A probe for detecting zearalenone, and its preparation method and application

Abstract

The invention discloses a probe for detecting zearalenone, and a preparation method and application thereof. The invention first prepares mesoporous silicon sphere composite gold nanoparticles, adsorbs signal molecule rhodamine 6G, obtains Rh6G-MSN@AuNPs surface enhanced Raman material by gold seed growth method, and then modifies zearalenone aptamer on the surface of Rh6G-MSN@AuNPs to construct zearalenone SERS probe. By collecting SERS spectra of zearalenone of different concentrations of SERS probe under excitation wavelength, a standard curve of spectral intensity at characteristic Raman shift of Rh6G and zearalenone content is established, and specific quantitative rapid detection of zearalenone in grain or food is realized. The method is applicable to the field of grain or food safety and the field of analysis and detection.

Description

Technical Field

[0001] The present invention relates to a probe for detecting zearalenone and a preparation method and application thereof, and in particular to a SERS probe for detecting zearalenone and a preparation method and application thereof, belonging to the technical field of rapid food safety evaluation. Background Art

[0002] Zearalenone is a secondary metabolite with estrogen-like effects produced by several fungi such as Fusarium graminearum and Fusarium culmorum. Zearalenone can be enriched in humans or animals through the food chain, which will cause adverse effects such as malformation, miscarriage, hepatotoxicity and hematotoxicity, and cause serious damage to multiple functional systems such as the immune system, endocrine system and reproductive system. Zearalenone is mainly found in corn, wheat and beer. The International Agency for Research on Cancer classifies zearalenone as a Class III carcinogen. The Chinese National Food Safety Standard stipulates that the maximum allowable amount of zearalenone in cereals and their products is 60 μg / kg. Traditional detection methods for zearalenone mainly include high-performance liquid chromatography, liquid chromatography-mass spectrometry and enzyme-linked immunosorbent assay. These assays show good accuracy and specificity, but their sensitivity is limited (effective detection cannot be performed at low concentrations), and they require complex extraction steps and long detection cycles, making it difficult to achieve rapid detection of batch samples. Therefore, finding a detection method with high specificity and sensitivity is of great significance for the rapid detection of zearalenone in grains or cereals.

[0003] Surface enhanced Raman (SERS) spectroscopy technology is based on the local electromagnetic field formed by the precious metal enhanced substrate such as gold and silver, which can enhance the Raman signal intensity of the sample to be tested and realize detection at the single molecule level. It has been applied to the detection of trace substances such as heavy metals, pesticide residues, and antibiotics, but is less used in the detection of fungal toxins. The research literature found that high-performance SERS probes play an important role in the detection results. Most of the SERS detection methods for fungal toxins use the enhanced substrate and the detection object to directly interact. The collected Raman spectra contain too much redundant information, and the characteristic peaks are not obvious and lack specificity. The method of directly labeling Raman signal molecules on the surface of precious metals is easily interfered by the external environment, resulting in unstable signals or inability to accurately establish a relationship with the substance to be tested, resulting in poor accuracy and sensitivity. Therefore, there are still challenges in developing stable and highly sensitive enhanced substrates and probes. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a probe for detecting zearalenone, a preparation method and application thereof, and specifically relates to a SERS probe for detecting zearalenone, a preparation method and application thereof. The probe of the present invention is a SERS probe constructed by combining silica with gold nanoparticles and an aptamer, and realizes the detection of zearalenone. The preparation process of the SERS probe of the present invention is simple to operate, has high sensitivity, and is suitable for rapid batch detection of zearalenone in cereals and their products.

[0005] The present invention modifies Apt on the surface of Rh6G-MSN@AuNPs as a SERS probe. Zearalenone and Apt combine through the base complementary pairing principle, thereby changing the masking effect of Apt on the signal molecule Rh6G in the SERS probe. By measuring the Raman response intensity of the SERS probe, a quantitative model is established to achieve rapid quantitative prediction of the content of zearalenone.

[0006] In order to achieve the above technical objectives, the present invention first provides a probe for detecting zearalenone, wherein the probe is constructed based on mesoporous silica spheres composited with gold nanoparticles and combined with an aptamer, and the probe is also a surface enhanced Raman probe.

[0007] The present invention also provides a method for preparing the probe for detecting zearalenone, comprising the following steps:

[0008] S1. Preparation of surface enhanced Raman material mesoporous silica sphere composite gold nanoparticles (Rh6G-MSN@AuNPs):

[0009] (1) Synthesis of mesoporous silica spheres (MSNs)

[0010] Ultrapure water dissolved with hexadecyltrimethylammonium bromide (CTAB) was magnetically stirred and heated to 80°C, and then NaOH and tetraethyl orthosilicate (TEOS) were added dropwise to the ultrapure water dissolved with hexadecyltrimethylammonium bromide (CTAB), and the solution was reacted under stirring until it turned milky white, and then allowed to stand and cool at room temperature; then centrifuged, the obtained product was washed with ethanol and water respectively, and vacuum dried to obtain MSNs without CTAB residue.

[0011] The volume ratio of NaOH, TEOS and ultrapure water dissolved with cetyltrimethylammonium bromide (CTAB) is 1.75:2.5:240; the concentration of NaOH is 2M; and the amount of CTAB in the ultrapure water is 0.5 g.

[0012] (2) Preparation of Rh6G-MSNs adsorbed with the signal molecule Rh6G

[0013] The aqueous solution of Rhodamine 6G is added to the aqueous solution of mesoporous silica spheres MSN prepared in step (1), and stirred for adsorption at room temperature. The unadsorbed signal molecule Rhodamine 6G is removed by centrifugation, and vacuum drying is performed to obtain Rh6G-MSN adsorbed with the signal molecule.

[0014] The dosage ratio of the aqueous solution of rhodamine 6G to the aqueous solution of mesoporous silica spheres MSN is: 10 μL: 2 mL; the concentration of the aqueous solution of rhodamine 6G is 1 mM, and the concentration of the aqueous solution of mesoporous silica spheres MSN is 9×10 -4 g / mL;

[0015] The stirring adsorption condition is a stirring speed of 150 rpm for 1 h.

[0016] (3) Growth of gold nanoparticles on the surface of Rh6G-MSN

[0017] Preparation of seed solution: Add HAuCL4 solution to Rh6G-MSN aqueous solution under stirring in an ice-water bath at 4°C; quickly add trisodium citrate aqueous solution after stirring evenly, and then immediately add ice-cold sodium borohydride aqueous solution. Under stirring conditions, the solution immediately changes from light yellow to reddish brown, indicating that the gold seeds are successfully synthesized. The precipitate after centrifugation is dispersed in water to obtain a seed solution.

[0018] Gold seed growth: The seed solution and HAuCL4 solution were mixed and heated to 80°C under stirring, and trisodium citrate aqueous solution was added. The mixed solution turned blue-purple under the reaction conditions. Stirring was continued until the color of the solution no longer changed. After centrifugation to remove the supernatant, it was dispersed in water to obtain Rh6G-MSN@AuNPs solution.

[0019] In the process of preparing the seed solution, the volume ratio of the Rh6G-MSN aqueous solution to the HAuCL4 solution is 1:5, and the concentration of the Rh6G-MSN aqueous solution is 9×10 -4 g / mL, the concentration of the HAuCL4 solution is 5×10 -4 M; the volume ratio of the trisodium citrate aqueous solution and the sodium borohydride aqueous solution is 0.1:1, the concentration of the trisodium citrate aqueous solution is 5% wt, and the concentration of the sodium borohydride aqueous solution is 0.01M.

[0020] During the growth of the gold seeds, the amount of the seed solution and the HAuCL4 aqueous solution was 0.4 mL:3.6 mL, wherein the concentration of the HAuCL4 aqueous solution was 0.27 mM;

[0021] The molar ratio of the trisodium citrate to HAuCL4 is 2-10:1. Preferably, the molar ratio of the trisodium citrate aqueous solution to HAuCL4 is 4:1; the concentration of the trisodium citrate aqueous solution is 0.1M.

[0022] S2. Preparation of SERS probe:

[0023] At room temperature, Apt solution was added to the Rh6G-MSN@AuNPs solution, and the reaction was incubated to allow the aptamer to connect to AuNPs. After the reaction, the unbound Apt was removed by centrifugation, and the product was dispersed in a PBS solution.

[0024] The amount of the Rh6G-MSN@AuNPs solution and the Apt solution is 500 μL:60-100 μL, the concentration of the Apt solution is 1.3 μM, and the incubation time is 1-9 h; preferably, the amount of the Rh6G-MSN@AuNPs solution and the Apt solution is 500 μL:60 μL, and the incubation time is 1 h.

[0025] The Apt sequence is:

[0026] SH-5′-AGCAGCACAGAGGTCAGATGTCATTCTATGGTACATTACTATCTCTGTAATGTGATATGCCTATGCGT GCTACCGTGAA-3′, with thiol modification at the 5′ end.

[0027] The present invention also provides a method for detecting zearalenone, which is based on the above-mentioned SESR probe and comprises the following steps:

[0028] S1. The SERS probes are mixed with the zearalenone standard solution, and after the capture reaction, the Raman spectrum is collected.

[0029] The volume ratio of the SERS probe to the zearalenone standard solution is 10:1, and the concentration of the zearalenone standard solution is 3-200 ng / mL;

[0030] The capture reaction time is 1-3 hours, preferably 2.5 hours.

[0031] S2. Establish a standard curve based on the relationship between different concentrations of zearalenone standard solution and the characteristic Raman peak of the signal molecule Rh6G.

[0032] S3. Detecting the content of zearalenone in the sample to be tested: mixing the sample to be tested with the SERS probe, collecting Raman spectra according to the method of step S1, and calculating the concentration of zearalenone in the sample to be tested according to the standard curve of step S2.

[0033] The content of zearalenone in the sample can also be further calculated according to the measured concentration. In the present invention, it is calculated in the following manner:

[0034] The actual zearalenone content in the positive corn sample was calculated according to formula (1):

[0035] X = (1)

[0036] X: The content of zearalenone in the sample, in micrograms per kilogram (μg / kg)

[0037] ρ :The concentration of zearalenone in the test sample is in nanograms per milliliter (ng / mL)

[0038] V: The volume of the sample solution to be tested, in milliliters (mL)

[0039] M: The weight of the sample, in grams (g)

[0040] The present invention also provides application of the probe or the detection method in detecting zearalenone in food or grain.

[0041] Beneficial effects of the present invention

[0042] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0043] (1) The SERS probe involved in the present invention has simple raw materials and preparation process. The mesoporous silica sphere is a highly stable base material that can effectively adsorb signal molecules. A new composite silicon-gold nanomaterial is constructed by the gold nanogrowth method. The signal molecules adsorbed in the mesopores can generate a strong Raman signal under the plasma coupling resonance between the gold nanoparticles caused by the irradiation of excitation light. In addition, the silicon-gold composite nanomaterial can achieve specific detection of zearalenone by connecting with an aptamer.

[0044] (2) The present invention relates to a SERS probe preparation method and a SERS specific detection method for zearalenone. In the probe preparation process, the incubation time used for aptamer connection is optimized to achieve effective masking of the Raman response of the signal molecule by the aptamer. In the detection process, the capture time of the probe identifying and connecting zearalenone is optimized to effectively weaken the masking effect, thereby expanding the detection range of the SERS probe for zearalenone.

[0045] (3) The probe and detection method of the present invention can quickly realize monitoring. It only needs to mix the probe with the sample to be tested, collect the signal, and establish a correlation between the Raman characteristic peak of the signal molecule and the concentration of zearalenone to quickly complete the detection and obtain accurate test results. The detection process is completed within 3 minutes, and the detection limit reaches 0.006387 ng / mL. For actual positive samples, there is no significant difference between the method of the present invention and the traditional HPLC method (P>0.05), and the stability is good, with RSD (n=5) ranging from 1.19% to 2.69%. The quality and safety of grains are determined by simple preparation and detection of spectral peak intensity, realizing rapid and intelligent detection of zearalenone. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Flow chart of the method for quantitative detection of zearalenone by SERS aptamer probe;

[0047] Figure 2 A is the TEM image of MSN;

[0048] Figure 2 B is the BET adsorption curve of MSN;

[0049] Figure 3 A is the Raman spectrum of Rh6G-MSN@AuNPs prepared under different ratios of trisodium citrate and HAuCL4;

[0050] Figure 3 B is the particle size distribution histogram of Rh6G-MSN@AuNPs prepared when the amount of trisodium citrate and HAuCL4 is 4:1;

[0051] Figure 3 C is the TEM image of Rh6G-MSN@AuNPs prepared when the amount of trisodium citrate and HAuCL4 is 4:1;

[0052] Figure 3 D is the XPS graph of Rh6G-MSN@AuNPs prepared when the amount of trisodium citrate and HAuCL4 is 4:1;

[0053] Figure 4 The UV images of the optimized Rh6G-MSN@AuNPs and those modified by aptamers;

[0054] Figure 5 This is the Raman spectrum after the aptamer connection amount is optimized;

[0055] Figure 6 Raman spectra optimized for aptamer incubation time and ZEN capture time;

[0056] Figure 7A Raman spectra of zearalenone standard samples with different concentrations;

[0057] Figure 7 B Raman spectra of zearalenone standard samples with different concentrations at 1508 cm -1 The relationship between the highest peak value and its concentration;

[0058] Figure 8 This is a bar graph showing the specificity of the SERS probe to zearalenone. DETAILED DESCRIPTION

[0059] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0060] Example 1: Preparation of a SERS probe for detecting zearalenone

[0061] (1) Synthesis of mesoporous silica spheres (MSNs)

[0062] 0.5 g of CTAB was dissolved in 240 mL of ultrapure water, stirred magnetically and gradually heated to 80°C. Then 1.75 mL (2 M) of NaOH and 2.5 mL of TEOS were added dropwise to the solution and stirred at 200 rpm for 2 h until the solution gradually turned milky white. The mixture was allowed to stand and cool at room temperature, then centrifuged at 10,000 rpm for 10 min, washed three times with ethanol and water to remove the residual CTAB in the pores, and finally vacuum dried to obtain MSNs.

[0063] In this embodiment, mesoporous silica spheres MSN were synthesized. Figure 2 As can be seen in A, the particle size of the synthesized mesoporous silica spheres MSN is 100-150 nm; Figure 2 B shows the BET adsorption curve of the mesoporous silica spheres. According to the adsorption curve, the specific surface area of ​​the synthesized mesoporous silica spheres is calculated to be 34.392 m 2 g -1 , the pore volume is 0.0445 cm 3 g -1 In order to obtain a stronger Raman response signal, Rh6G molecules with obvious Raman scattering peaks are adsorbed in the mesopores, and then gold nanoparticles are grown on their surface. The growth degree of gold nanoparticles affects the enhancement effect of Raman enhanced materials, so it is necessary to optimize the amount of trisodium citrate used in the growth process of gold nanoparticles.

[0064] (2) Preparation of Rh6G-MSN

[0065] Add 10 μL (1 mM) Rhodamine 6G aqueous solution to 2 mL (9 × 10 -4 g / mL) in the mesoporous silica sphere MSN aqueous solution prepared in step (1), adsorbed at room temperature at a stirring speed of 150 rpm for 1 h. Then centrifuged at a speed of 8000 rpm for 10 min to remove the unadsorbed signal molecules, and finally vacuum dried to obtain Rh6G-MSN adsorbed with signal molecules.

[0066] (3) Optimization of gold nanoparticle growth and preparation of Rh6G-MSN@AuNPs

[0067] Seed solution preparation: 2 mL (9 × 10 -4 g / mL ) of Rh6G-MSN aqueous solution was added to 10 mL (5×10 -4 M) HAuCL4 solution, stir evenly and quickly add 0.1 mL (5% wt) trisodium citrate aqueous solution and 1 mL (0.01 M) freshly prepared sodium borohydride aqueous solution precooled to 4°C. Under stirring, the solution immediately changes from light yellow to reddish brown, indicating that the gold seeds are successfully synthesized. Stirring is stopped after 6 min.

[0068] Gold seed growth: 0.4 mL of gold seed solution was mixed with 3.6 mL (0.27 mM) of HAuCL4 solution under stirring, and 0.1 M trisodium citrate solution was added under the reaction condition of 80 °C, so that the molar ratio of trisodium citrate to HAuCL4 was 2:1, 4:1, 8:1, and 10:1. Under the reaction conditions, the solution gradually turned blue-purple, and continued to stir until the color of the solution did not change. After centrifugation at 8000 rpm for 10 min, the supernatant was removed and dispersed in 2 mL, pH=7.4 PBS buffer solution to obtain Rh6G-MSN@AuNPs with different growth degrees of gold nanoparticles.

[0069] During the growth of gold seeds, the molar ratio of trisodium citrate to HAuCL4 was optimized. The optimization results showed that the best effect was achieved when the molar ratio of trisodium citrate to HAuCL4 was 4:1.

[0070] Figure 3 A shows that when the molar ratio of sodium tricitrate to HAuCL4 is 4:1 during the growth of gold nanoparticles, the Raman signal intensity of the prepared Rh6G-MSN@AuNPs is the highest; Figure 3B is the particle size distribution histogram of Rh6G-MSN@AuNPs prepared when the amount of trisodium citrate and HAuCL4 is 4:1. The figure shows that the particle size distribution of the prepared Rh6G-MSN@AuNPs conforms to the normal distribution, and the particle size is 120-150 nm.

[0071] Figure 3 C is the TEM image of Rh6G-MSN@AuNPs prepared when the molar ratio of trisodium citrate to HAuCL4 is 4:1. The figure shows that gold nanoparticles with a particle size of 10-20 nm are evenly distributed on the surface of the mesoporous silicon spheres in the Rh6G-MSN@AuNPs prepared at this time.

[0072] Figure 3 D is the XPS graph of Rh6G-MSN@AuNPs prepared when the molar ratio of trisodium citrate to HAuCL4 is 4:1, in which 87.77 and 83.87 eV are attributed to Au, and 102.97 eV is attributed to Si.

[0073] Figure 4 It also shows that the prepared Rh6G-MSN@AuNPs has an obvious plasmon resonance absorption peak at 530 nm.

[0074] Table 1 shows the BET test results of MSN, Rh6G-MSN and Rh6G-MSN@AuNPs. The results show that the specific surface area and pore volume of mesoporous silicon decrease after adsorbing signal molecules. After continuing to grow gold nanoparticles, the specific surface area increases and the pore volume decreases. This indicates that the mesoporous material effectively adsorbs the signal molecules and the grown gold nanoparticles greatly improve the Raman response intensity.

[0075] Table 1. BET calculation results

[0076]

[0077] (4) Preparation of SERS probes by Apt modification of Rh6G-MSN@AuNPs

[0078] At room temperature, Apt solution was added to the Rh6G-MSN@AuNPs solution, and the reaction was incubated to allow the aptamer to connect to AuNPs. After the reaction, the unbound Apt was removed by centrifugation, and the product was dispersed in a PBS solution.

[0079] In this process, since the amount of aptamer attached or modified on the surface of Rh6G-MSN@AuNPs affects the masking effect of the Raman response of rhodamine 6G and thus affects the sensitivity of the SERS probe during the detection of zearalenone, the amount of aptamer attached to the surface of Rh6G-MSN@AuNPs was optimized, and its masking effect was determined by collecting Raman spectra. The optimization method of Apt dosage is as follows:

[0080] Take 500 μL of trisodium citrate solution to make the ratio of trisodium citrate to HAuCL4 substance to be 4:1, and keep other conditions unchanged to prepare the Rh6G-MSN@AuNPs solution. Add 60, 70, 80, 90, and 100 μL (1.3 μM) of Apt aqueous solution to the Rh6G-MSN@AuNPs solution, incubate at room temperature for 2 h, and then add 50 μL (100 ng / mL) of zearalenone standard solution to capture for 2 h. After incubation, centrifuge and wash to remove unbound Apt, the centrifugal speed is 4000 rpm, the centrifugal time is 30 s, and redisperse in 500 μL of PBS solution.

[0081] Figure 5 It shows that when the preferred addition amount of the aptamer is 60 μL, the Raman signal masking effect of Rh6G-MSN@AuNPs is the best, and when zearalenone is added for capture, the Raman response signal is the strongest, and the signal intensity variation range before and after masking is the widest. Therefore, the aptamer addition amount of 60 μL is selected to prepare a highly sensitive SERS probe.

[0082] In order to further improve the Raman response sensitivity of the SERS probe, the incubation time of the aptamer during the probe synthesis and the capture time of the target during the zearalenone detection process were further optimized, and the effects were measured by collecting Raman spectra.

[0083] The optimization method is as follows:

[0084] Take the Rh6G-MSN@AuNPs solution, add 60 μL of Apt aqueous solution (1.3 μM), incubate at room temperature for 1, 3, 5, 7, and 9 h, then add 100 μL (100 ng / mL) of zearalenone standard solution and capture for 1, 1.5, 2, 2.5, and 3 h under each incubation condition. By controlling the aptamer incubation time, zearalenone capture time and combining SERS spectral data collection, a highly sensitive SERS probe was finally prepared.

[0085] Figure 6 It showed that the Raman enhancement effect was strongest when the incubation time was 1 h and the connection time was 2.5 h, thus determining the optimal preparation parameters and detection conditions.

[0086] Since the aptamer DNA has a characteristic absorption peak at 260 nm, UV characterization was used to verify whether Apt was connected to the surface of Rh6G-MSN@AuNPs.

[0087] Figure 4The ultraviolet absorption spectrum shows that in the SERS probe obtained after modification with Apt, in addition to the original plasma resonance absorption peak of gold nanoparticles at 530 nm, an obvious ultraviolet absorption peak appears at 260 nm, indicating the successful modification of the aptamer and also proving that the present invention successfully prepared a SERS probe for detecting zearalenone.

[0088] Embodiment 2:

[0089] The SERS probe prepared in Example 1 was applied to the quantitative detection of zearalenone in corn.

[0090] (1) Use the zearalenone standard to prepare 10 standard solutions with different gradient concentrations (3, 5, 10, 20, 40, 60, 80, 100, 150, 200 ng / mL). Add 50 μL of the standard solution to 500 μL of the SERS probe solution. After capturing for 2.5 hours, use a fully automatic micro-Raman spectrometer to collect and process SERS spectral data. First, use a 5× low-magnification objective lens to roughly adjust until the droplet sample is clearly focused, then switch to a 10× high-magnification objective lens, and obtain a clear microscopic image by adjusting the field of view brightness and focus.

[0091] The acquisition parameters were set as follows: the excitation wavelength was 638 nm; the grating was 600 nm; the attenuation power was 100%; and the integration time was 1 s. The spectra of the sample droplets of all standards were collected separately, and at least 25 spectra were collected for each standard sample.

[0092] (2) Data processing and analysis: Reliable quantitative and qualitative analysis of the original SERS spectra can effectively improve the accuracy of the detection method. The original spectra were preprocessed by chemometric methods using LabSpec6 software to eliminate background drift caused by fluorescence absorption; the spectrum was smoothed by the smoothing function to improve the spectral quality; the smoothing algorithm selected Polynomial polynomial, and the parameters were set to Max points = 256, Degree = 5, Size = 3.

[0093] Figure 7 A shows the Raman spectra collected from the standard samples of zearalenone (3, 5, 10, 20, 40, 60, 80, 100, 150, and 200 ng / mL) measured using the SERS probe. During the detection process, it was found that as the solubility of zearalenone increased, the intensity of the Raman characteristic peak of the signal molecule increased steadily.

[0094] In order to evaluate the detection effect of the SERS probe for quantitative analysis, the signal molecule Rh6G at 1508 cm -1 The functional relationship between the Raman peak intensity at and the concentration of zearalenone is shown in the figure below. Figure 7 As shown in B, the 1508 cm -1 The Raman peak intensity was linearly fitted, and the fitting results showed that the SERS probe had a good linear relationship for the detection of different concentrations of zearalenone. The linear range of the quantitative determination of zearalenone in the present invention was 3-200 ng / mL, and the detection limit of zearalenone was calculated to be 2.8464 ng / mL.

[0095] In order to verify the practical operability of this method in zearalenone-positive samples, the zearalenone content of zearalenone-positive samples was detected using the SERS detection method in this example.

[0096] The specific method is as follows: accurately weigh 5 g of contaminated corn sample, add 10 mL of acetonitrile and water (volume ratio of 9:1) extract, add 0.4 g of sodium chloride and vortex extract for 10 min, centrifuge at 6000 rpm for 10 min, filter twice with quantitative filter paper and make the filtrate up to 10 mL with ultrapure water, take 50 μL of filtrate and mix with 500 μL of SERS probe, collect Raman spectrum after capture, and set the acquisition parameters and data processing and analysis methods with the data processing method established by the standard curve. According to the intensity of the acquired spectrum, the established standard curve is called to measure the concentration of zearalenone in the test sample.

[0097] The content of zearalenone in the sample can also be further calculated according to the measured concentration. In the present invention, it is calculated in the following manner:

[0098] The actual zearalenone content in the positive corn sample was calculated according to formula (1):

[0099] X = (1)

[0100] X The content of zearalenone in the sample, in micrograms per kilogram (μg / kg)

[0101] ρ The concentration of zearalenone in the test sample is in nanograms per milliliter (ng / mL)

[0102] V is the final volume of the test sample solution, in milliliters (mL)

[0103] m is the weight of the sample, in grams (g)

[0104] (4) The detection value and recovery rate determined by the method of the present invention are compared with those by liquid chromatography as shown in Table 2. The results show that there is no significant difference between the method of the present invention and the traditional HPLC method (P > 0.05), and the stability is good, with RSD (n = 5) ranging from 1.19% to 2.69%. The quality and safety of grains can be determined by simple preparation and detection of spectral peak intensity, and rapid and intelligent detection of zearalenone in zearalenone can be achieved.

[0105] Table 2. Comparison between the method of the present invention and liquid chromatography detection

[0106]

[0107] Embodiment 3:

[0108] The SERS probe of the present invention detects zearalenone in corn oil:

[0109] This example uses the addition of a standard substance to corn oil that does not contain zearalenone toxin to verify the practical applicability of the detection method. The specific method is:

[0110] 1 μg / mL zearalenone alcohol solution was added to 5 g corn oil to prepare spiked samples with zearalenone content of (4, 9, 17, 25, 47, 55, 83 μg / kg), and 10 mL of acetonitrile and water (volume ratio 9:1) was added to extract. After vortex extraction with 0.4 g of sodium chloride for 30 min, the oil phase was discarded and filtered twice with quantitative filter paper, and the filtrate was made up to 10 mL with ultrapure water.

[0111] Take 50 μL of filtrate and mix it with 500 μL of SERS probe, capture it, collect Raman spectra, call the standard curve, and measure the content of zearalenone in the actual corn sample. The acquisition parameter setting and data processing and analysis method are the same as the data processing method established by the standard curve. According to the intensity of the acquired spectrum, call the standard curve and measure the concentration of zearalenone in the test sample.

[0112] The zearalenone content in the spiked corn oil sample can also be calculated according to formula (1). The detection value and recovery rate determined by the method of the present invention are shown in Table 3, and the recovery rate is between 91.13% and 103.45%.

[0113] Table 3. Test results of spiked samples by the method of the present invention

[0114]

[0115] Embodiment 4:

[0116] This example uses corn samples to perform spiked tests for different types of toxins to verify the specificity of the detection method.

[0117] 5 g corn sample was prepared into 100 μg / kg spiked corn samples of aflatoxin, ochratoxin, spore phenol, patulin and a mixture of five mycotoxins using 1 μg / mL standard solutions of aflatoxin, ochratoxin, spore phenol, patulin and zearalenone toxins, respectively.

[0118] 10 mL of acetonitrile and water (volume ratio of 9:1) were added respectively, and 0.4 g of sodium chloride was vortexed for 10 min. After centrifugation at 6000 rpm for 10 min, it was filtered twice with quantitative filter paper and the filtrate was made up to 10 mL with ultrapure water. 50 μL of the filtrate was mixed with 500 μL of SERS probe and captured to collect Raman spectra.

[0119] In the presence of other mycotoxins (aflatoxins, ochratoxins, spore phenol, patulin), the SERS probe was detected at 1508 cm -1 The SERS signal intensity at Figure 8 It can be found that only when zearalenone is present in the sample to be tested, the 1508 cm -1 The Raman intensity at the position will recover to a strong Raman value after signal masking. Therefore, it can be proved that the synthesized SERS probe has good specificity for zearalenone.

[0120] In summary, the SERS probe designed by the present invention, which is a mesoporous silica sphere composite gold nanoparticle combined with an aptamer, is a green and environmentally friendly SERS probe with good stability and environmental friendliness, and can quickly detect the content of zearalenone in corn. The peak at the characteristic Raman shift of rhodamine 6G is correlated with the content of zearalenone through subsequent calculations, without the need for cumbersome pre-treatment steps, and only 50 μL of sample is required. It can replace traditional liquid phase and liquid phase-mass spectrometry to detect zearalenone in food, and achieve highly sensitive quantitative detection within 3 minutes.

[0121] The above embodiments are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention; therefore, although the present invention has been described in detail in this specification with reference to the above embodiments, it should be understood by those skilled in the art that the present invention may still be modified or replaced by equivalents; and all technical solutions and improvements thereof that do not depart from the spirit and scope of the present invention should be included in the scope of the claims of the present invention.

Claims

1. A method for preparing a SERS probe for detecting zearalenone, characterized in that: The steps include: S1. Preparation of surface enhanced Raman material mesoporous silica sphere composite gold nanoparticles (Rh6G-MSN@AuNPs): The aqueous solution of rhodamine 6G is added to the aqueous solution of mesoporous silica spheres MSN, and stirred for adsorption at room temperature; centrifugation and vacuum drying are performed to obtain Rh6G-MSN adsorbed with signal molecules; The HAuCl4 solution was added to the obtained Rh6G-MSN aqueous solution, and after being stirred evenly, a trisodium citrate aqueous solution and a sodium borohydride aqueous solution were quickly added, and the gold seeds were synthesized by stirring. The precipitate after centrifugation was dispersed in water to obtain a seed solution; The seed solution and the HAuCl4 solution were mixed and heated to 80°C under stirring, and a trisodium citrate aqueous solution was added. Under the reaction conditions, the mixed solution turned blue-purple, and the stirring was continued until the color of the solution no longer changed. After centrifugation to remove the supernatant, the solution was dispersed in water to obtain a Rh6G-MSN@AuNPs solution. S2. Preparation of SERS probe: At room temperature, Apt solution was added to the Rh6G-MSN@AuNPs solution, and the reaction was incubated to allow the aptamer to connect to AuNPs. After the reaction, the unbound Apt was removed by centrifugation, and the product was dispersed in a PBS solution to obtain a SERS probe.

2. The method according to claim 1, characterized in that In step S1, During the preparation of the seed solution, the volume ratio of the Rh6G-MSN aqueous solution to the HAuCl4 solution was 1:5, and the concentration of the Rh6G-MSN aqueous solution was 9×10 -4 g / mL, the concentration of the HAuCl4 solution is 5×10 -4 M; the volume ratio of the trisodium citrate aqueous solution to the sodium borohydride aqueous solution is 0.1:1, the concentration of the trisodium citrate aqueous solution is 5%wt, and the concentration of the sodium borohydride aqueous solution is 0.01M.

3. The method according to claim 1, characterized in that In step S1, During the growth of gold seeds, the amount of the seed solution and the HAuCl4 aqueous solution is 0.4mL:3.6mL, wherein the concentration of the HAuCl4 aqueous solution is 0.27mM; the molar ratio of the trisodium citrate aqueous solution and HAuCl4 is 2-10:1, and the concentration of the trisodium citrate aqueous solution is 0.1M.

4. The method according to claim 3, characterized in that The molar ratio of the trisodium citrate aqueous solution to HAuCl4 is 4:

1.

5. The method according to claim 1, characterized in that In step S2, The dosage of the Rh6G-MSN@AuNPs solution and the Apt solution is 500 μL: 60-100 μL, the concentration of the Apt solution is 1.3 μM, and the incubation time is 1-9 h.

6. The method according to claim 5, characterized in that The dosage of the Rh6G-MSN@AuNPs solution and the Apt solution is 500 μL:60 μL, and the incubation time is 1 hour.

7. The method according to claim 1, characterized in that In step S2, The Apt sequence is: SH-5′-AGCAGCACAGAGGTCAGATGTCATTCTATGGTACATTACTATCTCTGTAATGTGATATGCCTATGCGT GCTACCGTGAA-3′, with thiol group modified at the 5′ end.

8. A SERS probe for detecting zearalenone prepared by the method according to any one of claims 1 to 7.

9. A method for detecting zearalenone, the method being carried out based on the SERS probe prepared by the method according to any one of claims 1 to 7, comprising the following steps: S1, mixing the SERS probe with the zearalenone standard solution, capturing the reaction, and collecting the Raman spectrum; S2. Establish a standard curve based on the relationship between different concentrations of zearalenone standard solution and the characteristic Raman peak of the SERS probe; S3. Detecting the content of zearalenone in the sample to be tested: mixing the sample to be tested with the SERS probe, collecting Raman spectra according to the method of step S1, and calculating the concentration of zearalenone in the sample to be tested according to the standard curve of step S2.

10. The method according to claim 9, characterized in that The volume ratio of the SERS probe to the zearalenone standard solution is 10:1, and the concentration of the zearalenone standard solution is 3-200 ng / mL; The capture reaction time is 1-3h.

11. The method according to claim 10, characterized in that The capture reaction time is 2.5 h.

12. The method according to claim 9, characterized in that The content of zearalenone in the sample is calculated according to the measured zearalenone concentration in the following manner: X: The content of zearalenone in the sample, in micrograms per kilogram (μg / kg) ρ: The concentration of zearalenone in the test sample, in nanograms per milliliter (ng / mL) V: The volume of the sample solution to be tested, in milliliters (mL) m: The weight of the sample, in grams (g).

13. Use of the SERS probe prepared by the method of any one of claims 1 to 7 or the SERS probe of claim 8 or the method of any one of claims 9 to 12 in detecting zearalenone in grains or foods.

Images