A QTL controlling wheat plant height and its candidate gene TaDHL-7B and its application
By locating QTL QPh-7B-1242 on wheat chromosome 7B and screening out the TaDHL-7B gene, and using CRISPR/Cas9 technology to edit the wheat plant height gene, the problem of few wheat plant height gene clones was solved, and a significant reduction in wheat plant height and an improvement in genetic improvement efficiency were achieved.
Patent Information
- Application Number
- CN202210566066.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-23
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2042-05-23
AI Technical Summary
In the prior art, there are few clones of wheat plant height genes, making it difficult to effectively carry out genetic improvement to increase yield.
The QTL QPh-7B-1242 was located on wheat chromosome 7B using CRISPR/Cas9 gene editing technology, and the candidate gene TaDHL-7B was screened. Gene editing was performed to reduce plant height, and amplification primers were used to detect and screen dwarf varieties.
It achieved a significant reduction in wheat plant height, improved the efficiency of wheat genetic improvement, accelerated the screening process of dwarf varieties, and promoted the increase in wheat yield.
Smart Images

Figure CN114921583B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of wheat molecular genetic breeding, and in particular relates to a QTL for controlling wheat plant height, a candidate gene TaDHL-7B thereof, and applications thereof. Background Art
[0002] Wheat (Triticum aestivum L., 2n=6X=42, AABBDD) is one of the most important grain crops worldwide. Increasing wheat yield has always been a major challenge in my country. Given my country's large population and limited arable land, increasing yield per unit area is the primary approach to achieving this goal. QTLs for wheat yield traits have been a hot topic in wheat genetic research, but few genes have been cloned. Plant height is a key trait affecting yield, and the isolation and identification of wheat plant height genes is crucial for genetic improvement of wheat yield.
[0003] Currently, 25 plant height-reducing genes (Rht) have been named in wheat. Among them, the Green Revolution genes Rht1 (Rht-B1b), Rht2 (Rht-D1b), Rht8, and Rht9 have been widely used worldwide. To date, only a few plant height-reducing genes have been cloned. Rht1 (Rht-B1b) and Rht2 (Rht-D1b) were cloned as early as 1999; in recent years, Rht8 (TraesCSU02G024900 or TraesCSU03G0022100), Rht24 (TraesCS6A02G221900), and TaWUS-like (WUS CHEL-related homeobox-like) have been cloned.
[0004] CRISPR / Cas9 genome editing technology can fully utilize existing genomic information to rapidly validate initially identified candidate genes, accelerating trait improvement and, consequently, the breeding process. Verification of plant height genes through CRISPR / Cas9 gene editing provides a theoretical basis for using these genes for genetic improvement of plant height. Summary of the Invention
[0005] The present invention aims to provide a QTL controlling wheat plant height and its candidate gene TaDHL-7B and applications thereof. The QTL and its candidate gene TaDHL-7B are beneficial to the breeding of dwarf wheat varieties.
[0006] In order to achieve the above-mentioned purpose of the invention, the technical solution adopted by the present invention is:
[0007] The present invention provides a QTL for controlling wheat plant height. The QTL is QPh-7B-1242, located on chromosome 7B, and has a genetic distance of 1234.5 to 1252.5 cM.
[0008] Further, the QTL has a positive additive effect, which increases plant height, and the allele of the QTL is from the maternal variety Tainong 18.
[0009] The application further provides a candidate gene of the QTL for controlling plant height of wheat, and the candidate gene is TaDHL-7B, and the nucleotide sequence of the candidate gene is shown as SEQ ID No. 1.
[0010] The application further provides an encoded protein of the candidate gene, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 2.
[0011] The application further provides application of the QTL or the candidate gene in genetic improvement of a plant height trait of wheat.
[0012] Further, in application, the plant height of wheat can be reduced by knocking out the candidate gene.
[0013] Further, the mutant genotypes of the wheat plant lines obtained by knocking out the candidate gene are AAbbDD(-5bp) and AAbbDD(-1bp).
[0014] Further, the mutant genotype AAbbDD is a deletion of 5bp at 285bp of the 2nd exon region of the candidate gene TaDHL-7B, and the mutant genotype AAbbDD encodes the amino acid sequence shown as SEQ ID No. 3.
[0015] Further, the mutant genotype AAbbDD is a deletion of 1bp at 286bp of the 2nd exon region of the candidate gene TaDHL-7B, and the mutant genotype AAbbDD encodes the amino acid sequence shown as SEQ ID No. 4.
[0016] The application further provides application of the QTL or the candidate gene in identifying or screening a dwarf wheat variety or line.
[0017] Further, the candidate gene is used to detect allelic variations of the candidate gene in a wheat variety or line, so that the process of identifying or screening a dwarf wheat variety or line is accelerated.
[0018] Further, in the detection process, the amplification primers of the candidate gene are as follows:
[0019] TaDHL-7B-F: CCTCTCTCGAATCATTCGCC;
[0020] TaDHL-7B-R: TGAAGAAGGAACCTAAATG.
[0021] Compared with the prior art, the application has the following beneficial effects and advantages:
[0022] Based on QTL analysis results in common wheat, this study located a major QTL for plant height stability, QPh-7B-1242, on chromosome 7B. Within its peak region, a candidate gene, TaDHL-7B, was identified. TaDHL-7B encodes an ATP-dependent DNA helicase. Collinearity analysis and expression level analysis revealed that TaDHL-7B is constitutively expressed and relatively conserved.
[0023] 2. The present invention uses the CRISPR / Cas9 system to perform gene editing on the B subgroup of the TaDHL-7B gene. A total of two homozygous mutant genotypes, AAbbDD (-5bp) and AAbbDD (-1bp), were obtained in the T2 generation. These two mutant genotypes will cause frameshift mutations and cause the stop codon to appear prematurely, resulting in inactivation of protein function. Pond and pot experiments showed that the homozygous mutants were significantly lower in plant height than the wild type, proving that the TaDHL-7B gene controls plant height. Therefore, the TaDHL-7B gene is beneficial to the genetic improvement and molecular breeding of wheat plant height traits, and can accelerate the screening of dwarf wheat varieties, or be used to regulate wheat plant height. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 The physical interval, QTL positioning and gene editing of TaDHL-7B; among them, a: a plant height QTL - QPh-7B-1242 was located using the TL-RIL population and its unigene genetic map (UPG-Map), and its peak interval included a candidate gene TraesCS7B02G055300; b: TaDHL-7B was gene-edited using the CRISPR / Cas9 system, proving that TaDHL-7B controls plant height.
[0025] Figure 2 These are the DNA sequences of Tainong 18 (TN18), Linmai 6 (LM6), Fielder and the mutant genotypes AAbbDD (-5bp) and AAbbDD (-1bp).
[0026] Figure 3 Characteristics of TaDHL-7B; a: phylogenetic tree of TaDHL-7B gene; b: collinearity analysis; c: expression levels of TaDHL-7B gene in different tissues and stages. DETAILED DESCRIPTION
[0027] The technical solution of the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments, but the scope of protection claimed in the present invention is not limited to the scope of the examples. In the following examples, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.
[0028] The wheat varieties used in the present invention: QTL mapping materials are the winter wheat varieties (lines) "Tainong 18" and "Linmai No. 6" and their recombinant inbred line populations (TL-RILs); the gene editing material is Fielder, and the above materials can all be obtained from Shandong Agricultural University.
[0029] Example 1: Determination of candidate genes for wheat plant height
[0030] IciMapping 4.1, WinQTLCart 2.5 and MAPQTL 6.0 software were used to analyze QTL for plant height in the TL-RIL population (Tainong 18 / Linmai 6).
[0031] QTL analysis of the TL-RIL population revealed (Table 1) that all three software programs simultaneously identified a stable QTL for plant height, QPh-7B-1242; this QTL is not associated with yield-related traits. The additive effect of QPh-7B-1242 was positive, indicating that its effect on plant height was derived from the maternal line, Tainong 18. The QTL peak was located between 1234.5 and 1252.5 cM and contained only one candidate gene, TraesCS7B02G055300 ( Figure 1 a). This gene encodes an ATP-dependent DNA helicase and was named TaDHL-7B. A nonsynonymous SNP (from arginine in Tainong 18 to tryptophan in Linmai 6) occurs at exon 1451 bp (ATG start). These results indicate that TaDHL-7B is a candidate gene for QPh-7B-1242.
[0032] Table 1: QTL analysis results for plant height in TL-RIL population (QPh-7B-1242)
[0033]
[0034] Note: F, field experiment; M, nutrient element experiment. CK, normal N, P, and K; LN, low N; LP, low P; LK, low K. Years 11, 2011; 14, 2014; 15, 2015; 16, 2016.
[0035] Example 2: Characteristics of the TaDHL-7B gene
[0036] 1. Experimental methods:
[0037] PCR amplification using TaDHL-7B amplification primers:
[0038]
[0039] PCR amplification system:
[0040]
[0041] PCR amplification program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 5 min, repeated for 30 cycles; extension at 72°C for 10 min.
[0042] Fielder seeds germinated with 3‰ H2O2 were placed flat, embryo-side down, on a 9cm thick medium covered with double-layer filter paper. They were soaked in water for 2-3 days until they began to root and then transplanted into pots. Throughout their growth period, samples were collected at the tillering stage (main stem, tillers, and roots), jointing stage (ears, leaves, and stems), flag stage (ears, flag leaves, second-to-last leaf, and stems), heading stage (ears, flag leaves, second-to-last leaf, and stems), flowering stage (ears, flag leaves, and stems), and grain filling stage (grains, husks, flag leaves, and stems).
[0043] Total RNA extraction from wheat was performed according to the protocol provided by Beijing Tiangen Biochemical Technology Co., Ltd. Using the extracted RNA as a template, first-strand synthesis was performed according to the protocol provided by Beijing Tiangen Biochemical Technology Co., Ltd. Thaw the template RNA, 10× lnR RT Buffer, lnR RT Enzyme Mix, lnR-RT Primer Mix, and RNase-Free ddH2O on ice. The reaction system was as follows:
[0044]
[0045] The obtained cDNA was stored at -20°C for use in the next experiment.
[0046] According to the Chinese Spring Refseqv1.1 annotation, the homologous genes of TaDHL-7B are TaDHL-7A (TraesCS7A02G151300) and TaDHL-7D) (TraesCS7D02G153200).
[0047] Specific primers were designed using Primer 5 for TaDHL and its coding region. TaActin was used as the internal reference gene for the reaction. qRT-PCR quantitative experiments were performed using the cDNA reverse-transcribed in the previous step as a template to analyze the expression differences of the TaDHL gene at different biological stages and in different tissue locations. The primers were designed as follows:
[0048]
[0049]
[0050] Using the SYBR Green method, three biological replicates were set for each sample, and the reaction system was as follows:
[0051]
[0052] The reaction program was: 95°C for 30 s, 95°C for 5 s, and 60°C for 30 s, for a total of 40 cycles.
[0053] 2. Experimental results:
[0054] The TaDHL-7B gene was sequenced and the gene was 6125 bp long (SEQ ID No. 1), containing 6 exons and 5 introns, with a coding sequence of 1593 bp ( Figure 2 ), encoding 530 amino acids (shown in SEQ ID No. 2).
[0055] To investigate the evolutionary relationships of TaDHL proteins from different species, we constructed a phylogenetic tree of TaDHL proteins from different species. The results showed that TaDHL-7B (TraesCS7B02G055300), TaDHL-7A (TraesCS7A02G151300), and TaDHL-7D (TraesCS7D02G153200) were in different branches. TaDHL-7B protein was closely related to TRITD7Bv1G021310 from Triticum turgidum and TRIDC7BG008090 from Triticum dicoccoides; TaDHL-7A was closely related to TRITD7Av1G047410 from Triticum turgidum; and TaDHL-7D was closely related to AET7Gv2038300 from Aegilopstauschii ( Figure 3 a).
[0056] To explore the collinearity between closely related species, we performed collinearity analysis and found that the TaDHL-7B region was conserved among genomes A, B, D, and E, but reversed in genome R ( Figure 3 b).
[0057] The expression levels in different tissues and stages showed that TaDHL-7B is a constitutive gene, with higher expression levels in stems at the flagging and heading stages ( Figure 3 c) This indicates that TaDHL-7B is a constitutively expressed and relatively conserved gene.
[0058] Example 3: Verification of the function of the TaDHL-7B gene using the CRISPR / Cas9 system
[0059] likeFigure 1 As shown in b, the B subgroup of the TaDHL gene (TaDHL-7B) was edited using the CRISPR / Cas9 system. The steps are as follows:
[0060] (1) Design of sgRNA
[0061] CRISPR technology was used to target and edit the gene. The sequences of Chinese Spring and Fielder obtained from the Ensembl Blast database were used as reference genomes, and the sgRNA sequences of candidate genes were designed using the sgRNA online website CRISPR-P (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR):
[0062] TraesCS7B02G055300-sgRNA:CCGATGCAGGGCAGTCATCTACG
[0063] (2) Construction of CRISPR editing vector
[0064] The plasmid extraction method was performed according to the instructions of the SteadyPure plasmid extraction kit provided by Aikerui Biotechnology Co., Ltd.
[0065] According to the characteristics of sgRNA, intermediate vector and large vector, the amplification primers are designed as follows:
[0066]
[0067] The PCR amplification system and reaction procedures are as follows:
[0068]
[0069] PCR reaction program: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 68°C for 5 s, 35 cycles; extension at 68°C for 5 min.
[0070] The product was recovered on an agarose gel. Large vector 1246 was digested overnight with Bsa I enzyme. Small vectors 3561 and 3571 were then ligated to the large vector using Bsa I and T4 ligase. The ligation product was transformed into Escherichia coli and plated onto kanamycin-resistant plates for culture. Recombinant plasmids were detected and screened using specific primers. Agrobacterium transformation and positive seedling screening were performed by the Transgenic Center of Li Genying's team at the Shandong Academy of Agricultural Sciences.
[0071] A total of 28 positive seedlings were obtained from the T1 generation and harvested per ear. The T2 generation was planted in the greenhouse of Shandong Agricultural University in August 2021, including both pool and pot cultivation. During the jointing stage of wheat, samples were taken from the lower young leaves of each T2 generation plant. DNA was extracted using the high-efficiency plant genomic DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. according to the manufacturer's instructions. Specific sequences were designed for each set of sgRNA sequences and PCR amplified. The primer sequences are as follows (lowercase letters represent linker sequences):
[0072]
[0073] The reaction system is as follows:
[0074]
[0075] The PCR program was as follows: pre-denaturation at 94°C for 10 min; denaturation at 94°C for 30 s, annealing at 68°C for 30 s, extension at 72°C for 30 s, repeated for 30 cycles; and extension at 72°C for 10 min.
[0076] PCR products were sent to the sequencing team at the Rice Research Institute, Chinese Academy of Agricultural Sciences, for Hi-TOM sequencing to identify variant loci. Main stem heights of Fielder and transgenic plants were measured before harvest. Phenotypic significance between Fielder and transgenic lines was compared using a t-test.
[0077] Two homozygous mutant genotypes, AAbbDD (-5bp) and AAbbDD (-1bp), were obtained in the T2 generation. AAbbDD (-5bp) had a 5bp deletion (ATG start point) at 285bp in the second exon region of TaDHL-7B; AAbbDD (-1bp) had a 1bp deletion (ATG start point) at 286bp in the second exon region. Figure 1 b and Figure 3 AAbbDD (-5 bp) encodes 102 amino acids (shown in SEQ ID No. 3), and AAbbDD (-1 bp) encodes 122 amino acids (shown in SEQ ID No. 4). Both mutant genotypes result in frameshift mutations and premature stop codons, rendering the protein functionally inactive.
[0078] The wild type and knockout mutant strains of T2 generation were cultured in ponds and pots respectively ( Figure 1b and Table 2). In the pool culture experiment, 16 plants with the homozygous mutant AAbbDD(-5bp) were obtained; the plant heights of the wild type and AAbbDD(-5bp) were 106.6 and 98.6 cm, respectively, with a significant difference between the two; the plant height of AAbbDD(-5bp) was 8.0 cm lower than that of the wild type. In the pot culture experiment, 9 and 7 plants with the homozygous mutant AAbbDD(-5bp) and AAbbDD(-1bp) were obtained, respectively. The plant heights of the wild type, AAbbDD(-5bp), and AAbbDD(-1bp) were 75.7, 66.8, and 67.8 cm, respectively, with a significant difference. Compared with the wild type, the plant heights of AAbbDD(-5bp) and AAbbDD(-1bp) were reduced by 8.9 and 7.9 cm, respectively. These results indicate that the TaDHL-7B gene controls wheat plant height.
[0079] Table 2: Plant height of wild type and mutants in T2 generation grown in ponds and pots
[0080]
[0081] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.
Claims
1. Application of a candidate gene for a QTL controlling wheat plant height in genetic improvement of wheat plant height traits, characterized in that: The candidate genes are TaDHL-7B , whose nucleotide sequence is shown in SEQ ID No. 1; when used, the plant height of wheat can be reduced by knocking out the candidate gene.
2. Use of a candidate gene for a QTL controlling wheat plant height in identifying or screening dwarf wheat varieties or lines, characterized in that: The candidate genes are TaDHL-7B , whose nucleotide sequence is shown in SEQ ID No. 1; the candidate gene is used to detect allelic variation of the candidate gene in wheat varieties or lines, and the variation causes the inactivation of its protein function, thereby reducing the wheat plant height, thereby accelerating the process of identifying or screening dwarf wheat varieties or lines.
3. The use according to claim 2, characterized in that During the detection process, the amplification primers of the candidate gene are: TaDHL-7B-F: CCTCTCTCGAATCATTCGCC; TaDHL-7B-R:TGAAGAAGGAACCTAAATG.