RT-qPCR detection method and application of the distribution of human mesenchymal stem cells in mice

Abstract

The present invention relates to an RT-qPCR detection method and application for the distribution of human mesenchymal stem cells in mice, belonging to the field of biomedicine technology. The RT-qPCR detection method comprises the following steps: sampling: taking organ tissues of mice injected with human mesenchymal stem cells, extracting their total RNA for testing; detection: using real-time fluorescence quantitative PCR to detect the human mesenchymal stem cell-specific protein gene sequence in the above-mentioned total RNA to obtain the distribution of human mesenchymal stem cells in mice. The above-mentioned detection method can achieve the purpose of quickly and accurately detecting the in vivo distribution of multiple tissues at different time points, providing data support for the selection of stem cell products, and being used in the evaluation of the distribution of stem cells in the body.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an RT-qPCR detection method for the distribution of human mesenchymal stem cells in mice and rats and its application. Background Art

[0002] Coronavirus disease 2019 (COVID-19), caused by the SARS-CoV-2 virus, can cause severe lung damage and even death. However, there are currently no specific treatments for COVID-19. Mesenchymal stem cells (MSCs), a type of multipotent tissue stem cell with tissue repair and immune regulation functions, have shown some efficacy in treating influenza-associated pneumonia and other lung diseases.

[0003] MSCs are "living drugs." Differences in their activity and heterogeneity between MSCs from different donors and tissues are crucial for their therapeutic applications. Studies have shown that the majority of bone marrow-derived MSCs (>80%) rapidly reside in the lungs after intravenous injection, with only a fraction homing to other tissues, such as the liver, spleen, and sites of inflammation or injury. Furthermore, once MSCs enter the body, their residence time is limited and they are cleared from the body over time. Some studies have shown that the duration of MSCs in the lungs ranges from seven days to three months, while other studies have found that MSC signals are no longer detectable in the lungs 18 hours after MSC injection. Furthermore, the sources and production methods of MSCs used by different research teams vary, leading to varying distribution and residence times of MSCs in the body and, consequently, varying therapeutic efficacy. Therefore, studying the in vivo distribution and residence time of mesenchymal stem cells in the treatment of novel coronavirus infection is crucial. From a quality control perspective, monitoring the in vivo distribution and duration of action of MSCs from different sources and batches is crucial.

[0004] Previous reports have often used flow cytometry to detect the distribution of cells in vivo. Taking lung tissue as an example, a common approach involves taking a certain amount of lung tissue, homogenizing it, identifying appropriate markers, and then counting them using flow cytometry to determine the number of MSCs and other cells in the lung tissue.

[0005] The COVID-19 mouse model (hACE2-KI / NIFDC) used in this application is a humanized animal model created by the China Food and Drug Inspection Institute using CRISPR / Cas9 technology to insert the human hACE2 gene cDNA under the mouse mACE2 promoter in a C57BL / 6 mouse background. This model effectively completes viral infection and can be used for domestic and international research, product evaluation, and other experimental studies. The in vivo distribution and residence time evaluation experiments for MSCs were primarily conducted based on this model. Summary of the Invention

[0006] The present invention provides an RT-qPCR detection method for the distribution of human mesenchymal stem cells in mice. This method can achieve the purpose of rapidly and accurately detecting the in vivo distribution of human mesenchymal stem cells in multiple tissues at different time points. It can process a large number of samples in a short period of time (up to 384 or even 1536 reactions per run), thereby providing data support for the selection of cell products.

[0007] A RT-qPCR detection method for the distribution of human mesenchymal stem cells in mice comprises the following steps:

[0008] Sampling: Organ tissues of mice injected with human mesenchymal stem cells were collected and total RNA was extracted for testing;

[0009] Detection: Real-time fluorescence quantitative PCR was used to detect the human mesenchymal stem cell-specific protein gene sequence in the above total RNA to obtain the distribution of human mesenchymal stem cells in mice.

[0010] In conventional methods, if the content of specific cells needs to be detected, a flow cytometer is usually used to identify and detect them through specific proteins on the cell surface. However, flow cytometry generally uses animal blood, and the processing of animal tissue samples is time-consuming and labor-intensive, and there are problems of missed detection, as well as high equipment costs. This method can quickly calculate the cell content through the CT value, which is superior to conventional flow cytometry experiments and solves the problem that it can only distinguish the proportion of positive cells but cannot be specific to the content in the tissue. At the same time, the inventors found in practice that the problem of missed detection may be caused by partial cell damage during the homogenization process. Therefore, this problem can be avoided by extracting total nucleic acid for detection.

[0011] The RT-qPCR detection method of the present invention quantitatively detects the gene sequence corresponding to a specific protein expressed on human mesenchymal stem cells (hMSCs). By sampling different tissues at predetermined time points after the injection of the hMSCs, the distribution of hMSCs in mice can be determined. The method and sample processing are relatively simple, requiring only a standard RT-qPCR instrument, rather than expensive flow cytometry. Furthermore, the RT-qPCR method can measure MSC cell content in various animal tissues and can precisely localize specific tissues and organs (such as the liver and lungs), thus expanding the scope of detection.

[0012] In one embodiment, the human mesenchymal stem cell-specific protein is CD29. Research and comparison have shown that CD29 is a strongly expressed antigen on the surface of MSCs. MSCs from different tissues can express CD29, making it universal and applicable to MSCs from different sources. Therefore, using CD29 as a marker for detection has the advantage of a wide range of applications.

[0013] In one embodiment, the human mesenchymal stem cell-specific protein gene sequence is an mRNA sequence. Since RNA is involved in the expression of genetic information, RNA is more accurately used to detect gene expression. It is understood that the RNA gene sequence can be extracted using methods such as TRIZOL.

[0014] In one embodiment, in the detection step, the mRNA sequence is first reverse transcribed into cDNA, and then measured by real-time fluorescence quantitative PCR method.

[0015] For example, the method for synthesizing cDNA by reverse transcription can be as follows:

[0016] Impurity removal: Add DNA degrading enzyme gDNA Eraser to the extracted total RNA to remove residual genomic DNA;

[0017] Reverse transcription: Add reverse transcriptase to reverse transcribe RNA into cDNA.

[0018] Accurate gene expression analysis requires only cDNA as a template. However, total RNA often contains genomic DNA, which can be directly amplified as a template in PCR reactions, resulting in inaccurate analysis results. To avoid this, the present invention preferably uses a two-step process: first, using a gDNA eraser with strong DNA degradation activity, heating the reaction (e.g., 42°C for 2 minutes) to remove residual genomic DNA, followed by reverse transcription using reverse transcriptase to synthesize cDNA.

[0019] In one embodiment, the mouse is a hACE2-KI / NIFDC model mouse.

[0020] Since the hACE2-KI / NIFDC model mouse is a humanized animal model in which human hACE2 gene cDNAs are inserted under the mouse mACE2 promoter on a C57BL / 6 mouse background, it can simulate human infection with the new coronavirus. Since mesenchymal stem cells can be used to treat new coronavirus infection, this model can better evaluate the research and treatment effects of mesenchymal stem cells in COVID-19. It is understandable that this detection method can also be used to evaluate other animal models such as mouse models and rat models.

[0021] In one embodiment, the real-time fluorescence quantitative PCR method uses the following amplification primer pairs for detection:

[0022] Upstream primer HCD29-F: 5'-TGTAACCAACCGTAGCAAAGG-3' (SEQ ID NO. 1)

[0023] Downstream primer HCD29-R: 5′-CCCCTGATCTTAATCGCAAAACC-3′ (SEQ ID NO. 2).

[0024] The present invention analyzed the human CD29 gene and found that it has 18 exons, while the mouse CD29 gene has 16 exons. Further sequence alignment led to the design of primers spanning exon regions of the human gene to ensure primer specificity. Designing primers to span at least one exon junction prevents amplification of genomic DNA, which could affect the results.

[0025] In one embodiment, in the detection step, the PCR reaction system is:

[0026] 2x SYBR Premix Ex Tag Il 10.0 µL

[0027] 10 nmol / L upstream primer 0.3 µL

[0028] 10 nmol / L downstream primer 0.3 µL

[0029] 2 µL of 50 ng / µL cDNA template

[0030] Add ddH20 to 20 µL.

[0031] In one embodiment, in the detection step, the PCR amplification reaction conditions are: 95°C for 30 s, followed by 95°C for 5 s and 60°C for 30 s as one cycle, 40 cycles, and collecting fluorescence at 60°C, and finally maintaining at 40°C for 5 s;

[0032] The detection conditions of the melting curve were as follows: maintaining at 65°C for 60 s, then heating from 65°C to 95°C, and measuring the fluorescence intensity of the system every 1 s.

[0033] In one embodiment, in the detection step, human mesenchymal stem cells are selected as positive samples to prepare a standard curve, and the concentration of human mesenchymal stem cells in each sample in the standard curve is: cells / mL.

[0034] The present invention also discloses the application of the above RT-qPCR detection method in evaluating the distribution of mesenchymal stem cells in an organism.

[0035] In one embodiment, the evaluation is an evaluation of the distribution of mesenchymal stem cells in the body.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The RT-qPCR detection method for detecting the distribution of human mesenchymal stem cells in mice of the present invention quantitatively detects the gene sequence corresponding to a specific protein (such as CD29 protein) on human mesenchymal stem cells. By sampling different tissues at predetermined time points after mesenchymal stem cell injection, the distribution of human mesenchymal stem cells in mice can be determined. Furthermore, this detection method and sample processing are relatively simple to operate, requiring only a standard RT-qPCR instrument, rather than an expensive flow cytometer. Furthermore, this method offers the advantages of speed and accuracy. Furthermore, this method enables rapid screening and validation of multiple samples, saving both cost and experimental time. Cell distribution can be determined using standard mathematical methods, yielding rapid results that can be immediately used in future research and drug development.

[0038] The RT-qPCR detection method for the distribution of human mesenchymal stem cells in mice established in the present invention can achieve the purpose of quickly and accurately detecting the in vivo distribution in multiple tissues at different time points, providing data support for the selection of stem cell products and being used in the evaluation of stem cell distribution in vivo. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the amplification curve of primer pair No. 1 in Example 1;

[0040] Figure 2 The amplification curve of primer pair No. 2 in Example 1 is shown;

[0041] Figure 3 This is the amplification curve of primer pair 3 in Example 1;

[0042] Figure 4 The amplification curves of primer pair 1 for RT-qPCR detection of mouse lung tissue at 2 h and 24 h are shown;

[0043] Figure 5 Schematic diagram of the standard curve for quantitative detection in Example 1;

[0044] Figure 6 This is a scatter plot of the flow cytometry experiment of animal lung tissue 2 hours and 24 hours after administration in Example 2. DETAILED DESCRIPTION

[0045] To facilitate understanding of the present invention, the present invention will be described more fully below with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the accompanying drawings. However, the present invention may be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the present disclosure.

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention pertains. The terms used in this specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0047] Unless otherwise specified, the reagents used in the following examples are all commercially available; the methods used in the following examples are all conventional methods unless otherwise specified.

[0048] Main instruments, equipment and reagents:

[0049] A Roche LC480 II fluorescence quantitative PCR instrument, a Thermo Nano Drop ultramicrospectrophotometer, a Mettler ME104E electronic balance, an ABI Veriti PCR amplifier, a Jingli BL-10D low-speed centrifuge, and a Sigma 3-18KS refrigerated centrifuge were used. RT-PCR kits, TB Premix Ex Taq II, and fluorescence quantitative PCR kits were all purchased from Dalian Takara Biotechnology.

[0050] Example 1

[0051] The RT-qPCR detection method was established.

[0052] 1. Primer design

[0053] After investigation and comparison, it was determined that CD29 could be a biomarker for human mesenchymal stem cells (hu-MSCs). CD29 is a strongly expressed antigen on the cell surface of MSCs, and MSCs from different tissues can express CD29, demonstrating its universal applicability. Therefore, RT-qPCR primers were designed based on the gene sequence of the human CD29 protein, and further comparisons were made between the corresponding mRNAs from human and mouse sources. This analysis revealed that the human CD29 protein gene (NCBI Gene ID: 3688) has 18 exons, while the mouse CD29 gene (NCBI Gene ID: 16412) has 16 exons, making it difficult to directly replicate the two. Further experimental screening, combined with sequence alignment, revealed that designing primers within the exon-spanning region of the human gene ensured primer specificity.

[0054] Considering that most RNA used for RT is isolated via Trizol extraction, primers should be designed to span at least one exon junction to prevent the amplification of genomic DNA. For RT-qPCR, a primer Tm (primer melting temperature) of 50-70°C and an amplified fragment length of 70-200 bp are generally suitable.

[0055] 2. Primer screening

[0056] A series of primer sets were designed and screened, and then synthesized by Shanghai Bioengineering Co., Ltd. The following describes only a portion of the primer screening process. The upstream primer HCD29-F and downstream primer HCD29-R targeted a 98-bp fragment; the upstream primer HCD29-F01 and downstream primer HCD29-R01 targeted a 208-bp fragment; the upstream primer HCD29-F02 and downstream primer HCD29-R02 targeted a 68-bp fragment.

[0057] Table 1. Primer pairs

[0058]

[0059] The target sequences amplified by the primer pairs 1-3 are shown in the following SEQ ID NOs. 7-9.

[0060] SEQ ID NO.7: TGTAACCAACCGTAGCAAAGGAACAGCAG AGAAGCTCAAGCCAGA GGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGG;

[0061] SEQ ID NO.8: CAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCGGACGCCGCGCGGAAAAGATGAATTTACAACCAATTTTCTGGATTGGACTGATCAGTTCAGTTTGCTGTGTGTTTGCTCAAACAGATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGGGTGGT;

[0062] SEQ ID NO. 9: GAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCGGACGCCGCGCGGAAAAGAT.

[0063] 2.1 Melting curve and melting temperature verification

[0064] The melting curve results of primer pairs No. 1-3 are as follows: Figure 1-3 shown.

[0065] To judge the specificity of primers, we can first look at whether the melting curve peak is single, and then look at the Tm value. The Tm value of the target gene of SYBR Green method is generally required to be between 80 and 90℃. According to these principles, it can be seen that the primer pair No. 1 has a single peak ( Figure 1 ), the peak is narrow and sharp, and there is no miscellaneous peak, indicating that the primers have good specificity and few dimers. The primer design specificity meets the experimental requirements. Primer pair No. 2 has a double peak ( Figure 2 ), double peaks indicate that the product is not specific, and there may be primer dimers or non-specific amplification. Although the primer pair No. 3 has a single peak ( Figure 3 ), but the amplification curve is incomplete and does not meet the experimental requirements.

[0066] The melting temperatures of these three primer pairs are: No. 1: 82.1°C, No. 2: 83°C and 93°C, No. 3: 93.1°C, among which No. 1 is 82.1°C, which is consistent with the melting curve judgment index of the SYBR Green method.

[0067] 2.2 Sample tissue amplification verification

[0068] Primers were screened using human mesenchymal stem cells and mouse tissue samples to further test the specificity of the HCD29 primer pair.

[0069] The experimental results are as follows Figure 4As shown, the results showed that the primer amplification curves were all "S"-shaped, with four obvious periods, and the CT values ​​of the replicate wells were consistent, with a difference of no more than 1 CT value.

[0070] 2.3 Primer specificity experimental verification

[0071] This pair of primers amplified in human cell samples but not in mouse tissues, indicating that the primers have good specificity and meet the experimental requirements. See the table below for details.

[0072] Table 2. Comparison of primer specificity for different samples

[0073]

[0074] Comprehensive melting curve results showed that this primer pair had a single peak and no other peaks appeared, indicating that there were few primer dimers and the melting temperature met the requirements. Primer pair No. 1 was selected for the formal experiment.

[0075] 3. Preparation of standard products and standard curves

[0076] First, the viability, quantity, and cell status of hu-MSC cells were quality controlled and the cell counting results were cells / mL, take 1 mL, extract the cell RNA and reverse transcribe it into cDNA for quantification as a standard, and perform 10-fold serial dilution to 、 There were 4 concentration gradients in total, and 3 replicates were performed for each gradient. The reaction system was 10 μL, and fluorescence quantitative amplification was performed.

[0077] The results are as follows Figure 5 As shown in the standard curve, the copy number and ct value are inversely proportional, and the regression equation is Y = -3.448x + 11.39 (R 2 >0.99), and the amplification efficiency was calculated by software based on the regression equation calculated from the standard curve to be 97.5%.

[0078] These results demonstrate that the RT-qPCR assay developed in this paper exhibits a single-peak melting curve with no other peaks and a melting temperature of 82.1°C, demonstrating specificity that meets experimental requirements. Furthermore, this primer pair amplified the gene in human mesenchymal stem cell samples but not in mouse tissue, demonstrating good specificity and reliable amplification conditions.

[0079] Example 2

[0080] The RT-qPCR assay for the distribution of human mesenchymal stem cells in mice involves sampling 10 tissue samples (<100 mg) from various mouse organs (brain, spinal cord (cervical), skeletal muscle, gonads (uterus and ovaries), bone marrow (femur), liver, kidney, spleen, heart, and lung). The assay involves the following steps:

[0081] 1. Cell Injection

[0082] Human umbilical cord mesenchymal stem cells were obtained and injected into hACE2-KI / NIFDC mice (reference: A Mouse Model of SARS-CoV-2 Infection and Pathogenesis, Cell Host & Microbe, 2020, 28, 1-10) via tail vein injection. The mice were then dissected 2 hours later and various organ tissues (brain, spinal cord (cervical segment), skeletal muscle, gonads (uterus and ovaries), bone marrow (femur), liver, kidney, spleen, heart, and lung 10 samples, tissue <100 mg) were collected for later use.

[0083] 2. Sampling

[0084] The TRIZOL method was used to extract genomic RNA from the above tissues and to detect RNA content and purity as follows:

[0085] 2.1 Weigh the fresh tissue soaked in RNA later, add Trizol (100 mg / ml), a rapid RNA extraction reagent, and further break it up with a tissue homogenizer until no large pieces of tissue are visible to the naked eye.

[0086] 2.2 Add 0.2 ml of chloroform, mix by inversion several times, let stand on ice for 5 min, and centrifuge at 12,000 rpm at 4°C for 5 min.

[0087] 2.3 Pipette about 0.5 ml of the upper aqueous phase into a new tube, add 0.5 ml of cold isopropanol, mix thoroughly by inversion, and place on ice for 10 min. Centrifuge at 120,000 rpm at 4°C for 10 min.

[0088] 2.4 Discard the supernatant and wash the precipitate with 0.5 ml of 75% ethanol (prepared with DEPC water). Centrifuge at 7,500 rpm at 4°C for 5 min. Pour off the ethanol and dry the pellet at room temperature. Dissolve the RNA in 40 µl of DEPC water. Check the purity and integrity by UV spectrophotometry and store at -80°C.

[0089] 2.5 Extraction of Cellular RNA Human mesenchymal stem cells were obtained, centrifuged, and then directly extracted and dissolved using the Trizol method and stored directly at -80°C.

[0090] 2.6. Determine the purity and concentration of the samples using NanoDrop-2000.

[0091] 3. Detection

[0092] 3.1 Reverse transcription

[0093] 3.1.1 Impurity Removal: Genomic DNA Reaction

[0094] Prepare the reaction mixture on ice, dispense it into each reaction tube, and finally add the RNA sample. The reaction system is shown in the table below.

[0095] Table 3. Reaction system for genomic DNA removal

[0096]

[0097] *In a 10 μl reverse transcription reaction system, a maximum of 1 μg of total RNA can be used in the reaction system.

[0098] After the reaction system was prepared, it was kept at 42°C for 2 min and then transferred to 4°C for maintenance.

[0099] 3.1.2. Reverse transcription reaction

[0100] Prepare the reaction mixture on ice and aliquot 10 μl into each reaction tube. Use the reverse transcription reaction system shown in the table below. Gently mix thoroughly and immediately proceed with the reverse transcription reaction. Reaction conditions: maintain at 37°C for 15 min, increase the temperature to 85°C for 5 s, and then transfer to 4°C for maintenance.

[0101] Table 4. Reverse transcription reaction

[0102]

[0103] 3.2 RT-qPCR

[0104] Reaction system:

[0105] Measure the cDNA concentration and dilute to 50 ng / µL. Prepare the following qRT-PCR reaction system: 10.0 µL of SYBR PremixEx Tag II (Tli RNase H Plus) (2x), 0.3 µL each of upstream and downstream primers (10 wmol / L), 2 µL of cDNA template, and add ddH20 to 20 µL.

[0106] Reaction conditions:

[0107] The cells were maintained at 95°C for 30 s, followed by 95°C for 5 s and 60°C for 30 s, for 40 cycles, during which fluorescence was collected at 60°C, and the cells were maintained at 40°C for 5 s.

[0108] The reaction system was mixed in a 96-well plate (MJ Research HSP29655) and sealed with an ultra-clean lid (MJ Research TCS20803) before reaction.

[0109] The reaction results were collected and analyzed using LC480 software. All samples were replicated three times on the same plate, and the values ​​are expressed as mean ± SD.

[0110] 4. Results

[0111] 4.1 RT-qPCR test results

[0112] RT-qPCR test data showed that the drug was distributed in different tissues and organs of mice 2 hours after administration, with the highest distribution in the lungs. The specific results are shown in Table 5.

[0113] Table 5. 2-hour RT-qPCR test data of 10 tissues in the experimental group

[0114]

[0115] Note: The above cell numbers were calculated based on the average Ct value.

[0116] When the lungs have the highest organ distribution, further expression detection and verification are carried out in the lungs of different mice at different time points. This not only saves costs but also allows for quick acquisition of experimental results.

[0117] RT-qPCR detection showed that hu-MSC cells were detected in the lung tissues of mice 2h and 24h after administration.

[0118] Specific as Figure 4 As shown, Figure 4 Schematic diagram of the real-time fluorescence PCR amplification results using primers HCD29-F and HCD29-F (primer pair 1) in lung tissue samples from six mice at two time points, 2 hours and 24 hours after drug administration. These samples were designated 2H-01, 2H-02, 24H-03, 24H-01, 24H-02, and 24H-03, respectively. RT-qPCR data for lung tissue are shown in Table 6. Cell counts can be quickly calculated using the CT value, which is superior to conventional flow cytometry, overcoming the limitation of conventional flow cytometry, which can only determine the proportion of positive cells but not the specific concentration within the tissue.

[0119] Table 6. RT-qPCR data in lungs

[0120]

[0121] 4.2 Verification Results

[0122] Preliminary experimental results showed that stem cells were most highly distributed in the lung tissue after injection. Therefore, lung tissue samples from the above mice were obtained and processed using enzymatic digestion and appropriate physical grinding methods. The proportion of total white blood cells in the mice at two time points, 2 hours and 24 hours, was statistically analyzed by flow cytometry, and qualitatively compared with the RT-qPCR detection data.

[0123] Querying hu-MSC cell-specific markers revealed that CD45 and HLA-DR were negatively expressed, and CD29 was positively expressed. All cells were circled, excluding cell debris and adherent cells; CD45-HLA-DR- cells were circled, and CD29 was analyzed. + The proportion of cells in the total leukocytes was statistically analyzed. Anti-human CD29 and CD45 fluorescently labeled antibodies were added to the experiment, and 1 million cell particles were obtained from each sample for flow cytometry analysis.

[0124] The results are shown in Table 7 and Figure 6 As shown in Figure 7, the mean HCD29+ ratio of total leukocytes in the experimental group mice was 6.29% ± 0.02% and 1.55% ± 0.01% at 2 hours and 24 hours after administration (Table 7). The flow cytometry scatter plot results are shown in ( Figure 6 ), from the experimental results, it can be seen that the distribution and action time of stem cells in lung tissue after injection can be repeated, and the specificity is good, which further verifies the experimental results of RT-qPCR.

[0125] Table 7. Flow cytometry data of animal lung tissue 2h and 24h after administration

[0126]

[0127] As can be seen from the above table, the RT-qPCR detection method of the present invention is consistent with the results of flow cytometry determination. Flow cytometric analysis shows that HCD29 is positively expressed 2 hours after administration, and the HCD90 marker can be detected 2 hours and 24 hours after administration, that is, hu-MSC cells are detected. Moreover, as time goes on, the cell content after 24 hours of administration is lower than that after 2 hours, which is consistent with the results of the RT-qPCR detection method established by the present invention. It can be seen that the method of the present invention has high accuracy and good reliability, and can be used to study the in vivo distribution and residence time of mesenchymal stem cells during the treatment of novel coronavirus infection.

[0128] In summary, the above results show that the SYBR Green I real-time fluorescence quantitative PCR detection method established in the present invention is a rapid and accurate method for detecting the distribution and action time of human mesenchymal stem cells in hACE2-KI homozygous humanized mice.

[0129] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0130] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims. Sequence Listing <110> China Food and Drug Inspection Institute <120> RT-qPCR detection method and application of the distribution of human mesenchymal stem cells in mice <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 tgtaaccaac cgtagcaaag g 21 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <400> 2 cccctgatct taatcgcaaa acc 23 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 cagcgggagt cgcggaacag 20 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence <400> 4 accacccaca atttggccct g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 gagaggccca gcgggagtcg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 atcttttccg cgcggcgtcc 20 <210> 7 <211> 98 <212> DNA <213> Artificial Sequence <400> 7 tgtaaccaac cgtagcaaag gaacagcaga gaagctcaag ccagaggata ttactcagat 60 ccaaccacag cagttggttt tgcgattaag atcagggg 98 <210> 8 <211> 208 <212> DNA <213> Artificial Sequence <400> 8 cagcgggagt cgcggaacag caggcccgag cccaccgcgc cgggccccgg acgccgcgcg 60 gaaaagatga atttacaacc aattttctgg attggactga tcagttcagt ttgctgtgtg 120 tttgctcaaa cagatgaaaa tagatgttta aaagcaaatg ccaaatcatg tggagaatgt 180 atacaagcag ggccaaattg tgggtggt 208 <210> 9 <211> 76 <212> DNA <213> Artificial Sequence <400> 9 gagaggccca gcgggagtcg cggaacagca ggcccgagcc caccgcgccg ggccccggac 60 gccgcgcgga aaagat 76

Claims

1. A RT-qPCR detection method for the distribution of human mesenchymal stem cells in mice for non-diagnostic purposes, characterized in that: The following steps are involved: Sampling: Organ tissues of mice injected with human mesenchymal stem cells were collected and total RNA was extracted for testing; Detection: The CD29 protein mRNA sequence in the above total RNA was reverse transcribed into cDNA, and then measured by real-time fluorescence quantitative PCR to obtain the distribution of human mesenchymal stem cells in mice; in the real-time fluorescence quantitative PCR method, the following amplification primer pairs were used for detection: Upstream primer HCD29-F: 5'-TGTAACCAACCGTAGCAAAGG-3' (SEQ ID NO. 1) Downstream primer HCD29-R: 5′-CCCCTGATCTTAATCGCAAAACC-3′ (SEQ ID NO. 2); The mice are hACE2-KI / NIFDC model mice.

2. The RT-qPCR detection method according to claim 1, characterized in that In the detection step, the PCR reaction system is: 2x SYBR Premix Ex Tag Il 10.0 µL 10 nmol / L upstream primer 0.3 µL 10 nmol / L downstream primer 0.3 µL 2 µL of 50 ng / µL cDNA template Add ddH20 to 20 µL.

3. The RT-qPCR detection method according to claim 2, characterized in that In the detection step, the PCR amplification reaction conditions are: 95°C for 30 seconds; then 95°C for 5 seconds, 60°C for 30 seconds as one cycle, 40 cycles, and collecting fluorescence at 60°C, and finally maintaining at 40°C for 5 seconds; The detection conditions of the melting curve were as follows: maintaining at 65°C for 60 s, then heating from 65°C to 95°C, and measuring the fluorescence intensity of the system every 1 s.

4. The RT-qPCR detection method according to claim 1, characterized in that In the detection step, human mesenchymal stem cells were selected as positive samples to prepare a standard curve. The concentration of human mesenchymal stem cells in each sample in the standard curve was: cells / mL.

5. Use of the RT-qPCR detection method according to any one of claims 1 to 4 for non-diagnostic purposes in evaluating the distribution of human mesenchymal stem cells in mice.

Images