A major effect QTL for rice stigma exsertion rate, detection primers, kit and application
The major effect QTL was located on rice chromosome 9 through QTL-seq method and SSR marker analysis. Primers were used to detect and introduce into the sterile line, which solved the problem of locating the rice stigma exsertion rate, increased seed production yield and reduced costs.
Patent Information
- Application Number
- CN202210511057.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-11
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2042-05-11
AI Technical Summary
Existing technologies make it difficult to effectively locate and utilize the major QTL for rice stigma exsertion rate controlled by multiple genes, resulting in low yield and high cost of hybrid rice seed production.
The QTL-seq method combined with SSR marker analysis was used to locate the major QTL for rice stigma exsertion rate on chromosome 9. Primers RM23662 and RM3700 were used for detection, and the major QTL was introduced into the elite sterile line through molecular marker-assisted selection.
It improves the stigma exposure rate of rice sterile lines, increases the yield of breeding seeds, reduces breeding costs, and accelerates the breeding process.
Smart Images

Figure CN114807420B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular to a major-effect QTL for rice stigma exsertion rate, detection primers, a kit and applications. Background Art
[0002] Rice, one of the most important food crops, feeds more than half of the world's population. Rice yields directly impact food security and social stability, and increasing grain yield per unit area has always been a paramount goal for rice breeders. The commercialization of hybrid rice has significantly boosted grain production, with improvements in seed production capacity playing a crucial role. The outcrossing performance of sterile lines is a key factor influencing hybrid rice seed yield, and stigma exsertion is the most important trait for improving outcrossing performance in sterile lines.
[0003] Stigma exsertion rate in rice is a quantitative trait controlled by multiple genes, exhibiting continuous variation across generations. Numerous studies have mapped QTLs for stigma exsertion rate using diverse segregating populations and linkage analysis. Furthermore, researchers have used BSA and association analysis to locate QTLs for stigma exsertion rate. With the completion of the rice genome and the increasing maturity of next-generation sequencing (NGS) technology, the QTL-seq (QTL-seq) method has emerged. Compared to traditional map-based cloning methods, which require time-consuming population construction and lack sufficient molecular markers, QTL-seq, based on the high-density genetic map generated by second-generation sequencing (NGS), is faster, more efficient, and less expensive. Studies have reported a large number of QTLs located across all 12 rice chromosomes, but the phenotypic variation explained by a single QTL is often less than 10%, indicating that stigma exsertion rate is a typical quantitative trait influenced by multiple QTLs of minor effect. Marker-assisted selection is an effective approach for improving the stigma exsertion rate trait in rice. Therefore, discovering stable and reliable QTLs that control the stigma exsertion rate plays an important role in improving the efficiency of stigma exsertion rate, which is beneficial to increasing hybrid seed production yield and reducing costs, and promoting the commercial promotion and application of hybrid rice. Summary of the Invention
[0004] The present invention aims to provide a major QTL for rice stigma exsertion rate, detection primers, a kit, and applications. The major QTL described in the present invention can control the stigma exsertion rate in rice. Introducing the major QTL into an elite sterile rice line can increase the stigma exsertion rate of the sterile rice line, thereby improving seed production and propagation yields and accelerating the breeding process.
[0005] The present invention provides a major QTL for rice stigma exsertion rate. The major QTL is located on chromosome 9 and between linkage markers RM23662 and RM3700.
[0006] The present invention also provides a set of primers for detecting a major effect QTL for rice stigma exsertion rate, the primers comprising primers RM23662 and RM3700; the nucleotide sequences of the primers RM23662 are shown in SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the primers RM3700 are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0007] The present invention also provides a kit for detecting a major-effect QTL for rice stigma exsertion rate, the kit comprising the primers and a reaction solution described in the above technical solution.
[0008] The present invention also provides the use of a substance for detecting the major effect QTL described in the above technical solution in breeding or detecting rice varieties with a high stigma exsertion rate.
[0009] The present invention provides a major QTL for rice stigma exsertion rate. The present invention utilizes an F2 population constructed from Huhan 1B and P3155B (Huhan 1B / K17B / / Huhan 1B / / / Huhan 1B), employs two analytical methods, QTL-seq and SSR markers, and repeatedly identifies a major QTL site on chromosome 9 that stably affects stigma exsertion rate, providing a reliable basis for further fine positioning and candidate gene cloning. By utilizing the linked molecular markers of the major QTL detected by QTL positioning, the major QTL can be introduced into an elite sterile rice line through molecular marker-assisted selection, thereby increasing the stigma exsertion rate of the sterile rice line, improving the seed production yield, and accelerating the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 This is a distribution result diagram of the ΔSNP-Index provided by the present invention on the whole genome; wherein the abscissa represents the physical position on the chromosome; the ordinate represents the Δ(SNP_index) value; the black curve represents the fitting value of Δ(SNP_index); the rose-red line and the blue line represent the threshold line of the LOESS fitting value of 99%;
[0011] Figure 2 Schematic diagram of the QTL location on chromosome 9 provided by the present invention;
[0012] Figure 3 This is the frequency distribution diagram of the total stigma exsertion rate of the Huhan 1B / P3155B F2 population provided by the present invention. DETAILED DESCRIPTION
[0013] The present invention provides a major QTL for rice stigma exsertion rate. The major QTL is located on chromosome 9, between linked markers RM23662 and RM3700. In the present invention, the nucleotide sequences of the primers for RM23662 are shown in SEQ ID NO. 1 (GAGAGGACGATGGCACTATTGG) and SEQ ID NO. 2 (CGAGGAACTTGATTCGCATGG); the nucleotide sequences of the primers for RM3700 are shown in SEQ ID NO. 3 (AAATGCCCCATGCACAAC) and SEQ ID NO. 4 (TTGTCAGATTGTCACCAGGG).
[0014] The method for locating a major effect QTL of the present invention comprises the following steps:
[0015] The maintainer line P3155B was obtained by hybridizing Huhan 1B as the female parent and K17B, a three-line maintainer line with a high stigma exsertion rate, as the male parent through three backcross selections. Compared with Huhan 1B, the maintainer line P3155B has a significantly improved stigma exsertion rate and similar agronomic traits.
[0016] The F2 population was constructed by hybridizing Huhan 1B with the maintainer line P3155B, containing 673 individuals;
[0017] The total stigma exsertion rate phenotypic data of the F2 population were investigated, and 35 individuals with low stigma exsertion rates were selected to construct a Low-pool, with an average value of 32.9%; 35 individuals with high stigma exsertion rates were selected to construct a High-pool, with an average value of 78.3%. High-throughput sequencing was performed on each of the two pools, and QTL-seq analysis was performed by comparing the SNP-index of the two pools. A genetic linkage map was then constructed using polymorphic markers between the parent Huhan 1B and the maintainer line P3155B, and QTL analysis was performed in combination with the phenotypic data. Finally, a major QTL for rice stigma exsertion rate was located on chromosome 9, namely, the major QTL for rice stigma exsertion rate described in the above technical solution.
[0018] The present invention also provides a set of primers for detecting a major effect QTL for rice stigma exsertion rate, the primers comprising primers RM23662 and RM3700; the nucleotide sequences of the primers RM23662 are shown in SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the primers RM3700 are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0019] The present invention also provides a kit for detecting a major-effect QTL for rice stigma exsertion rate, the kit comprising the primers and a reaction solution described in the above technical solution.
[0020] The present invention also provides the use of a substance that detects the major QTL described in the above technical solution in breeding or detecting rice varieties with high stigma exsertion rates. By introducing the major QTL into elite sterile rice lines through molecular marker-assisted selection, the stigma exsertion rates of these sterile rice lines can be increased, boosting seed production and propagation yields, and accelerating the breeding process.
[0021] The following is a further detailed introduction to the major effect QTL for rice stigma exsertion rate, detection primers, kit and application of the present invention in conjunction with specific examples. The technical solutions of the present invention include but are not limited to the following examples.
[0022] Example 1
[0023] 1. F2 population construction and stigma exposure rate performance
[0024] P3155B was a hybrid of Huhan 1B as the female parent and K17B, a three-line maintainer line with high stigma exsertion rate, as the male parent. This maintainer line was selected through three backcrosses. Compared with Huhan 1B, the stigma exsertion rate was significantly improved, and the agronomic traits were similar. Huhan 1B and P3155B were used to construct an F2 population containing 673 individuals. The stigma exsertion rate phenotypic data of the two parents, Huhan 1B and P3155B, and their F2 population are shown in Tables 1 and Figure 3 (Frequency distribution of total stigma exsertion rate in the F2 population of Huhan 1B / P3155B) As can be seen from Table 1, there are significant differences in the stigma exsertion rate phenotypes of the two parents, and the stigma exsertion rate phenotype of the F2 population shows a normal distribution.
[0025] Table 1 The stigma exsertion rate of Huhan 1B / P3155B F2 population and parents
[0026]
[0027] 2.QTL-seq analysis
[0028] Based on the stigma exsertion phenotype of 673 F2 segregating populations, 35 individuals with low stigma exsertion were selected to construct a low-pool, with an average of 32.9%. Thirty-five individuals with high stigma exsertion were selected to construct a high-pool, with an average of 78.3%. Sequencing data were depleted of duplicate reads due to PCR, adapters, and low-quality sequences to obtain high-quality sequences. Results showed that the high-pool yielded 167,151,875 short reads, which were aligned to the Nipponbare reference genome, covering 93.52% of the genome with an average coverage depth of 44× and identifying 2,437,972 SNPs. The low-pool yielded 162,898,799 short reads, covering 93.54% of the genome with an average coverage depth of 45× and identifying 2,428,627 SNPs (Table 2).
[0029] Table 2 Sequencing data statistics
[0030]
[0031] QTL analysis is performed by comparing a parameter (SNP-index) related to the sequencing depth of SNPs in two pools. The SNP-index method uses differences in genotype frequencies between pools for marker association analysis. It primarily identifies significant differences in genotype frequencies between pools, using Δ(SNP_index) as a statistical measure. The stronger the association between a marker SNP and the trait, the closer Δ(SNP_index) is to 1.
[0032] The candidate interval is the sliding window where the ΔSNP_index exceeds the threshold at the 95% confidence level. A total of 7 candidate intervals were detected ( Figure 1 , Table 3), of which 2 are on chromosome 8 and 5 are on chromosome 9.
[0033] Table 3 QTL-seq analysis of Huhan1B / P3155B F2 population
[0034]
[0035] 3. SSR marker analysis
[0036] Polymorphism analysis of the recurrent parent Huhan 1B and the donor parent K17B using 940 pairs of evenly distributed SSR markers across rice chromosomes revealed significant polymorphism between the recurrent parent Huhan 1B and the donor parent K17B. 92 markers were found to be significantly polymorphic between the parents, with a polymorphism rate of 9.79%. Genetic background analysis of line P3155B using these 92 polymorphic markers revealed that 83 markers reverted to the Huhan 1B genotype, while 9 loci still exhibited polymorphic differences, with a background reversion rate of 90%. Molecular mapping of the population using these 9 SSR markers revealed that single-marker analysis revealed a significant linkage relationship between RM5688, located on chromosome 9, and total stigma exsertion rate (Table 4).
[0037] Table 4 Single marker analysis of Huhan1B / P3155B F2 population
[0038]
[0039]
[0040] Both single marker analysis and QTL-seq analysis detected a significant correlation interval on chromosome 9. Therefore, we continued to screen for polymorphic markers between Huhan 1B and 3155B on chromosome 9, and obtained a total of 8 markers. These 8 markers were combined with the total stigma exsertion rate phenotype for QTL analysis, and a major QTL controlling the total stigma exsertion rate was located. The LOD value was 12.65, and the contribution rate was 11.58% (Table 5). The LOD peak was close to the position of the resequencing mapping interval ( Figure 2 , schematic diagram of the QTL location on chromosome 9).
[0041] Table 5 QTL location on chromosome 9 in Huhan1B / P3155B F2 population
[0042]
[0043] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Shanghai Agricultural Biological Gene Center <120> A major effect QTL for rice stigma exsertion rate, detection primers, kit and application <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> DNA <213> Artificial Sequence <400> 1 gagaggacga tggcactatt gg 22 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 cgaggaactt gattcgcatg g 21 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 aaatgcccca tgcacaac 18 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 ttgtcagatt gtcaccaggg 20
Claims
1. A molecular marker linked to a major QTL for stigma exsertion rate in rice, characterized in that: The molecular markers are RM23662 and RM3700; the nucleotide sequences of the primers of RM23662 are shown in SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the primers of RM3700 are shown in SEQ ID NO.3 and SEQ ID NO.
4.
2. A set of primers for detecting the major effect QTL of rice stigma exsertion rate, characterized by: The primers include primer RM23662 and primer RM3700; the nucleotide sequence of the primer RM23662 is shown in SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequence of the primer RM3700 is shown in SEQ ID NO.3 and SEQ ID NO.
4.
3. A kit for detecting a major QTL for rice stigma exsertion rate, characterized in that: The kit comprises the primers according to claim 2 and a reaction solution.
4. Use of a substance for detecting a molecular marker linked to a major QTL for rice stigma exsertion rate according to claim 1 in breeding or detecting rice varieties with high stigma exsertion rate.
Citation Information
Patent Citations
Paddy rice stigma exsertion rate main-effect QTL, and positioning method and application thereof
CN107435066A
Molecular markers and primer groups of indica-japonica hybrid rice and application
CN113151259A