure 3 As shown, it is shown that the enzyme of the present invention has higher DNA polymerase activity.

[0177] Example 4: Strand displacement activity assay

[0178] The assay is based on an increase in fluorescence signal, which is measured upon displacement of a quenched reporter strand. This can only be achieved through the strand displacement activity of a DNA polymerase.

[0179] The substrate for the strand displacement activity assay consists of a "cold" primer of 19 oligonucleotides and a reporter strand consisting of 20 oligonucleotides, labeled with a TAMRA fluorophore [TAMRA] at its 3' end. The template strand consists of 40 oligonucleotides and is labeled with a black hole quencher 2 (BHQ2) at its 5' end. The primer anneals to the template strand, leaving a nucleotide gap (gap) at position 20 of the template strand. In addition, the label is in close proximity and therefore the fluorophore TAMRA will be quenched by BHQ2. When strand displacement activity occurs in DNA polymerase I, the TAMRA-labeled oligonucleotide is displaced from the template strand. Therefore, the fluorophore and quencher are no longer in close proximity, and the increase in TAMRA fluorescence can be measured (excitation 525nm, emission 598nm).

[0180] 5'-TATCCACCAATACTACCCTCGATACTTTGTCCACTCAAT[TAMRA]-3'(SEQ ID No.12)

[0181] 3'-ATAGGTGGTTATGATGGGATGCTATGAAACAGGTGAGTTA[BHQ2]-5'(SEQ ID No.13)

[0182] The strand displacement activity of the DNA polymerases and variants thereof of the present invention has been analyzed using the strand displacement activity assay described above and is expressed as mRFU / min / μg.

[0183] The substrate for the strand displacement activity assay was generated by incubating 20 μl of 10 μM "cold" primer, 10 μM reporter strand, and 10 μM template strand in 10 mM Tris-HCl pH 8.0, 100 mM NaCl at 95°C for 5 minutes. The reaction was then allowed to cool at room temperature for 2 hours. The substrate solution was stored at -20°C at a final concentration of 10 μM.

[0184] Fifty microliter reactions consisted of 200 nM substrate and 200 μM dNTPs (equimolar amounts of dATP, dGTP, dCTP, and dTTP). The reaction further contained 5 mM MgCl2 in 50 mM Tris-HCl pH 8.5, 100 mM KCl, 1 mM DTT, 0.2 mg / ml BSA, and 2% glycerol. In a black 96-well fluorescence assay plate Activity assays were performed at 25°C in . The reaction was initiated by adding protein solution (i.e. MG pol I and its variants). The increase in TAMRA fluorescence was measured as relative fluorescence units at appropriate time intervals by excitation at 525 nm and recording emission at 598 nm. M2 e The measurements were performed in a microplate reader (Molecular Devices).

[0185] The analysis results are as follows Figure 5 and Figure 6 shown.

[0186] Overview of serial numbers mentioned in the description and sequence listing

[0187] Sequence Listing <110> University of Tromsø <120> DNA polymerase <130> P26587PC00 <160> 13 <170> PatentIn version 3.5 <210> 1 <211> 611 <212> PRT <213> Marine polymerase <220> <221> misc_feature <222> (449)..(451) <223> Xaa can be any naturally occurring amino acid <220> <221> misc_feature <222> (521)..(521) <223> Xaa can be any naturally occurring amino acid <400> 1 Phe Asp Lys Ser Lys Tyr Glu Cys Val Gln Asp Val Glu Arg Leu Gln 1 5 10 15 His Trp Val Asp Arg Cys Thr Asp Val Gly Tyr Cys Ala Val Asp Leu 20 25 30 Glu Thr Asp Ser Leu Asp Ser Ala Ala Ala Asn Leu Val Gly Val Cys 35 40 45 Leu Ala Val Ala Asp Asn Glu Ala Cys Tyr Ile Pro Leu Gly His Thr 50 55 60 Gly Gly Gly Asp Leu Leu Gly Asp Gly Ala Pro Glu Gln Ile Pro Met 65 70 75 80 Gln Thr Ala Leu Asp Val Leu Glu Pro Met Leu His Asn Ala Ala Val 85 90 95 Leu Lys Ile Gly Gln Asn Phe Lys Tyr Asp Leu Gly Val Phe Gln Arg 100 105 110 Tyr Gly Leu Gln Pro Ala Pro Tyr Asp Asp Thr Met Leu Ile Ser Tyr 115 120 125 Ala Leu Ser Cys Gly Leu His Ser His Gly Met Asp Asn Leu Ser Glu 130 135 140 Met Tyr Phe Asp His Lys Pro Ile Pro Phe Lys Glu Leu Val Gly Ser 145 150 155 160 Gly Lys Ser Gln Lys Thr Phe Asn Gln Leu Ser Leu Glu Glu Ser Thr 165 170 175 Pro Tyr Ala Ala Glu Asp Ala Asp Val Thr Leu Arg Leu Trp Lys Leu 180 185 190 Leu Lys Pro Arg Leu Ala Ser Glu Asn Val Ala Ser Val Tyr Glu Thr 195 200 205 Leu Glu Arg Gly Met Pro Ser Val Leu Ala Met Met Glu Asn Asn Gly 210 215 220 Ile Lys Val Asp Lys Ala Val Leu Ala Arg Leu Ser Gly Asp Phe Glu 225 230 235 240 Gln Lys Lys Ala Gly Leu Glu Ala Glu Ala His Glu Leu Ala Gly Arg 245 250 255 Ser Phe Asn Leu Gly Ser Pro Lys Gln Leu Gly Glu Ile Leu Phe Asp 260 265 270 Glu Leu Gly Leu Ser Gly Gly Lys Lys Thr Lys Thr Gly Ala Trp Gln 275 280 285 Thr Gly Ala Gly Ile Leu Glu Ala Leu Glu His Val His Pro Leu Pro 290 295 300 Lys Ala Ile Leu Glu Trp Arg His Tyr Ala Lys Leu Lys Ser Thr Tyr 305 310 315 320 Thr Asp Thr Leu Pro Gln Gln Ile Asn Ala Arg Thr Gly Arg Val His 325 330 335 Thr Ser Tyr Ser Leu Ala Ser Thr Ser Thr Gly Arg Leu Ser Ser Ser 340 345 350 Asp Pro Asn Leu Gln Asn Ile Pro Ile Arg Thr Glu Asp Gly Arg Lys 355 360 365 Ile Arg Thr Ala Phe Ile Ala Glu Pro Gly Asn Ile Leu Val Ala Ala 370 375 380 Asp Tyr Ser Gln Val Glu Leu Arg Ile Leu Ala His Val Ala Asp Leu 385 390 395 400 Thr Asn Met Lys Gln Ala Phe Ala Asp Gly Val Asp Ile His Ala Leu 405 410 415 Thr Ala Ser Glu Met Phe Gly Val Pro Ile Asp Gly Met Asp Ser Ser 420 425 430 Val Arg Arg Arg Ala Lys Ala Ile Asn Phe Gly Ile Ile Tyr Gly Ile 435 440 445 Xaa Xaa Xaa Gly Leu Ala Asn Asn Leu Gly Ile Ser Arg Thr Glu Ala 450 455 460 Lys Glu Tyr Ile Asp Ser Tyr Phe Glu Lys Phe Pro Gly Ile Lys Thr 465 470 475 480 Tyr Met Glu Ser Ala Lys Asp Glu Ala Arg Glu Asn Gly Phe Val Lys 485 490 495 Thr Ile Phe Gly Arg Lys Cys His Ile Lys Gly Ile Asn Asp Lys Asn 500 505 510 Gly Ala Met Arg Gly Phe Gly Glu Xaa Gln Ala Ile Asn Ala Pro Ile 515 520 525 Gln Gly Ala Ala Ala Asp Ile Met Arg Arg Ala Met Ile Arg Met Pro 530 535 540 Asn Ala Ile Ser Asn Ile Glu Asn Ala Arg Met Leu Leu Gln Val His 545 550 555 560 Asp Glu Leu Val Phe Glu Val Pro Glu Ala Ser Ala Glu Ala Leu Ile 565 570 575 Lys Thr Val Lys Ser Val Met Gln Asn Ala Cys Ala Pro Ala Val His 580 585 590 Leu Ser Val Pro Leu Val Val Asp Ala Lys Ala Ala His Asn Trp Asn 595 600 605 Asp Ala His 610 <210> 2 <211> 611 <212> PRT <213> Marine polymerase <400> 2 Phe Asp Lys Ser Lys Tyr Glu Cys Val Gln Asp Val Glu Arg Leu Gln 1 5 10 15 His Trp Val Asp Arg Cys Thr Asp Val Gly Tyr Cys Ala Val Asp Leu 20 25 30 Glu Thr Asp Ser Leu Asp Ser Ala Ala Ala Asn Leu Val Gly Val Cys 35 40 45 Leu Ala Val Ala Asp Asn Glu Ala Cys Tyr Ile Pro Leu Gly His Thr 50 55 60 Gly Gly Gly Asp Leu Leu Gly Asp Gly Ala Pro Glu Gln Ile Pro Met 65 70 75 80 Gln Thr Ala Leu Asp Val Leu Glu Pro Met Leu His Asn Ala Ala Val 85 90 95 Leu Lys Ile Gly Gln Asn Phe Lys Tyr Asp Leu Gly Val Phe Gln Arg 100 105 110 Tyr Gly Leu Gln Pro Ala Pro Tyr Asp Asp Thr Met Leu Ile Ser Tyr 115 120 125 Ala Leu Ser Cys Gly Leu His Ser His Gly Met Asp Asn Leu Ser Glu 130 135 140 Met Tyr Phe Asp His Lys Pro Ile Pro Phe Lys Glu Leu Val Gly Ser 145 150 155 160 Gly Lys Ser Gln Lys Thr Phe Asn Gln Leu Ser Leu Glu Glu Ser Thr 165 170 175 Pro Tyr Ala Ala Glu Asp Ala Asp Val Thr Leu Arg Leu Trp Lys Leu 180 185 190 Leu Lys Pro Arg Leu Ala Ser Glu Asn Val Ala Ser Val Tyr Glu Thr 195 200 205 Leu Glu Arg Gly Met Pro Ser Val Leu Ala Met Met Glu Asn Asn Gly 210 215 220 Ile Lys Val Asp Lys Ala Val Leu Ala Arg Leu Ser Gly Asp Phe Glu 225 230 235 240 Gln Lys Lys Ala Gly Leu Glu Ala Glu Ala His Glu Leu Ala Gly Arg 245 250 255 Ser Phe Asn Leu Gly Ser Pro Lys Gln Leu Gly Glu Ile Leu Phe Asp 260 265 270 Glu Leu Gly Leu Ser Gly Gly Lys Lys Thr Lys Thr Gly Ala Trp Gln 275 280 285 Thr Gly Ala Gly Ile Leu Glu Ala Leu Glu His Val His Pro Leu Pro 290 295 300 Lys Ala Ile Leu Glu Trp Arg His Tyr Ala Lys Leu Lys Ser Thr Tyr 305 310 315 320 Thr Asp Thr Leu Pro Gln Gln Ile Asn Ala Arg Thr Gly Arg Val His 325 330 335 Thr Ser Tyr Ser Leu Ala Ser Thr Ser Thr Gly Arg Leu Ser Ser Ser 340 345 350 Asp Pro Asn Leu Gln Asn Ile Pro Ile Arg Thr Glu Asp Gly Arg Lys 355 360 365 Ile Arg Thr Ala Phe Ile Ala Glu Pro Gly Asn Ile Leu Val Ala Ala 370 375 380 Asp Tyr Ser Gln Val Glu Leu Arg Ile Leu Ala His Val Ala Asp Leu 385 390 395 400 Thr Asn Met Lys Gln Ala Phe Ala Asp Gly Val Asp Ile His Ala Leu 405 410 415 Thr Ala Ser Glu Met Phe Gly Val Pro Ile Asp Gly Met Asp Ser Ser 420 425 430 Val Arg Arg Arg Ala Lys Ala Ile Asn Phe Gly Ile Ile Tyr Gly Ile 435 440 445 Ser Ala Phe Gly Leu Ala Asn Asn Leu Gly Ile Ser Arg Thr Glu Ala 450 455 460 Lys Glu Tyr Ile Asp Ser Tyr Phe Glu Lys Phe Pro Gly Ile Lys Thr 465 470 475 480 Tyr Met Glu Ser Ala Lys Asp Glu Ala Arg Glu Asn Gly Phe Val Lys 485 490 495 Thr Ile Phe Gly Arg Lys Cys His Ile Lys Gly Ile Asn Asp Lys Asn 500 505 510 Gly Ala Met Arg Gly Phe Gly Glu Arg Gln Ala Ile Asn Ala Pro Ile 515 520 525 Gln Gly Ala Ala Ala Asp Ile Met Arg Arg Ala Met Ile Arg Met Pro 530 535 540 Asn Ala Ile Ser Asn Ile Glu Asn Ala Arg Met Leu Leu Gln Val His 545 550 555 560 Asp Glu Leu Val Phe Glu Val Pro Glu Ala Ser Ala Glu Ala Leu Ile 565 570 575 Lys Thr Val Lys Ser Val Met Gln Asn Ala Cys Ala Pro Ala Val His 580 585 590 Leu Ser Val Pro Leu Val Val Asp Ala Lys Ala Ala His Asn Trp Asn 595 600 605 Asp Ala His 610 <210> 3 <211> 611 <212> PRT <213> Marine polymerase modified by mutagenesis <400> 3 Phe Asp Lys Ser Lys Tyr Glu Cys Val Gln Asp Val Glu Arg Leu Gln 1 5 10 15 His Trp Val Asp Arg Cys Thr Asp Val Gly Tyr Cys Ala Val Asp Leu 20 25 30 Glu Thr Asp Ser Leu Asp Ser Ala Ala Ala Asn Leu Val Gly Val Cys 35 40 45 Leu Ala Val Ala Asp Asn Glu Ala Cys Tyr Ile Pro Leu Gly His Thr 50 55 60 Gly Gly Gly Asp Leu Leu Gly Asp Gly Ala Pro Glu Gln Ile Pro Met 65 70 75 80 Gln Thr Ala Leu Asp Val Leu Glu Pro Met Leu His Asn Ala Ala Val 85 90 95 Leu Lys Ile Gly Gln Asn Phe Lys Tyr Asp Leu Gly Val Phe Gln Arg 100 105 110 Tyr Gly Leu Gln Pro Ala Pro Tyr Asp Asp Thr Met Leu Ile Ser Tyr 115 120 125 Ala Leu Ser Cys Gly Leu His Ser His Gly Met Asp Asn Leu Ser Glu 130 135 140 Met Tyr Phe Asp His Lys Pro Ile Pro Phe Lys Glu Leu Val Gly Ser 145 150 155 160 Gly Lys Ser Gln Lys Thr Phe Asn Gln Leu Ser Leu Glu Glu Ser Thr 165 170 175 Pro Tyr Ala Ala Glu Asp Ala Asp Val Thr Leu Arg Leu Trp Lys Leu 180 185 190 Leu Lys Pro Arg Leu Ala Ser Glu Asn Val Ala Ser Val Tyr Glu Thr 195 200 205 Leu Glu Arg Gly Met Pro Ser Val Leu Ala Met Met Glu Asn Asn Gly 210 215 220 Ile Lys Val Asp Lys Ala Val Leu Ala Arg Leu Ser Gly Asp Phe Glu 225 230 235 240 Gln Lys Lys Ala Gly Leu Glu Ala Glu Ala His Glu Leu Ala Gly Arg 245 250 255 Ser Phe Asn Leu Gly Ser Pro Lys Gln Leu Gly Glu Ile Leu Phe Asp 260 265 270 Glu Leu Gly Leu Ser Gly Gly Lys Lys Thr Lys Thr Gly Ala Trp Gln 275 280 285 Thr Gly Ala Gly Ile Leu Glu Ala Leu Glu His Val His Pro Leu Pro 290 295 300 Lys Ala Ile Leu Glu Trp Arg His Tyr Ala Lys Leu Lys Ser Thr Tyr 305 310 315 320 Thr Asp Thr Leu Pro Gln Gln Ile Asn Ala Arg Thr Gly Arg Val His 325 330 335 Thr Ser Tyr Ser Leu Ala Ser Thr Ser Thr Gly Arg Leu Ser Ser Ser 340 345 350 Asp Pro Asn Leu Gln Asn Ile Pro Ile Arg Thr Glu Asp Gly Arg Lys 355 360 365 Ile Arg Thr Ala Phe Ile Ala Glu Pro Gly Asn Ile Leu Val Ala Ala 370 375 380 Asp Tyr Ser Gln Val Glu Leu Arg Ile Leu Ala His Val Ala Asp Leu 385 390 395 400 Thr Asn Met Lys Gln Ala Phe Ala Asp Gly Val Asp Ile His Ala Leu 405 410 415 Thr Ala Ser Glu Met Phe Gly Val Pro Ile Asp Gly Met Asp Ser Ser 420 425 430 Val Arg Arg Arg Ala Lys Ala Ile Asn Phe Gly Ile Ile Tyr Gly Ile 435 440 445 Ser Asp Phe Gly Leu Ala Asn Asn Leu Gly Ile Ser Arg Thr Glu Ala 450 455 460 Lys Glu Tyr Ile Asp Ser Tyr Phe Glu Lys Phe Pro Gly Ile Lys Thr 465 470 475 480 Tyr Met Glu Ser Ala Lys Asp Glu Ala Arg Glu Asn Gly Phe Val Lys 485 490 495 Thr Ile Phe Gly Arg Lys Cys His Ile Lys Gly Ile Asn Asp Lys Asn 500 505 510 Gly Ala Met Arg Gly Phe Gly Glu Arg Gln Ala Ile Asn Ala Pro Ile 515 520 525 Gln Gly Ala Ala Ala Asp Ile Met Arg Arg Ala Met Ile Arg Met Pro 530 535 540 Asn Ala Ile Ser Asn Ile Glu Asn Ala Arg Met Leu Leu Gln Val His 545 550 555 560 Asp Glu Leu Val Phe Glu Val Pro Glu Ala Ser Ala Glu Ala Leu Ile 565 570 575 Lys Thr Val Lys Ser Val Met Gln Asn Ala Cys Ala Pro Ala Val His 580 585 590 Leu Ser Val Pro Leu Val Val Asp Ala Lys Ala Ala His Asn Trp Asn 595 600 605 Asp Ala His 610 <210> 4 <211> 611 <212> PRT <213> Marine polymerase modified by mutagenesis <400> 4 Phe Asp Lys Ser Lys Tyr Glu Cys Val Gln Asp Val Glu Arg Leu Gln 1 5 10 15 His Trp Val Asp Arg Cys Thr Asp Val Gly Tyr Cys Ala Val Asp Leu 20 25 30 Glu Thr Asp Ser Leu Asp Ser Ala Ala Ala Asn Leu Val Gly Val Cys 35 40 45 Leu Ala Val Ala Asp Asn Glu Ala Cys Tyr Ile Pro Leu Gly His Thr 50 55 60 Gly Gly Gly Asp Leu Leu Gly Asp Gly Ala Pro Glu Gln Ile Pro Met 65 70 75 80 Gln Thr Ala Leu Asp Val Leu Glu Pro Met Leu His Asn Ala Ala Val 85 90 95 Leu Lys Ile Gly Gln Asn Phe Lys Tyr Asp Leu Gly Val Phe Gln Arg 100 105 110 Tyr Gly Leu Gln Pro Ala Pro Tyr Asp Asp Thr Met Leu Ile Ser Tyr 115 120 125 Ala Leu Ser Cys Gly Leu His Ser His Gly Met Asp Asn Leu Ser Glu 130 135 140 Met Tyr Phe Asp His Lys Pro Ile Pro Phe Lys Glu Leu Val Gly Ser 145 150 155 160 Gly Lys Ser Gln Lys Thr Phe Asn Gln Leu Ser Leu Glu Glu Ser Thr 165 170 175 Pro Tyr Ala Ala Glu Asp Ala Asp Val Thr Leu Arg Leu Trp Lys Leu 180 185 190 Leu Lys Pro Arg Leu Ala Ser Glu Asn Val Ala Ser Val Tyr Glu Thr 195 200 205 Leu Glu Arg Gly Met Pro Ser Val Leu Ala Met Met Glu Asn Asn Gly 210 215 220 Ile Lys Val Asp Lys Ala Val Leu Ala Arg Leu Ser Gly Asp Phe Glu 225 230 235 240 Gln Lys Lys Ala Gly Leu Glu Ala Glu Ala His Glu Leu Ala Gly Arg 245 250 255 Ser Phe Asn Leu Gly Ser Pro Lys Gln Leu Gly Glu Ile Leu Phe Asp 260 265 270 Glu Leu Gly Leu Ser Gly Gly Lys Lys Thr Lys Thr Gly Ala Trp Gln 275 280 285 Thr Gly Ala Gly Ile Leu Glu Ala Leu Glu His Val His Pro Leu Pro 290 295 300 Lys Ala Ile Leu Glu Trp Arg His Tyr Ala Lys Leu Lys Ser Thr Tyr 305 310 315 320 Thr Asp Thr Leu Pro Gln Gln Ile Asn Ala Arg Thr Gly Arg Val His 325 330 335 Thr Ser Tyr Ser Leu Ala Ser Thr Ser Thr Gly Arg Leu Ser Ser Ser 340 345 350 Asp Pro Asn Leu Gln Asn Ile Pro Ile Arg Thr Glu Asp Gly Arg Lys 355 360 365 Ile Arg Thr Ala Phe Ile Ala Glu Pro Gly Asn Ile Leu Val Ala Ala 370 375 380 Asp Tyr Ser Gln Val Glu Leu Arg Ile Leu Ala His Val Ala Asp Leu 385 390 395 400 Thr Asn Met Lys Gln Ala Phe Ala Asp Gly Val Asp Ile His Ala Leu 405 410 415 Thr Ala Ser Glu Met Phe Gly Val Pro Ile Asp Gly Met Asp Ser Ser 420 425 430 Val Arg Arg Arg Ala Lys Ala Ile Asn Phe Gly Ile Ile Tyr Gly Ile 435 440 445 Ala Ala Ala Gly Leu Ala Asn Asn Leu Gly Ile Ser Arg Thr Glu Ala 450 455 460 Lys Glu Tyr Ile Asp Ser Tyr Phe Glu Lys Phe Pro Gly Ile Lys Thr 465 470 475 480 Tyr Met Glu Ser Ala Lys Asp Glu Ala Arg Glu Asn Gly Phe Val Lys 485 490 495 Thr Ile Phe Gly Arg Lys Cys His Ile Lys Gly Ile Asn Asp Lys Asn 500 505 510 Gly Ala Met Arg Gly Phe Gly Glu Arg Gln Ala Ile Asn Ala Pro Ile 515 520 525 Gln Gly Ala Ala Ala Asp Ile Met Arg Arg Ala Met Ile Arg Met Pro 530 535 540 Asn Ala Ile Ser Asn Ile Glu Asn Ala Arg Met Leu Leu Gln Val His 545 550 555 560 Asp Glu Leu Val Phe Glu Val Pro Glu Ala Ser Ala Glu Ala Leu Ile 565 570 575 Lys Thr Val Lys Ser Val Met Gln Asn Ala Cys Ala Pro Ala Val His 580 585 590 Leu Ser Val Pro Leu Val Val Asp Ala Lys Ala Ala His Asn Trp Asn 595 600 605 Asp Ala His 610 <210> 5 <211> 611 <212> PRT <213> Marine polymerase modified by mutagenesis <400> 5 Phe Asp Lys Ser Lys Tyr Glu Cys Val Gln Asp Val Glu Arg Leu Gln 1 5 10 15 His Trp Val Asp Arg Cys Thr Asp Val Gly Tyr Cys Ala Val Asp Leu 20 25 30 Glu Thr Asp Ser Leu Asp Ser Ala Ala Ala Asn Leu Val Gly Val Cys 35 40 45 Leu Ala Val Ala Asp Asn Glu Ala Cys Tyr Ile Pro Leu Gly His Thr 50 55 60 Gly Gly Gly Asp Leu Leu Gly Asp Gly Ala Pro Glu Gln Ile Pro Met 65 70 75 80 Gln Thr Ala Leu Asp Val Leu Glu Pro Met Leu His Asn Ala Ala Val 85 90 95 Leu Lys Ile Gly Gln Asn Phe Lys Tyr Asp Leu Gly Val Phe Gln Arg 100 105 110 Tyr Gly Leu Gln Pro Ala Pro Tyr Asp Asp Thr Met Leu Ile Ser Tyr 115 120 125 Ala Leu Ser Cys Gly Leu His Ser His Gly Met Asp Asn Leu Ser Glu 130 135 140 Met Tyr Phe Asp His Lys Pro Ile Pro Phe Lys Glu Leu Val Gly Ser 145 150 155 160 Gly Lys Ser Gln Lys Thr Phe Asn Gln Leu Ser Leu Glu Glu Ser Thr 165 170 175 Pro Tyr Ala Ala Glu Asp Ala Asp Val Thr Leu Arg Leu Trp Lys Leu 180 185 190 Leu Lys Pro Arg Leu Ala Ser Glu Asn Val Ala Ser Val Tyr Glu Thr 195 200 205 Leu Glu Arg Gly Met Pro Ser Val Leu Ala Met Met Glu Asn Asn Gly 210 215 220 Ile Lys Val Asp Lys Ala Val Leu Ala Arg Leu Ser Gly Asp Phe Glu 225 230 235 240 Gln Lys Lys Ala Gly Leu Glu Ala Glu Ala His Glu Leu Ala Gly Arg 245 250 255 Ser Phe Asn Leu Gly Ser Pro Lys Gln Leu Gly Glu Ile Leu Phe Asp 260 265 270 Glu Leu Gly Leu Ser Gly Gly Lys Lys Thr Lys Thr Gly Ala Trp Gln 275 280 285 Thr Gly Ala Gly Ile Leu Glu Ala Leu Glu His Val His Pro Leu Pro 290 295 300 Lys Ala Ile Leu Glu Trp Arg His Tyr Ala Lys Leu Lys Ser Thr Tyr 305 310 315 320 Thr Asp Thr Leu Pro Gln Gln Ile Asn Ala Arg Thr Gly Arg Val His 325 330 335 Thr Ser Tyr Ser Leu Ala Ser Thr Ser Thr Gly Arg Leu Ser Ser Ser 340 345 350 Asp Pro Asn Leu Gln Asn Ile Pro Ile Arg Thr Glu Asp Gly Arg Lys 355 360 365 Ile Arg Thr Ala Phe Ile Ala Glu Pro Gly Asn Ile Leu Val Ala Ala 370 375 380 Asp Tyr Ser Gln Val Glu Leu Arg Ile Leu Ala His Val Ala Asp Leu 385 390 395 400 Thr Asn Met Lys Gln Ala Phe Ala Asp Gly Val Asp Ile His Ala Leu 405 410 415 Thr Ala Ser Glu Met Phe Gly Val Pro Ile Asp Gly Met Asp Ser Ser 420 425 430 Val Arg Arg Arg Ala Lys Ala Ile Asn Phe Gly Ile Ile Tyr Gly Ile 435 440 445 Ala Asp Phe Gly Leu Ala Asn Asn Leu Gly Ile Ser Arg Thr Glu Ala 450 455 460 Lys Glu Tyr Ile Asp Ser Tyr Phe Glu Lys Phe Pro Gly Ile Lys Thr 465 470 475 480 Tyr Met Glu Ser Ala Lys Asp Glu Ala Arg Glu Asn Gly Phe Val Lys 485 490 495 Thr Ile Phe Gly Arg Lys Cys His Ile Lys Gly Ile Asn Asp Lys Asn 500 505 510 Gly Ala Met Arg Gly Phe Gly Glu Arg Gln Ala Ile Asn Ala Pro Ile 515 520 525 Gln Gly Ala Ala Ala Asp Ile Met Arg Arg Ala Met Ile Arg Met Pro 530 535 540 Asn Ala Ile Ser Asn Ile Glu Asn Ala Arg Met Leu Leu Gln Val His 545 550 555 560 Asp Glu Leu Val Phe Glu Val Pro Glu Ala Ser Ala Glu Ala Leu Ile 565 570 575 Lys Thr Val Lys Ser Val Met Gln Asn Ala Cys Ala Pro Ala Val His 580 585 590 Leu Ser Val Pro Leu Val Val Asp Ala Lys Ala Ala His Asn Trp Asn 595 600 605 Asp Ala His 610 <210> 6 <211> 611 <212> PRT <213> Marine polymerase modified by mutagenesis <400> 6 Phe Asp Lys Ser Lys Tyr Glu Cys Val Gln Asp Val Glu Arg Leu Gln 1 5 10 15 His Trp Val Asp Arg Cys Thr Asp Val Gly Tyr Cys Ala Val Asp Leu 20 25 30 Glu Thr Asp Ser Leu Asp Ser Ala Ala Ala Asn Leu Val Gly Val Cys 35 40 45 Leu Ala Val Ala Asp Asn Glu Ala Cys Tyr Ile Pro Leu Gly His Thr 50 55 60 Gly Gly Gly Asp Leu Leu Gly Asp Gly Ala Pro Glu Gln Ile Pro Met 65 70 75 80 Gln Thr Ala Leu Asp Val Leu Glu Pro Met Leu His Asn Ala Ala Val 85 90 95 Leu Lys Ile Gly Gln Asn Phe Lys Tyr Asp Leu Gly Val Phe Gln Arg 100 105 110 Tyr Gly Leu Gln Pro Ala Pro Tyr Asp Asp Thr Met Leu Ile Ser Tyr 115 120 125 Ala Leu Ser Cys Gly Leu His Ser His Gly Met Asp Asn Leu Ser Glu 130 135 140 Met Tyr Phe Asp His Lys Pro Ile Pro Phe Lys Glu Leu Val Gly Ser 145 150 155 160 Gly Lys Ser Gln Lys Thr Phe Asn Gln Leu Ser Leu Glu Glu Ser Thr 165 170 175 Pro Tyr Ala Ala Glu Asp Ala Asp Val Thr Leu Arg Leu Trp Lys Leu 180 185 190 Leu Lys Pro Arg Leu Ala Ser Glu Asn Val Ala Ser Val Tyr Glu Thr 195 200 205 Leu Glu Arg Gly Met Pro Ser Val Leu Ala Met Met Glu Asn Asn Gly 210 215 220 Ile Lys Val Asp Lys Ala Val Leu Ala Arg Leu Ser Gly Asp Phe Glu 225 230 235 240 Gln Lys Lys Ala Gly Leu Glu Ala Glu Ala His Glu Leu Ala Gly Arg 245 250 255 Ser Phe Asn Leu Gly Ser Pro Lys Gln Leu Gly Glu Ile Leu Phe Asp 260 265 270 Glu Leu Gly Leu Ser Gly Gly Lys Lys Thr Lys Thr Gly Ala Trp Gln 275 280 285 Thr Gly Ala Gly Ile Leu Glu Ala Leu Glu His Val His Pro Leu Pro 290 295 300 Lys Ala Ile Leu Glu Trp Arg His Tyr Ala Lys Leu Lys Ser Thr Tyr 305 310 315 320 Thr Asp Thr Leu Pro Gln Gln Ile Asn Ala Arg Thr Gly Arg Val His 325 330 335 Thr Ser Tyr Ser Leu Ala Ser Thr Ser Thr Gly Arg Leu Ser Ser Ser 340 345 350 Asp Pro Asn Leu Gln Asn Ile Pro Ile Arg Thr Glu Asp Gly Arg Lys 355 360 365 Ile Arg Thr Ala Phe Ile Ala Glu Pro Gly Asn Ile Leu Val Ala Ala 370 375 380 Asp Tyr Ser Gln Val Glu Leu Arg Ile Leu Ala His Val Ala Asp Leu 385 390 395 400 Thr Asn Met Lys Gln Ala Phe Ala Asp Gly Val Asp Ile His Ala Leu 405 410 415 Thr Ala Ser Glu Met Phe Gly Val Pro Ile Asp Gly Met Asp Ser Ser 420 425 430 Val Arg Arg Arg Ala Lys Ala Ile Asn Phe Gly Ile Ile Tyr Gly Ile 435 440 445 Ser Asp Ala Gly Leu Ala Asn Asn Leu Gly Ile Ser Arg Thr Glu Ala 450 455 460 Lys Glu Tyr Ile Asp Ser Tyr Phe Glu Lys Phe Pro Gly Ile Lys Thr 465 470 475 480 Tyr Met Glu Ser Ala Lys Asp Glu Ala Arg Glu Asn Gly Phe Val Lys 485 490 495 Thr Ile Phe Gly Arg Lys Cys His Ile Lys Gly Ile Asn Asp Lys Asn 500 505 510 Gly Ala Met Arg Gly Phe Gly Glu Arg Gln Ala Ile Asn Ala Pro Ile 515 520 525 Gln Gly Ala Ala Ala Asp Ile Met Arg Arg Ala Met Ile Arg Met Pro 530 535 540 Asn Ala Ile Ser Asn Ile Glu Asn Ala Arg Met Leu Leu Gln Val His 545 550 555 560 Asp Glu Leu Val Phe Glu Val Pro Glu Ala Ser Ala Glu Ala Leu Ile 565 570 575 Lys Thr Val Lys Ser Val Met Gln Asn Ala Cys Ala Pro Ala Val His 580 585 590 Leu Ser Val Pro Leu Val Val Asp Ala Lys Ala Ala His Asn Trp Asn 595 600 605 Asp Ala His 610 <210> 7 <211> 611 <212> PRT <213> Marine polymerase modified by mutagenesis <400> 7 Phe Asp Lys Ser Lys Tyr Glu Cys Val Gln Asp Val Glu Arg Leu Gln 1 5 10 15 His Trp Val Asp Arg Cys Thr Asp Val Gly Tyr Cys Ala Val Asp Leu 20 25 30 Glu Thr Asp Ser Leu Asp Ser Ala Ala Ala Asn Leu Val Gly Val Cys 35 40 45 Leu Ala Val Ala Asp Asn Glu Ala Cys Tyr Ile Pro Leu Gly His Thr 50 55 60 Gly Gly Gly Asp Leu Leu Gly Asp Gly Ala Pro Glu Gln Ile Pro Met 65 70 75 80 Gln Thr Ala Leu Asp Val Leu Glu Pro Met Leu His Asn Ala Ala Val 85 90 95 Leu Lys Ile Gly Gln Asn Phe Lys Tyr Asp Leu Gly Val Phe Gln Arg 100 105 110 Tyr Gly Leu Gln Pro Ala Pro Tyr Asp Asp Thr Met Leu Ile Ser Tyr 115 120 125 Ala Leu Ser Cys Gly Leu His Ser His Gly Met Asp Asn Leu Ser Glu 130 135 140 Met Tyr Phe Asp His Lys Pro Ile Pro Phe Lys Glu Leu Val Gly Ser 145 150 155 160 Gly Lys Ser Gln Lys Thr Phe Asn Gln Leu Ser Leu Glu Glu Ser Thr 165 170 175 Pro Tyr Ala Ala Glu Asp Ala Asp Val Thr Leu Arg Leu Trp Lys Leu 180 185 190 Leu Lys Pro Arg Leu Ala Ser Glu Asn Val Ala Ser Val Tyr Glu Thr 195 200 205 Leu Glu Arg Gly Met Pro Ser Val Leu Ala Met Met Glu Asn Asn Gly 210 215 220 Ile Lys Val Asp Lys Ala Val Leu Ala Arg Leu Ser Gly Asp Phe Glu 225 230 235 240 Gln Lys Lys Ala Gly Leu Glu Ala Glu Ala His Glu Leu Ala Gly Arg 245 250 255 Ser Phe Asn Leu Gly Ser Pro Lys Gln Leu Gly Glu Ile Leu Phe Asp 260 265 270 Glu Leu Gly Leu Ser Gly Gly Lys Lys Thr Lys Thr Gly Ala Trp Gln 275 280 285 Thr Gly Ala Gly Ile Leu Glu Ala Leu Glu His Val His Pro Leu Pro 290 295 300 Lys Ala Ile Leu Glu Trp Arg His Tyr Ala Lys Leu Lys Ser Thr Tyr 305 310 315 320 Thr Asp Thr Leu Pro Gln Gln Ile Asn Ala Arg Thr Gly Arg Val His 325 330 335 Thr Ser Tyr Ser Leu Ala Ser Thr Ser Thr Gly Arg Leu Ser Ser Ser 340 345 350 Asp Pro Asn Leu Gln Asn Ile Pro Ile Arg Thr Glu Asp Gly Arg Lys 355 360 365 Ile Arg Thr Ala Phe Ile Ala Glu Pro Gly Asn Ile Leu Val Ala Ala 370 375 380 Asp Tyr Ser Gln Val Glu Leu Arg Ile Leu Ala His Val Ala Asp Leu 385 390 395 400 Thr Asn Met Lys Gln Ala Phe Ala Asp Gly Val Asp Ile His Ala Leu 405 410 415 Thr Ala Ser Glu Met Phe Gly Val Pro Ile Asp Gly Met Asp Ser Ser 420 425 430 Val Arg Arg Arg Ala Lys Ala Ile Asn Phe Gly Ile Ile Tyr Gly Ile 435 440 445 Ala Asp Ala Gly Leu Ala Asn Asn Leu Gly Ile Ser Arg Thr Glu Ala 450 455 460 Lys Glu Tyr Ile Asp Ser Tyr Phe Glu Lys Phe Pro Gly Ile Lys Thr 465 470 475 480 Tyr Met Glu Ser Ala Lys Asp Glu Ala Arg Glu Asn Gly Phe Val Lys 485 490 495 Thr Ile Phe Gly Arg Lys Cys His Ile Lys Gly Ile Asn Asp Lys Asn 500 505 510 Gly Ala Met Arg Gly Phe Gly Glu Arg Gln Ala Ile Asn Ala Pro Ile 515 520 525 Gln Gly Ala Ala Ala Asp Ile Met Arg Arg Ala Met Ile Arg Met Pro 530 535 540 Asn Ala Ile Ser Asn Ile Glu Asn Ala Arg Met Leu Leu Gln Val His 545 550 555 560 Asp Glu Leu Val Phe Glu Val Pro Glu Ala Ser Ala Glu Ala Leu Ile 565 570 575 Lys Thr Val Lys Ser Val Met Gln Asn Ala Cys Ala Pro Ala Val His 580 585 590 Leu Ser Val Pro Leu Val Val Asp Ala Lys Ala Ala His Asn Trp Asn 595 600 605 Asp Ala His 610 <210> 8 <211> 611 <212> PRT <213> Marine polymerase modified by mutagenesis <400> 8 Phe Asp Lys Ser Lys Tyr Glu Cys Val Gln Asp Val Glu Arg Leu Gln 1 5 10 15 His Trp Val Asp Arg Cys Thr Asp Val Gly Tyr Cys Ala Val Asp Leu 20 25 30 Glu Thr Asp Ser Leu Asp Ser Ala Ala Ala Asn Leu Val Gly Val Cys 35 40 45 Leu Ala Val Ala Asp Asn Glu Ala Cys Tyr Ile Pro Leu Gly His Thr 50 55 60 Gly Gly Gly Asp Leu Leu Gly Asp Gly Ala Pro Glu Gln Ile Pro Met 65 70 75 80 Gln Thr Ala Leu Asp Val Leu Glu Pro Met Leu His Asn Ala Ala Val 85 90 95 Leu Lys Ile Gly Gln Asn Phe Lys Tyr Asp Leu Gly Val Phe Gln Arg 100 105 110 Tyr Gly Leu Gln Pro Ala Pro Tyr Asp Asp Thr Met Leu Ile Ser Tyr 115 120 125 Ala Leu Ser Cys Gly Leu His Ser His Gly Met Asp Asn Leu Ser Glu 130 135 140 Met Tyr Phe Asp His Lys Pro Ile Pro Phe Lys Glu Leu Val Gly Ser 145 150 155 160 Gly Lys Ser Gln Lys Thr Phe Asn Gln Leu Ser Leu Glu Glu Ser Thr 165 170 175 Pro Tyr Ala Ala Glu Asp Ala Asp Val Thr Leu Arg Leu Trp Lys Leu 180 185 190 Leu Lys Pro Arg Leu Ala Ser Glu Asn Val Ala Ser Val Tyr Glu Thr 195 200 205 Leu Glu Arg Gly Met Pro Ser Val Leu Ala Met Met Glu Asn Asn Gly 210 215 220 Ile Lys Val Asp Lys Ala Val Leu Ala Arg Leu Ser Gly Asp Phe Glu 225 230 235 240 Gln Lys Lys Ala Gly Leu Glu Ala Glu Ala His Glu Leu Ala Gly Arg 245 250 255 Ser Phe Asn Leu Gly Ser Pro Lys Gln Leu Gly Glu Ile Leu Phe Asp 260 265 270 Glu Leu Gly Leu Ser Gly Gly Lys Lys Thr Lys Thr Gly Ala Trp Gln 275 280 285 Thr Gly Ala Gly Ile Leu Glu Ala Leu Glu His Val His Pro Leu Pro 290 295 300 Lys Ala Ile Leu Glu Trp Arg His Tyr Ala Lys Leu Lys Ser Thr Tyr 305 310 315 320 Thr Asp Thr Leu Pro Gln Gln Ile Asn Ala Arg Thr Gly Arg Val His 325 330 335 Thr Ser Tyr Ser Leu Ala Ser Thr Ser Thr Gly Arg Leu Ser Ser Ser 340 345 350 Asp Pro Asn Leu Gln Asn Ile Pro Ile Arg Thr Glu Asp Gly Arg Lys 355 360 365 Ile Arg Thr Ala Phe Ile Ala Glu Pro Gly Asn Ile Leu Val Ala Ala 370 375 380 Asp Tyr Ser Gln Val Glu Leu Arg Ile Leu Ala His Val Ala Asp Leu 385 390 395 400 Thr Asn Met Lys Gln Ala Phe Ala Asp Gly Val Asp Ile His Ala Leu 405 410 415 Thr Ala Ser Glu Met Phe Gly Val Pro Ile Asp Gly Met Asp Ser Ser 420 425 430 Val Arg Arg Arg Ala Lys Ala Ile Asn Phe Gly Ile Ile Tyr Gly Ile 435 440 445 Ser Ala Phe Gly Leu Ala Asn Asn Leu Gly Ile Ser Arg Thr Glu Ala 450 455 460 Lys Glu Tyr Ile Asp Ser Tyr Phe Glu Lys Phe Pro Gly Ile Lys Thr 465 470 475 480 Tyr Met Glu Ser Ala Lys Asp Glu Ala Arg Glu Asn Gly Phe Val Lys 485 490 495 Thr Ile Phe Gly Arg Lys Cys His Ile Lys Gly Ile Asn Asp Lys Asn 500 505 510 Gly Ala Met Arg Gly Phe Gly Glu Ala Gln Ala Ile Asn Ala Pro Ile 515 520 525 Gln Gly Ala Ala Ala Asp Ile Met Arg Arg Ala Met Ile Arg Met Pro 530 535 540 Asn Ala Ile Ser Asn Ile Glu Asn Ala Arg Met Leu Leu Gln Val His 545 550 555 560 Asp Glu Leu Val Phe Glu Val Pro Glu Ala Ser Ala Glu Ala Leu Ile 565 570 575 Lys Thr Val Lys Ser Val Met Gln Asn Ala Cys Ala Pro Ala Val His 580 585 590 Leu Ser Val Pro Leu Val Val Asp Ala Lys Free Mp3 Download 595 600 605 Asp Wing His 610 <210> 9 <211> 1836 <212> DNA <213> Already a snowflake with a snowflake <400> 9 ttcgacaaaa gcaaatatga gtgcgttcag gatgttgac gtctgcagca ttgggttgat cgttgtaccg atgttggtta ttgtgcagtt gatctggaaa ccgatagcct ggatagcgca gcagcaaatc tggttggtgt ttgtctggca gttgcagata atgaagcatg ttatattccg ctgggtcata ccggtggtgg tgatctgctt ggtgatggtg caccggaaca aattccgatg cagaccgcac tggatgttct ggaccgatg ctgcataatg ccgcagttct gaaaattggc 360. cagaacttca aatatgatct gggtgtgttt cagcgttatg gtctgcagcc tgcaccgtat gatgatacca tgctgattag ctatgcactg agctgtggtc tgcatagcca tggtatggat 420 480. aatctgagcg aaatgtattt cgaccataa ccgattccgt tcaaagaact ggttggtagc ggtaaaagcc agaaaacctt taatcagctg agcctggaag aaagcacccc gtatgcagcc 540 gaagatgcag atgttaccct gcgtctgtgg aaactgctga aaccgcgtct ggcaagcgaa 600 aatgttgcaa gcgtttatga aaccctggaa cgtggtatgc cgagcgttct ggcaatgatg 660 gaaaataatg gtatcaaagt ggataaagcg gttctggcac gtctgagcgg tgattttgaa 720 cagaaaaaag caggtctgga agccgaagca catgaactgg caggtcgttc atttaatctg 780 ggtagcccga aacagctggg tgaaattctg tttgatgaac tgggtctgag tggtggcaaa 840 aaaaccaaaa ccggtgcatg gcagaccggt gcaggtattc tggaagcact ggaacatgtg 900 catccgctgc cgaaagcaat tctggaatgg cgtcattatg caaaactgaa aagcacctat 960 accgatacac tgccgcagca gattaatgca cgtaccggtc gtgttcatac cagctatagc 1020 ctggcaagca ccagcaccgg tcgtctgagc agcagcgatc cgaatctgca gaatattccg 1080 attcgtaccg aagatggtcg taaaattcgc accgcattta ttgcagaacc gggtaatatt 1140 ctggttgcag ccgattatag ccaggttgaa ctgcgtattc tggcacatgt tgcagatctg 1200 accaatatga aacaggcatt tgcagatggt gttgatattc atgcactgac cgcaagtgaa 1260 atgtttggtg ttccgattga tggcatggat agcagcgttc gtcgtcgtgc aaaagcaatt 1320 aactttggta ttatctatgg catcagcgca tttggtctgg caaataatct gggcattagc 1380 cgcaccgaag caaaagaata tatcgatagc tacttcgaga agttccctgg cattaaaacc 1440 tatatggaaa gcgcaaaaga tgaagcccgt gaaaatggtt ttgtgaaaac gatttttggt 1500 cgcaagtgcc atattaaagg catcaacgat aaaaatggtg ccatgcgtgg ttttggtgaa 1560 cgtcaggcaa ttaacgcacc gattcagggt gcagcagcag atattatgcg tcgtgccatg 1620 attcgtatgc cgaatgccat tagcaatatt gaaaatgccc gtatgctgct tcaggttcat 1680 gatgagctgg tttttgaagt gccggaagca agcgcagaag cactgattaa aaccgttaaa 1740 agcgttatgc agaatgcatg tgcaccggca gttcatctga gcgttccgct ggttgttgat 1800 gcaaaagccg cacataattg gaatgatgcc cattaa 1836 <210> 10 <211> 82 <212> DNA <213> Synthetic molecular beacon template <400> 10 ggcccgtagg aggaaaggac atcttctagc atacgggccg tcaagttcat ggccagtcaa 60 gtcgtcagaa atttcgcacc ac 82 <210> 11 <211> 19 <212> DNA <213> Primer <400> 11 gtggtgcgaa atttctgac 19 <210> 12 <211> 39 <212> DNA <213> Primer <400> 12 tatccaccaa tactaccctc gatactttgt ccactcaat 39 <210> 13 <211> 40 <212> DNA <213> Primer <400> 13 ataggtggtt atgatgggat gctatgaaac aggtgagtta 40

Claims

1. An isolated DNA polymerase, wherein The DNA polymerase exerts strand displacement activity and 3'-5' exonuclease activity, and wherein the DNA polymerase is irreversibly inactivated at a temperature ranging from 30°C to 45°C, and wherein the DNA polymerase consists of the amino acid sequence of SEQ ID No.

2.

2. An isolated DNA polymerase, which consists of the amino acid sequence of any one of SEQ ID No. 3 to SEQ ID No.

8.

3. The isolated DNA polymerase according to claim 1 or 2, wherein The DNA polymerase is a large fragment DNA polymerase I lacking 5'-3' exonuclease activity.

4. A composition comprising the isolated DNA polymerase according to any one of claims 1 to 3 and a buffer.

5. A nucleic acid molecule encoding the isolated DNA polymerase according to any one of claims 1 to 3.

6. An expression vector comprising: the nucleic acid molecule according to claim 5; and a regulatory sequence necessary for transcribing and translating the protein sequence encoded by the nucleic acid molecule.

7. A host cell comprising one or more expression vectors according to claim 6 or one or more nucleic acid molecules according to claim 5.

8. A method for preparing the DNA polymerase according to any one of claims 1 to 3, comprising the following steps: a) culturing a host cell comprising one or more expression vectors according to claim 6, or one or more nucleic acid molecules according to claim 5, under conditions suitable for expression of the encoded DNA polymerase; and b) isolating or obtaining the DNA polymerase from the host cell or from the culture medium or supernatant.

9. Use of the DNA polymerase according to any one of claims 1 to 3 in nucleic acid amplification, sequencing reaction, recombinogenic cloning process or multiple DNA assembly process.

10. A method for assembling two or more double-stranded DNA molecules, the method comprising the steps of: (a) providing two or more double-stranded DNA molecules to be assembled, wherein the double-stranded DNA molecules comprise single-stranded DNA overhangs, wherein the ends of the overhangs comprising the two or more double-stranded DNA molecules share a region of sequence identity; (b) incubating the DNA molecule of (a) under conditions whereby the DNA molecule anneals via the overhanging portions; (c) contacting the annealed molecules with an isolated DNA polymerase according to any one of claims 1 to 3, whereby the DNA polymerase fills in the gaps remaining after annealing of the DNA molecules formed in step (b), wherein the DNA polymerase has reduced, impaired or inactivated strand displacement activity.

11. The method according to claim 10, wherein: The overhangs of the two or more DNA molecules of step (a) are provided using a 3'-5' exonuclease.

12. A method for nucleotide polymerization using the DNA polymerase according to any one of claims 1 to 3, the method comprising the following steps: (a) providing a reaction mixture comprising a DNA polymerase according to any one of claims 1 to 3, a template nucleic acid molecule, an oligonucleotide primer capable of annealing to a portion of the template nucleic acid molecule, and one or more nucleotides; and (b) incubating the reaction mixture under conditions where the oligonucleotide primer anneals to the template nucleic acid molecule and the DNA polymerase extends the oligonucleotide primer by polymerizing one or more nucleotides.

13. A method for amplifying nucleic acid using the DNA polymerase according to any one of claims 1 to 3, the method comprising the following steps: (a) providing a reaction mixture comprising a DNA polymerase according to any one of claims 1 to 3, a template nucleic acid molecule, one or more oligonucleotide primers capable of annealing to a portion of the template nucleic acid molecule, and nucleotides; (b) incubating the reaction mixture under conditions where the one or more oligonucleotide primers anneal to the template nucleic acid molecule and the DNA polymerase extends the one or more oligonucleotide primers by polymerizing one or more nucleotides to produce a polynucleotide.

Images