Detection of gastric cancer molecular markers and their applications in plasma tRF levels
By using the tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 detection kits for fluorescence quantitative PCR detection of tRF molecular markers in plasma, the traumatic and hyposensitivity problems of existing gastric cancer diagnosis methods were solved, and efficient and accurate diagnosis of early gastric cancer was achieved.
Patent Information
- Application Number
- CN202210400599.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-16
- Publication Date
- 2025-08-15
- Estimated Expiration
- 2042-04-16
AI Technical Summary
Existing methods for diagnosis of gastric cancer, such as endoscopic tissue extraction, are highly invasive, and traditional tumor markers such as CEA, CA125 and CA19-9 are not sensitive and specific, making it difficult to achieve efficient diagnosis of early gastric cancer.
Using a detection kit containing tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5, tRF molecular markers in plasma were detected by fluorescence quantitative PCR to achieve absolute quantitative analysis and be used for early auxiliary diagnosis of gastric cancer.
It has achieved rapid and accurate screening and identification of early gastric cancer, with high sensitivity and high accuracy, and only a small number of samples are required, which can effectively improve the early diagnosis efficiency of gastric cancer.
Smart Images

Figure CN114875145B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for detecting transfer RNA-derived fragments in plasma, and in particular to a method for detecting tRF gastric cancer molecular markers in plasma and an application thereof. Background Art
[0002] According to epidemiological statistics reported by the World Health Organization in 2021, there were over 1 million new cases of gastric cancer worldwide in 2020, with over 760,000 deaths from the disease, making gastric cancer the fifth most common malignant tumor globally. In my country, an epidemiological survey released in 2020 showed that in 2015, gastric cancer was the leading cause of cancer-related death, second only to lung cancer and liver cancer.
[0003] Early diagnosis and treatment are crucial for improving the high mortality rate of gastric cancer. The current gold standard for gastric cancer diagnosis is endoscopic tissue sampling for pathological examination, but its invasive nature limits its widespread use. Traditional tumor markers, such as carcinoembryonic antigen (CEA), carbohydrate antigen 125 (CA125), and carbohydrate antigen 19-9 (CA19-9), have low sensitivity and specificity. Therefore, the development of novel gastric cancer-related markers is of great clinical significance for improving the efficiency of early diagnosis of gastric cancer.
[0004] In recent years, with the development of high-throughput sequencing technology, a new type of noncoding RNA—tRNA-derived fragments (tRFs)—has been discovered. These fragments are formed by the cleavage of tRNA precursors (pre-tRNAs) or mature tRNAs by specific ribonucleases (such as Dicer or angiopoietin). tRFs have diverse biological functions, including involvement in reverse transcriptional regulation, post-reverse transcriptional regulation, translational regulation, and epigenetic regulation. Furthermore, they are involved in the development and progression of various cancers. Therefore, they hold great potential as diagnostic biomarkers for gastric cancer. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a detection kit for auxiliary diagnosis of gastric cancer in response to the above-mentioned existing technical status.
[0006] The technical solution adopted by the present invention to solve the above technical problems is: the detection kit for auxiliary diagnosis of gastric cancer is characterized by comprising a reagent for detecting one or a combination of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in plasma samples, wherein:
[0007] The nucleotide sequence of tRF-20-V29K9UV3 is shown in SEQ ID No. 1, UAGGAUGGGGUGUGAUAGGU, and the tRF-20-V29K9UV3 is significantly upregulated in the plasma of patients with early gastric cancer; the primers are: F1: 5'-CCGTTGGTAGGATGGGGTGT-3'; R1: 5'-GGTACCTCCTCTCTTCTCTACT-3';
[0008] The nucleotide sequence of tRF-27-87R8WP9N1E5 is shown in SEQ ID No. 2, UCCCUGGUGGUCUAGUGGUUAGGAUUC, and the tRF-27-87R8WP9N1E5 is significantly upregulated in the plasma of patients with early gastric cancer; F2: 5'-GGTCTCTGGTGGTCTAGTGGT-3'; R2: 5'-GGTACCTCCTCTCTTCTCTACT-3'.
[0009] Furthermore, the kit also includes reverse transcription primer sequences of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5, wherein:
[0010] The reverse transcriptase sequence of tRF-20-V29K9UV3 is shown in SEQ ID No. 3: 5′-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCACCTAT-3′;
[0011] The reverse transcription sequence of tRF-27-87R8WP9N1E5 is shown in SEQ ID No. 4: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCGAATCC-3'.
[0012] Furthermore, the kit also includes probe primer sequences of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5, wherein:
[0013] The probe primer sequence of tRF-20-V29K9UV3 is shown in SEQ ID No. 5: 5'-FAM-TGTCCTACCCTCGTCTGCACCTAT-TAMRA-3'
[0014] The probe primer sequence of tRF-27-87R8WP9N1E5 is shown in SEQ ID No. 6: 5′-FAM-AGGATTCGCAGACGAGGGTAGGACA-TAMRA-3′.
[0015] The present invention also provides a method for detecting tRF molecular markers in plasma, characterized in that the tRF molecular markers are tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 described in claim 1, and the method comprises the following steps:
[0016] (1) Collect blood and extract total RNA from plasma;
[0017] (2) reverse transcription of total RNA into cDNA;
[0018] (3) using specific amplification primers of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 to perform fluorescence quantitative PCR detection on the cDNA solution of step (2), and after the reaction is completed, the fluorescence signal value is detected and the Y value is set;
[0019] (4) Obtain the Cq value of each sample, that is, the y value, 10 x To detect the corresponding copy number in the sample, the corresponding copy number was calculated according to the standard curve corresponding to the detected tRF, and the number was calculated according to 400×10 x / 3Calculate the copy number of each sample corresponding to 1 mL of plasma, and perform statistical analysis on the copy number of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in 1 mL of plasma from patients with early gastric cancer.
[0020] Compared with the existing technology, the advantages of the present invention are: the kit of the present invention uses tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 alone or in combination as markers for auxiliary diagnosis of early gastric cancer, and the corresponding detection target can be selected for absolute quantitative detection according to the detection purpose. Only a small amount of sample is required to quickly and accurately complete the absolute quantitative detection of target molecules and the screening and identification of early gastric cancer, with high sensitivity, high accuracy and rapid detection. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 This is a graph showing the results of next-generation sequencing of tRF in gastric cancer plasma in Example 1 of the present invention;
[0022] Figure 2 The figure is a ROC curve diagram of the combined detection of the combined detection kit for auxiliary diagnosis of gastric cancer in the present invention;
[0023] Figure 3 This is a graph showing the levels of tRF-20-V29K9UV3 in healthy human plasma and in the plasma of patients with early gastric cancer in Example 3 of the present invention;
[0024] Figure 3-1This is a ROC curve diagram of tRF-20-V29K9UV3 alone in Example 3 of the present invention;
[0025] Figure 4 This is an amplification curve of tRF-20-V29K9UV3 in gastric cancer plasma in Example 3 of the present invention;
[0026] Figure 5 This is a fluorescence quantitative standard curve of the tRF-20-V29K9UV3 plasmid standard in Example 3 of the present invention;
[0027] Figure 6 This is a graph showing the levels of tRF-27-87R8WP9N1E5 in the plasma of healthy subjects and in the plasma of patients with early gastric cancer in Example 4 of the present invention;
[0028] Figure 6-1 This is the ROC curve diagram of tRF-27-87R8WP9N1E5 alone in Example 4 of the present invention;
[0029] Figure 7 This is an amplification curve of tRF-27-87R8WP9N1E5 in gastric cancer plasma in Example 4 of the present invention;
[0030] Figure 8 This is a fluorescence quantitative standard curve of the tRF-27-87R8WP9N1E5 plasmid standard in Example 4 of the present invention. DETAILED DESCRIPTION
[0031] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments.
[0032] Example 1
[0033] Detection of the expression of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in the plasma of early gastric cancer patients and healthy subjects:
[0034] Sequencing detection: The tRF sequencing reagent of Arraystar Company of the United States was used to detect the level of tRF in gastric cancer plasma and healthy human plasma by next generation sequencing method.
[0035] Result analysis: The results are as follows Figure 1 As shown in the figure, by analyzing the plasma of gastric cancer patients and healthy subjects, molecular markers of tRNA-derived fragments with significantly upregulated expression were obtained, and the differences in tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in gastric cancer plasma and healthy subjects were 10.11 and 15.36 times, respectively. Figure 1As shown in the dashed box and Table 1, AS-tDR-000508 is named tRF-20-V29K9UV3 in the MINTbase database, and Figure 1 As shown in the solid line box and Table 1, AS-tDR-000543 was named tRF-27-87R8WP9N1E in the MINTbase database, suggesting that tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E may function as an oncogene in gastric cancer.
[0036] Table 1. Screening of differentially expressed tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in gastric cancer plasma
[0037]
[0038]
[0039] Example 2
[0040] This combined detection kit for auxiliary diagnosis of gastric cancer includes reagents for detecting tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in plasma samples, wherein:
[0041] The nucleotide sequence of tRF-20-V29K9UV3 is shown in SEQ ID No. 1. The tRF-20-V29K9UV3 is significantly upregulated in the plasma of patients with early gastric cancer. The primers are: F1: 5'-CCGTTGGTAGGATGGGGTGT-3'; R1: 5'-GGTACCTCCTCTCTTCTCTACT-3';
[0042] The reverse transcriptase sequence of tRF-20-V29K9UV3 is shown in SEQ ID No. 3: 5′-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCACCTAT-3′;
[0043] The probe primer sequence of tRF-20-V29K9UV3 is shown in SEQ ID No. 5: 5′-FAM-TGTCCTACCCTCGTCTGCACCTAT-TAMRA-3′;
[0044] The nucleotide sequence of tRF-27-87R8WP9N1E is shown in SEQ ID No. 2. The tRF-27-87R8WP9N1E5 is significantly upregulated in the plasma of patients with early gastric cancer; F2: 5'-GGTCTCTGGTGGTCTAGTGGT-3'; R2: 5'-GGTACCTCCTCTCTTCTCTACT-3';
[0045] The reverse transcriptase sequence of tRF-27-87R8WP9N1E5 is shown in SEQ ID No. 4: 5′-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCGAATCC-3′;
[0046] The probe primer sequence of tRF-27-87R8WP9N1E5 is shown in SEQ ID No. 6: 5′-FAM-AGGATTCGCAGACGAGGGTAGGACA-TAMRA-3′.
[0047] For details, please refer to the primer sequences designed for tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in Table 2 below;
[0048] Table 2 Designed tRF primer sequences
[0049]
[0050]
[0051] In this example, 40 plasma samples of early gastric cancer and healthy subjects were selected from the Affiliated Hospital of Ningbo University Medical College. Informed consent was obtained from the subjects or their families. The relevant patient information was complete and a clinical data database was established in accordance with regulations.
[0052] (1) All blood samples were collected in strict accordance with the specimen collection specifications. 5 mL of peripheral blood was drawn into an EDTA anticoagulant tube and immediately placed in a 4°C refrigerator. The tube was allowed to stand for 30 minutes and then centrifuged at 3000 rpm for 10 minutes at 4°C to remove the residual blood cell components in the plasma. The upper layer of plasma was aspirated and transferred to a centrifuge tube. The obtained plasma was divided and stored in a -80°C refrigerator.
[0053] (2) Plasma total RNA extraction: Use TRIzol LS reagent from Invitrogen, USA. Pipette 250 μL plasma sample into a new nuclease-free 1.5 mL centrifuge tube, add 750 μL TRIzol LS reagent, fasten the centrifuge tube cap, vortex for 10 seconds, and place in a 4°C refrigerator for 5 minutes; add 200 μL chloroform, fasten the centrifuge tube cap, shake by hand 6 times, place in a 4°C refrigerator for 5 minutes, and centrifuge at 12000 rpm at 4°C for 15 minutes to separate the liquid in the tube into 3 clear layers; prepare a new nuclease-free 1.5 mL centrifuge tube, add 500 μL isopropanol, take out the centrifuged specimen, carefully pipette 500 μL of the upper transparent liquid into another centrifuge tube, fasten the centrifuge tube cap, vortex for 5 seconds, and place in a 4°C refrigerator. Place in a box for 15 minutes, centrifuge at 4°C 12000rpm for 10 minutes, and carefully discard the supernatant; add 1 mL of pre-cooled 75% ethanol to the centrifuge tube, fasten the centrifuge tube cap, and turn the centrifuge tube upside down to wash the precipitate; centrifuge at 4°C 12000rpm for 5 minutes, discard the supernatant, and return the centrifuge tube to the centrifuge, centrifuge at 4°C 12000rpm for 3 minutes and discard the supernatant; dry for 3 minutes, add 8 μL of enzyme-free water, fasten the centrifuge tube cap, vortex for a few seconds, and centrifuge at 4°C 3000rpm for 30 seconds; aspirate 1 μL of RNA solution, use the NanoDrop One ultra-micro UV spectrophotometer of Thermo Fisher Scientific, USA to detect the total RNA concentration and purity of the sample to ensure that the A260 / A280 value of the obtained RNA solution is between 1.8-2.1, and take 6 μL of total RNA for reverse transcription.
[0054] (3) cDNA synthesis: According to the instructions of the Polestar 1st cDNA Synthesis Kit (gDNA removal) produced by Beijing Baoying Tonghui Biotechnology Co., Ltd., the reverse transcription reaction solution was prepared according to the following components:
[0055] ①Reverse transcription reaction system (20 μL):
[0056]
[0057] ②The cDNA synthesis reaction procedure is: 37°C for 30 minutes, followed by 85°C for 5 minutes to inactivate the reverse transcriptase. The obtained cDNA can be frozen at -20°C or directly used for quantitative PCR.
[0058] ③Preparation of plasmid standards:
[0059] Recombinant plasmids of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 amplification products:
[0060] 2.4 μg of tRF-20-V29K9UV3 pUC57 and tRF-27-87R8WP9N1E5 pUC57 were prepared by General Biotechnology (Anhui) Co., Ltd.
[0061] ④Measure the recombinant plasmid using UV spectrophotometer:
[0062] The OD260, OD280, and OD260 / OD280 values of tRF-20-V29K9UV3 pUC57 and tRF-27-87R8WP9N1E5 pUC57 were measured and repeated three times to determine the concentration and purity of each plasmid DNA.
[0063] Copy number = plasmid concentration × 6.02 × 10 23 / (660×total length of plasmid) to obtain the copy number of plasmid and dilute to 1×10 9 copies / μL, stored at –20℃ for future use. 9 copies / μL as plasmid stock solution, and perform 10 -1 × Plasmid stock sample, 10 -2 × Plasmid stock sample, 10 -3 × Plasmid stock sample, 10 -4 × plasmid stock sample and 10 -5 × Plasmid stock sample, 10 -6 × Plasmid stock sample, 10 -7 A total of 8 serial dilutions of × plasmid stock solution samples were used as subsequent amplification templates for fluorescence quantitative PCR detection.
[0064] ⑤ Fluorescence quantitative PCR: Three replicates of each cDNA sample were added to a 96-well PCR reaction plate and amplified using a two-step method. Simultaneously, negative control samples (using an equal volume of ddH2O instead of plasmid or cDNA) and serially diluted recombinant plasmid standards were amplified using fluorescence quantitative PCR. The reaction procedure consisted of 40 cycles of pre-denaturation at 95°C for 30 seconds, denaturation at 95°C for 10 seconds, and extension / annealing at 60°C for 20 seconds. Standard curves for the recombinant plasmids tRF-20-V29K9UV3 pUC57 and tRF-27-87R8WP9N1E5 pUC57 were automatically generated by the fluorescence quantitative PCR measurement system based on the changes in fluorescence values.
[0065] Correlation coefficient R of the recombinant plasmid tRF-20-V29K9UV3 pUC57 curve 2 =0.9998, correlation coefficient R of tRF-27-87R8WP9N1E5 pUC57 curve 2 =0.9992;
[0066] This indicates that there is a good linear relationship within the range of linear plasmid dilution concentration:
[0067] The regression equation for tRF-20-V29K9UV3 pUC57 was y = -3.264x + 42.52;
[0068] The regression equation for tRF-27-87R8WP9N1E5 pUC57 was y = -3.343x + 43.03;
[0069] Where y is the Cq value obtained by real-time quantitative PCR detection, 10 x To detect the corresponding copy number in the sample, the amplification efficiency of each curve is 100%, indicating that the standard curve established by each recombinant plasmid can accurately reflect the amplification of the target product.
[0070] After obtaining the Cq value of each sample, that is, the y value, and calculating the corresponding copy number according to the standard curve corresponding to the detected tRF, the 400×10 x / 3Calculate the copy number of each sample corresponding to 1 mL of plasma, and perform statistical analysis on the copy number of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in 1 mL of plasma from patients with early gastric cancer.
[0071] ⑥The results show:
[0072] The combined diagnostic value of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in early gastric cancer plasma is: the area under the ROC curve is 0.940, the sensitivity is 0.9, and the specificity is 0.875. Figure 2 can be effectively used for screening and diagnosis of early gastric cancer.
[0073] Example 3
[0074] The results of using tRF-20-V29K9UV3 alone as a molecular marker for screening and diagnosis of early gastric cancer showed that the number of tRF-20-V29K9UV3 copies per milliliter of plasma in patients with early gastric cancer was significantly higher than that in healthy people (P<0.001), with a cutoff value of 1127717. For specific results, please refer to Figure 3 Its diagnostic value in early cancer plasma is: the area under the ROC curve is 0.815, the sensitivity is 0.675, and the specificity is 0.85. Figure 3-1 ,and Figure 4 This is the amplification curve of tRF-20-V29K9UV3 in plasma of early gastric cancer in Example 3 of the present invention. Figure 5 This is a fluorescence quantitative standard curve of the tRF-20-V29K9UV3 plasmid standard in early gastric cancer plasma in Example 3 of the present invention.
[0075] Example 4
[0076] The results of using tRF-27-87R8WP9N1E5 as a molecular marker for screening and diagnosis of early gastric cancer showed that the copy number per milliliter of plasma in patients with early gastric cancer was significantly higher than that in healthy people (P<0.001), with a cutoff value of 269277. For specific results, please refer to Figure 6 Its diagnostic value in early cancer plasma is: the area under the ROC curve is 0.886, the sensitivity is 0.725, and the specificity is 0.925. Figure 6-1 ;and Figure 7 This is the amplification curve of tRF-27-87R8WP9N1E5 in plasma of early gastric cancer in Example 4 of the present invention. Figure 8 This is a fluorescence quantitative standard curve of the tRF-27-87R8WP9N1E5 plasmid standard in early gastric cancer plasma in Example 4 of the present invention. Sequence Listing <110> Ningbo University <120> Detection of gastric cancer molecular markers and their applications in plasma tRF levels <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> RNA <213> Homo sapiens <400> 1 uaggaugggg ugugauaggu 20 <400> 2 <211> 27 ucccuggugg ucuagugguu aggauuc 27 <400> 3 <211> 57 gcagacgagg gtacctcctc tcttctctac tcgtgtccta ccctcgtctg cacctat 57 <400> 4 <211> 57 gcagacgagg gtacctcctc tcttctctac tcgtgtccta ccctcgtctg cgaatcc 57 <400> 5 <211> twenty four tgtcctaccc tcgtctgcac ctat 24 <400> 6 <211> 25 aggattcgca gacgagggta ggaca 25
Claims
1. A detection kit for auxiliary diagnosis of gastric cancer, characterized by: Comprising two combined reagents for detecting tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5 in plasma samples, wherein: The nucleotide sequence of tRF-20-V29K9UV3 is shown in SEQ ID NO:
1. The tRF-20-V29K9UV3 is significantly upregulated in the plasma of patients with early gastric cancer. The amplification primers of the tRF-20-V29K9UV3 are: F1: 5'-CCGTTGGTAGGATGGGGTGT-3'; R1: 5'-GGTACCTCCTCTCTTCTCTACT-3'; The nucleotide sequence of tRF-27-87R8WP9N1E5 is shown in SEQ ID NO:
2. The tRF-27-87R8WP9N1E5 is significantly upregulated in the plasma of patients with early gastric cancer; the amplification primers of the tRF-27-87R8WP9N1E5 are: F2: 5'-GGTCTCTGGTGGTCTAGTGGT-3'; R2: 5'-GGTACCTCCTCTCTTCTCTACT-3'; The kit also includes reverse transcription primer sequences of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5, wherein: The reverse transcriptase sequence of tRF-20-V29K9UV3 is shown in SEQ ID NO: 3: 5′-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCACCTAT-3′; The reverse transcriptase sequence of tRF-27-87R8WP9N1E5 is shown in SEQ ID NO: 4: 5′-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCGAATCC-3′; The kit also includes probe primer sequences of tRF-20-V29K9UV3 and tRF-27-87R8WP9N1E5, wherein The probe primer sequence of tRF-20-V29K9UV3 is shown in SEQ ID NO: 5: 5′-FAM-TGTCCTACCCTCGTCTGCACCTAT-TAMRA-3′; The probe primer sequence of tRF-27-87R8WP9N1E5 is shown in SEQ ID NO: 6: 5′-FAM-AGGATTCGCAGACGAGGGTAGGACA-TAMRA-3′.
Citation Information
Patent Citations
Plasma miRNA (micro-ribonucleic acid) biologic marker assemblage for gastric cancer, application of assemblage and early diagnosis kit for gastric cancer
CN105200157A
Detection and application of novel gastric cancer molecular marker tRF-5026a
CN108165634A