Novel coronavirus vmiRNA precursor sequence, novel coronavirus vmiRNA and its application

Abstract

The present invention provides a novel coronavirus vmiRNA precursor sequence, a novel coronavirus vmiRNA and an application, which belong to the field of medical inspection technology; the novel coronavirus vmiRNA precursor sequence includes one or more of nt 476-nt 557, nt 2122-nt 2197 and nt 2312-nt 2380. The 5' arm and 3' arm of the novel coronavirus vmiRNA precursor sequence of the present invention can express mature vmiRNA in human cells. On the one hand, these vmiRNAs can be secreted into peripheral blood, sputum, saliva and other body fluids with cell exosomes, and can be used as diagnostic markers for viral infection. On the other hand, these vmiRNAs can target human genes in human cells, affect their expression and function, and are closely related to the clinical symptoms of new crown patients.

Description

Technical Field

[0001] The present invention belongs to the field of medical testing technology, and specifically relates to a novel coronavirus vmiRNA precursor sequence, a novel coronavirus vmiRNA and applications. Background Art

[0002] The COVID-19 pandemic is still the most concerned "public health emergency" in the world and a common challenge facing human health. The most commonly used method for diagnosing COVID-19 internationally is nucleic acid testing based on the gene sequence of the new coronavirus. The test samples include nasal swabs, throat swabs, and lower respiratory tract specimens. For patients with mild symptoms, nasopharyngeal swabs of the upper respiratory tract can be collected within 1 to 7 days of onset. For patients with severe symptoms and artificial airways, specimens such as sputum or alveolar lavage fluid from the lower respiratory tract should be collected first. According to the latest version of the COVID-19 diagnosis and treatment guidelines, prevention and control plans, and laboratory testing expert consensus, a negative result for the COVID-19 nucleic acid test cannot rule out COVID-19 infection. It is necessary to consider the causes of false negatives in each link, including sample quality, oropharyngeal sampling location, patient stage of illness, sample storage and transportation methods, and other reasons for the existence of other technologies themselves.

[0003] In addition to nucleic acid testing, antibody testing is also the most commonly used method for diagnosing new coronavirus infection. According to the research results of the SARS coronavirus in 2002 and the MERS coronavirus in 2012, IgM antibodies can be detected in the peripheral blood of patients 3 to 6 days after the virus infection, and IgG antibodies can be detected after 8 days. Based on this, kits for detecting the new coronavirus using IgG or IgM antibodies are also widely used around the world. The advantage is that the patient's viral nucleic acid test is negative during the recovery period, but the antibody positive can still be detected. The disadvantage is the problem of antibody specificity, and the possibility of false positives cannot be ruled out.

[0004] Nucleic acid testing cannot rule out false negatives, and antibody testing has problems with antibody specificity. The development of new technologies and methods for rapid, accurate, and automated detection of the new coronavirus, as well as new biomarkers with high screening specificity, are urgent issues that need to be addressed in the current epidemic diagnosis.

[0005] After the virus infects the human body, it may use the enzyme system of the host cell to edit or cut the viral RNA sequence to produce non-coding miRNA derivatives derived from the virus. The virus's own genome can encode miRNA, which is called viral miRNA (vmiRNA). In 2004, Pfeffer et al. first discovered vmiRNA derived from the Ebola virus genome. In recent years, with the development of high-throughput sequencing technology and bioinformatics, vmiRNA has been found in mammalian cells infected with hepatitis B virus, adenovirus, influenza virus, Ebola virus, etc. vmiRNA can in turn regulate host cells and inhibit the immune recognition and response capabilities of host cells. It can be seen that vmiRNAs can "tame" or "transform" host cells to accept the invasion of viruses, and play a "malignant" role in the process of virus infection of hosts leading to the occurrence and development of diseases. Other studies have shown that vmiRNA can be distributed in the peripheral blood and other body fluids of infected people with exosomes, and the time when vmiRNA is detected in the blood is earlier than the time when the viral genome nucleic acid is detected. After the new coronavirus infects human cells, the viral RNA sequence may use the host cell's enzyme system to synthesize non-coding miRNA small molecule derivatives, which can enter body fluids and peripheral blood with the secretion of exosomes. However, there are currently no records or reports on the new coronavirus vmiRNA. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide a novel coronavirus vmiRNA precursor sequence, a novel coronavirus vmiRNA and applications. The vmiRNA derived from the novel coronavirus vmiRNA precursor sequence of the present invention can be used as a diagnostic marker for novel coronavirus infection.

[0007] The present invention provides a novel coronavirus vmiRNA precursor sequence, including one or more of nt 476---nt 557, nt 2122---nt 2197 and nt 2312---nt 2380; the nucleotide sequences of nt 476---nt 557, nt 2122---nt 2197 and nt 2312---nt 2380 are shown in SEQ ID NO.1 to SEQ ID NO.3, respectively.

[0008] The present invention also provides the novel coronavirus vmiRNA precursor sequence described in the above scheme, which expresses mature novel coronavirus vmiRNA in human cells.

[0009] Preferably, the novel coronavirus vmiRNA includes one or more of the vmiRNAs whose nucleotide sequences are shown in SEQ ID NO.4 to SEQ ID NO.83.

[0010] The present invention also provides the use of the novel coronavirus vmiRNA precursor sequence or the novel coronavirus vmiRNA described in the above scheme as a diagnostic marker in the preparation of a kit or chip for predicting the risk of novel coronavirus pneumonia and / or diagnosing novel coronavirus pneumonia.

[0011] Preferably, the application method comprises:

[0012] The body fluid of the subject is used as the experimental group to detect the expression level of the novel coronavirus vmiRNA in the body fluid of the subject;

[0013] The normal body fluid of healthy people was used as a control group to obtain the expression level of the novel coronavirus vmiRNA in the normal blood samples of healthy people;

[0014] If the expression level of the SARS-CoV-2 vmiRNA in the experimental group is higher than the expression level of the SARS-CoV-2 vmiRNA in the control group, it is determined that there is a risk of COVID-19 or that COVID-19 has occurred.

[0015] The present invention also provides a primer set for detecting the novel coronavirus vmiRNA described in the above scheme in the body fluid of a subject; the primer set includes one or more of a first primer, a second primer and a third primer; the nucleotide sequences of the first primer, the second primer and the third primer are respectively shown in SEQ ID NO.84 to SEQ ID NO.86.

[0016] The present invention also provides a kit comprising the primer set described in the above scheme.

[0017] The present invention also provides the use of the primer set described in the above scheme in the preparation of a kit or chip for predicting the risk of COVID-19 and / or diagnosing COVID-19.

[0018] The present invention also provides the use of the novel coronavirus vmiRNA precursor sequence described in the above scheme or the novel coronavirus vmiRNA inhibitor in the preparation of drugs for treating COVID-19.

[0019] Preferably, the inhibitor of the SARS-CoV-2 vmiRNA comprises an antisense oligonucleotide of the SARS-CoV-2 vmiRNA.

[0020] The present invention provides a novel coronavirus vmiRNA precursor sequence, including one or more of nt 476---nt 557, nt2122---nt2197 and nt 2312---nt 2380; the nucleotide sequences of nt 476---nt 557, nt2122---nt 2197 and nt 2312---nt 2380 are shown in SEQ ID NO.1 to SEQ ID NO.3, respectively. The 5' arm and 3' arm of the novel coronavirus vmiRNA precursor sequence of the present invention can express mature vmiRNA in human cells. On the one hand, these vmiRNAs can be secreted into peripheral blood, sputum, saliva and other body fluids with cell exosomes, and can be used as diagnostic markers for viral infection. On the other hand, these vmiRNAs can target human genes in human cells, affect their expression and function, and are closely related to the clinical symptoms of new crown patients. The advantages of using SARS-CoV-2 vmiRNA as a diagnostic marker include: (1) exosome secretion is uniform and is not affected by the sampling location or method; (2) body fluids such as saliva and sputum are used as samples, which enables non-invasive sampling of subjects and avoids the discomfort of nasal and throat swab sampling; (3) the diagnostic accuracy is improved and the false negative problem of existing nucleic acid detection technology is avoided; (4) vmiRNA is stable and has little effect on storage environment and time; (5) by using the conversion of biological signals and photoelectric signals, rapid test strips or diagnostic chips can be developed to achieve the purpose of rapid and high-throughput detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 .The secondary structure of SEQ ID NO.1;

[0022] Figure 2 .The secondary structure of SEQ ID NO.2;

[0023] Figure 3 .The secondary structure of SEQ ID NO.3;

[0024] Figure 4 .Quantitative detection of mature vmiRNA of SEQ ID NO.1 in peripheral blood samples of patients; Hsa-miR-16 is a housekeeping gene miRNA;

[0025] Figure 5 .Quantitative detection of mature vmiRNA of SEQ ID NO.2 in peripheral blood samples of patients; 5S ribosomal RNA is a housekeeping gene;

[0026] Figure 6 .Quantitative detection of mature vmiRNA of SEQ ID NO.3 in peripheral blood samples of patients; Hsa-miR-16 is a housekeeping gene miRNA;

[0027] Figure 7 .Gene sequencing results of mature vmiRNA of SEQ ID NO.1 in virus-infected cells;

[0028] Figure 8 .Gene sequencing results of mature vmiRNA of SEQ ID NO.2 in virus-infected cells;

[0029] Fig. 9 .Gene sequencing results of mature vmiRNA of SEQ ID NO.3 in virus-infected cells. DETAILED DESCRIPTION

[0030] The present invention provides a novel coronavirus vmiRNA precursor sequence, including one or more of nt 476---nt 557, nt 2122---nt 2197 and nt 2312---nt 2380; the nucleotide sequences of nt 476---nt 557, nt 2122---nt 2197 and nt 2312---nt 2380 are shown in SEQ ID NO.1 to SEQ ID NO.3, respectively, as follows:

[0031] nt 476---nt 557, the nucleotide sequence is shown in SEQ ID NO.1: 5'-AUCAAACGUUCGGAUGCUCGAACUGCACCUCAUGGUCAUGUUAUGGUUGAGCUGGUAGCAGAACUCGAAGGCAUUCAGUACG-3'

[0032] nt 2122---nt 2197, the nucleotide sequence is shown in SEQ ID NO.2: 5'-UGUUUAUGAAAAACUCAAACCCGUCCUUGAUUGGCUUGAAGAGAAGUUUAAGGAAGGUGUAGAGUUUCUUAGAGAC-3'

[0033] nt 2312---nt 2380, the nucleotide sequence is shown in SEQ ID NO.3: 5'-

[0034] AAUAAAUUUUUGGCUUUGUGUGCUGACUCUAUCAUUAUUGGUGGAGCUAAACUUAAAGCCUUGAAUUUA-3'.

[0035] In the present invention, the schematic diagram of the hairpin structure of nt 476---nt 557, nt 2122---nt 2197 and nt 2312---nt 2380 is as follows Figure 1 to Figure 3 shown.

[0036] The present invention also provides the novel coronavirus vmiRNA precursor sequence described in the above scheme, which expresses mature novel coronavirus vmiRNA in human cells.

[0037] In the present invention, the novel coronavirus vmiRNA includes one or more of the vmiRNAs whose nucleotide sequences are respectively as shown in SEQ ID NO.4 to SEQ ID NO.83, as specifically shown in Table 1. The vmiRNAs described in SEQ ID NO.4 to SEQ ID NO.33 are mature forms generated in human cells from nt 476---nt 557 precursors; the vmiRNAs described in SEQ ID NO.34 to SEQ ID NO.65 are mature forms generated in human cells from nt 2122---nt 2197 precursors; and the vmiRNAs described in SEQ ID NO.66 to SEQ ID NO.83 are mature forms generated in human cells from nt2312---nt 2380 precursors.

[0038] Table 1 SARS-CoV-2 vmiRNA

[0039]

[0040]

[0041]

[0042]

[0043] The present invention also provides the use of the novel coronavirus vmiRNA precursor sequence or the novel coronavirus vmiRNA described in the above scheme as a diagnostic marker in the preparation of a kit or chip for predicting the risk of novel coronavirus pneumonia and / or diagnosing novel coronavirus pneumonia.

[0044] The present invention also provides a primer set for detecting the novel coronavirus vmiRNA described in the above scheme in the body fluid of a subject; the primer set includes one or more of a first primer, a second primer and a third primer; the nucleotide sequences of the first primer, the second primer and the third primer are shown in SEQ ID NO.84 to SEQ ID NO.86, respectively;

[0045] SEQ ID NO.84: ggtagcagaactcgaaggca;

[0046] SEQ ID NO.85: aactcaaacccgtccttgat;

[0047] SEQ ID NO. 86: tggctttgtgtgctgact.

[0048] The present invention also provides a kit comprising the primer set described in the above scheme.

[0049] The present invention also provides the use of the primer set described in the above scheme in the preparation of a kit or chip for predicting the risk of COVID-19 and / or diagnosing COVID-19.

[0050] In the present invention, the chip preferably includes a solid phase carrier; and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe includes a partial or complete sequence specifically corresponding to the SARS-CoV-2 vmiRNA.

[0051] In the present invention, the body fluid preferably includes peripheral blood, sputum or saliva.

[0052] In the present invention, the application method preferably includes:

[0053] The body fluid of the subject is used as the experimental group to detect the expression level of the novel coronavirus vmiRNA in the body fluid of the subject;

[0054] The normal body fluid of healthy people is used as a control group to obtain the expression level of the novel coronavirus vmiRNA in the normal body fluid of healthy people;

[0055] If the expression level of the SARS-CoV-2 vmiRNA in the experimental group is higher than the expression level of the SARS-CoV-2 vmiRNA in the control group, it is determined that there is a risk of COVID-19 or that COVID-19 has occurred.

[0056] The present invention also provides the use of the novel coronavirus vmiRNA precursor sequence described in the above scheme or the novel coronavirus vmiRNA inhibitor in the preparation of drugs for treating COVID-19.

[0057] In the present invention, the novel coronavirus vmiRNA inhibitor preferably includes an antisense oligonucleotide of the novel coronavirus vmiRNA mature body, which can be chemically synthesized in vitro. In the present invention, the novel coronavirus vmiRNA inhibitor is preferably chemically modified to enhance the stability of the novel coronavirus vmiRNA inhibitor and the firmness of its binding to the novel coronavirus vmiRNA mature body; the present invention has no special restrictions on the type of chemical modification, and conventional chemical modifications in the art can be used. The vmiRNA inhibitor of the present invention can specifically target and knock down vmiRNA molecules, weakening the function of vmiRNA in regulating host cells.

[0058] The drug of the present invention is suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation and allergic reactions), that is, a substance with a reasonable benefit / risk ratio.

[0059] The drug of the present invention contains a safe and effective amount of an inhibitor of the novel coronavirus vmiRNA and a pharmaceutically acceptable carrier. In the present invention, the pharmaceutically acceptable carrier refers to a carrier for administering a therapeutic agent, including an excipient and a diluent. In the present invention, the pharmaceutically acceptable carrier includes: one or more of water, grape set solution, physiological saline, liposomes, lipids, proteins, protein-antibody conjugates, peptide substances, cellulose and nanogels. In the present invention, the selection of the pharmaceutically acceptable carrier matches the mode of administration.

[0060] In the present invention, the dosage form of the drug includes injection, oral preparation, transdermal preparation or sustained release; the oral preparation includes tablets, capsules or oral liquid. The present invention has no special restrictions on the preparation method of the drug, and conventional methods in the art can be used. In the present invention, the drug is preferably prepared under sterile conditions.

[0061] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0062] Example 1

[0063] nt 476---nt 557, the nucleotide sequence is shown in SEQ ID NO.1:

[0064] 5'-AUCAAACGUUCGGAUGCUCGAACUGCACCUCAUGGUCAUGUUAUGGUUGAGCUGGUAGCAGAACUCGAAGGCAUUCAGUACG-3'

[0065] nt 2122---nt 2197, the nucleotide sequence is shown in SEQ ID NO.2:

[0066] 5'-UGUUUAUGAAAACUCAAACCCGUCCUUGAUUGGCUUGAAGAGAAGUUUAAGGAAGGUAGUAGAGUUUCUUAGAGAC-3'

[0067] nt 2312---nt 2380, the nucleotide sequence is shown in SEQ ID NO.3:

[0068] 5'-AAUAAAUUUUUGGCUUUGUGUGCUGACUCUAUCAUUAUUGGUGGAGCUAAACUUAAAGCCUUGAAUUUA-3'

[0069] Quantitative detection of mature vmiRNAs produced by the above three vmiRNA precursors in patient peripheral blood samples.

[0070] The detection process is as follows:

[0071] 1. Plasma Collection

[0072] 1) Draw 3 ml of blood from the vein into an EDTA anticoagulant blood collection tube. Turn the blood collection tube upside down to prevent blood clotting and avoid hemolysis during blood collection.

[0073] 2) Centrifuge at 4°C, 1500 rpm for 10 min, take the upper layer of plasma, dispense 200 μL / tube into nuclease-free centrifuge tubes, and store at -80°C for later use.

[0074] 2. Plasma RNA extraction

[0075] 1) Add 1 mL of Trizol to every 200 μL of plasma, repeatedly pipette or shake vigorously, and lyse at room temperature for 5 to 10 minutes;

[0076] 2) Add 200 μL chloroform to each 1 mL Trizol in the above centrifuge tube, cover the EP tube cap, shake vigorously in the hand for 15 seconds, let stand at room temperature for 2-3 minutes, and centrifuge at 4°C and 12000g for 15 minutes;

[0077] 3) Take the upper aqueous phase and place it in a new EP tube, add 500 μL of isopropanol, add 1 μL of glycogen to each tube, and place it at -20°C overnight;

[0078] 4) On the next day, centrifuge the above EP tubes at 4°C and 12,000 rpm for 15 min;

[0079] 5) Carefully remove the supernatant, add 0.2 ml of pre-cooled 75% ethanol for washing, centrifuge at 4°C, 12000 rpm for 5 min, and discard the supernatant;

[0080] 6) Repeat step 5);

[0081] 7) Dry the precipitate naturally at room temperature;

[0082] 8) Dissolve the RNA precipitate in 10 μL RNase-free water, detect RNA concentration and quality, and store at -80°C for later use.

[0083] 3. Collection of nasopharyngeal swab samples

[0084] 1) Tear off the sealing paper on the disposable sampling swab package and take out the disposable sampling swab

[0085] 2) Hold the disposable sampling swab and insert it into the nasal cavity or oral cavity to the bottom of the nasopharynx. Stay for a while, gently rotate the sampling swab and withdraw it.

[0086] 3) After the collection is completed, place the sampling swab into the sampling tube, break the handle of the disposable sampling swab at the break mark, cover the sampling tube cap and tighten it, and shake it thoroughly to mix.

[0087] 4. RNA extraction from nasopharyngeal swab

[0088] Nasopharyngeal swab RNA was extracted and purified using the MagNA Pure 96 DNA and Viral NA Small Volume Kit (Roche, Mannheim, Germany).

[0089] 5. miRNA cDNA chain synthesis

[0090] miRNA cDNA strand synthesis (Clontech, 638315);

[0091] Add the following to the EP tube: 5 μL mRQ buffer (2x), 1.25 μL mRQ enzyme, 0.1-0.2 μg RNA, and make up the volume to 10 μL with enzyme-free water. Place at 37°C for 1 hour. Place at 85°C for 5 minutes. Store at -80°C for later use.

[0092] 6. Real-time fluorescence quantitative detection of miRNA (Clontech, 638316)

[0093] 10 μL ddHO was added to each of the 384 wells. 2 O, 12.5 μL TB Green Advantage Premix (2X), 0.5 μL ROX Dye (50X), 1 μL miRNA front primer (first primer, second primer or third primer sequence), 1 μL mRQ3' primer (10 μM), 2 μL cDNA.

[0094] Reaction procedure: preliminary denaturation: 95°C, 10 sec; amplification 40 cycles: 95°C, 5 sec, 60°C, 20 sec; melting curve: 95°C, 60 sec, 55°C, 30 sec, 95°C, 30 sec.

[0095] First primer: ggtagcagaactcgaaggca;

[0096] Second primer: aactcaaacccgtccttgat;

[0097] The third primer: tggctttgtgtgctgact.

[0098] Test results see Figures 4 to 6 .

[0099] Figure 4 :The mature vmiRNA (CvmiR-SEQ-ID1-3p) produced by the precursor of nt 476---nt 557 was detected by fluorescence quantitative PCR from nasal swab samples of three COVID-19 patients. Human hsa-miR-16 was used as an internal control.

[0100] Figure 5 :The mature vmiRNA (CvmiR-SEQ-ID2-5p) produced by the precursor of nt 2122---nt 2197 was detected by fluorescence quantitative PCR from nasal swab samples of three COVID-19 patients. Human 5s-rRNA was used as an internal control.

[0101] Figure 6 :The mature vmiRNA (CvmiR-SEQ-ID3-5p) produced by the precursor of nt 2312---nt 2380 was detected by fluorescence quantitative PCR from nasal swab samples of three COVID-19 patients. Human hsa-miR-16 was used as an internal control.

[0102] Example 2

[0103] The gene sequencing results of the three mature vmiRNAs in Example 1 in COVID-19 infected cells or patients are shown in Figure 7 to Figure 9 .

[0104] Figure 7 :The gene sequencing database of patients infected with the new coronavirus (GSE148729) detected 67 mature vmiRNA reads fragments originating from the new coronavirus nt476-nt 557 sequence, covering SEQ ID NO.4 to SEQ ID NO.33 sequences.

[0105] Figure 8 :The gene sequencing database of patients infected with the new coronavirus (GSE148729) detected 419 mature vmiRNA reads fragments originating from the new coronavirus nt2122-nt 2197 sequence, covering SEQ ID NO.34 to SEQ ID NO.65 sequences.

[0106] Fig. 9:The gene sequencing database of patients infected with the new coronavirus (GSE148729) detected reads fragments of 37 mature vmiRNAs originating from the nt2312-nt 2380 sequence of the new coronavirus, covering sequences from SEQ ID NO.66 to SEQ ID NO.83.

[0107] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention rather than all the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention. Sequence Listing <110> Shanghai Oriental Hospital (Oriental Hospital Affiliated to Tongji University) <120> Novel coronavirus vmiRNA precursor sequence, novel coronavirus vmiRNA and its application <160> 86 <170> SIPOSequenceListing 1.0 <210> 1 <211> 82 <212> RNA <213> Artificial Sequence <400> 1 aucaaacguu cggaugcucg aacugcaccu cauggucaug uuaugguuga gcugguagca 60 gaacucgaag gcauucagua cg 82 <210> 2 <211> 76 <212> RNA <213> Artificial Sequence <400> 2 uguuuaugaa aaacucaaac ccguccuuga uuggcuugaa gagaaguuua aggaaggugu 60 agaguuucuu agagac 76 <210> 3 <211> 69 <212> RNA <213> Artificial Sequence <400> 3 aauaaauuuu uggcuuug ugcugacu aucauuauug guggagcuaa acuuaaagcc 60 uugaauuua 69 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence <400> 4 ggtagcagaa ctcgaaggca t 21 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <400> 5 gtagcagaac tcgaaggcat t 21 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 tggtagcaga actcgaaggc a 21 <210> 7 <211> twenty two <212> DNA <213> Artificial Sequence <400> 7 agcagaactc gaaggcattc ag 22 <210> 8 <211> twenty two <212> DNA <213> Artificial Sequence <400> 8 ctggtagcag aactcgaagg ca 22 <210> 9 <211> twenty two <212> DNA <213> Artificial Sequence <400> 9 ggtagcagaa ctcgaaggca tt 22 <210> 10 <211> twenty three <212> DNA <213> Artificial Sequence <400> 10 agctggtagc agaactcgaa ggc 23 <210> 11 <211> twenty four <212> DNA <213> Artificial Sequence <400> 11 agctggtagc agaactcgaa ggca 24 <210> 12 <211> twenty four <212> DNA <213> Artificial Sequence <400> 12 gagctggtag cagaactcga aggc 24 <210> 13 <211> twenty four <212> DNA <213> Artificial Sequence <400> 13 agcagaactc gaaggcattc agta 24 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <400> 14 ggtagcagaa ctcgaaggca ttcag 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <400> 15 gagctggtag cagaactcga aggca 25 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <400> 16 gagctggtag cagaactcga aggcat 26 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <400> 17 ggtagcagaa ctcgaaggca ttcagta 27 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <400> 18 gagctggtag cagaactcga aggcatt 27 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <400> 19 gtagcagaac tcgaaggcat tcagtacg 28 <210> 20 <211> 28 <212> DNA <213> Artificial Sequence <400> 20 ggtagcagaa ctcgaaggca ttcagtac 28 <210> twenty one <211> 28 <212> DNA <213> Artificial Sequence <400> twenty one ggttgagctg gtagcagaac tcgaaggc 28 <210> twenty two <211> 28 <212> DNA <213> Artificial Sequence <400> twenty two agagctggta gcagaactcg aaggcatt 28 <210> twenty three <211> 28 <212> DNA <213> Artificial Sequence <400> twenty three gttgagctgg tagcagaact cgaaggca 28 <210> twenty four <211> 29 <212> DNA <213> Artificial Sequence <400> twenty four ggttgagctg gtagcagaac tcgaaggca 29 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 ggttgagctg gtagcagaac tcgaaggcat 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <400> 26 gagctggtag cagaactcga aggcattcag 30 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <400> 27 tggttgagct ggtagcagaa ctcgaaggca 30 <210> 28 <211> 31 <212> DNA <213> Artificial Sequence <400> 28 ctggtagcag aactcgaagg cattcagtac g 31 <210> 29 <211> 31 <212> DNA <213> Artificial Sequence <400> 29 agagctggta gcagaactcg aaggcattca g 31 <210> 30 <211> 32 <212> DNA <213> Artificial Sequence <400> 30 agctggtagc agaactcgaa ggcattcagt ac 32 <210> 31 <211> 34 <212> DNA <213> Artificial Sequence <400> 31 gagctggtag cagaactcga aggcattcag tacg 34 <210> 32 <211> 34 <212> DNA <213> Artificial Sequence <400> 32 ggttgagctg gtagcagaac tcgaaggcat tcag 34 <210> 33 <211> 35 <212> DNA <213> Artificial Sequence <400> 33 gttgagctgg tagcagaact cgaaggcatt cagta 35 <210> 34 <211> 34 <212> DNA <213> Artificial Sequence <400> 34 gaaaaactca aacccgtcct tgattggctt gaag 34 <210> 35 <211> 31 <212> DNA <213> Artificial Sequence <400> 35 gaaaaactca aacccgtcct tgattggctt g 31 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <400> 36 gaaaaactca aacccgtcct tgattggctt 30 <210> 37 <211> 29 <212> DNA <213> Artificial Sequence <400> 37 gaaaaactca aacccgtccttgattggct 29 <210> 38 <211> 28 <212> DNA <213> Artificial Sequence <400> 38 gaaaaactca aacccgtccttgattggc 28 <210> 39 <211> 27 <212> DNA <213> Artificial Sequence <400> 39 gaaaaactca aacccgtccttgattgg 27 <210> 40 <211> 26 <212> DNA <213> Artificial Sequence <400> 40 gaaaaactca aacccgtccttgattg 26 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <400> 41 gaaaaactca aacccgtccttgatt 25 <210> 42 <211> twenty four <212> DNA <213> Artificial Sequence <400> 42 gaaaaactca aacccgtcct tgat 24 <210> 43 <211> twenty three <212> DNA <213> Artificial Sequence <400> 43 gaaaaactca aacccgtcct tga 23 <210> 44 <211> twenty one <212> DNA <213> Artificial Sequence <400> 44 gaaaaactca aacccgtcct t 21 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <400> 45 gaaaaactca aacccgtcct 20 <210> 46 <211> 29 <212> DNA <213> Artificial Sequence <400> 46 aaaaactcaa acccgtcctt gattggctt 29 <210> 47 <211> twenty four <212> DNA <213> Artificial Sequence <400> 47 aaaaactcaa acccgtcctt gatt 24 <210> 48 <211> twenty two <212> DNA <213> Artificial Sequence <400> 48 aaaaactcaa acccgtcctt ga 22 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <400> 49 aaaaactcaa acccgtcctt 20 <210> 50 <211> 19 <212> DNA <213> Artificial Sequence <400> 50 aaaaactcaa acccgtcct 19 <210> 51 <211> twenty one <212> DNA <213> Artificial Sequence <400> 51 aaactcaaac ccgtccttga t 21 <210> 52 <211> 27 <212> DNA <213> Artificial Sequence <400> 52 aactcaaacc cgtccttgat tggcttg 27 <210> 53 <211> 26 <212> DNA <213> Artificial Sequence <400> 53 aactcaaacc cgtccttgat tggctt 26 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <400> 54 aactcaaacc cgtccttgat tggct 25 <210> 55 <211> twenty four <212> DNA <213> Artificial Sequence <400> 55 aactcaaacc cgtccttgat tggc 24 <210> 56 <211> twenty two <212> DNA <213> Artificial Sequence <400> 56 aactcaaacc cgtccttgat tg 22 <210> 57 <211> twenty one <212> DNA <213> Artificial Sequence <400> 57 aactcaaacc cgtccttgat t 21 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <400> 58 aactcaaacc cgtccttgat 20 <210> 59 <211> 26 <212> DNA <213> Artificial Sequence <400> 59 actcaaaccc gtccttgatt ggcttg 26 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <400> 60 actcaaaccc gtccttgatt ggctt 25 <210> 61 <211> twenty four <212> DNA <213> Artificial Sequence <400> 61 actcaaaccc gtccttgatt ggct 24 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <400> 62 actcaaaccc gtccttgatt 20 <210> 63 <211> 28 <212> DNA <213> Artificial Sequence <400> 63 ctcaaacccg tccttgattg gcttgaag 28 <210> 64 <211> twenty four <212> DNA <213> Artificial Sequence <400> 64 tcaaacccgt ccttgattgg cttg 24 <210> 65 <211> twenty two <212> DNA <213> Artificial Sequence <400> 65 tcaaacccgt ccttgattgg ct 22 <210> 66 <211> 29 <212> DNA <213> Artificial Sequence <400> 66 taaatttttg gctttgtgtg ctgactcta 29 <210> 67 <211> twenty one <212> DNA <213> Artificial Sequence <400> 67 taaatttttg gctttgtgtg c 21 <210> 68 <211> 32 <212> DNA <213> Artificial Sequence <400> 68 aaatttttgg ctttgtgtgc tgactctatc at 32 <210> 69 <211> 30 <212> DNA <213> Artificial Sequence <400> 69 atttttggct ttgtgtgctg actctatcat 30 <210> 70 <211> 32 <212> DNA <213> Artificial Sequence <400> 70 atttttggct ttgtgtgctg actctatcat ta 32 <210> 71 <211> 29 <212> DNA <213> Artificial Sequence <400> 71 atttttggct ttgtgtgctg actctatca 29 <210> 72 <211> 32 <212> DNA <213> Artificial Sequence <400> 72 atttttggct ttgtgtgctg actctatcat ta 32 <210> 73 <211> 32 <212> DNA <213> Artificial Sequence <400> 73 atttttggct ttgtgtgctg actctatcat ta 32 <210> 74 <211> 31 <212> DNA <213> Artificial Sequence <400> 74 tttttggctt tgtgtgctga ctctatcatt a 31 <210> 75 <211> 26 <212> DNA <213> Artificial Sequence <400> 75 tttggctttg tgtgctgactctatca 26 <210> 76 <211> 26 <212> DNA <213> Artificial Sequence <400> 76 ttggctttgt gtgctgactc tatcat 26 <210> 77 <211> twenty four <212> DNA <213> Artificial Sequence <400> 77 tggctttgtg tgctgactct atca 24 <210> 78 <211> 27 <212> DNA <213> Artificial Sequence <400> 78 tggctttgtg tgctgactct atcatta 27 <210> 79 <211> 25 <212> DNA <213> Artificial Sequence <400> 79 tggctttgtg tgctgactct atcat 25 <210> 80 <211> 25 <212> DNA <213> Artificial Sequence <400> 80 tggctttgtg tgctgactct atcat 25 <210> 81 <211> 25 <212> DNA <213> Artificial Sequence <400> 81 tggctttgtg tgctgactct atcat 25 <210> 82 <211> 27 <212> DNA <213> Artificial Sequence <400> 82 tggctttgtg tgctgactct atcatta 27 <210> 83 <211> twenty one <212> DNA <213> Artificial Sequence <400> 83 tggctttgtg tgctgactct a 21 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <400> 84 ggtagcagaa ctcgaaggca 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <400> 85 aactcaaacc cgtccttgat 20 <210> 86 <211> 18 <212> DNA <213> Artificial Sequence <400> 86 tggctttgtg tgctgact 18

Claims

1. A primer set for detecting novel coronavirus vmiRNA in body fluids of a subject; the primer set is a second primer; the nucleotide sequence of the second primer is shown in SEO ID NO.85; The novel coronavirus vmiRNA is a mature vmiRNA nucleic acid gene obtained by nuclease cleavage of the novel coronavirus vmiRNA precursor sequence in human cells; The novel coronavirus vmiRNA precursor is nt2122---nt2197: the nucleotide sequence of nt2122---nt2197 is shown in SEQ ID NO.2; The novel coronavirus vmiRNA includes one or more of the vmiRNAs whose nucleotide sequences are shown in SEO ID NO.34 to SEOID NO.

65.

2. A kit comprising the primer set according to claim 1.

3. Use of the primer set described in claim 1 in preparing a kit or chip for detecting the novel coronavirus vmiRNA in a subject.

Images