Channa maculata female molecular marker primer and its application, method for identifying the sex of Channa maculata

Abstract

The present invention belongs to the technical field of sex identification of Channa maculata, and specifically relates to female molecular marker primers of Channa maculata, applications thereof, and a method for identifying the sex of Channa maculata. The female molecular marker primers provided by the present invention include primer pair BLX1 and / or primer pair BLX2. The primer pair provided by the present invention can specifically identify the sex of Channa maculata, and can be used in combination with male molecular markers to quickly and accurately identify super male fish YY type and normal male and female fish XX type or XY type of Channa maculata, thereby improving the all-male or all-female breeding efficiency of Channa maculata.

Description

Technical Field

[0001] The invention belongs to the technical field of Channa maculata sex identification, and in particular relates to a female Channa maculata molecular marker primer and application thereof, and a method for identifying the sex of Channa maculata. Background Art

[0002] Channa maculata belongs to the family Channidae and the genus Channa. It is a freshwater bottom fish that mostly inhabits shallow water areas with coastal aquatic plants and silt bottoms. Channa maculata is a typical carnivorous fish. Juveniles mainly feed on copepods, some fish fry and aquatic insect larvae, while adults feed on various small fish, including carp and dace. They can be fed with compound feeds in artificial breeding and high-density breeding in earth ponds or cement pools. Channa maculata has white and tender meat, delicious meat, refreshing meat, rich nutrition and high economic value.

[0003] Studies have shown that both Channa argus and Channa maculata belong to the XY sex determination type. To produce all-male Channa maculata or all-male Channa maculata hybrid commercial seedlings on a large scale, it is necessary to construct a Channa maculata YY breeding line and produce a large number of YY males. To construct a Channa maculata YY breeding line, two key steps need to be solved. The first step is to screen out XY physiological females from XX physiological females in the feminized induced offspring, and the second step is to screen out YY males from XX females and XY males in the offspring of XY physiological females and XY males. Although the male Y molecular marker has been successfully developed before, it can solve the problem faced in the first step and screen out XY physiological female individuals. However, in the second step, the Y marker cannot distinguish between normal XY males and YY super males, and the traditional test cross method is time-consuming and laborious, which is not suitable for large-scale screening of YY super males. It is necessary to develop a stable and reliable female X molecular marker for screening, so as to screen out the YY super males. So far, although there have been reports of molecular markers that can successfully identify the genetic sex of Channa maculata at home and abroad, they are mainly single nucleotide polymorphism markers, which are difficult to use in practice. Therefore, developing a simple and accurate molecular marker that can identify the genetic sex of Channa maculata with X chromosome genes has great production application value in all-male breeding of Channa maculata. Summary of the invention

[0004] The invention aims to provide female molecular marker primers of Channa maculata and applications thereof, and a method for identifying the sex of Channa maculata, so as to identify the sex of Channa maculata at the molecular level, screen out super male fish of Channa maculata YY breeding system, improve the accuracy of detection results, and improve the all-male breeding efficiency of Channa maculata.

[0005] The present invention provides a female Channa maculata molecular marker primer, comprising a primer pair BLX1 and / or a primer pair BLX2;

[0006] The primer pair BLX1 includes an upstream primer Contig-1-F having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer Contig-1-R having a nucleotide sequence as shown in SEQ ID NO.2;

[0007] The primer pair BLX2 includes an upstream primer Contig-2-F having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer Contig-2-R having a nucleotide sequence as shown in SEQ ID NO.4.

[0008] The present invention also provides the application of the primers in all-male or all-female breeding of Channa maculata.

[0009] The invention also provides application of the primers in sex identification of Channa maculata.

[0010] The present invention also provides a method for sex identification of Channa maculata, comprising the following steps:

[0011] Using the above primers to perform PCR amplification on the genomic DNA of the Channa maculata to be tested, and detecting the PCR amplification product;

[0012] When the DNA fragment can be amplified, the detected Channa macrochirus is female XX type or normal male XY type;

[0013] When the DNA fragment cannot be amplified, the detected Channa macrochirus is the super male fish YY type.

[0014] Preferably, the PCR amplification reaction system, in 20 μL, includes: 20-50 ng of genomic DNA of Channa maculata, 0.8 μL of 10 μM upstream primer and downstream primer, 10 μL of 2×Taq Plus MasterMix II and the balance of ddH2O.

[0015] Preferably, the PCR amplification program is: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 35 cycles; final extension at 72°C for 5 min.

[0016] Preferably, the PCR amplification product is detected by using 1% by mass agarose gel electrophoresis.

[0017] Preferably, when the primer pair BLX1 is used to detect PCR amplification, the length of the amplified fragment is 243 bp; when the primer pair BLX2 is used to detect PCR amplification, the length of the amplified fragment is 628 bp.

[0018] Preferably, the genomic DNA of the Channa maculata to be tested is extracted by column centrifugation.

[0019] The present invention provides female molecular marker primers for Channa maculata, including primer pair BLX1 and / or primer pair BLX2. The present invention designs 12 pairs of primers based on high-throughput genome sequencing data of male and female Channa maculata, and finally screens out 2 female molecular marker primer pairs BLX1 and primer pair BLX2 for specific identification of Channa maculata sex, which can quickly and accurately identify super male fish YY type and normal male and female fish XX type or XY type of Channa maculata.

[0020] The present invention utilizes any pair of primers among the female molecular marker primers of Channa maculata, and only needs to complete a simple PCR amplification reaction and agarose gel electrophoresis to identify the super male fish YY type and the normal male and female fish XX type or XY type of Channa maculata, which is time-saving, efficient, resource-saving, and effectively improves the all-male or all-female breeding efficiency of Channa maculata. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0022] Figure 1 Schematic diagram of the distribution of the length of the specific fragment of chromosome X in Example 1;

[0023] Figure 2-1 and Figure 2-2 The electrophoresis diagram of PCR products of 12 primer pairs in Example 1 in which amplified fragments were detected in the XX and XY samples of normal male and female individuals, but the corresponding amplified fragments were not detected in the YY sample of super male individuals;

[0024] Figure 3 Electrophoresis diagram of PCR products detected by primer pair BLX1 in Example 2 for female individuals of type XX, male individuals of type XY, and super male fish of type YY (48 fish in total, 16 fish of each type on average);

[0025] Figure 4 Electrophoresis diagram of PCR products detected by primer pair BLX2 in Example 2 for female individuals of XX type, male individuals of XY type and super male fish of YY type (48 fish in total, 16 fish of each type on average). DETAILED DESCRIPTION

[0026] The present invention provides a female Channa maculata molecular marker primer, comprising a primer pair BLX1 and / or a primer pair BLX2;

[0027] The primer pair BLX1 includes an upstream primer Contig-1-F having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer Contig-1-R having a nucleotide sequence as shown in SEQ ID NO.2;

[0028] The primer pair BLX2 includes an upstream primer Contig-2-F having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer Contig-2-R having a nucleotide sequence as shown in SEQ ID NO.4.

[0029] The base sequences of the primers of the present invention are as follows from 5' to 3':

[0030] Contig-1-F: GCCAAACAGTGTAATAGGTTAG;

[0031] Contig-1-R:TATGGTTCTCTCTGACATTGG;

[0032] Contig-2-F:AAGGATAAAACAATGGGTACAC;

[0033] Contig-2-R: TTGTGCTGACATTGCCTCAG.

[0034] The primers of the present invention can amplify the X gene of Channa maculata, wherein the size of the amplified fragment of primer Contig-1 is 243bp; the size of the amplified fragment of primer Contig-2 is 628bp. The primer pair of the present invention can specifically amplify a single, bright, and expected-size amplified band for the sex of Channa maculata when it is a normal male and female fish XX type or XY type, and the agarose gel electrophoresis result is positive. When it cannot specifically amplify a single, bright, and expected-size amplified band, the detected Channa maculata is a super male fish YY type. The primers of the present invention are synthesized by Invitrogen (Shanghai) Trading Co., Ltd.

[0035] The method for screening and searching for molecular markers of female Channa maculata described in the present invention preferably comprises utilizing methods such as genome assembly, alignment and in-depth analysis, using Primer5 software (the software usage refers to Primer PREMIER Version 5.0 for Windows and Power Macintosh) to design 12 pairs of PCR primers, and analyzing the detection effect of each pair of primers. It is finally found that among the multiple pairs of primers designed, only the above two primer pairs can achieve the purpose of distinguishing the super male fish YY type and the normal female XX type or the normal male XY type of Channa maculata at the molecular level.

[0036] The present invention also provides the application of the primer pair in all-male breeding of Channa maculata and / or sex identification of Channa maculata.

[0037] The present invention also provides a method for identifying sex of Channa maculata, comprising the following steps:

[0038] The above primers are used to perform PCR amplification on the genomic DNA of the Channa maculata to be tested, and the PCR amplification product is detected;

[0039] When the DNA fragment can be amplified, the detected Channa macrochirus is female XX type or normal male XY type;

[0040] When the DNA fragment cannot be amplified, the detected Channa macrochirus is the super male fish YY type.

[0041] The present invention does not specifically limit the method for extracting the genomic DNA. In the embodiment, the column centrifugation method is preferably used to extract the genomic DNA of the Channa maculata to be tested, but it cannot be identified as the entire protection scope of the present invention. The present invention has no strict requirements on the specific operation process of the column centrifugation method, and the extraction can be performed using steps or reagents well known in the art, such as using the marine animal tissue genome extraction kit of Tiangen Biochemical Technology Co., Ltd. and preparing DNA samples according to the operating steps in the instruction manual.

[0042] After obtaining the genomic DNA of Channa maculata, the present invention uses the above primers to perform PCR amplification on the genomic DNA of Channa maculata. The reaction system of PCR amplification described in the present invention preferably includes: 50ng of genomic DNA of Channa maculata, 0.8μL of 10μM upstream primer and downstream primer, 10μL of 2×Taq Plus MasterMix II and the balance of ddH2O. The procedure of PCR amplification described in the present invention is preferably: pre-denaturation at 94℃ for 2min; denaturation at 94℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 2min, 35 cycles; final extension at 72℃ for 5min. In the reaction system of PCR amplification described in the present invention, one of the primer pair BLX1 and the primer pair BLX2 is preferably used.

[0043] After obtaining the PCR amplification product, the present invention preferably uses agarose gel electrophoresis with a mass percentage of 1% to detect the PCR amplification product. The present invention does not strictly require the operating steps of agarose gel electrophoresis, and conventional operations are sufficient. The present invention distinguishes the super male fish YY type and the normal male and female fish XX type or XY type according to the detection results. When the primer pair BLX1 is used for PCR amplification, the agarose gel electrophoresis detection result shows that there is a single, bright amplification band at 243bp, and the spot Channa is a normal male and female fish XX type or XY type, and if there is no band, it is a super male fish YY type of Channa; when the primer pair BLX2 is used for PCR amplification, the agarose gel electrophoresis detection result shows that there is a single, bright amplification band at 628bp, the spot Channa is a normal male and female fish XX type or XY type, and if there is no band, it is a super male fish YY type of Channa.

[0044] The identification method provided by the present invention is time-saving and only requires a simple PCR amplification reaction and agarose gel electrophoresis detection to identify the super male fish YY type and the normal female and male fish XX type or XY type of Channa maculatus. The identification result is accurate, resources are saved, and the all-male or all-female breeding efficiency of Channa maculatus is effectively improved.

[0045] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0046] Example 1

[0047] (I) Sequencing library construction and resequencing

[0048] 1. Preparation of DNA samples of Channa maculata:

[0049] During the breeding period, the tail fins of 31 female (marked as F1-F31) and 3 male (marked as M1-M3) Channa maculata were clipped, and DNA samples were prepared by conventional column centrifugation method (Marine Animal Tissue Genome Extraction Kit, Tiangen Biochemical Technology Co., Ltd.) according to the instructions. The quality and concentration were detected by 1% agarose gel electrophoresis and a micro spectrophotometer (NanoDrop2000) to meet the requirements of high-throughput sequencing.

[0050] 2. Sequencing library construction and high-throughput sequencing:

[0051] DNA samples of female fish F1-F3 and male fish M1-M3 were taken to construct 350-500bp fragment sequencing libraries, respectively. Pair-End PE150 sequencing was performed using the Illumina Hiseq X Ten platform to obtain female and male genome sequencing clean data: 60,506,228,100bp and 65,442,598,200bp, respectively.

[0052] From the remaining 28 female fish (F4-F31) DNA samples, equal amounts of DNA were taken and mixed into a female fish DNA mixed pool to construct a 350-500 bp fragment sequencing library. PE150 double-end sequencing was performed using the Illumina Hiseq X Ten platform to obtain the clean data of the female fish DNA mixed pool sequencing: 30,925,893,000 bp.

[0053] The library construction steps were specifically referred to the Novogene NGS DNA Library Prep Kit instructions, and sequencing was completed by Beijing Novogene Technology Co., Ltd.

[0054] (II) Enrichment of X chromosome-specific DNA fragments

[0055] 1. Including female fish genome assembly:

[0056] The genome of female fish F3 sequencing reads was assembled using the all method in SOAPdenovo v2.04-r240 (https: / / github.com / aquaskyline / SOAPdenovo2), and a total of 541,932 scaffolds of female fish were obtained, with a total size of 667,573,559 bp, of which N50 = 57,259 bp.

[0057] 2. Obtaining candidate DNA fragments of female fish:

[0058] The sequencing reads of female fish F1-F3 and male fish M1-M3 were aligned to the female fish genome using the aln method of bwa ​​v0.7.17-r1188 (http: / / bio-bwa.sourceforge.net / ) software, and the reads that could not be aligned with the paired ends of the female fish sequencing reads were filtered out. The regions that the sequencing reads of female fish could be aligned but the sequencing reads of male fish could not be aligned were selected. These regions are the female fish-specific DNA fragments, as shown in Table 1.

[0059] Table 1 Information table of candidate fragments specific to female fish

[0060] Female specific sequence Number of sequences Full length (nt) Maximum length (nt) Minimum length (nt) Average length (nt) female 20 16715 3549 301 796

[0061] 3. Enrichment of female-specific DNA fragments:

[0062] Using the female genome as reference and the male fish DNA pool sequencing reads as query, the aln method of bwav0.7.17-r1188 (http: / / bio-bwa.sourceforge.net / ) software was used for sequence alignment to find the female fish-specific DNA fragments that were not covered by any reads. There were 23 DNA fragments with a length of ≥300bp that could not be matched by any reads from the male fish DNA pool. The lengths of these female fish DNA fragments were mainly distributed in the range of 300-1000bp, accounting for 74.21% of the total. These 23 contigs contain specific DNA fragments from the X chromosome. The length distribution of the 23 DNA fragments detected is shown in the figure below. Figure 1 As shown by Figure 1 It can be seen that 12 DNA fragments are between 300 and 500 bp in length, 6 DNA fragments are between 501 and 1000 bp in length, 3 DNA fragments are between 1001 and 1500 bp in length, 1 DNA fragment is between 1501 and 2500 bp in length, and 1 DNA fragment is between 2501 and 3500 bp in length.

[0063] (III) Screening of X chromosome molecular markers

[0064] 1. Primer design and synthesis:

[0065] Based on the above high-throughput sequencing data, 12 pairs of PCR primers were designed using Primer5 software (software usage refers to Primer PREMIER Version 5.0 for Windows and Power Macintosh). The primers were numbered according to Contig-xxF / R (xx represents the Contig number). For example, the primer number of Contig-1 is Contig-1F / R (F represents the upstream primer, R represents the downstream primer, the same below). The specific sequences are shown in Table 2 below and were synthesized by Invitrogen (Shanghai) Trading Co., Ltd.

[0066] Table 2 Detection primer pairs

[0067]

[0068]

[0069] 2. Screening and confirmation of X chromosome molecular markers:

[0070] Select 12 pairs of primers in Table 2 to perform PCR detection on 4 individuals of normal female fish XX type, normal male fish XY type and super male fish YY type.

[0071] The total PCR amplification reaction system was 20 μL, including 10 μL of 2×Taq Plus MasterMix II (Nanjing Novozyme Biotechnology Co., Ltd.), 0.8 μL of upstream and downstream primers (10 μmol / L), and 50 ng of template DNA.

[0072] The PCR reaction program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 35 cycles; and final extension at 72°C for 5 min.

[0073] Agarose gel electrophoresis results Figure 2-1 and Figure 2-2 , where BLX1 to 10 represent the primer pairs numbered 1 to 12 in Table 2, respectively; numbers 1 to 4 are repeated, 5 to 8 are repeated, and 9 to 12 are repeated. Figure 2-1 and Figure 2-2It can be seen that PCR amplification was performed in 4 normal female XX type, 4 normal male XY type and 4 super male YY type individuals using 12 pairs of primers. Finally, only 2 pairs of primers (i.e., BLX1 and BLX2) had specific amplification bands in normal female XX type and normal male XY type individuals, and no specific amplification fragments were detected in super male YY type individuals, indicating that the two Contigs, i.e., Contig-1 and Contig-2, are X chromosome specific fragments and are female molecular markers of Channa maculata.

[0074] Example 2

[0075] The method for identifying the YY type of super male Channa maculata individuals using the primer pair Contig-1-F / R or the primer pair Contig-2-F / R screened in Example 1 comprises the following steps:

[0076] (1) Preparation of DNA samples of Channa maculata:

[0077] Sexually mature Channa maculata were obtained from Sanshui Baijin Aquatic Seed Co., Ltd. in Foshan City, Guangdong Province. Sixteen normal female XX-type, normal male XY-type Channa maculata and super male YY-type Channa maculata confirmed by test cross were obtained by dissection. The tail fins of each were cut off, and DNA samples were prepared by conventional column centrifugation method (Marine Animal Tissue Genome Extraction Kit, Tiangen Biochemical Technology Co., Ltd.) according to the operating procedures in the instruction manual.

[0078] (2) PCR amplification verification:

[0079] The primer pairs Contig-1-F / R and Contig-2-F / R were used to perform PCR verification on 16 DNA samples of normal female XX type, normal male XY type and super male fish YY type mentioned above.

[0080] The total PCR amplification reaction system was 20 μL, including 10 μL of Kangwei Century 2×Taq Plus MasterMix II (Nanjing Novogene Biotechnology Co., Ltd.), 0.8 μL of upstream and downstream primers (10 μmol / L), and 50 ng of template DNA.

[0081] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 2 min; then denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 2 min, for a total of 35 cycles; and then final extension at 72°C for 5 min.

[0082] After the PCR reaction was completed, the product was subjected to 1% agarose gel electrophoresis. Figure 3 and Figure 4 As shown, Figure 3 To use the detection results of primer pair Contig-1-F / R, Figure 4This is the detection result using primer pair Contig-2-F / R.

[0083] according to Figure 3 and Figure 4 It can be seen that the primer pair Contig-1-F / R or the primer pair Contig-2-F / R can amplify bands in 16 normal female XX-type and 16 normal male XY-type DNA samples, and the molecular size of the female-specific band amplified by the primer Contig-1F / R is 243bp; the molecular size of the male-specific band amplified by the primer Contig-2F / R is 628bp. The primer pair Contig-1-F / R or the primer pair Contig-2-F / R cannot amplify female-specific bands in 16 super male fish YY-type DNA samples. The molecular marker primer pair Contig-1-F / R and Contig-2-F / R of the present invention can be used to identify super male Channa maculata YY-type individuals.

[0084] Example 3

[0085] Using the primer pair Contig-1-F / R or the primer pair Contig-2-F / R screened in Example 1 to carry out all-male breeding of Channa maculata comprises the following steps:

[0086] XY pseudo-female fish were cultured until sexual maturity, and mated with normal XY male fish during the breeding season. The offspring obtained included normal female fish XX type, normal male fish XY type and super male fish YY type. Feeding was continued for two months, with natural light used during the culture period, the water temperature was kept at 26-28℃, and the fish were fed with full food.

[0087] The method in Example 2 was used to screen the offspring of the pseudo-female fish Channa maculata to obtain fish with genotype YY, i.e., super male fish. The specific process is described in Example 2.

[0088] (3) After the obtained YY super male fish is cultured to sexual maturity, it is mated with XX female fish to obtain all-male fish offspring.

[0089] The primer pair Contig-1-F / R and Contig-2-F / R provided by the present invention can respectively specifically identify the sex of Channa maculata, and can quickly and accurately identify the super male fish YY type and the normal male and female fish XX type or XY type of Channa maculata, thereby effectively improving the all-male or all-female breeding efficiency of Channa maculata.

[0090] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention. Sequence Listing <110> Guangdong Liangshi Aquatic Seed Co., Ltd. <120> Channa maculata female molecular marker primer and its application, method for identifying the sex of Channa maculata <160> twenty four <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> DNA <213> Artificial Sequence <400> 1 gccaaacagt gtaataggtt ag 22 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 tatggtctct tctgacattg g 21 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <400> 3 aaggataaaa caatgggtac ac 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 ttgtgctgac attgcctcag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 atccgcgtat cgatctagct 20 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 ctgactagtc agtctaggct c 21 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 attggatagc tagtatcatg a 21 <210> 8 <211> twenty two <212> DNA <213> Artificial Sequence <400> 8 atctagctat gatcgatggc at 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 atgatcgtag ctagtcgtat 20 <210> 10 <211> twenty two <212> DNA <213> Artificial Sequence <400> 10 tcgatgcatg catcgtagct cc 22 <210> 11 <211> twenty three <212> DNA <213> Artificial Sequence <400> 11 cgtgtagtcg ataatgctat cgt 23 <210> 12 <211> twenty four <212> DNA <213> Artificial Sequence <400> 12 atgatgctag tcgattctag ctcg 24 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence <400> 13 atcgtagtcg ttgatcgtta ta 22 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <400> 14 gtgtagtcgt agcgtaatgc gtatt 25 <210> 15 <211> twenty four <212> DNA <213> Artificial Sequence <400> 15 ctgatgtgcg attcgtagtc gtag 24 <210> 16 <211> twenty two <212> DNA <213> Artificial Sequence <400> 16 ctgtgattcc aagtcgtgtg ca 22 <210> 17 <211> twenty one <212> DNA <213> Artificial Sequence <400> 17 atgtaatgcg tagtcaattg a 21 <210> 18 <211> twenty two <212> DNA <213> Artificial Sequence <400> 18 ctgtatgtca gtgaccagtg ac 22 <210> 19 <211> twenty three <212> DNA <213> Artificial Sequence <400> 19 atgtaggata ctagtcgatg cgt 23 <210> 20 <211> twenty three <212> DNA <213> Artificial Sequence <400> 20 gtgatctagt ctgctgccaa ccg 23 <210> twenty one <211> twenty four <212> DNA <213> Artificial Sequence <400> twenty one ctgtatcgta gctgctgact gatg 24 <210> twenty two <211> twenty four <212> DNA <213> Artificial Sequence <400> twenty two atgtatcgtg acggtagctg aatc 24 <210> twenty three <211> twenty four <212> DNA <213> Artificial Sequence <400> twenty three ctgtagtcgt agccttgccg tatg 24 <210> twenty four <211> twenty four <212> DNA <213> Artificial Sequence <400> twenty four tgtgatctag tcggcttagt cgtc 24

Claims

1. A molecular marker primer for female Channa maculata, characterized in that: including primer pair BLX1 and primer pair BLX2; The primer pair BLX1 includes an upstream primer Contig-1-F having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer Contig-1-R having a nucleotide sequence as shown in SEQ ID NO.2; The primer pair BLX2 includes an upstream primer Contig-2-F having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer Contig-2-R having a nucleotide sequence as shown in SEQ ID NO.

4.

2. Use of the primers according to claim 1 in all-male or all-female breeding of Channa maculata.

3. Use of the primers described in claim 1 in sex identification of Channa maculata.

4. A method for identifying sex of Channa maculata, characterized in that: The steps include: Using the primers described in claim 1 to perform PCR amplification on the genomic DNA of the Channa maculata to be tested, and detecting the PCR amplification product; When the DNA fragment can be amplified, the detected Channa macrochirus is a female XX type or a normal male XY type; When the DNA fragment cannot be amplified, the detected Channa macrochirus is the super male fish YY type.

5. The method according to claim 4, characterized in that The PCR amplification reaction system, in 20 μL, includes: 20-50 ng of genomic DNA of Channa maculata, 0.8 μL of 10 μM upstream primer and downstream primer respectively, 10 μL of 2×TaqPlus MasterMixII and the balance of ddH2O.

6. The method according to claim 4 or 5, characterized in that: The PCR amplification procedure was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 35 cycles; and final extension at 72°C for 5 min.

7. The method according to claim 4, characterized in that The PCR amplification product was detected by 1% agarose gel electrophoresis.

8. The method according to claim 7, characterized in that When the primer pair BLX1 is used to detect PCR amplification, the length of the amplified fragment is 243 bp; when the primer pair BLX2 is used to detect PCR amplification, the length of the amplified fragment is 628 bp.

9. The method according to claim 4, characterized in that The genomic DNA of the Channa maculata to be tested is extracted by column centrifugation.

Images