A set of specific methylation markers related to colorectal cancer and detection kits thereof

Abstract

The present invention discloses a group of specific methylation markers related to colorectal cancer and a detection kit thereof. The methylation markers are 15 target CpG sites located on the B3GALNT1, C6orf97, FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 genes. The 15 CpG sites show a specific high methylation state in colorectal cancer tissues compared with other types of cancer tissues. The present invention detected the methylation levels of 10 CpG sites in colorectal cancer plasma cfDNA for the first time. By optimizing primers, probes and reaction systems, three multiplex digital PCR detection systems were established. The detection sensitivity of the detection method is significantly better than the conventional MethyLight detection method, and the detection limit can reach 0.032%. Multiplex digital PCR qualitatively and quantitatively measures the methylation levels of the 7 amplified fragments by calculating the number of methylated molecule copies per milliliter of plasma. The results show that it has the potential to become a non-invasive diagnostic marker for colorectal cancer, and at the same time has a certain ability to identify colorectal adenomas and distinguish other tumor patients.

Description

Technical Field

[0001] The present invention relates to a group of methylation markers related to colorectal cancer, and also relates to a kit for diagnosing colorectal cancer in a population, and belongs to the technical field of biomedicine. Background Art

[0002] According to GLOBOCAN 2020 estimates, colorectal cancer (CRC) ranks among the highest in both morbidity and mortality worldwide. Colorectal cancer has an insidious onset, and more than half of patients are already in the middle or late stages when diagnosed. The 5-year survival rate has dropped significantly, from 80% in the early stages (stage I / II) to 12%. Therefore, early screening and effective removal of colorectal cancer or precancerous lesions can greatly curb the occurrence and development of cancer and improve the survival rate of patients. Colonoscopy is currently a routine method for colorectal cancer screening and endoscopic treatment in clinical practice, but its invasiveness and relatively complex intestinal preparation process make patient compliance not high, only 30-55%. Some non-invasive screening methods, such as fecal occult blood tests, serum tumor markers CEA and CA199, etc., have limitations such as high false positive rates or limited sensitivity.

[0003] In recent years, liquid biopsy has emerged as a new type of tumor marker research and development field, that is, the identification of molecules released by the lysis or apoptosis of primary tumor cells or metastatic cells into body fluids such as blood, urine, saliva and pleural effusion, such as circulating tumor cells (CTC), circulating tumor DNA (ctDNA), circulating tumor RNA (ctRNA) and exosomes. Compared with traditional surgical biopsies, liquid biopsies are less invasive and heterogeneous, and can flexibly sample to dynamically monitor tumors (treatment effects and recurrence, etc.). The minimal invasiveness of blood tests and their convenience in routine medical examinations make them the most commonly used biological samples in liquid biopsies. In tumor patients, ctDNA in cfDNA is identified by tumor-specific genetic and epigenetic changes such as mutations, copy number variations and methylation levels, thereby achieving non-invasive diagnosis of cancer patients. DNA methylation is a dynamic, reversible and stably inherited epigenetic change that occurs on the CpG dinucleotide cytosine. DNA methylation is widely present in the genome and is crucial for gene regulation, transcript silencing and gene imprinting. Studies have shown that abnormal DNA methylation occurs in the early stages of many cancers, including colorectal cancer, and is cell or tissue specific, making it possible to construct methylation maps of different cancer tissues or cells. Therefore, the combination of epigenetic modification of DNA methylation and blood testing makes cfDNA methylation testing the most promising biomarker for liquid biopsy. SEPT9 gene methylation is the first commercialized blood cfDNA methylation marker for colorectal cancer screening. After extensive testing and review, research results show that its sensitivity for diagnosing colorectal cancer ranges from 37% to 96%, and its specificity ranges from 79% to 99%. However, studies have suggested that SEPT9 has varying degrees of increased methylation levels in cfDNA of patients with head and neck squamous cell carcinoma, lung cancer, and liver cancer, with a sensitivity of up to 82.7% in liver cancer. Therefore, early non-invasive detection of colorectal cancer should take tumor specificity into account while considering improving sensitivity, and further exploration of colorectal cancer-specific cfDNA methylation diagnostic markers is still needed. Summary of the invention

[0004] In order to fill the gap that there is currently no methylation marker that can achieve specific detection of colorectal cancer, one of the objectives of the present invention is to provide a group of methylation markers that can be used to specifically detect colorectal cancer.

[0005] A second object of the present invention is to provide a kit for detecting colorectal cancer based on the above-mentioned methylation markers.

[0006] In order to achieve the above object, the present invention adopts the following technical means:

[0007] The present invention first proposes a group of specific methylation markers associated with colorectal cancer, wherein the methylation markers are B3GALNT1, C6orf97, FAM72A, FAM72B, LIFR, OSMR, ZNF264 or ZNF543 gene sequences or fragments thereof containing at least one CpG methylation site, or any combination of the gene sequences or fragments thereof;

[0008] According to the genome annotation information of the 450K chip (GRCh37 / hg19), there is one CpG site on the B3GALNT1 gene, namely cg20841906, located at nucleotide 160822911 on the reverse strand of chromosome 3;

[0009] Among them, there is one CpG site on the C6orf97 gene, namely cg00117463, located at nucleotide 151815241 on the positive strand of chromosome 6;

[0010] There are two CpG sites on the FAM72A gene, namely cg00552973 and cg10439914. cg00552973 is located at nucleotide 206137054 on the reverse strand of chromosome 1, and cg10439914 is located at nucleotide 206137759 on the forward strand of chromosome 1.

[0011] There are 6 CpG sites on the FAM72B gene, namely cg07784526, cg18948743, cg08728856, cg00198436, cg07236150 and cg09169215. cg07784526 is located at nucleotide 120838320 of the positive strand of chromosome 1, cg18948743 is located at nucleotide 120838323 of the positive strand of chromosome 1, cg08728856 is located at nucleotide 120838718 of the positive strand of chromosome 1, cg00198436 is located at nucleotide 120839380 of the reverse strand of chromosome 1, and cg07236150 is located at nucleotide 120838323 of the reverse strand of chromosome 1. is located at nucleotide 120839385 of the reverse strand of chromosome 1, and cg09169215 is located at nucleotide 120839390 of the reverse strand of chromosome 1;

[0012] Among them, there is one CpG site on the LIFR gene, namely cg18174928, located at nucleotide 38557085 on the positive strand of chromosome 5;

[0013] Among them, there is one CpG site on the OSMR gene, namely cg17528648, located at nucleotide 38846100 on the positive strand of chromosome 5;

[0014] There are two CpG sites on the ZNF264 gene, namely cg26970847 and cg11140785. cg26970847 is located at nucleotide 57702793 of the reverse strand of chromosome 19, and cg11140785 is located at nucleotide 57703301 of the reverse strand of chromosome 19.

[0015] There is one CpG site on the ZNF543 gene, namely cg14786398, located at the 57831816th nucleotide on the reverse strand of chromosome 19.

[0016] Furthermore, the present invention also proposes a digital PCR kit for detecting methylation of colorectal cancer-related genes, the kit comprising a combination of digital PCR primers and probes for detecting CpG methylation sites of colorectal cancer-related genes FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 genes, and the kit also comprises a primer pair and a probe required for amplifying a fragment of an internal reference gene ACTB gene that needs to correct the loading amount, and the sequences of the primers and probes are as follows:

[0017]

[0018]

[0019] Among them, the FAM72A primer pair is used to amplify the FAM72A gene fragment, and the probe is used to detect one CpG site on the gene fragment, namely cg00552973, located at the 206137054 nucleotide of the reverse strand of chromosome 1; the FAM72B_1 primer pair is used to amplify the FAM72B gene fragment, and the probe is used to detect two CpG sites on the gene fragment, namely cg07784526 and cg18948743, cg07784526 is located at the 120838320 nucleotide of the positive strand of chromosome 1, and cg18948743 is located at the 120838323 nucleotide of the positive strand of chromosome 1; the FAM72B_2 primer pair is used to amplify the FAM72B gene fragment, and the probe is used to detect three CpG sites on the gene fragment, namely cg00198436, cg07236150 and cg09169215, cg00198436 is located at nucleotide 120839380 of the reverse strand of chromosome 1, cg07236150 is located at nucleotide 120839385 of the reverse strand of chromosome 1, and cg09169215 is located at nucleotide 120839390 of the reverse strand of chromosome 1; the LIFR primer pair is used to amplify the LIFR gene fragment, and the probe is used to detect a CpG site on the gene fragment, namely cg18174928, located at nucleotide 5 The OSMR primer pair is used to amplify the OSMR gene fragment, and the probe is used to detect a CpG site on the gene fragment, namely cg17528648, located at the 38846100 nucleotide on the positive chain of chromosome 5; the ZNF264 primer pair is used to amplify the ZNF264 gene fragment, and the probe is used to detect a CpG site on the gene fragment, namely cg11140785, located at the 57703301 nucleotide on the reverse chain of chromosome 19; the ZNF543 primer pair is used to amplify the ZNF543 gene fragment, and the probe is used to detect a CpG site on the gene fragment, namely cg14786398, located at the 57831816 nucleotide on the reverse chain of chromosome 19.

[0020] Among them, preferably, the 5' end of the probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, VIC / HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5, and the methylation probe and the internal reference gene probe used for CpG methylation site detection use different fluorescent groups, and the 3' end of the probe contains a fluorescent quenching group, and the fluorescent quenching group includes any one of MGB, BHQ-1, BHQ-2, and BHQ-3.

[0021] Preferably, the seven amplified fragments are combined into three multiplex digital PCR detection systems, multiplex ddPCR system 1 is used to amplify LIFR, ZNF264 and ZNF543 fragments, multiplex ddPCR system 2 is used to amplify FAM72A and FAM72B_2 fragments, and multiplex ddPCR system 3 is used to amplify FAM72B_1 and OSMR fragments; the digital PCR reaction system and conditions of the kit are as follows:

[0022] Digital PCR reaction system: PCR premix 2×ddPCR Supermix forProbes 10μL, primer final concentration range between 0.2μM-0.9μM, probe final concentration between 0.1μM-0.5μM, 0.002-70ng / uL template DNA, supplemented with RNase-free water to 21uL;

[0023] The digital PCR reaction conditions are as follows:

[0024] Pre-denaturation at 95°C for 10 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 60 seconds, for a total of 40 cycles, inactivate the enzyme at 98°C for 10 minutes, then maintain at 4°C; the heating and cooling rate is ≤2.5°C / s.

[0025] Preferably, the template DNA is DNA in the blood of the subject.

[0026] Among them, preferably, the template DNA is circulating cell free DNA (cfDNA), circulating tumor DNA (ctDNA) or circulating tumor cell (CTCs) DNA in peripheral blood plasma or serum.

[0027] Furthermore, the present invention also proposes the use of the digital PCR kit in the preparation of colorectal cancer diagnostic reagents.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The present invention uses databases such as TCGA to analyze the specific methylation spectrum of colorectal cancer tissues, screens out tumor methylation-specific markers, and mainly screens out 15 CpG sites distributed on B3GALNT1, C6orf97, FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 genes. The 15 CpG sites show a colorectal cancer tissue-specific high methylation state in 29 types of cancer tissues and peripheral blood leukocytes including colorectal cancer. Compared with the existing FDA-approved SEPT9 methylation marker, the 15 CpG sites screened by the present invention have higher colorectal cancer specificity. In addition, the present invention also proposes for the first time the primers, probes and kits used for detecting the methylation of 10 target CpG sites on FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 genes in human plasma DNA based on digital PCR technology. Compared with the existing detection method based on MethyLight technology to detect gene methylation, the detection method of the present invention has higher detection sensitivity. Based on the biomarkers screened by the present invention, it is possible to attempt to establish a rapid, sensitive, and specific detection method system for the diagnosis of colorectal cancer, which can help large-scale population screening and assist in the clinical diagnosis of colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The average methylation levels of 15 colorectal cancer-specific methylated CpG sites in 29 types of tumor tissues including colorectal cancer and colorectal cancer peripheral blood leukocyte DNA;

[0031] Note: The WBC at the bottom of Tumor Tissues is the average DNA methylation level of peripheral blood leukocytes in patients with colorectal cancer, while the WBC at the bottom of Normal Tissues is the average DNA methylation level of peripheral blood leukocytes in healthy controls;

[0032] Figure 2 The amplified fragments and signal distribution included in three multiplex digital PCR detection systems (Multiplex ddPCR, mddPCR);

[0033] Among them: (A) mddPCRassay 1, (B) mddPCR assay 2 and (C) mddPCR assay 3.

[0034] Note: Each single amplification system or multiple amplification system amplifies four templates, including positive quality control M, negative quality control U, RNase-free water and non-template control NTC;

[0035] Figure 3It is a comparative analysis of the detection sensitivity of multiplex digital PCR system 1 and multiplex MethyLightPCR (mqPCR) system 1;

[0036] Wherein: (A) The relationship between the Cq value of the amplification curve of the mqPCR assay 1 detection system and the log2 (methylation level of the standard); (B) The relationship between the relative methylation level (target gene copy number / gene copy number) of the mddPCR assay 1 detection system and the methylation level of the standard; (C) The droplet distribution of the gradient dilution standard amplified by the mddPCR assay 1, the solid line is the threshold manually set for dividing positive and negative droplets;

[0037] Figure 4 It is a comparative analysis of the detection sensitivity of multiplex digital PCR system 2 and multiplex MethyLightPCR system 2;

[0038] Wherein: (A) The relationship between the Cq value of the amplification curve of the mqPCR assay 2 detection system and log2 (methylation level of the standard); (B) The relationship between the relative methylation level (target gene copy number / gene copy number) of the mddPCR assay 2 detection system and the methylation level of the standard; (C) The droplet distribution of the gradient dilution standard amplified by the mddPCR assay 2, the solid line is the threshold manually set for dividing positive and negative droplets;

[0039] Figure 5 It is a comparative analysis of the detection sensitivity of multiplex digital PCR system 3 and multiplex MethyLightPCR system 3;

[0040] Wherein: (A) The relationship between the Cq value of the amplification curve of the mqPCR assay 3 detection system and the log2 (methylation level of the standard); (B) The relationship between the relative methylation level (target gene copy number / gene copy number) of the mddPCR assay 3 detection system and the methylation level of the standard; (C) The droplet distribution of the gradient dilution standard of the mddPCR assay 3 amplification, the solid line is the manually set threshold for dividing positive and negative droplets;

[0041] Figure 6 Diagnostic performance of three multiplex digital PCR detection systems.

[0042] Among them: (A) Box plot of the number of methylated molecule copies detected by three multiplex digital PCRs in each milliliter of plasma; (BD) ROC curves of the three multiplex digital PCR systems for distinguishing colorectal cancer from healthy controls. DETAILED DESCRIPTION

[0043] The present invention is described in detail below through specific embodiments so that those skilled in the art can easily implement the present invention according to the disclosure of this specification. The embodiments described below are only preferred examples of the present invention and are not intended to limit the present invention in other forms. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] Example 1 Screening and verification of cfDNA methylation markers for colorectal cancer

[0045] 1. Colorectal cancer tissue specificity

[0046] The present invention uses databases such as TCGA to analyze the specific methylation spectrum of colorectal cancer tissues, screens out colorectal cancer specific methylation markers, and screens out 15 CpG sites mainly distributed on B3GALNT1, C6orf97, FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 genes. Based on 29 cancer tissues including colorectal cancer in public databases such as TCGA and GEO and 450K methylation data from peripheral blood leukocytes of colorectal cancer and healthy people, it shows that the 15 CpG sites are specifically hypermethylated in colorectal cancer tissues, and the average methylation level is Figure 1 The genomic information of the 15 CpG sites is shown in Table 1. The diagnostic effect of the 15 CpG sites was evaluated using 395 colorectal cancer tissues and 45 paracancerous tissues in the TCGA database, and three datasets from GEO (GSE48684, GSE101764, and GSE131013), including 270 colorectal cancer tissues and 334 paracancerous tissues. The ROC curve analysis results showed that the AUC range of the 15 CpG sites was 0.643-0.903, and the sensitivity and specificity of diagnosing colorectal cancer were between 43.5%-80.3% and 91.0%-98.9%, respectively. The detailed results are shown in Table 2.

[0047] Based on the above results, the 15 CpG sites screened by the present invention are colorectal cancer tissue-specific hypermethylated sites and have certain diagnostic capabilities.

[0048] Table 1 Genomic information of colorectal cancer tissue-specific methylated CpG sites

[0049]

[0050] Note: The genomic position refers to the 450K chip annotation information (GRCh37 / hg19)

[0051] Table 2 Diagnostic performance of 15 CpG sites in differentiating colorectal cancer from adjacent tissue samples in four datasets

[0052]

[0053] Example 2 Establishment of multiplex ddPCR detection method and kit

[0054] The present invention adopts droplet digital PCR (ddPCR) to quantitatively detect the methylation level of candidate markers in plasma cfDNA.

[0055] 1. Primer and probe design

[0056] Following the conventional MethyLight primer and probe design principles, a total of 7 amplification fragments were successfully designed, including 10 candidate CpG sites located on the FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 genes. The amplification primers included universal / methylation sequence amplification primers and internal reference gene sequence amplification primers. The TaqMan probes included methylation probes and internal reference gene probes. The nucleotides for connecting the reporter fluorescent group and the quenching group, the methylation probe and the internal reference gene probe should use different fluorescent groups such as FAM, VIC, etc., referring to the fluorescence range of the digital PCR machine. The quenching group can choose the MGB group that can increase the probe annealing temperature, or use a lock probe; the ddPCR reaction primer and probe sequences are shown in Table 3, in which Y represents the degenerate base T / C; R represents the degenerate base A / G.

[0057] Table 3 Primer and probe sequences of digital PCR detection system

[0058]

[0059] In an exemplary embodiment of the present invention, the main feature of the ddPCR technology used is that the PCR mixture is added to the droplet generator, and each reaction well generates about 10,000 to 20,000 droplets, each droplet contains 0-1 copies of the target gene fragment or background DNA, and the droplet is determined to be positive or negative according to the end point signal after PCR amplification, and the copy number in the original template is calculated in combination with the Poisson distribution. Unlike traditional methylation-specific PCR, it is not affected by PCR inhibitors and does not rely on standard curve quantification, and can absolutely quantify rare methylation events in low-concentration DNA samples. In each PCR layout, positive quality control products (M), negative quality control products (U), RNase-free water H2O and template-free control NTC should be included at the same time. The so-called positive quality control product can be fully methylated human genomic DNA treated with bisulfite, and the negative quality control product can be sulfurized non-methylated human genomic DNA. The threshold values ​​of quality control, H2O and NTC are set to determine whether the sample contains methylated DNA target molecules of human FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 genes, and the number of target DNA methylated molecules of human FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 per milliliter of plasma is determined. Data analysis is performed using corresponding commercial software (such as QuantaSoft, Bio-Rad).

[0060] 2. Extraction and preparation of DNA samples

[0061] The DNA template detected by the present invention can be derived from circulating free DNA (cfDNA), circulating tumor DNA (ctDNA) extracted from the peripheral blood plasma / serum of the subject to be tested, or by extracting DNA from circulating tumor cells; the specific operation is described in detail as follows.

[0062] 1) Extraction of cfDNA / ctDNA from samples to be tested

[0063] A total of 368 blood samples were collected in the present invention, including 195 patients with colorectal cancer, 22 patients with adenoma, 5 patients with polyps, 102 healthy controls, 20 patients with breast diseases (14 of which were breast cancer) and 24 patients with lung diseases (18 were lung cancer). The basic information is shown in Table 4. 3-5 mL of plasma or serum was obtained for each sample, and a commercial free nucleic acid extraction kit such as QIAamp Circulating Nucleic Acid Kit was used to extract DNA samples from plasma or serum, and the specific operation was carried out according to the kit operation manual.

[0064] Table 4 Clinical and demographic characteristics of blood samples

[0065]

[0066]

[0067] 2) Sulfurization of DNA samples to be tested

[0068] Use commercial kits such as EZ DNAMethylation-Gold TM The kit treats the extracted DNA to be tested with bisulfite, and the specific operation is carried out according to the kit operation manual.

[0069] 3. Multiplex droplet digital PCR (mddPCR) detection system

[0070] Using QX200 TM DropletDigital TM The mddPCR detection system was used for the PCR System (Bio-Rad). For specific steps, please refer to the operation manual. In order to improve the utilization rate of cfDNA samples and the sensitivity of detection, multiple targeted amplification fragments were combined into the same reaction well to establish a multiplex digital PCR (Multiplex ddPCR, mddPCR) detection system. Limited by the choice of fluorescence channels of ddPCR (dual channels, FAM and VIC), the FAM fluorescent group was used to label all target site methylation probes, while the VIC fluorescent group was used to label the internal reference gene probe (ACTB). According to the signal value distribution of the positive droplets and negative droplets of the methylation standard in different amplification fragment systems, three multiple amplification systems were successfully constructed by combining 7 amplification fragments ( Figure 2 ): mddPCR assay 1 contains ZNF543, ZNF264 and LIFR amplified fragments, mddPCR assay 2 contains amplified fragments FAM72A and FAM72B_2, and mddPCR assay 3 contains amplified fragments OSMR and FAM72B_1. During the experiment, the primer and probe concentration ratio in the system may be changed according to the space temperature and operation time, and the corresponding droplet signal distribution and threshold line fluctuate within a reasonable range. In addition, the fluorescence background and amplification effect of probes synthesized in different batches (some specific sequence probes labeled with MGB) may vary greatly. The final concentration of the probe in the system can be adjusted according to the fluorescence signal distribution results, or gradient PCR can be used to determine the optimal annealing temperature.

[0071] (1) mddPCR reaction system: The sulfurized sample was divided into three parts, and three multiplex digital PCR reaction systems were prepared respectively. The working concentrations of primers and probes were 20 μM and 10 μM, respectively. The probe solution should be protected from light. The total reaction volume was 21 μL. The specific system preparation is shown in Table 5.

[0072] Table 5 Preparation of three mddPCR detection reaction systems

[0073]

[0074] (2) Preparation and amplification of droplet PCR reaction system: Add the prepared system to the 8 wells in the middle row of the droplet generator card, add 70 μL of droplet generator oil to the empty well below, put a rubber pad on it, and slowly transfer it to the droplet generator to generate droplets. 10,000-20,000 droplets will be generated in about 2 minutes. Pipette 40 μL of the prepared droplets and slowly transfer them to a 96-well plate. After sealing the film, the PCR reaction should be carried out within 30 minutes, or placed in a 4°C refrigerator for PCR within 4 hours. The PCR reaction can be carried out in any 96-well PCR instrument according to the set reaction conditions.

[0075] The amplification conditions of the above PCR reaction are pre-denaturation at 95°C for 10 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 60 seconds, for a total of 40 cycles, inactivation of the enzyme at 98°C for 10 minutes, and then maintaining at 4°C; the heating and cooling speed is ≤2.5°C / s.

[0076] (3) Evaluation of sensitivity of multiplex digital PCR detection

[0077] In order to evaluate the detection sensitivity of the mddPCR system, the diluted M standard (2.5ng / μL) and U standard (2.5ng / μL) were prepared into a series of standards with methylation levels of 100%, 20%, 4%, 0.8%, 0.16%, 0.032%, 0.006% and 0% in different volumes, and the total mass of DNA loading was controlled at about 10ng; the same standard series was also tested on multiplex MethyLight PCR (Multiplex MethyLight, mqPCR), and all standard series were tested four times to compare the detection performance of the two. Except that the detection reagent was KAPA PROBE FAST qPCR Master Mix (2X) Kit (Roche), the rest of the system preparation was consistent with digital PCR. Methylation detection was performed on the LightCycler 480II real-time fluorescence quantitative PCR instrument, and Roche's Abs Quant / Fit Points module was used to analyze the experimental results after the experiment was completed. The experimental steps and experimental running conditions refer to digital PCR. Figure 3-Figure 5 As shown, the multiplex digital PCR detection system constructed by the present invention can detect methylation levels as low as 0.032%, and its detection sensitivity is 5-125 times higher than that of multiplex MethyLight PCR.

[0078] (4) Signal detection and result determination: After PCR amplification, the 96-well plate was placed in a droplet reader, and the droplets of each sample were aspirated according to the set order and passed through a dual-color detector (Bio-Rad) along with the droplet reading oil. The number of methylated molecule copies per milliliter of plasma in the sample to be tested was calculated using QuantaSoft (version 1.7) software.

[0079] 4. Effectiveness of the testing system and criteria for judging the results

[0080] Multiplex digital PCR detection system effectiveness and result judgment:

[0081] a) Positive quality control (M): If there are 2 or more positive droplets in the FAM (Ch1) channel and the VIC (Ch2) channel, and no more than 1 positive droplet in the RNase-free water / NTC, the positive quality control is considered valid. Otherwise, prepare it again.

[0082] b) Negative control (U): If there are 2 or more positive droplets in the VIC (Ch2) channel and no more than 1 positive droplet in the FAM (Ch1) channel and RNase-free water / NTC, the negative control is considered valid. Otherwise, prepare it again.

[0083] c) Result determination: The threshold line is drawn based on positive and negative quality control products, RNase-free water / NTC. Samples with a total droplet count of less than 8,000 or no positive droplets in the VIC channel are excluded. Samples with at least 2 positive droplets above the threshold line in the FAM channel are considered methylation-positive samples. The copies of methylated molecules per milliliter of plasma (copies / mL) are calculated. The quality control product test results are shown in Figure 2 .

[0084] 5. Test results and analysis

[0085] like Figure 6As shown in the figure, the number of methylated molecule copies detected in the blood samples of colorectal cancer patients was significantly higher than that of healthy controls and non-colorectal cancer patients. The results of ROC curve analysis showed that the AUCs of mddPCR assay 1, mddPCR assay 2 and mddPCRassay 3 for distinguishing colorectal cancer from healthy controls were 0.769 (95% CI: 0.730-0.809), 0.842 (95% CI: 0.807-0.878) and 0.774 (95% CI: 0.736-0.813), respectively. The samples in which methylated molecules were detected were judged as methylation positive. A total of 113 colorectal cancer patients were judged as positive in mddPCR assay 1, with a sensitivity of 57.9%. The sensitivities of mddPCRassay 2 and mddPCR assay 3 were 71.8% and 57.9%, respectively, and the corresponding specificities were 93.1%, 93.1% and 96.1%, respectively. The sensitivity of the three detection systems increased with the increase of TNM stage, ranging from 35.9% to 94.4%. In addition, the three detection systems also have a certain diagnostic ability in patients with early colorectal cancer adenomas and polyps, with a sensitivity of 22.7% to 31.8% in adenomas (Table 6).

[0086] Table 6 Methylation positive rates of three multiplex digital PCR detection systems in cfDNA of colorectal cancer patients

[0087]

[0088] The number of methylated molecule copies detected per milliliter of plasma in the three systems was added to evaluate their combined diagnostic effect. The combined analysis results of the three systems were named combined_7 (a total of 7 detection fragments), and the cutoff value was set to 0. A total of 165 patients with 195 colorectal cancer patients were judged to be positive, with a sensitivity of 84.6% and a corresponding specificity of 84.3% (Table 7); the false positive rates in patients with breast and lung diseases were 45% and 50%, respectively. Considering that the false positive rate of mddPCR assay 1 in patients with non-colorectal cancer was high, the results of mddPCR assay 2 and mddPCR assay 3 were combined and analyzed, named combined_4 (a total of 4 detection fragments), and the sensitivity and specificity of diagnosing colorectal cancer were 78.5% and 89.2%, respectively; the misdiagnosis rates in breast and lung diseases were 30.0% and 33.3%, respectively.

[0089] Table 7 Methylation positive rate of multi-system combined analysis in colorectal cancer cfDNA in the present invention

[0090]

[0091] The preferred specific implementation modes and implementation examples of the present invention are described in detail above, but the present invention is not limited to the above implementation modes and implementation examples. Various changes can be made within the knowledge scope of technicians in this field without departing from the concept of the present invention. Sequence Listing <110> Harbin Medical University <120> A set of specific methylation markers associated with colorectal cancer and detection kits thereof <130> klpi220143 <141> 2022-05-13 <160> twenty four <170> SIPOSequenceListing 1.0 <210> 1 <211> 26 <212> DNA <213> artificial sequence <400> 1 gggataattggagttgtataygttyg <210> 2 <211> twenty three <212> DNA <213> artificial sequence <400> 2 ccctcacctctaaaacaaccttc <210> 3 <211> 13 <212> DNA <213> artificial sequence <400> 3 taccgcctcccgc <210> 4 <211> twenty three <212> DNA <213> artificial sequence <400> 4 tyggtgttttagtttttggagga <210> 5 <211> 19 <212> DNA <213> artificial sequence <400> 5 cccgacgaaatcctacgaa <210> 6 <211> 13 <212> DNA <213> artificial sequence <400> 6 acgacgaaaactc <210> 7 <211> 29 <212> DNA <213> artificial sequence <400> 7 gatgtttagttygagattygatagtaggg <210> 8 <211> 22 <212> DNA <213> artificial sequence <400> 8 aaacatcccttccccaacatta <210> 9 <211> 13 <212> DNA <213> artificial sequence <400> 9 ccgaaacgctccg <210> 10 <211> 23 <212> DNA <213> artificial sequence <400> 10 ygagaaaggtygagtgygygayg <210> 11 <211> 27 <212> DNA <213> artificial sequence <400> 11 caaaacactatttacaacracaacaac <210> 12 <211> 18 <212> DNA <213> artificial sequence <400> 12 acgcgatcctccccgcaa <210> 13 <211> 21 <212> DNA <213> artificial sequence <400> 13 tcgcgtttgtttcgtagttga <210> 14 <211> 23 <212> DNA <213> artificial sequence <400> 14 craactccraaacraacrtacaa <210> 15 <211> 14 <212> DNA <213> artificial sequence <400> 15 aacgacccgaaccg <210> 16 <211> 20 <212> DNA <213> artificial sequence <400> 16 gyggtttagggggtgaygtg <210> 17 <211> 22 <212> DNA <213> artificial sequence <400> 17 caccrtccactcacctaaaccc <210> 18 <211> 14 <212> DNA <213> artificial sequence <400> 18 ccgtcaacaccgct <210> 19 <211> 21 <212> DNA <213> artificial sequence <400> 19 ggataygggygatttttgygg <210> 20 <211> 23 <212> DNA <213> artificial sequence <400> 20 ctcacraaaataacrtcacrcra <210> 21 <211> 13 <212> DNA <213> artificial sequence <400> 21 tccgccgccctaa <210> 22 <211> 24 <212> DNA <213> artificial sequence <400> 22 ggttaagtgtgattttgtggtgtg <210> 23 <211> 23 <212> DNA <213> artificial sequence <400> 23 ccttttacaaaattcaccctcct <210> 24 <211> 14 <212> DNA <213> artificial sequence <400> 24 accctctactaccc

Claims

1. A specific methylation marker combination associated with colorectal cancer, characterized in that: The methylation marker combination is selected from one of the following combinations: 1) Combination 1: a combination of gene sequences or fragments thereof containing CpG methylation sites cg18174928, cg11140785 and cg14786398; 2) Combination 2: a combination of gene sequences or fragments thereof containing CpG methylation sites cg00552973, cg00198436, cg07236150 and cg09169215; 3) Combination 3: a combination of gene sequences or fragments thereof containing CpG methylation sites cg07784526, cg18948743, and cg17528648; 4) Combination 4: a combination of gene sequences or fragments thereof containing CpG methylation sites cg00552973, cg00198436, cg07236150, cg09169215, cg07784526, cg18948743 and cg17528648; 5) Combination 5: a combination of gene sequences or fragments thereof containing CpG methylation sites cg18174928, cg11140785, cg14786398, cg00552973, cg00198436, cg07236150, cg09169215, cg07784526, cg18948743 and cg17528648; According to the genome annotation information of the 450K chip, there is one CpG site on the FAM72A gene, namely cg00552973, located at nucleotide 206137054 on the reverse strand of chromosome 1; There are 5 CpG sites on the FAM72B gene, namely cg07784526, cg18948743, cg00198436, cg07236150 and cg09169215. cg07784526 is located at the 120838320th nucleotide of the positive strand of chromosome 1, cg18948743 is located at the 120838323rd nucleotide of the positive strand of chromosome 1, cg00198436 is located at the 120839380th nucleotide of the reverse strand of chromosome 1, cg07236150 is located at the 120839385th nucleotide of the reverse strand of chromosome 1, and cg09169215 is located at the 120839390th nucleotide of the reverse strand of chromosome 1. Among them, there is one CpG site on the LIFR gene, namely cg18174928, located at nucleotide 38557085 on the positive strand of chromosome 5; Among them, there is one CpG site on the OSMR gene, namely cg17528648, located at nucleotide 38846100 on the positive strand of chromosome 5; Among them, there is one CpG site on the ZNF264 gene, namely cg11140785, located at nucleotide 57703301 on the reverse strand of chromosome 19; There is one CpG site on the ZNF543 gene, namely cg14786398, located at the 57831816th nucleotide on the reverse strand of chromosome 19.

2. A digital PCR kit for detecting methylation of colorectal cancer-related genes, characterized in that: The kit includes a combination of digital PCR primers and probes for detecting CpG methylation sites of colorectal cancer-related genes FAM72A, FAM72B, LIFR, OSMR, ZNF264 and ZNF543 genes. The kit also includes a primer pair and probe required for amplifying a fragment of the internal reference gene ACTB gene that needs to correct the loading amount. The sequences of the primers and probes are as follows: The FAM72A primer pair was used to amplify the FAM72A gene fragment, and the probe was used to detect a CpG site on the gene fragment, namely cg00552973, located at the 206137054 nucleotide on the reverse strand of chromosome 1; the FAM72B_1 primer pair was used to amplify the FAM72B gene fragment, and the probe was used to detect two CpG sites on the gene fragment, namely cg07784526 and cg18948743, cg07784526 was located at the 12083 nucleotide on the positive strand of chromosome 1. The primer pair FAM72B_2 was used to amplify the FAM72B gene fragment, and the probe was used to detect the three CpG sites on the gene fragment, namely cg00198436, cg07236150 and cg09169215. cg00198436 was located at the 120839380 nucleotide of the reverse strand of chromosome 1, and cg07236150 was located at the 120839380 nucleotide of the reverse strand of chromosome 1. The LIFR primer pair was used to amplify the LIFR gene fragment, and the probe was used to detect a CpG site on the gene fragment, namely cg18174928, located at nucleotide 38557085 on the positive strand of chromosome 5; the OSMR primer pair was used to amplify the OSMR gene fragment, and the probe was used to detect a CpG site on the gene fragment, namely cg17528648, located at nucleotide 38557085 on the positive strand of chromosome 5. The ZNF264 primer pair is used to amplify the ZNF264 gene fragment, and the probe is used to detect a CpG site on the gene fragment, namely cg11140785, which is located at the 57703301 nucleotide on the reverse strand of chromosome 19; the ZNF543 primer pair is used to amplify the ZNF543 gene fragment, and the probe is used to detect a CpG site on the gene fragment, namely cg14786398, which is located at the 57831816 nucleotide on the reverse strand of chromosome 19.

3. The digital PCR kit according to claim 2, characterized in that: The 5' end of the probe contains a fluorescent reporter group, which includes any one of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5. The methylation probe and the internal reference gene probe used for CpG methylation site detection use different fluorescent groups. The 3' end of the probe contains a fluorescent quenching group, which includes any one of MGB, BHQ-1, BHQ-2, and BHQ-3.

4. Use of the digital PCR kit according to claim 2 or 3 in the preparation of a colorectal cancer diagnostic reagent.

Images