A method for rapid detection of heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system

Abstract

The present invention belongs to the technical field of heavy metal detection, and specifically relates to a method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system. The steps are as follows: Synthesize upconversion fluorescent nanoparticles, perform supercrystal assembly on them to form microsphere crystal clusters, then modify amino groups on the outside of the microsphere crystal clusters, add aptamers corresponding to heavy metals, connect the aptamers to the microsphere crystal clusters, and then put them into a polydopamine solution to obtain a detection system. Add heavy metal standard solutions with different concentrations to the said system, then detect the characteristic values of the fluorescence intensity signals of the solution, and draw a standard curve regarding the relationship between heavy metal concentration and fluorescence intensity according to the change in fluorescence intensity. The heavy metal concentration in an actual sample with unknown heavy metal content can be calculated using the standard curve. The present invention provides a novel heavy metal detection method, realizing the rapid and sensitive detection of heavy metals in polished glutinous rice flour.

Description

Technical Field

[0001] The present invention belongs to the technical field of heavy metal detection, and particularly relates to a method for rapidly detecting heavy metal ions in water-milled glutinous rice flour based on a microsphere crystal cluster fluorescence system. Background Art

[0002] Heavy metal pollution widely exists in foods. Due to the presence of excessive heavy metal ions in some foods, human oral intake of these foods can lead to chronic heavy metal poisoning. Rapid and accurate detection of heavy metals in environmental samples plays a very important role in timely discovery and prevention of their spread. Commonly used existing methods for detecting heavy metals include atomic fluorescence spectrometry, cold vapor atomic absorption spectrometry, inductively coupled plasma mass spectrometry, potassium permanganate-potassium persulfate digestion method, dithizone spectrophotometry, etc. However, these methods all require professional testers with professional operation skills, and dangerous chemicals such as sulfuric acid and potassium borohydride are also needed when processing samples, which will also pose a certain threat to the physical health of the testers. Moreover, these detection methods have cumbersome steps, take a long time, require professional instruments, the equipment is expensive, the maintenance cost is high, and the detection cost is relatively high. Therefore, it is necessary to develop a more rapid, simple, safe and accurate heavy metal detection method. Summary of the Invention

[0003] In order to solve the above problems existing in the prior art, the present invention provides a method for rapidly detecting heavy metal ions in water-milled glutinous rice flour based on a microsphere crystal cluster fluorescence system, and utilizes the fluorescence resonance energy transfer effect between upconversion fluorescent materials and polydopamine nanoparticles to achieve rapid and sensitive detection of heavy metals in water-milled glutinous rice flour.

[0004] To achieve the above object, the present invention provides the following scheme:

[0005] The present invention provides a method for rapidly detecting heavy metal ions in water-milled glutinous rice flour based on a microsphere crystal cluster fluorescence system, comprising the following steps:

[0006] Step 1: Synthesize upconversion fluorescent nanoparticles by a high-temperature thermal decomposition method.

[0007] Dissolve yttrium chloride hexahydrate, ytterbium chloride hexahydrate, and erbium chloride hexahydrate with methanol A, then add oleic acid and 1-octadecene, and carry out a first heating and stirring reaction under the condition of introducing nitrogen. After the reaction ends, a mixed solution A is obtained, and it is cooled to a certain temperature for standby;

[0008] Ammonium fluoride and sodium hydroxide were added to methanol B to obtain a methanol mixture, which was then mixed with mixed solution A and stirred for the second time. After stirring, the mixture was heated to a certain temperature to evaporate methanol, and then heated to a certain temperature under a nitrogen atmosphere and stabilized for a period of time. Subsequently, the temperature was further increased for the third heating and stirring reaction. After cooling to room temperature, a mixed solution B was obtained; the mixed solution B was taken and washed with a mixed solution of ethanol and cyclohexane, and after washing and drying, an upconversion fluorescent nanomaterial was obtained;

[0009] Step 2: Supercrystal assembly of upconversion fluorescent nanoparticles to form microsphere crystal clusters;

[0010] The upconversion fluorescent nanomaterial obtained in Step 1 was dissolved in cyclohexane to form a mixed solution C, and an aqueous solution of sodium dodecyl sulfate was added to obtain a mixed solution D. The mixed solution D was ultrasonically dispersed, then heated in a water bath and stirred. Then, it was centrifugally washed with deionized water, and after washing and drying, microsphere crystal clusters were obtained;

[0011] Step 3: Modify the outside of the microsphere crystal clusters with amino groups;

[0012] The microsphere crystal clusters obtained in Step 2 were dissolved in ethanol, and then ammonia water and deionized water were added for the first heating and stirring reaction. Tetraethyl orthosilicate was added for the second heating and stirring reaction. Finally, 3-aminopropyltriethoxysilane was added for the third heating and stirring. All three stirrings were carried out under sealed conditions. After stirring, the mixture was allowed to stand and cool to room temperature, and after centrifugal washing, it was dried to obtain microsphere crystal clusters with amino groups modified on the surface;

[0013] Step 4: Connect the aptamer of heavy metal to the microsphere crystal clusters;

[0014] Glutaraldehyde and the microsphere crystal clusters with amino groups modified on the surface prepared in Step 3 were mixed and shaken in the dark at a certain temperature. After the shaking ended, centrifugal washing was carried out with deionized water A. After centrifugal washing, the precipitate was dissolved in deionized water B, and then an aptamer was added for constant-temperature shaking. After the shaking ended, centrifugal washing was carried out with deionized water C to obtain aptamer-functionalized microsphere crystal clusters. The aptamer-functionalized microsphere crystal clusters were dissolved in deionized water again to obtain a microsphere crystal cluster solution;

[0015] Step 5: Synthesize polydopamine nanoparticles.

[0016] Deionized water, ethanol, and ammonia water were mixed and heated with stirring. After stirring for a certain time, an aqueous solution of dopamine hydrochloride was added for constant-temperature stirring. After the stirring ended, centrifugal washing was carried out. The obtained precipitate was dissolved in deionized water, and then the pH of the solution was adjusted with hydrochloric acid to obtain a polydopamine solution.

[0017] Step 6: Mix the polydopamine solution obtained in Step 5 with the microsphere crystal cluster solution prepared in Step 4 in a certain proportion and incubate. After incubation, the detection system is obtained.

[0018] Step 7: Establish a standard curve related to the heavy metal concentration.

[0019] First, prepare heavy metal standard solutions with different concentrations. Add the heavy metal standard solutions with different concentrations to the detection system obtained in Step 6, and then incubate. After incubation, detect the characteristic values of the fluorescence intensity signals of the mixed solution. According to the characteristic values of the fluorescence intensity signals corresponding to the heavy metal standard solutions with different concentrations, draw a standard curve related to the heavy metal concentration.

[0020] Step 8: Detection of heavy metals in water-milled glutinous rice flour.

[0021] Weigh the water-milled glutinous rice flour, add deionized water, stir evenly to make it into a homogeneous slurry, centrifuge, take the supernatant to obtain a sample solution, measure the characteristic values of the fluorescence intensity signals of the sample solution, and calculate the content of heavy metals in the water-milled glutinous rice flour sample according to the heavy metal detection standard curve obtained in Step 7.

[0022] Preferably, in Step 1, the dosage ratio of methanol A, yttrium chloride hexahydrate, ytterbium chloride hexahydrate, and erbium chloride hexahydrate is 6 mL: 236.6 mg: 77.5 mg: 7.6 mg; the dosage ratio of methanol A, oleic acid, 1-octadecene, NH 4 F, NaOH, and methanol B is 6 mL: 6 mL: 15 mL: 0.1482 g: 0.1 g: 10 mL; the temperature of the first heating and stirring reaction is 160 - 170 °C, and the stirring time is 20 - 30 min (both methanol A and methanol B are methanol, and different letters are only for name distinction).

[0023] Preferably, in Step 1, the mixed solution A is cooled to a certain temperature of 45 - 50 °C; the stirring rates of the first, second, and third stirring reactions are all 400 - 500 revolutions per minute; the temperature of the second stirring is 45 - 50 °C, and the time is 30 - 40 min; the temperature for evaporating methanol when rising to a certain temperature is 65 - 70 °C, and the time is 40 - 50 min;

[0024] Heating to a certain temperature under the condition of introducing nitrogen is 100 °C, and the stabilization time is 10 - 15 min. The temperature for continuing to rise for the third heating and stirring reaction is 290 - 300 °C, and the stirring reaction time is 60 - 90 min; the volume ratio of the mixed solution B to the ethanol and cyclohexane mixed solution is 1:1, and the volume ratio of cyclohexane to ethanol is 1:1; the drying temperature is 50 - 60 °C, and the time is 6 - 12 h.

[0025] Preferably, in step two, the concentration of the upconversion fluorescence nanomaterials in the mixed solution is 5-10 mg / mL; the volume ratio of the mixed solution C to the sodium dodecyl sulfate solution is 1:5-1:20, and the concentration of the sodium dodecyl sulfate aqueous solution is 2.8-3 mg / mL; the ultrasonic dispersion time of the mixed solution D is 1-2 h; the temperature of the water bath heating is 70 °C, and the time is 4-7 h; the drying temperature is 50-60 °C, and the time is 6-12 h.

[0026] Preferably, in step three, the dosage ratio of the microsphere crystal clusters, ethanol, ammonia water, deionized water, tetraethyl orthosilicate, and 3-aminopropyltriethoxysilane is 50 mg:40 mL:2.5 mL:10 mL:50 μL:100 μL; the reaction temperatures of the first, second, and third heating and stirring are all 65 °C; the reaction time of the first stirring is 10-15 min; the second stirring time is 4-6 h; the third stirring time is 2-3 h; the drying temperature is 50-60 °C, and the time is 6-12 h.

[0027] Preferably, in step four, the dosage ratio of the microsphere crystal clusters with an amino group on the surface, deionized water B, glutaraldehyde, and aptamer is 10 mg:5 mL:1.25 mL:60 μL; among them, the aptamer is a nucleic acid aptamer that can specifically bind to the heavy metal to be detected, and the concentration is 100 μM (deionized water A, deionized water B, and deionized water C are all deionized water, and different letters are only for name distinction);

[0028] Mix and shake at a certain temperature, the mixing and shaking time is 2 h, and the temperature is 37 °C; the temperature of the constant temperature shaking after adding the aptamer is 37 °C, and the time is 10-12 h; the concentration of the microsphere crystal cluster solution is 0.4-0.5 mg / mL.

[0029] Preferably, in step five, the dosage ratio of the hydrochloric acid dopamine aqueous solution, ethanol, ammonia water, and deionized water is 5 mL:10 mL:0.75 mL:25 mL; the volume concentration of the ammonia water is 25-28%, and the stirring time is 20-30 min.

[0030] Preferably, in step five, the temperature of the constant temperature stirring is 25-30 °C, and the stirring time is 24 h; among them, the concentration of the hydrochloric acid dopamine aqueous solution is 0.05 g / mL; the hydrochloric acid concentration is 0.8-1.5 mol / L; the pH of the adjusted solution is 2-4.

[0031] Preferably, in step six, the volume ratio of the polydopamine nano solution to the microsphere crystal cluster solution is 1-1.5:5; the incubation time is 5-10 min; the concentration of the polydopamine nano solution is 0.5-1 mg / mL.

[0032] Preferably, in step seven, the concentration range of the heavy metal in the system after adding the heavy metal standard solution is 1 μg / L to 10 μg / L; the incubation time after adding the heavy metal standard solution to the system is 40 to 60 min.

[0033] Preferably, in step eight, the dosage ratio of the water-milled glutinous rice flour to deionized water is 1 g:10 mL.

[0034] Compared with the existing detection technologies, the beneficial effects of the present invention are as follows:

[0035] 1. By means of the microemulsion self-assembly method of the present invention, through the evaporation of the low-boiling organic solvent and the way of droplet shrinkage, the upconversion nanoparticles are confined in the micron-sized three-dimensional space provided by the microemulsion droplets. Due to the spontaneous crossing of the alkane chains of the aqueous surfactant and the alkane chains on the outer surface of the upconversion nanoparticles through hydrophobic van der Waals forces, the nanoparticles aggregate, assemble and fix together to form microsphere crystal clusters. By changing the ratio of the oil phase to the water phase, the size of the synthesized microsphere crystal clusters can be controlled. The clusters still have obvious fluorescence in aqueous solution, have good water solubility and dispersibility, which is beneficial to the detection of actual samples in aqueous solution, and overcomes the disadvantage of poor dispersibility of oil-soluble upconversion fluorescent nanomaterials in aqueous solution.

[0036] 2. The present invention constructs a detection system by using the electrostatic adsorption between the polydopamine nanoparticles and the aptamer-functionalized microsphere crystal clusters. When the pH is 2 - 4, the polydopamine nanoparticles are positively charged, while the aptamer-functionalized microsphere crystal clusters are negatively charged, and the two can be combined by electrostatic adsorption. When heavy metals are present, the heavy metals specifically bind to the aptamers of the heavy metals. At the same time, the positive charges carried by the heavy metals change the local potential of the aptamer-functionalized microsphere crystal clusters, resulting in a weakening of the electrostatic adsorption force between the clusters and the polydopamine particles, and part of the polydopamine nanoparticles fall off from the clusters, and the fluorescence resonance energy transfer fails, and the fluorescence intensity of the system changes; this system is sensitive to heavy metals and has specificity, and can detect heavy metals at a lower concentration.

[0037] 3. The present invention adopts the method of establishing a standard curve, and the heavy metal concentration in the actual sample can be calculated according to the fluorescence intensity signal characteristic value. Compared with the existing detection technologies, this method is more simple and rapid. Description of the Drawings

[0038] Figure 1 It is the fluorescence spectrum of the microsphere crystal clusters (SDSUCNPs) and the ultraviolet absorption spectrum of the polydopamine nanoparticles (PDANPs).

[0039] Figure 2It is a potential contrast diagram, where SDSUCNPs are microsphere crystal clusters, and SDSUCNPs-NH 2 are microsphere crystal clusters modified with amino groups, and SDSUCNPs-NH 2 -Apt are aptamer-functionalized microsphere crystal clusters, and PDANPs are polydopamine nanoparticles.

[0040] Figure 3 This is the schematic diagram of the rapid detection of heavy metal ions in polished glutinous rice flour based on the microsphere crystal cluster fluorescence system of the present invention.

[0041] Figure 4 It is the standard curve graph constructed for detecting mercury ions based on the microsphere crystal cluster fluorescence system in Example 1. Detailed implementation manners

[0042] Now, the exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0043] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0044] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0045] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0046] The aptamer used in this example was synthesized by Sangon Biotech (Shanghai) Co., Ltd. For the heavy metal ion mercury ion in this example, taking the detection of mercury ion as an example, the aptamer is a mercury ion nucleic acid aptamer, and the mercury ion nucleic acid aptamer sequence is 5-’CTACAGTTTCACCTTTTCCCCCGTTTTGGTGTTT-3’.

[0047] Example 1:

[0048] Step 1, prepare upconversion fluorescent nanomaterials

[0049] Accurately weigh 236.6 mg of YCl 3 ·6H 2 O, 77.5 mg of YbCl 3 ·6H 2 O and 7.6 mg of ErCl 3 ·6H 2 O and add them to 6 mL of methanol, dissolve by ultrasonic treatment, transfer it to a 150 mL three-necked round-bottom flask, then add 6.0 mL of oleic acid and 15.0 mL of 1-octadecene, and carry out the first heating and stirring reaction under the condition of introducing nitrogen. The heating temperature is 160 °C, magnetic stirring is carried out for 30 minutes at 500 revolutions per minute; after the reaction, the solution changes from a turbid milky white liquid to clear, obtaining a mixed solution A, allowing it to cool naturally to 50 °C for standby.

[0050] Then, weigh 148.2 mg of NH 4 F and 100 mg of NaOH, add 10.0 mL of methanol and dissolve it by ultrasonic treatment to obtain a methanol solution, then mix it with the mixed solution A cooled to 50 °C, and continue to carry out the second stirring at 50 °C for half an hour. Then, raise the temperature to 70 °C and continuously stir for 40 minutes to completely evaporate the methanol. After the methanol evaporation is completed, introduce nitrogen and slowly heat the mixture to 100 °C under a nitrogen stream and keep it for 10 minutes, then raise the temperature to 300 °C for the third heating and stirring reaction, and the heating time is 90 min to form upconversion fluorescent nanoparticles. After the reaction is completed, allow the mixture to cool naturally to room temperature, add a cyclohexane-ethanol solution with a volume ratio of 1:1 to the obtained mixed solution, transfer it to a centrifuge tube, centrifuge and wash 3 times at a speed of 8000 rpm, discard the supernatant, and place the obtained solid product in a vacuum drying oven at 50 °C for drying for 12 h to obtain upconversion fluorescent nanomaterials (OA-UCNPs).

[0051] As an energy donor, upconversion nanoparticles have good fluorescence properties. Under the excitation of fluorescence at a wavelength of 980 nm, emission peaks can be generated at 550 nm and 660 nm. Upconversion fluorescence overcomes the interference of the autofluorescence of the sample to be measured and can greatly improve the detection sensitivity. Moreover, the fluorescence of the upconversion material is stable and is not easily affected by the temperature and pH value of the external environment, and the low-energy excitation fluorescence has strong penetration ability and will not damage biological samples, and stable and reliable detection can be achieved.

[0052] Step 2, prepare microsphere crystal clusters; use the microemulsion method to self-assemble hydrophobic UCNPs into water-soluble supercrystals.

[0053] Weigh 100 mg of upconversion nanoparticles, dissolve them in 10 mL of cyclohexane, then add 100 mL of sodium dodecyl sulfate solution with a concentration of 3 mg / mL, and perform ultrasonic treatment on the mixed liquid to form a microemulsion. After the ultrasonic treatment is completed, pour the solution into a beaker, place it in a water bath at 70 °C for 5 h to evaporate and concentrate the solution. Finally, add deionized water for centrifugal washing, collect the precipitate after washing, and dry it in an oven at 60 °C to obtain microsphere crystal clusters (SDSUCNPs).

[0054] The advantage of the microsphere crystal clusters is that through the evaporation of low-boiling organic solvents, the droplets shrink, and the upconversion nanoparticles are confined in the micron-sized three-dimensional space provided by the microemulsion droplets. Since the alkane chains of the aqueous surfactant and the alkane chains on the outer surface of the upconversion nanoparticles spontaneously cross through hydrophobic van der Waals forces, the nanoparticles aggregate, assemble, and fix together to form microsphere crystal clusters. Compared with oil-soluble upconversion nanomaterials, the clusters have good water solubility and dispersibility, which is beneficial to the detection of actual samples in aqueous solutions, overcoming the disadvantage of poor dispersibility of oil-soluble upconversion fluorescent nanomaterials in aqueous solutions. At the same time, by changing the ratio of the oil phase to the water phase, the size of the synthesized microsphere crystal clusters can be controlled.

[0055] Step 3: Connect amino groups to the surface of the microsphere crystal clusters

[0056] Take 50 mg of SDSUCNPs obtained in Step 2, dissolve them in 40 mL of ethanol, ultrasonicate for 10 min, then add 2.5 mL of ammonia water with a volume concentration of 25% and 10 mL of deionized water, and perform the first heating and stirring reaction in a water bath. The heating temperature is 65 °C, stir for 10 min, then add 50 μL of tetraethyl orthosilicate for the second heating and stirring reaction, stir at 65 °C for 5 h, and finally add 100 μL of APTES for the third heating and stirring, continue to stir for 2 h, then turn off the water bath. All three stirrings are carried out under sealed conditions, and let it stand and cool for 1 h. Centrifuge the obtained solution to collect the precipitate, and finally place the precipitate in an oven at 50 °C and dry for 12 h to obtain microsphere crystal clusters with amino groups modified on the surface.

[0057] The microsphere crystal clusters modified with amino groups can covalently bind to the amino-terminated mercury ion specific aptamer. The aptamer can be firmly adsorbed on the microsphere crystal clusters, making the system more stable and reducing the situation where the aptamer detaches from the clusters due to external forces.

[0058] Step 4: Connect aptamers to SDSUCNPs

[0059] Take 10 mg of the microsphere crystal clusters with amino groups modified on the surface prepared in Step 3. Under light - shielding conditions, add 1.25 mL of glutaraldehyde, and slowly oscillate at 37 °C for 2 hours; add deionized water and centrifuge for washing, repeat the washing three times in total to remove the glutaraldehyde solution. Take the precipitate, add 5 mL of deionized water, and then add 60 μL of nucleic acid aptamer with a concentration of 100 μM. The mercury - ion nucleic acid aptamer sequence used is 5 - ’CTACAGTTTCACCTTTTCCCCCGTTTTGGTGTTT - 3’. The mercury - ion - specific aptamer contains abundant thymine, and mercury ions will stably bind to thymine, enabling the accurate and sensitive detection of the presence of mercury ions. Mix the obtained microsphere crystal clusters with amino groups modified on the surface and the aptamer mixture system, and oscillate at a constant temperature of 37 °C for 12 hours. After the oscillation ends, add 5 mL of deionized water and centrifuge for washing to remove the unconnected aptamer. Finally, dissolve the obtained precipitate in 25 mL of deionized water to obtain a microsphere crystal cluster solution.

[0060] Step Five, Synthesis of Polydopamine Nanoparticles

[0061] Take 25 mL of deionized water and place it in a 150 - mL round - bottom flask. Then add 10 mL of ethanol and 0.75 mL of ammonia water, heat in a water bath at 30 °C, put in a magnetic stirrer, and stir for 30 minutes. Then add 5 mL of 0.05 g / mL dopamine hydrochloride solution, and stir at a constant temperature of 30 °C for 24 hours. After the stirring ends, take out the round - bottom flask, pour the polymerized dark - brown polydopamine solution into a centrifuge tube for centrifugation. Dissolve the precipitate in 10 mL of deionized water, adjust the pH of the polydopamine solution with hydrochloric acid, adjust the pH to 4 to make it positively charged, obtain a polydopamine solution, and then store it in a refrigerator at 4 °C.

[0062] Step Six, Connection of Polydopamine Nanoparticles and Aptamer - Functionalized Microsphere Crystal Clusters.

[0063] Take 500 μL of the microsphere crystal cluster solution and mix it with 150 μL of the polydopamine solution, and slowly shake at room temperature for 8 minutes. The polydopamine nanoparticles are finally adsorbed onto the aptamer - functionalized microsphere crystal clusters.

[0064] The isoelectric point of the polydopamine nanoparticles is 4.5. After adjusting the pH of the system to below 4.5, the polydopamine nanoparticles carry positive charges, overcoming the defect that negatively charged polydopamine nanoparticles cannot bind to aptamer - functionalized microsphere crystal clusters that are also negatively charged. When the charges of the polydopamine nanoparticles and the microsphere crystal clusters are opposite, electrostatic adsorption can occur, the distance between them is less than 10 nm, and the polydopamine nanoparticles have absorption in the range of 400 - 800 nm, which can cover the emission peak of the microsphere crystal clusters, meeting the conditions for fluorescence resonance energy transfer to occur, and the fluorescence of the microsphere crystal clusters will be quenched.Figure 1 are the fluorescence spectra of microsphere crystal clusters (SDSUCNPs) and the UV absorption spectra of polydopamine nanoparticles (PDANPs); by Figure 1 it can be seen that the fluorescence emission band of the microsphere crystal clusters overlaps with the UV absorption band of the polydopamine nanoparticles, indicating that the polydopamine nanoparticles can quench the fluorescence of the microsphere crystal clusters.

[0065] Figure 2 is the potential comparison diagram, where SDSUCNPs are microsphere crystal clusters, SDSUCNPs-NH 2 are microsphere crystal clusters modified with amino groups, SDSUCNPs-NH 2 -Apt are aptamer-functionalized microsphere crystal clusters, and PDANPs are polydopamine nanoparticles. It can be seen from the figure that the aptamer-functionalized microsphere crystal clusters carry negative charges, while the polydopamine nanoparticles at pH 2 carry positive charges, indicating that the two can bind through electrostatic adsorption.

[0066] Figure 3 is the schematic diagram of the rapid detection of heavy metal ions in polished glutinous rice flour based on the microsphere crystal cluster fluorescence system of the present invention. Polydopamine nanoparticles (PDANPs) can quench the fluorescence of microsphere crystal clusters (SDSUCNPs), and at the same time, the two can bind through electrostatic adsorption, meeting the conditions for fluorescence resonance energy transfer to occur. Therefore, the system constructs a detection system based on fluorescence resonance energy transfer (FRET).

[0067] Step 7: First, prepare heavy metal standard solutions with different concentrations. Standard solutions of mercury ions with different concentrations are added to the system in Step 6 and incubated for 40 minutes. After incubation, the system is excited with an excitation wavelength of 980 nm. After the values are stable, the fluorescence signal characteristic values at 550 nm and 660 nm are recorded, and a standard curve related to the mercury ion concentration is plotted.

[0068] When mercury ions are present, mercury ions specifically bind to mercury ion aptamers. The positive charges carried by mercury ions change the local potential of the aptamer-functionalized microsphere crystal clusters, resulting in a weakening of the electrostatic adsorption force between the microsphere crystal clusters and the polydopamine particles. Part of the polydopamine nanoparticles fall off from the microsphere crystal clusters, and fluorescence resonance energy transfer fails, and the fluorescence intensity of the system changes. The degree of change in fluorescence intensity is correlated with the mercury ion concentration. ( Figure 4 is the standard curve diagram constructed for the detection of mercury ions based on the microsphere crystal cluster fluorescence system in Example 1. In the concentration range of 1 μg / L - 10 μg / L, the two show a good linear relationship, and the linear equation is y = 144.34x + 2097.13, and the linear correlation coefficient R 2 reaches 0.9946)

[0069] Step 8: Verification of accuracy by spike recovery

[0070] Weigh 1 g of water-milled glutinous rice flour, add 1 mL of mercury ion standard solution and 9 mL of deionized water, stir evenly to make a homogeneous slurry, centrifuge, take the supernatant, measure the fluorescence intensity signal characteristic value of the solution, and calculate the mercury ion content in the water-milled glutinous rice flour sample according to the standard curve related to the mercury ion concentration obtained in Step 7.

[0071] (Table 1)

[0072]

[0073] It can be seen from the data in the table that the detection recovery rates of the samples with spike concentrations of 4 and 8 μg / L are 94.25%-96.50%, and the coefficient of variation is 3.58%-3.89%; this shows that the experimental method is stable, sensitive and accurate, and is suitable for the detection of Hg 2+ residue in actual water-milled glutinous rice flour.

[0074] Note: The above embodiments are only used to illustrate the present invention and do not limit the technical solutions described in the present invention; therefore, although the present specification has described the present invention in detail with reference to the above embodiments, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention, all improvements to the technical solutions that do not depart from the spirit and scope of the present invention shall be covered within the scope of the claims of the present invention.

Claims

1. A method for rapid detection of heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system, characterized in that, it includes the following steps: Step 1: Dissolve yttrium chloride hexahydrate, ytterbium chloride hexahydrate, and erbium chloride hexahydrate in methanol A, then add oleic acid and 1-octadecene, and conduct the first heating and stirring reaction under the condition of introducing nitrogen. After the reaction ends, obtain a mixed solution A, and cool it to a certain temperature for standby; Add ammonium fluoride and sodium hydroxide to methanol B to obtain a methanol solution, then mix it with the mixed solution A and conduct the second stirring. After stirring, raise the temperature to volatilize methanol, then heat it to a certain temperature under the condition of introducing nitrogen and keep it stable for a period of time, and then continue to raise the temperature for the third heating and stirring reaction. After cooling to room temperature, obtain a mixed solution B; Take the mixed solution B and wash it with a mixed solution of ethanol and cyclohexane, and dry it after washing to obtain upconversion fluorescent nanomaterials; Step 2: Dissolve the upconversion fluorescent nanomaterials obtained in Step 1 in cyclohexane to form a mixed solution C, add an aqueous solution of sodium dodecyl sulfate to obtain a mixed solution D, ultrasonically disperse the mixed solution D, then heat it in a water bath and conduct stirring, and then centrifuge and wash it with deionized water. After washing and drying, obtain microsphere crystal clusters; Step 3: Dissolve the microsphere crystal clusters obtained in Step 2 in ethanol, then add ammonia water and deionized water for the first heating and stirring reaction, then add tetraethyl orthosilicate for the second heating and stirring reaction, and finally dropwise add 3-aminopropyltriethoxysilane for the third heating and stirring. All three stirrings are carried out under sealed conditions. After stirring, let it stand and cool to room temperature, and after centrifugal washing, conduct drying to obtain microsphere crystal clusters with amino groups modified on the surface; Step 4: Mix and shake glutaraldehyde and the microsphere crystal clusters with amino groups modified on the surface prepared in Step 3 in the dark at a certain temperature. After the shaking ends, add deionized water A for centrifugal washing. After centrifugal washing, take the precipitate and dissolve it in deionized water B, then add an aptamer for constant temperature shaking. After the end, add deionized water C for centrifugal washing to obtain aptamer-functionalized microsphere crystal clusters. Dissolve the aptamer-functionalized microsphere crystal clusters in deionized water again to obtain a microsphere crystal cluster solution; Step 5: Mix and heat and stir deionized water, ethanol, and ammonia water. After stirring for a certain time, add an aqueous solution of dopamine hydrochloride for constant temperature stirring. After the stirring ends, conduct centrifugal washing. The obtained precipitate is dissolved in deionized water, and then the pH of the solution is adjusted with hydrochloric acid to obtain a polydopamine solution; Step 6: Mix the polydopamine solution obtained in Step 5 with the microsphere crystal cluster solution prepared in Step 4 in a certain proportion and conduct incubation. After incubation, obtain a detection system; Step 7: First, prepare heavy metal standard solutions with different concentrations. Add heavy metal standard solutions with different concentrations to the detection system obtained in Step 6, and then conduct incubation. After incubation, detect the fluorescence intensity signal characteristic values of the mixed solution. According to the fluorescence intensity signal characteristic values corresponding to the heavy metal standard solutions with different concentrations, draw a standard curve related to the heavy metal concentration; Step 8: Detection of heavy metals in polished glutinous rice flour; Weigh polished glutinous rice flour, add deionized water, stir evenly to make it into a homogeneous slurry, centrifuge, take the supernatant to obtain a sample solution; measure the characteristic value of the fluorescence intensity signal of the sample solution, and calculate the heavy metal content in the polished glutinous rice flour sample according to the heavy metal detection standard curve obtained in Step Seven.

2. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to claim 1, characterized in that, In Step 1, the dosage ratio of methanol A, yttrium chloride hexahydrate, ytterbium chloride hexahydrate, and erbium chloride hexahydrate is 6 mL: 236.6 mg: 77.5 mg: 7.6 mg; the dosage ratio of methanol A, oleic acid, 1-octadecene, NH 4 F, NaOH, and methanol B is 6 mL: 6 mL: 15 mL: 0.1482 g: 0.1 g: 10 mL; the temperature of the first heating and stirring reaction is 160~170 °C, and the stirring time is 20~30 min.

3. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to claim 1, characterized in that, In Step One, the mixed solution A is cooled to a certain temperature of 45 - 50 °C; the stirring rates of the first, second, and third stirring reactions are all 400 - 500 revolutions per minute; the temperature of the second stirring is 45 - 50 °C, and the time is 30 - 40 min; the temperature for evaporating methanol when rising to a certain temperature is 65 - 70 °C, and the time is 40 - 50 min; It is heated to a certain temperature of 100 °C under the condition of introducing nitrogen, and stabilized for a period of 10 - 15 min. Then it continues to heat up for the third heating and stirring reaction at a temperature of 290 - 300 °C, and the stirring reaction time is 60 - 90 min; the volume ratio of the mixed solution B to the ethanol and cyclohexane mixed solution is 1:1, and the volume ratio of cyclohexane to ethanol is 1:1; the drying temperature is 50 - 60 °C, and the time is 6 - 12 h.

4. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to claim 1, characterized in that, In Step Two, the concentration of the upconversion fluorescent nanomaterials in the mixed solution is 5 - 10 mg / mL; the volume ratio of the mixed solution C to the sodium dodecyl sulfate solution is 1:5 - 1:20, and the concentration of the sodium dodecyl sulfate aqueous solution is 2.8 - 3 mg / mL; the ultrasonic dispersion time of the mixed solution D is 1 - 2 h; the water bath heating temperature is 70 °C, and the time is 4 - 7 h; the drying temperature is 50 - 60 °C, and the time is 6 - 12 h.

5. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to claim 1, characterized in that, In Step Three, the dosage ratio of the microsphere crystal cluster, ethanol, ammonia water, deionized water, tetraethyl orthosilicate, and 3 - aminopropyltriethoxysilane is 50 mg:40 mL:2.5 mL:10 mL:50 μL:100 μL; the reaction temperatures of the first, second, and third heating and stirring are all 65 °C; the reaction time of the first stirring is 10 - 15 min; the time of the second stirring is 4 - 6 h; the time of the third stirring is 2 - 3 h; the drying temperature is 50 - 60 °C, and the time is 6 - 12 h.

6. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to claim 1, characterized in that, In Step 4, the dosage ratio of the microsphere crystal clusters with amino groups on the surface, deionized water B, glutaraldehyde, and aptamer is 10 mg: 5 mL: 1.25 mL: 60 μL; wherein the aptamer is a nucleic acid aptamer that can specifically bind to the heavy metal to be detected, and the concentration is 100 μM; Mix and shake at a certain temperature. The mixing and shaking time is 2 h, and the temperature is 37°C; the temperature for constant-temperature shaking after adding the aptamer is 37°C, and the time is 10 - 12 h; the concentration of the microsphere crystal cluster solution is 0.4 - 0.5 mg / mL.

7. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to Claim 1, characterized in that, In Step 5, the dosage ratio of the aqueous dopamine hydrochloride solution, ethanol, ammonia water, and deionized water is 5 mL: 10 mL: 0.75 mL: 25 mL; the volume concentration of the ammonia water is 25 - 28%, and the stirring time is 20 - 30 min; the temperature for constant-temperature stirring is 25 - 30°C, and the stirring time is 24 h; wherein the concentration of the aqueous dopamine hydrochloride solution is 0.05 g / mL; the concentration of the hydrochloric acid is 0.8 - 1.5 mol / L; the pH of the solution is adjusted to 2 - 4.

8. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to Claim 1, characterized in that, In Step 6, the volume ratio of the polydopamine solution to the microsphere crystal cluster solution is 1 - 1.5:5; the incubation time is 5 - 10 min; the concentration of the polydopamine solution is 0.5 - 1 mg / mL.

9. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to Claim 1, characterized in that, In Step 7, the concentration range of the heavy metal after adding the heavy metal standard solution to the system is 1 μg / L - 10 μg / L; the incubation time after adding the heavy metal standard solution to the system is 40 - 60 min.

10. A method for rapidly detecting heavy metal ions in polished glutinous rice flour based on a microsphere crystal cluster fluorescence system according to Claim 1, characterized in that, In Step 8, the dosage ratio of the polished glutinous rice flour to the deionized water is 1 g: 10 mL.

Images