A dCAPS molecular marker for efficient potassium utilization in wheat and its application

Abstract

The present invention provides a dCAPS molecular marker for efficient potassium utilization in wheat and an application thereof, belonging to the field of biotechnology, wherein the dCAPS molecular marker is a molecular specific detection marker of TaHAK1-2B, and the nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO: 1. The molecular marker has strong specificity and can accurately and quickly identify wheat varieties with efficient potassium utilization.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a dCAPS molecular marker for efficient potassium utilization of wheat and an application thereof. Background Art

[0002] Potassium is one of the macronutrients necessary for plant growth and development. It participates in a series of physiological and biochemical reactions of plants and plays an important role in plant growth and development. However, due to the influence of factors such as the fixation of secondary minerals in the soil and the depletion of effective potassium in the rhizosphere by plants, the content of effective potassium available to plants in cultivated soil is currently low, resulting in serious potassium deficiency in some areas. In addition, the utilization efficiency of potassium fertilizer in the season is only 40%, which has become an important factor that plagues the sustainable development of China's agriculture. Therefore, improving the absorption and utilization efficiency of potassium in the soil and cultivating new wheat varieties with efficient potassium utilization are urgent issues to be solved in the sustainable development of my country's agriculture.

[0003] Based on the current molecular marker-assisted breeding technology, which has been applied in different crops, some key agronomic traits in crops have been developed with relevant functional markers, and applied to genetic improvement of relevant traits, creation of germplasm resources and breeding of new varieties. However, the development of functional markers for wheat potassium stress tolerance genes is still very scarce, and there has been no report on the molecular markers of wheat HAK1 in potassium stress tolerance. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a dCAPS molecular marker for efficient potassium utilization of wheat and application thereof, wherein the molecular marker can quickly, efficiently and accurately screen out new varieties of wheat with efficient potassium utilization.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a dCAPS molecular marker for efficient potassium utilization in wheat. The dCAPS molecular marker is a molecular specific detection marker of TaHAK1-2B. The nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO:1.

[0007] The invention provides application of the dCAPS molecular marker in identifying wheat with high potassium utilization efficiency.

[0008] The present invention provides a primer set for detecting the dCAPS molecular marker, which consists of an upstream primer dCAPS-F sequence as shown in SEQ ID NO:2 and a downstream primer dCAPS-R sequence as shown in SEQ ID NO:3.

[0009] The present invention provides application of the primer set in identifying wheat with high potassium utilization efficiency.

[0010] The invention provides a kit for identifying wheat with high potassium utilization efficiency, and the kit comprises the primer set.

[0011] The present invention provides a dCAPS molecular marker method for identifying efficient potassium utilization in wheat, comprising the following steps:

[0012] (1) Extracting genomic DNA from wheat samples;

[0013] (2) performing PCR amplification on the genomic DNA in step (1) using the primer set;

[0014] (3) Recovering the PCR product of step (2), connecting the vector and transferring it into Escherichia coli for overnight culture, picking the positive clones, extracting the plasmids; performing double enzyme digestion, and performing electrophoresis after enzyme digestion to obtain the enzyme digestion products;

[0015] (4) If two electrophoretic bands are obtained, the wheat sample is potassium efficient wheat; if only one electrophoretic band is obtained, the wheat sample is non-potassium efficient wheat.

[0016] Preferably, the double enzyme digestion in step (3) is performed using HgaI enzyme and XbaI enzyme carried on the vector.

[0017] Preferably, the PCR amplification reaction system comprises: 25 μL of 2×KOD OneTM PCR Master Mix, 0.3 μL of 10 μM upstream primer, 0.3 μL of 10 μM downstream primer, 200 ng of sample DNA, supplemented with ddH2O to a total volume of 50 μL.

[0018] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 3 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 3 min, 32 cycles; extension at 68°C for 5 min.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The dCAPS-1231 molecular marker provided by the present invention has strong specificity and can accurately and quickly identify wheat varieties with high potassium utilization efficiency.

[0021] In practical applications, the dCAPS-1231 molecular marker provided by the present invention only requires PCR combined with enzyme digestion, has low cost, high throughput, and high specificity, can identify desired plants at the seedling stage, and is suitable for production practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1Amplification results of different fragments of TaHAK1-2B gene in different types of wheat varieties; (lanes 1-6: using Hap1 wheat varieties Gaomai 8901, Xinmai 18, Yunong 10, Pumai 9, Chang 6154, Emai 12 as amplification templates; lanes 7-12: using Hap2 wheat varieties Yangmai 2, Jimai 20, Aikang 58, Luohan 13, Shixin 828, Jimai 19 as amplification templates; lanes 13-14: using Hap3 wheat varieties Shi 4185, Jinnong 207, Yumai 14, Yumai 62 as amplification templates).

[0023] Figure 2 Haplotype analysis of TaHAK1-2B gene in 26 different wheat varieties (numbered 1 to 26, Table 1 corresponds to the 26 wheat varieties).

[0024] Figure 3 Phenotypes (A) and growth parameters (B) of wheat varieties with different haplotypes of TaHAK1-2B under potassium stress; (Hap1 includes three varieties, namely Xinmai 18, Yunong 10, and Pumai 9; Hap2 includes three varieties, namely Jimai 20, Aikang 58, and Luohan 13; Hap3 includes three varieties, namely Jinnong 207, Yumai 14, and Yumai 62).

[0025] Figure 4 Changes in potassium content in different tissues of different haplotype wheat varieties of TaHAK1-2B under potassium stress conditions; (Hap1 includes three varieties, namely Xinmai 18, Yunong 10, and Pumai 9; Hap2 includes three varieties, namely Jimai 20, Aikang 58, and Luohan 13; Hap3 includes three varieties, namely Jinnong 207, Yumai 14, and Yumai 62).

[0026] Figure 5 Different types of haplotype restriction sites of TaHAK1-2B are distinguished.

[0027] Figure 6 Amplification of different types of haplotypes of TaHAK1-2B (A) and electrophoresis of their corresponding sequences digested with XbaI and HgaI (B); (Hap1 includes three varieties, namely Xinmai 18, Yunong 10, and Pumai 9; Hap2 includes three varieties, namely Jimai 20, Aikang 58, and Luohan 13; Hap3 includes three varieties, namely Jinnong 207, Yumai 14, and Yumai 62). DETAILED DESCRIPTION

[0028] The present invention provides a dCAPS molecular marker for efficient potassium utilization in wheat, the dCAPS molecular marker is a molecular specific detection marker of TaHAK1-2B, and the nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO:1. The dCAPS molecular marker of the present invention is named dCAPS-1231, and there is a different SNP site of G→C at the 1231st position of the TaHAK1-2B coding region. The potassium efficient utilization wheat has a restriction endonuclease HgaI enzyme recognition site in the adjacent sequence of this site: GACGC. The nucleotide sequence of the TaHAK1-2B coding region in the present invention is shown in SEQ ID NO:4, and the nucleotide sequence of the promoter region of the TaHAK1-2B is shown in SEQ ID NO:5.

[0029] The present invention provides the use of the dCAPS molecular marker in identifying wheat with high potassium utilization efficiency. The dCAPS molecular marker in the present invention can accurately, quickly and efficiently identify wheat with high potassium utilization efficiency.

[0030] The present invention provides a primer set for detecting the dCAPS molecular marker, characterized in that the primer set consists of an upstream primer sequence as shown in SEQ ID NO: 2 and a downstream primer sequence as shown in SEQ ID NO: 3. The nucleotide sequence of the upstream primer dCAPS-F of the present invention is specifically CACCAAGTGACACCGAC (SEQ ID NO: 2), and the nucleotide sequence of the downstream primer dCAPS-R is specifically AGCAATCTCTGGTAAATG (SEQ ID NO: 3). The primer set of the present invention is designed upstream and downstream of the SNP identified by the dCAPS-1231 marker.

[0031] The present invention provides an application of the primer set in identifying wheat with high potassium utilization efficiency. The present invention uses the primer set as a part of a kit to identify wheat with high potassium utilization efficiency. The primer set of the present invention has strong specificity and high sensitivity.

[0032] The present invention provides a dCAPS molecular marker method for identifying wheat potassium efficient utilization, comprising the following steps: (1) extracting wheat sample genomic DNA; (2) performing PCR amplification on the genomic DNA of step (2) with the primer set; (3) recovering the PCR product of step (2), connecting the vector and transferring it into Escherichia coli for overnight culture, picking positive clones, extracting plasmids; performing double enzyme digestion, electrophoresis after enzyme digestion, and obtaining enzyme digestion products; (4) if two electrophoresis bands are obtained, the wheat sample is potassium efficient wheat, and if one electrophoresis band is still obtained, the wheat sample is non-potassium efficient wheat. The vector of the present invention is preferably a ZT4 vector; and the Escherichia coli is preferably a DH5α strain. In step (3) of the present invention, HgaI enzyme and XbaI enzyme carried on the vector are used for double enzyme digestion, and the HgaI enzyme digestion can identify the adjacent sequence at the 1231st position of the coding region in the amplified product, and the XbaI enzyme is an enzyme carried by the ZT4 vector. The reaction system of the PCR amplification of the present invention is preferably: 2×KOD OneTM PCRMasterMix 25μL, 10μM upstream primer 0.3μL, 10μM downstream primer 0.3μL, sample DNA 200ng, supplemented with ddH2O to a total volume of 50μL, and the reaction procedure of the PCR amplification is preferably: 94°C pre-denaturation for 3min; 98°C denaturation for 10s, 55°C annealing for 30s, 68°C extension for 3min, 32 cycles; 68°C extension for 5min.

[0033] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0034] Example 1 Screening of excellent haplotypes of TaHAK1 potassium transporter gene

[0035] 1 Materials and methods

[0036] 1.1 Materials

[0037] The present invention uses 26 common wheat varieties (commercially available modern cultivars) preserved in this laboratory (Laboratory 317, South of the First Laboratory Building, College of Agriculture, Henan Agricultural University), and detailed information is shown in Table 1.

[0038] Table 1 Hexaploid wheat varieties used in the present invention

[0039]

[0040]

[0041] The high-fidelity PCR enzyme KOD OneTM PCR MasterMix used for PCR amplification was purchased from Toyobo Biotechnology Co., Ltd., the blunt-end cloning vector pEASY-Blunt was purchased from Quanshijin Biotechnology Co., Ltd., and the HgaI restriction endonuclease was purchased from New England Biolabs Co., Ltd. Other drugs were of domestic analytical grade.

[0042] 1.2 Primer design

[0043] According to the sequence differences of the three copies of the TaHAK1 gene in the wheat genome database, the primers for the 2B copy segment that is specifically highly expressed under potassium deficiency conditions were designed as shown in Table 2 below. The primer synthesis and sequencing were completed by Henan Shangya Biotechnology Co., Ltd.

[0044] Table 2 Primer sets used

[0045]

[0046] 1.3 Extraction of total wheat DNA

[0047] The total DNA of wheat was extracted using the CTAB method. First, the wheat leaves or other tissues were quickly frozen and ground with liquid nitrogen, 1 mL of preheated CTAB extraction solution was added, and the mixture was incubated in a 65°C water bath for 1 hour. Then, after centrifugation at 12,000 g, the supernatant was added with an equal volume of chloroform:isoamyl alcohol (24:1) mixture and oscillated. Centrifuge at 12,000 g for 10 minutes, transfer the supernatant to a new tube, add 2 times the volume of anhydrous ethanol to mix, and let stand at -20°C for 30 minutes. Centrifuge again to remove the supernatant, wash twice with 75% ethanol, dry it, and add 100 μL of sterile water to dissolve the DNA.

[0048] 2. Experimental methods and results

[0049] 2.1 Amplification and sequencing of TaHAK1-2B gene

[0050] The target fragment was amplified using the high-fidelity PCR enzyme KOD OneTM PCR Master Mix. The TaHAK1-2B primers described in Table 2 were used to amplify the TaHAK1-2B sequence using the 16 hexaploid wheat DNAs in Table 1 as templates. The PCR system included: 25μL KOD OneTM PCR Master Mix (2×), 0.3μL (10μM) of each upstream and downstream primer, 200ng DNA template, and ddH2O supplemented to a total volume of 50μL. The PCR reaction program was: pre-denaturation at 94℃ for 3min; denaturation at 98℃ for 10s, annealing at 56℃ for 30s, extension at 68℃ for 3min, 32 cycles; extension at 68℃ for 5min. Different fragments of TaHAK1-2B were amplified in the promoter and coding domain of the TaHAK1-2B gene, respectively. The amplification results of varieties He1-6 (Hap1), He11-16 (Hap2), and He21-24 (Hap3) are shown in the following figure. Figure 1 As shown: under the conditions of primers TaHAK-2B-F1&R1, TaHAK-2B-F2&R2, TaHAK-2B-F3&R3, and TaHAK-2B-F4&R4, lanes 1-6: Hap1 varieties Gaomai 8901, Xinmai 18, Yunong 10, Pumai 9, Chang 6154, and Emai 12; lanes 7-12: Hap2 varieties Yangmai 2, Jimai 20, Aikang 58, Luohan 13, Shixin 828, and Jimai 19; lanes 13-14: Hap3 varieties Shi 4185, Jinnong 207, Yumai 14, and Yumai 62 amplified different fragments of 2245bp, 1429bp, 1699bp, and 1048bp, respectively. Afterwards, the PCR amplification products of the above different fragments were recovered respectively, connected with the pEASY-Blunt cloning vector, transformed into Escherichia coli, and more than three positive clones were picked and sequenced using universal primers.

[0051] 2.2 Sequence alignment and haplotype analysis of TaHAK1-2B genes

[0052] DNAMAN software (http: / / www.lynnon.com) was used to splice the sequencing results and perform sequence comparison. It was found that TaHAK1-2B in 26 wheat varieties had two SNP polymorphic variation sites in the promoter region (-1630bp to -1bp): -1630bp (A / G) and -1328bp (C / G) ( Figure 2 A and 2B); there are 3 SNPs (168A / G, 501C / G and 1231G / C) in the coding region (1bp-2925bp) ( Figure 2CE). Then, the haplotypes of the promoter and coding region of TaHAK1-2B were identified using DnaSP 5.10 software (http: / / www.ub.edu / DnaSP). The results showed that the five SNPs were closely linked to form three haplotypes, named TaHAK1-2B-Hap1, TaHAK1-2B-Hap2 and TaHAK1-2B-Hap3 (hereinafter referred to as Hap1, Hap2 and Hap3). The SNP sites contained in Hap1 were used as the control, and Hap2 and Hap3 contained 4 and 1 SNPs, respectively ( Figure 2 F).

[0053] 2.3 Comparison of tolerance of wheat varieties with different haplotypes of TaHAK1-2B gene to low potassium stress

[0054] Three varieties were selected from different TaHAK1-2B haplotype wheat varieties (Hap1 includes three varieties, namely Xinmai 18, Yunong 10, and Pumai 9; Hap2 includes three varieties, namely Jimai 20, Aikang 58, and Luohan 13; Hap3 includes three varieties, namely Jinnong 207, Yumai 14, and Yumai 62). The wheat seedlings were cultured to the two-leaf and one-heart stage and treated with potassium deficiency. After 10 days of treatment, the wheat plants were photographed according to the previous potassium stress treatment method in the laboratory (Li et al., 2017). The phenotypes were as follows: Figure 3 As shown in A: Under potassium deficiency conditions, the growth of the Hap2 haploid wheat variety of TaHAK1-2B was better than that of the Hap1 and Hap3 haploid wheat varieties, and no obvious symptoms such as root shortening and leaf wilting appeared.

[0055] Then, the plant height, root length, fresh weight, dry weight and other growth parameters were measured using a ruler and an electronic balance. The calculation formula used in the measurement was: relative elongation of roots = root length of treated plants - root elongation of control plants; relative increase in root dry weight = root dry weight of treated plants - root dry weight of control plants; relative increase in aboveground plants = aboveground height of treated plants - aboveground height of control plants; relative increase in aboveground plant dry weight = aboveground dry weight of treated plants - aboveground dry weight of control plants. The measurement results showed that the relative elongation of underground roots of the Hap2 haplotype was significantly higher than that of the Hap1 and Hap3 haplotypes, and a similar trend was found in root dry weight ( Figure 3 B); In addition, the relative growth of the aboveground part had the same trend as that of the underground part. The plant height and dry matter growth of the Hap2 haplotype were significantly higher than those of the Hap1 and Hap3 haplotypes ( Figure 3 B) This indicates that under potassium deficiency stress, haplotype Hap2 wheat varieties have stronger tolerance to potassium than Hap1 and Hap3 wheat varieties.

[0056] In order to further analyze the utilization efficiency of potassium fertilizer by different types of varieties, the present invention dried the above-mentioned different types of wheat, digested them according to the previous method of this experiment (Li et al., 2021), measured the potassium concentration of different tissues above and below the ground, and calculated the potassium content and utilization index of the plant. Figure 4 As shown in the figure, under potassium deficiency conditions, the potassium content and utilization index of the Hap2 haplotype wheat varieties containing TaHAK1-2B increased significantly both above and below ground, indicating that under potassium stress conditions, the Hap2 haplotype wheat varieties have enhanced potassium absorption capacity, absorbed a large amount of potassium, and further transported it to the above ground part to adapt to the normal growth and development of wheat under potassium stress conditions. This further indicates that the TaHAK1 gene containing the Hap2 haplotype is an excellent haplotype for wheat under potassium stress conditions.

[0057] Example 2 Determination and application of CAPS molecular markers of TaHAK1-2B gene

[0058] 1. Experimental Materials

[0059] Same as Example 1.

[0060] 2. Experimental methods and results

[0061] 2.1 Determination of dCAPS-1231 molecular markers

[0062] The sequence differences of different haplotypes were analyzed using dCAPSFinder2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html), and it was found that the sequence at position 1231 had two forms, G / C, such as Figure 5 As shown in A, the sequence of the varieties containing Hap1 and Hap3 is CACCAAGTGACACCCACCCACTCTTCC, and the sequence of the Hap2 type wheat variety is CACCAAGTGACACCCACGCACTCTTCC. To distinguish the above differences, C was mutated to G at position 1228 of the above sequence, and a dCAPS forward primer CACCAAGTGACCGAC and a dCAPS reverse primer containing the restriction endonuclease HgaI (GACGC) cleavage site were designed to distinguish Hap1 (Hap-2B-1), Hap3 (Hap-2B-3) and Hap2 (Hap-2B-2), among which Hap2 contains the GACGC sequence that can be recognized and cut by the restriction endonuclease HgaI, while Hap1 and Hap3 contain the sequence GACCC, and therefore cannot be cut by the restriction endonuclease HgaI ( Figure 5B). Based on the sequence difference, the dCAPS molecular marker was considered to be used to distinguish Hap2 from other haplotypes, and the marker was named dCAPS-1231. Primers dCAPS-F: CACCAAGTGACACCGAC (SEQ ID NO: 2) and dCAPS-R: AGCAATCTCTGGTAAATG (SEQ ID NO: 3) were designed upstream and downstream of the SNP identified by the dCAPS-1231 marker to distinguish different haplotypes, providing a basis for the subsequent screening of different varieties with high potassium utilization efficiency.

[0063] 2.2 Application of dCAPS-1231 molecular marker

[0064] To verify the practical applicability of the dCAPS-1231 molecular marker determined above. The present invention selects the above-mentioned wheat varieties containing different types of haploids (Hap1 contains varieties Xinmai 18, Yunong 10, Pumai 9; Hap2 contains varieties Jimai 20, Aikang 58, Luohan 13; Hap3 contains varieties Jinnong 207, Yumai 14, Yumai 62), and extracts genomic DNA respectively (the method is the same as that in Example 1); uses the upstream and downstream primers of the dCAPS-1231 marker determined in step 2.1 to amplify the dCAPS-1231 molecular marker in different wheat varieties, and the PCR amplification reaction system includes: 2×KOD OneTM PCR MasterMix 25μL, 0.3μL of 10μM upstream primer, 0.3μL of 10μM downstream primer, 200ng of sample DNA, supplemented with ddH2O to a total volume of 50μL, PCR amplification reaction program: 94℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 55℃ annealing for 30s, 68℃ extension for 3min, 32 cycles; 68℃ extension for 5min). The results are as follows Figure 6 As shown in A: TaHAK1-2B fragments (774bp~1249bp) in different haplotype wheats can all obtain a single amplified band (476bp). Then, the above amplified PCR product was recovered, connected to the ZT4 vector and transferred into the DH5α strain. After overnight culture, the positive clones were picked and the plasmids were extracted. Double enzyme digestion was performed using HgaI enzyme and XbaI enzyme on the ZT4 vector. The electrophoresis detection results are shown as follows: Figure 6 As shown in B: It was found that the transformation products of the haplotype wheat varieties of Hap1 and Hap3 were still a single 3450bp band after enzyme digestion (including vector 2974bp + fragment 476bp), while the amplification product of the haplotype material of Hap2 became two fragments of 2974bp (vector) and 476bp after double enzyme digestion. This shows that the molecular marker dCAPS-1231 can distinguish Hap2 from Hap1 and Hap3 haplotypes, and can be used in the molecular design breeding of new wheat varieties with high potassium efficiency.

[0065] In summary, the molecular marker dCAPS-1231 provided by the present invention will be conducive to the rapid and accurate screening of wheat varieties with high potassium utilization efficiency.

[0066] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Henan Agricultural University <120> A dCAPS molecular marker for efficient potassium utilization in wheat and its application <160> 13 <170> SIPOSequenceListing 1.0 <210> 1 <211> 476 <212> DNA <213> Artificial Sequence <400> 1 tccaccaagt gacacccacc cactcttccc gttccttatg aagtattgca ctatatacat 60 gggattgaag gcccgcagaa caccgacgtc gtgaacaacg aggttgtaca tcccgatgcc 120 ggcaatcaga aggaaccaca ctgagatgac cggcgcaaag gtgtacccga ccttgtcggt 180 cccgaagcgc tggaccgaga agagcatgaa cagaatggcc accgagatga ggaccacttg 240 tgctgcacaa agaaggaaca ttagacgtga tggactgatg gacacagaaa caatcaaggt 300 tgttatacta atccttcttc acatactctg agtcaagctt ggcgcctttt ctctgatccc 360 actcaccgca gagagcactg cagcacagca catccatgaa caaaacatta gtacagtact 420 cttcttaata gacaacacaa ctgaagctct tggctcttca tttaccagag attgct 476 <210> 2 <211> 17 <212> DNA <213> Artificial Sequence <400> 2 caccaagtga caccgac 17 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 agcaatctct ggtaaatg 18 <210> 4 <211> 3092 <212> DNA <213> Artificial Sequence <400> 4 atgtcgctcc aggtcgagga cccgcggagc gcagagacgc cggcgccgct caagcgtcac 60 gactcgctgt tcggcgacgc agagaaggtc tccgactcga agcaccatgg gtctcaggta 120 cgttccttct ctcgcagacg cagcctggtg accatgtaat gttacagaca gagcaagtta 180 aactgactga ctgactcctg gtgatggatg caggtgagct ggatgcggac gctgagcctg 240 gctttccaga gcgtcggcat catctacggc gacatcggga cgtcgccgct ctacgtctac 300 tccagcacct tcccggacgg catcaaggac aggacgatc tcctgggcgt cctctcgctc 360 atcctctaca ccctcatcat catacccatg ctcaagtacg tcttcatcgt gctctacgcc 420 aacgacaacg gagatggtaa gtaagctcgc tcattctctg aaacctcggc ctgctgtcat 480 accagtttt gtacgctaca ctagtattga agtaacaaga aactctggtg ttgtaggtgg 540 cacgtttgcg ctttactcgc tgatatcacg gtacgcgaag atcaggctga tcccggacca 600 gcaggcggag gatgcggcgg tgtccaatta ccacatagaa gcgccaaact cacagctcaa 660 gagggcgcaa tggttgaagc agaagcttga gtccagcaag gcggccaaga ttgtgctctt 720 caccctcacc atcctcggca cgtcaatggt gataggcgat ggaaccttga ccccagcaat 780 ctctggtaaa tgaagagcca agagcttcag ttgtgttgtc tattaagaag agtactgtac 840 taatgttttg ttcatggatg tgctgtgctg cagtgctctc tgcggtgagt gggatcagag 900 aaaaggcgcc aagcttgact cagagtatgt gaagaaggat tagtataaca accttgattg 960 tttctgtgtc catcagtcca tcacgtctaa tgttccttct ttgtgcagca caagtggtcc 1020 tcatctcggt ggccattctg ttcatgctct tctcggtcca gcgcttcggg accgacaagg 1080 tcgggtacac ctttgcgccg gtcatctcag tgtggttcct tctgattgcc ggcatcggga 1140 tgtacaacct cgttgttcac gacgtcggtg ttctgcgggc cttcaatccc atgtatatag 1200 tgcaatactt cataaggaac gggaagagtg ggtgggtgtc acttggtgga attatcttgt 1260 gtgtcacagg taaccttaat ttctaactga aaatttgaac tgacaagcga ttgtattgca 1320 aactatagcc tgcagaactg taatctgaat taactgactg attgtcatac ataacaggca 1380 cagaaggcat gtttgctgac ctaggacatt tcaatatcag ggctgttcag gtaaccactt 1440 ttaacttcag atataagctt tcggaagtat aaacaaattt tgcccaacag aaggacctca 1500 tctgacaatg gttcttgtac ttacacttgc agctcagctt caacggcatc ctgttcccat 1560 ctgtggcact gtgttatatc gggcaggcgg cttacctgag gaaattccca gacaacgttg 1620 caaacacctt ctatagatcc atcccaggta cagagttttt tctataagac agcagtttgc 1680 tgcttcgggg gcatgcattt ggtagagca fathercacaa gtaagatcaa ctctccatgt ctatgtgcag caccaatgtt ctggccaacc ttcatcgttg ccattcttgc tgccatcatc gcaagccaag ccatgctctc cggtgcgttt gccatcctct ccaaggccct gtctctcggt tgcatgccaa gggttcgagt catccacacc tcgcacaagt acgaggggca ggtgtacatt cctgaagtga acttcctcat gggattggcg agcatcgtcg tcacggtcgc 1980. cttccggacg accaccagca tcggccacgc ttacggtaag tagctagcta gcgaaggata agtcctttgt gatgattcag tgaggttttc atctgacgct ctgacccatc tgatgttggt tatgcgcagg gatctgtgtg gtgaccacgt ttgcgatcac cacccatctg atgaccgtcg tcatgctgct catatggaag aagcacgcca tcttcatcat gctcttctac gtcgtgttcg gctccataga gctgatctac ctctcctcca tactgtcaaa gttcatcgaa ggcgggtacc tccccatctg cttcgcgctg gtggtgatga gcctgatggc ggcgtggcac tacgtccagg 2340 tgaagaggta ctggtacgag ctcgaccaca tcgtgcccgt cagcgagatg acgatgctgc tggagaagaa cgaggtgcgg cggatccccg gggtgggcct cctgtacacg gagctggtcc 2460 agggcatccc cccggtgttc cccaggctga tccagaagat accgtccgtg cactccatct 2520 tcatgttcat gtccatcaag cacctgccca tctcgcgcgt ggtgcccacg gagcggttca 2580 tcttccggca ggtcgggccg agggagcacc ggatgttccg ctgcgtggcg cggtacgggt 2640 acagcgacac gctggaggag cccaaggagt tcgcggcgtt cctcgtggac aggctcaaga 2700 tgttcatcca ggaagagagc gcgttcgcgc tcgcgcagag cgaagaggtt tcggacgccc 2760 aggcgaggcc ggggcggtg acggtgcaca gcgaggaggc ggtccaaggc caggcgcggg 2820 tgagcagcca ctcggcctcg gggaggatga gcttccacac gaaccaggca gtggaggagg 2880 agaagcagct gattgacagg gaggtggagc gggggatggt gtatctgatg ggggaggcca 2940 acgtcacggc ggaggccaag tcctccatct tgaagaaggt cgtggtgaac catgtctaca 3000 ccttcttgag gaagaacttg acggaggggc acaaggtgct ggccattccc aaagatcagc 3060 tgctcaaagt cgggatcacg tacgagatat ag 3092 <210> 5 <211> 2243 <212> DNA <213> Artificial Sequence <400> 5 gatggtgata agcagcggag ccatggctcc tcgcagccga taaactttta tgcaacgaac 60 caattcaggc atgacatctg ggtcacacac tcacacccgg aaaacaacca acaaccctca 120 aaataagctg ccaagttacc gcttatcaca ccgctgtaga aaaagaggaa ggaaactaaa 180 gagaggaacg gcaccaaaac aatggattcg gcatcaatta ttgcacgggg cgaagcagct 240 ggtagatccc agagaaggaa aacggaaagt ctttggcggc cgaagaccgg ctggcgggct 300 ggcgaggatg cgaatgcatt tctgctcttg tgcttcccat tttttccttc tctccctgtg 360 ttcaaaataa gctgctgccc aataattcac agcacactgc acataattca cagttcttta 420 tggtttcgcg gaaacctcga gcccaaactc cgagccaccc ctcctcctcc tcctcctcct 480 cgttttggct cccactgcat gcccagccga tccctctatt taaacagagg cctcctcgcc 540 ttctctctga ctcctcatcc cagccccagc ccagtgcgag ctgagctgac ctgctgcaga 600 ccttcgcctg cctgcctgcc gcctccttgc tacttcctcc tcaggtttcg tcccgcctgc 660 cctcttcagc cggccggccg aacgtacctc gccgccggcc gtccctgcgt cgccttagct 720 tagcaaggta ggtgctcagt tgctcgccat ccccacctcc aatggcctgt ttctcctgtt 780 tctttttttt ctttctttct tttggtttcg aaccatgcgt ctcctgtttc ttcgtttcat 840 tctccagtgt tataccacct attctcctgt aagtgtttac ttatttgatt atgcgtatgg 900 actgaaatta catcgcgcaa aggaattctt tccttcctct cttctctgta aacactccta 960 ggaaatgaac aactttttgc cactcactag cagaacagag gtttgctgat acagagtagc 1020 agtgttaatt agtttcagct tagctgggcg cacatgtcag cactacgtag ttaattaaga 1080 ttcgttccaa gagtaacgct tgctagtact agtagatcag gtgtggacgg tgtggagttt 1140 gggggcccgg aaggtcaagg gtgtggccaa tgaggctgat ttgtgatctg atcaccactt 1200 aaactaatgg ggtttgttat catttggaag tgagtgaggg cggtgtgcat gacccaagaa 1260 gatctgcgga aaactataga aaactggagt actactagta gtatactgcc tcgcgtcatg 1320 ccacgctagt actagttact aatcttcgtg catgagttca actcagggtt gggtgtatct 1380 ctccctggtt tgaagtcat actcacaca ctttcttac gaaatatgta agttttttgt 1440 acaggaatac agatgaat actattgta ttagtatccc tctgttcttt tataaagag 1500 cataatcatg catacatgac agcaatagat actattcatg gaacaattt ggggaccgga 1560 aaaagtggt aattacaat tagtgtacac taactctct tchaatagaac agagtaattt 1620 gctcaattg ttgtagtaaa aacagagta atgaggtca cttatgcttc aattatatgg 1680 aggttgttt cctcgcaaaa agataaata tatatatgga ggtttgttga taaggtatgc 1740 gaccgagatg agaagcctgc tgattcttta tcggtgcaat tcatgaaaaa ttcttgaaag 1800 gaaatgttta catacacagg atagactaat ggtactagta cgtactccag tacacaatca 1860 caagcaggc ttactaaaaa ttgaaagcaa caatttgac tagaatatgg aaacatgcat 1920 cgcaccgctc gttatattta tagactagg gttttattag gggcctgcac ttgctacca 1980 atgaatcgtg gtcttgctt aggaacaag gatgattct tttggttt ttcaatgctc 2040 ccacgccggt tttaagccag ccttttattc ttggaatgt aaaaagtta tacttacttg 2100 gttttcacac cactaccgtc tcaaagtctt ggagccattg atgcaggcca tataggcccc 2160 gctggagagc tgaaggaggc ctccaaggca ttcggaagcg tgcagcttga acatcagcag 2220 cagcagcagg cgaccgacca gaa 2243 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <400> 6 atggtgataa gcagcgg 17 <210> 7 <211> twenty two <212> DNA <213> Artificial Sequence <400> 7 catttctggt cggtcgcctg ct 22 <210> 8 <211> twenty two <212> DNA <213> Artificial Sequence <400> 8 agcaggcgac cgaccagaaa tg 22 <210> 9 <211> 17 <212> DNA <213> Artificial Sequence <400> 9 aatgtcctag gtcagca 17 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <400> 10 tgctgaccta ggacatt 17 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 actatatctc gtacgtgatc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 gatcacgtac gagatatagt 20 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <400> 13 ctagccgctc cacctcat 18

Claims

1. A primer set for identifying dCAPS molecular markers in wheat with high potassium utilization efficiency, characterized in that: The primer set consists of an upstream primer dCAPS-F sequence as shown in SEQ ID NO:2 and a downstream primer dCAPS-R sequence as shown in SEQ ID NO:

3.

2. Use of the primer set according to claim 1 in identifying wheat with high potassium utilization efficiency.

3. A kit for identifying wheat with high potassium utilization efficiency, characterized in that: The kit comprises the primer set according to claim 1.

4. A dCAPS molecular marker method for identifying efficient potassium utilization in wheat, characterized in that: The steps include: (1) Extracting genomic DNA from wheat samples; (2) performing PCR amplification on the genomic DNA in step (1) using the primer set described in claim 1; (3) Recovering the PCR product of step (2), connecting the vector and transferring it into Escherichia coli for overnight culture, picking the positive clones, extracting the plasmids; performing double enzyme digestion, and performing electrophoresis after enzyme digestion to obtain the enzyme digestion products; (4) If two electrophoretic bands are obtained, the wheat sample is potassium efficient wheat; if only one electrophoretic band is obtained, the wheat sample is non-potassium efficient wheat.

5. The method according to claim 4, characterized in that The double enzyme digestion uses HgaI enzyme and XbaI enzyme on the vector for digestion.

6. The method according to claim 4, characterized in that The PCR amplification reaction system comprises: 2×KOD OneTMPCR MasterMix 25 μL, 10 μM upstream primer 0.3 μL, 10 μM downstream primer 0.3 μL, sample DNA 200 ng, supplemented with ddH2O to a total volume of 50 μL.

7. The method according to claim 4, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 3 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 3 min, 32 cycles; and extension at 68°C for 5 min.

Images