A method for calculating the concentration of microbial units by gray value

Abstract

A method for calculating the concentration of microbial units using grayscale values ​​includes: calculating the concentration of microbial units in the test sample based on the grayscale value of the PCR amplification product of the target gene of the target microorganism's nucleic acid in the test sample, and the functional relationship between the initial copy number concentration of different concentrations of plasmid standards and the grayscale value of the PCR amplification product of each plasmid standard. Each plasmid standard contains the target gene of the corresponding microorganism. The copy number of the rRNA gene in the test sample is calculated using the grayscale value of the amplification product, thereby calculating the number of microbial units in the test sample. This method eliminates the need for cell culture, significantly reducing experimental materials and shortening operation time. The method also eliminates the need for cell culture, significantly reducing experimental materials and shortening operation time.

Description

Technical Field

[0001] This invention relates to the field of cell counting, and more specifically to a method for calculating the concentration of microbial units using grayscale values. Background Technology

[0002] Existing cell counting methods mainly include hemocytometer counting, image-based methods, and various manual counting techniques. These methods all require prior cell culture, and the measurement process demands a homogeneous cell suspension, making it a lengthy process. Hemocytometers allow direct reading of the number of microorganisms in each small square under a microscope, quickly estimating the total number of microorganisms per unit volume of solution based on the volume occupied by that square. However, this method requires a large amount of material, and if no reagent is added to the bacterial suspension to distinguish between live and dead cells, the count typically includes both live and dead cells, as well as tiny impurities, leading to an overestimation of the results. Therefore, this method is only suitable for counting large single-celled microorganisms. While direct cell counting is simple to operate, it is time-consuming and requires a large number of cells. Although various types of cell counters are available on the market that eliminate manual counting, they still require artificial cell culture, and some instruments are complex to operate. Therefore, current cell counting methods are not only time-consuming and labor-intensive but also susceptible to technical and instrumental errors. Summary of the Invention

[0003] According to the first aspect, one embodiment provides a method for calculating the microbial unit number concentration by gray value, comprising: calculating the unit number concentration of the microorganism in the sample based on the gray value of the PCR amplification product of the target gene of the nucleic acid of the microorganism in the sample to be tested, and the functional relationship between the initial copy number concentration of different concentrations of plasmid standards and the gray value of the PCR amplification product of each plasmid standard, wherein each plasmid standard contains the target gene of the corresponding microorganism.

[0004] The method for calculating the concentration of microbial units by grayscale value according to the above embodiment calculates the copy number concentration of the target gene of the microorganism in the sample by using the grayscale value of the PCR amplification product, and then calculates the concentration of the concentration of microbial units in the sample. It does not require cell culture, significantly reduces experimental materials, and shortens the operation time. Attached Figure Description

[0005] Figure 1 An image of the PCR product of E. coil in one embodiment;

[0006] Figure 2 Here is a grayscale value formula curve of E.coil according to one embodiment;

[0007] Figure 3An image of the PCR product of B. fragilis in one embodiment;

[0008] Figure 4 This is a graph of the B.fragilis grayscale formula, as shown in one embodiment. Detailed Implementation

[0009] The present invention will now be described in further detail with reference to specific embodiments and accompanying drawings. Similar elements in different embodiments are referred to by associated similar element reference numerals. In the following embodiments, many details are described to facilitate a better understanding of this application. However, those skilled in the art will readily recognize that some features may be omitted in different situations, or may be replaced by other elements, materials, or methods. In some cases, certain operations related to this application are not shown or described in the specification. This is to avoid obscuring the core parts of this application with excessive description. For those skilled in the art, detailed description of these related operations is not necessary; they can fully understand the related operations based on the description in the specification and general technical knowledge in the art.

[0010] Furthermore, the features, operations, or characteristics described in the specification can be combined in any suitable manner to form various embodiments. At the same time, the steps or actions in the method description can be rearranged or adjusted in a manner obvious to those skilled in the art. Therefore, the various orders in the specification and drawings are only for the clear description of a particular embodiment and do not imply a necessary order, unless otherwise stated that a particular order must be followed.

[0011] The serial numbers assigned to components in this document, such as "first" and "second," are used only to distinguish the described objects and have no sequential or technical meaning. The terms "connection" and "linkage" used in this application, unless otherwise specified, include both direct and indirect connections (linkages).

[0012] In this article, "plasmid" refers to a DNA molecule in an organism that is outside of chromosomes or the nucleoid. Plasmids are DNA molecules in organisms such as bacteria, yeast, and actinomycetes that are outside of chromosomes (or the nucleoid). They exist in the cytoplasm (except for yeast, where the 2μm plasmid is located in the nucleus), have the ability to replicate autonomously, and maintain a constant copy number in daughter cells. They also express the genetic information they carry and are closed circular double-stranded DNA molecules.

[0013] In this article, "rRNA" refers to ribosomal RNA.

[0014] In this article, "rRNA gene" refers to the gene that encodes ribosomal RNA, also known as rDNA. For example, the 16S rRNA gene is also known as 16S rDNA, which is the gene that encodes 16S rRNA.

[0015] In this article, "16S rRNA" refers to 16S ribosomal RNA, which is a component of the 30S small subunit of the prokaryotic ribosome. The "S" in 16S is a sedimentation coefficient, an indicator reflecting the rate at which biological macromolecules settle in a centrifugal field; a higher value indicates a larger molecule. "16S rRNA gene" refers to the DNA sequence encoding the rRNA gene in bacteria, present in the genomes of all bacteria.

[0016] In one embodiment, the present invention provides a method for calculating the microbial unit number concentration by gray value, comprising: calculating the unit number concentration of the microorganism in the sample based on the gray value of the PCR amplification product of the target gene of the nucleic acid of the microorganism in the sample to be tested, and the functional relationship between the initial copy number concentration of different concentrations of plasmid standards and the gray value of the PCR amplification product of each plasmid standard, wherein each plasmid standard contains the target gene of the corresponding microorganism.

[0017] Copy number concentration refers to the number of nucleic acid copies in a unit volume (e.g., per microliter, per milliliter, per liter, etc.) of a sample or plasmid standard reagent. For example, the copy number concentration of the target gene in the test sample can be the number of target gene copies per microliter of the test sample, i.e., copies / μL. Similarly, for plasmid standards, the copy number concentration of the plasmid standard can be the initial copy number of the plasmid standard in a unit volume (e.g., per microliter, per milliliter, per liter, etc.) of the plasmid standard reagent, i.e., copies / μL.

[0018] The unit number concentration of the test microorganism in the sample refers to the number of test microorganism units per unit volume (e.g., per microliter, per milliliter, per liter, etc.) of the sample. For example, for cellular microorganisms, the unit number concentration is the cell number concentration, which can be cells / μL; for acellular microorganisms, the unit number concentration is the copy number concentration, which can be copies / μL.

[0019] In one embodiment, in a PCR amplification reaction system containing fluorescent reagent, PCR amplification reactions are performed on the nucleic acid of the microorganism to be tested and each plasmid standard in the sample to be tested, respectively, to obtain PCR amplification products bound to the fluorescent reagent.

[0020] In one embodiment, the fluorescent reagent is selected from at least one of SYTO-82, SYTO-9, SYTO-13, SYBR Green I, SYBRGold, and EvaGreen.

[0021] In one embodiment, each PCR amplification product is photographed to obtain the gray value of the target gene PCR amplification product of the nucleic acid of the microorganism to be tested in the sample and the gray value of the PCR amplification product of each plasmid standard.

[0022] In one embodiment, the nucleic acid of the microorganism to be tested, the PCR amplification reaction system of each plasmid standard, and the PCR amplification reaction conditions are completely identical in the sample to be tested.

[0023] In one embodiment, the PCR amplification reaction system also contains a thermostable DNA polymerase and its buffer, and primers for specifically amplifying the target gene.

[0024] In one embodiment, the thermostable DNA polymerase is selected from at least one of Ex-Taq polymerase, Taq polymerase, and Pyrobest DNA polymerase. The buffer is typically used in conjunction with the thermostable polymerase. For example, when the enzyme used is Ex Taq polymerase, the buffer is Ex Taq Buffer, and the purchased enzyme and its buffer are usually compatible.

[0025] In one embodiment, the PCR amplification reaction system also contains dNTPs.

[0026] dNTP, an abbreviation for deoxyribonucleoside triphosphate, is a collective term that includes dATP, dGTP, dTTP, dCTP, etc. N refers to a nitrogenous base, and the variable represents one of A, T, G, C, etc.

[0027] In one embodiment, the PCR reaction has ≥20 cycles.

[0028] In one embodiment, the number of cycles for the PCR reaction is 23-40. This includes, but is not limited to, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40.

[0029] In one embodiment, each cycle reaction is as follows: 94-95℃, 5-30s; 60-65℃, 5-30s. The 94-95℃, 5-30s step is the denaturation step, with denaturation temperatures including but not limited to 94℃, 94.5℃, 95℃, etc., and denaturation times including but not limited to 5s, 10s, 15s, 20s, 25s, 30s, etc. The 60-65℃, 5-30s step is the annealing step, with annealing temperatures including but not limited to 60℃, 61℃, 62℃, 63℃, 64℃, 65℃, etc., and annealing times including but not limited to 5s, 10s, 15s, 20s, 25s, 30s, etc.

[0030] In one embodiment, the PCR amplification reaction further includes pre-denaturation prior to cycling.

[0031] In one embodiment, the pre-denaturation step is performed at a temperature of 94-95°C for a time of 1-5 minutes. Temperatures include, but are not limited to, 94°C, 94.5°C, 95°C, etc., and times include, but are not limited to, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, etc.

[0032] In one embodiment, the nucleic acid and plasmid standards are both DNA molecules.

[0033] In one embodiment, the nucleic acid is a DNA molecule extracted from the microorganism to be tested.

[0034] In one embodiment, the nucleic acid is a DNA molecule obtained by reverse transcription of RNA molecules extracted from the microorganism to be tested. That is, DNA molecules are first obtained by reverse transcription, and then plasmid standards and primers are designed for PCR amplification.

[0035] In one embodiment, the copy number of the target gene in a single microbial unit of the test sample is known and can usually be obtained by consulting the literature.

[0036] In one embodiment, the target gene includes an rRNA gene.

[0037] In one embodiment, the rRNA gene refers to an rRNA gene with a certain sedimentation coefficient.

[0038] In one embodiment, the rRNA gene includes, but is not limited to, at least one of the following: 16S rRNA gene, 5S rRNA gene, 23S rRNA gene, 28S rRNA gene, 5.8S rRNA gene, 18S rRNA gene, etc.

[0039] In one embodiment, if the microorganism is a cellular microorganism, then the unit number concentration of the microorganism to be tested refers to the cell number concentration.

[0040] In one embodiment, if the microorganism is a non-cellular microorganism, then the unit number concentration of the microorganism to be tested refers to the copy number concentration.

[0041] In one embodiment, the initial copy number concentration of each plasmid standard is known.

[0042] In one embodiment, the plasmid standards of different concentrations refer to plasmid standards of different initial copy number concentrations;

[0043] In one embodiment, the plasmid standards of different concentrations are obtained by diluting the original plasmid standards to different copy number concentrations, typically by diluting the same original plasmid standards, which makes the calculation results more accurate.

[0044] In one embodiment, the different concentrations include different concentration gradients.

[0045] In one embodiment, the copy number exponent gradient of plasmid standards with different initial copy number concentrations is 1-7, including but not limited to 1, 2, 3, 4, 5, 6, 7, etc.

[0046] In one embodiment, the unit number concentration of the microorganism to be tested in the test sample is calculated based on the gray value of the PCR amplification product of the target gene of the nucleic acid of the microorganism to be tested in the test sample, and the functional relationship between the initial copy number concentration index of different concentrations of plasmid standards and the gray value of the PCR amplification product of each plasmid standard.

[0047] In one embodiment, the target gene copy number index of the microorganism in the test sample is calculated based on the gray value of the PCR amplification product of the nucleic acid of the microorganism in the test sample, and the functional relationship between the initial copy number concentration index of different concentrations of plasmid standards and the gray value of the PCR amplification product of each plasmid standard, thereby obtaining the target gene copy number concentration of the microorganism in the test sample. Based on the target gene copy number concentration of the microorganism in the test sample and the copy number of the target gene in a single microorganism unit, the unit number concentration of the microorganism in the test sample is calculated.

[0048] In one embodiment, the microorganism to be tested is at least one of cellular microorganisms and non-cellular microorganisms.

[0049] In one embodiment, the microorganism to be tested includes, but is not limited to, at least one of bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasma, chlamydia, and spirochetes.

[0050] In one embodiment, the microorganism to be tested includes, but is not limited to, at least one of Escherichia coli, Bacteroides fragilis, Bifidobacterium adolescentis, Lactobacillus acidophilus, and Streptococcus.

[0051] In one embodiment, the sample to be tested includes, but is not limited to, at least one of feces, saliva, sputum, and nasal secretions.

[0052] In one embodiment, the PCR amplification of the present invention is mainly set according to the PCR reaction procedure, without an extension step, which can save time. In another embodiment, the conventional PCR amplification procedure is also applicable to the present invention, but it will be more time-consuming.

[0053] In one embodiment, this invention provides a method for calculating cell number concentration using grayscale values, enabling rapid, simple, and accurate calculation of cell counts. This method eliminates the need for cell culture, saving considerable experimental materials and time, and is applicable to virtually all cellular microorganisms, including bacteria, as well as other non-cellular microorganisms. The reaction solution is prepared according to the reaction system and placed in the microarray reaction wells for PCR. After the reaction, the entire microarray is placed in a designated optical module to capture an image, and the grayscale values ​​are read. The grayscale values ​​of the standards are plotted as a grayscale curve to derive the relationship between the copy number exponent and the grayscale value, known as the grayscale formula. The copy number of the rRNA gene of the microorganism being tested in the sample is obtained using the grayscale formula, thereby calculating the cell number concentration.

[0054] In one embodiment, when the microorganism to be tested is bacteria, the principle of the present invention is as follows: the copy number of the 16S rRNA gene in the bacterial genome is known. When performing PCR detection of bacteria, only one additional imaging process is needed to read the gray value of each product in the image and correlate the gray value with the copy number. The gray value has a linear relationship with the initial copy number concentration index of the 16S rRNA gene in the corresponding template. Based on the gray value of the plasmid standard with a known initial copy number concentration of the 16S rRNA gene and the corresponding PCR amplification product, a standard curve is established between the gray value and the initial copy number concentration index of the 16S rRNA gene in the corresponding template, and the standard curve formula is obtained. Based on this formula and the gray value of the amplification product of the sample to be tested, the initial copy number concentration index of the 16S rRNA gene in the sample to be tested is calculated, thereby obtaining the initial copy number concentration of the 16S rRNA gene in the sample to be tested. Then, the initial copy number concentration of the 16S rRNA gene in the sample to be tested is divided by the copy number of the 16S rRNA gene in a single bacterial cell to calculate the cell number concentration.

[0055] In one embodiment, primers can also be designed based on rRNA genes with other sedimentation coefficients for cellular microorganisms to calculate the copy number of the corresponding rRNA gene, and then calculate the number of cells of bacteria and other microorganisms.

[0056] In one embodiment, the present invention cleverly utilizes copy number as a conversion medium to correlate grayscale values ​​with cell number concentration. It is known that the copy number of the 16S rRNA gene in the bacterial genome is fixed. Primers are designed on its 16S rRNA gene sequence for PCR experiments, and the standard is diluted in orders of magnitude gradients of 10-10. 7 10 6 10 5 10 4 10 3The corresponding gray values ​​are plotted as a gray value curve to derive the gray value formula. Substituting the gray value of the sample into the formula, the copy number of the sample can be calculated. If the sample has been diluted, multiply by the dilution factor to obtain the copy number concentration of the undiluted sample. Then divide by the 16S rRNA gene copy number in a single cell of the bacterium to finally calculate the cell number concentration of the microorganism to be tested in the sample.

[0057] In one embodiment, the main operational steps of the present invention are as follows:

[0058] 1. Design primers based on the 16S rRNA gene sequence of bacteria;

[0059] 2. Perform serial dilutions of the plasmid standard to reduce the copy number concentration of the 16S rRNA gene to 10^10. 7 10 6 10 5 10 4 10 3 PCR was performed on each diluted standard and the DNA of the test sample.

[0060] 3. Place the product into the designated optical module to take a picture and read the grayscale value of each product;

[0061] 4. Fit the gray values ​​of the plasmid standard to a gray value formula curve, substitute the gray values ​​of the PCR amplification products of the sample to be tested into the formula, calculate the target gene copy number concentration index of the microorganism to be tested in the sample to be tested, and then obtain the target gene copy number concentration of the microorganism to be tested in the sample to be tested based on the copy number concentration of the plasmid standard.

[0062] 5. The cell number concentration of the target microorganism in the test sample can be calculated by dividing the concentration of the target gene copy number in the test sample by the 16S rRNA gene copy number of the test microorganism. If the test sample has been diluted, multiply it by the dilution factor to obtain the copy number of the undiluted sample, and then divide it by the 16S rRNA gene copy number of the bacterium.

[0063] In one embodiment, this invention calculates cell number concentration using the grayscale value of the sample, breaking away from traditional cell counting methods. Normally, cell counting requires cell culture, a lengthy and labor-intensive process. This invention eliminates the need for cell culture; the experimental part only requires a PCR reaction. After photographing the product and reading the grayscale value, a formula is derived to calculate the copy number concentration, thus determining the cell number concentration. The operation is simple and rapid.

[0064] In one embodiment, the total time for PCR reaction, image imaging and grayscale reading, and calculation of the present invention generally does not exceed 2 hours. That is to say, the cell count of bacteria and other microorganisms can be completed within 2 hours. In contrast, in the existing technology, cell culture requires 2-3 days and the cells need to be revived in advance, which takes much longer than the present invention. Therefore, the present invention significantly shortens the time required for cell counting and improves counting efficiency.

[0065] Example 1

[0066] This embodiment provides a method for calculating the number of Escherichia coli cells in fecal samples.

[0067] The following is the experimental results and formula for obtaining the grayscale value of *Escherichia coli* (E. coil) in fecal samples. It is known that the 16S rRNA gene copy number of *E. coil* is 7 (i.e., the copy number of the 16S rRNA gene in a single cell is 7, this copy number was obtained from literature review; in subsequent calculations, it needs to be divided by the 16S rRNA gene copy number of this bacterium, which is the value here), meaning that the 16S rRNA gene copy number in the genome of this bacterium is 7. The nucleotide sequence of the plasmid standard is as follows:

[0068] (SEQ ID NO.5).

[0069] The plasmid standard was synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0070] The copy number concentration of the plasmid standard is 0.96*10. 10 The samples were DNA extracted from the feces of healthy individuals, with each copy / μL containing 3410bp of DNA. Sample 1, sample 2, and sample 3 represent three samples extracted from the feces. Each of the three samples was diluted 100 times with ddH2O.

[0071] The sequence of the target gene (16S rRNA gene in this example) can be directly searched in databases such as NCBI. The inventors will find a suitable sequence to design primers and synthesize plasmids. That is to say, the designed primers must be located on this sequence of the plasmid standard.

[0072] Regarding the 16S rRNA gene copy number of E. coil being 7, the referenced literature is as follows: Zhou Lin, Zhang Jie. Optimization and amplification of 16S rRNA and its 16S rDNA in community analysis. Acta Microbiologica Sinica, 2010, 50(1):7-14. See Table 2 of that literature for details.

[0073] The copy number of plasmid standards is calculated as follows:

[0074] The plasmid concentration (ng / μL) was determined using a Thermo Fisher NanoDrop One ultraviolet spectrophotometer. Specifically, 1 μL of plasmid standard (DNA or RNA, DNA in this example) was added to the device, and the concentration (ng / μL) was directly obtained. This was the result obtained in this example. The concentration was then calculated using the formula: Copies / μL = Plasmid standard concentration (ng / μL) * 6.02 * 10-1 14 Convert using / (number of bases * 660).

[0075] The base number is the length of the plasmid standard sequence. In this embodiment, the base number is obtained by adding the T vector sequence to the plasmid sequence. In this embodiment, the base number of E. coil = 718 + 2692 = 3410 bp.

[0076] The copy number calculation process is as follows:

[0077] 36.1*6.02*10 14 / (3410*660)=0.96*10 10 copies / μL.

[0078] In this embodiment, dNTPs, Ex Taq enzyme, and their buffer solutions were all purchased from Takara.

[0079] Using the primers in Table 1, and following the system in Table 2 and the procedure in Table 3, PCR amplification was performed on the DNA of the test sample and the five gradient plasmid standards, respectively.

[0080] Table 1 Primers for E. coil

[0081] name Sequence (5'-3') E.coil-F ACGATTGATTATGAGGTCGAG(SEQ ID NO.1) E.coil-R TTGTTCTGTGAGCACCTG(SEQ ID NO.2)

[0082] Table 2 PCR reaction system

[0083]

[0084]

[0085] In Table 2, the full name of the SYTO-82 dye is SYTO. TM 82 Orange Fluorescent Nucleic Acid Stain, purchased from Invitrogen, USA.

[0086] Table 3 PCR reaction procedure

[0087]

[0088] In Table 3, "12℃" means that after the PCR reaction is completed, the sample can be stored in the instrument at a low temperature of 12℃ for a period of time.

[0089] Figure 1 The images show PCR products of E. coil. As can be seen, the higher the plasmid concentration, the brighter the image and the higher the gray value. The images of the products of the three samples after being diluted by the same factor are not significantly different.

[0090] Table 4 Gray values ​​corresponding to E. coil plasmid standards

[0091]

[0092] In Table 4, the copy number index of plasmid standards refers to the index of the copy number concentration of the plasmid standard. For example, the copy number concentration is 0.96*10^6. 7 When copies / μL, the index is 7.

[0093] In Table 4, a plasmid standard copy number index of 3 means that 0.96*10 10 The standard was diluted to 0.96 x 10^9 copies / μL. 3 copies / μL. Copy numbers for other experimental groups follow the same definition as above.

[0094] Figure 2 The graph shows the relationship between the gray value and copy number index of the E. coil plasmid standard. The horizontal axis represents the copy number concentration index (x), and the vertical axis represents the gray value (y). The imaging instrument and lens were purchased from Thorlabs, USA.

[0095] Input the gray values ​​of each sample to be tested. Figure 2 The number of cells can be obtained by following the calculation order in the table below using the E.coil grayscale value formula curve.

[0096] Table 5. Number of E. coli cells in fecal samples, expressed as grayscale value.

[0097]

[0098] As shown in Table 5, the number of cells calculated from the three DNA samples was very close.

[0099] Example 2

[0100] This embodiment provides a method for obtaining the grayscale value formula of Bacteroides fragilis in fecal samples and cell counting results. It is known that the 16S rRNA gene copy number in a single B. fragilis cell is 6, and the copy number concentration of the plasmid standard is 1.77 * 10⁻⁶. 10 The sample contained DNA extracted from feces, with a length of 2790 bp and a density of copies / μL.

[0101] Table 6 Primers for B. fragilis

[0102] name Sequence (5'-3') B.fragilis-F ATGGATAGGGGTTCTGAGAG(SEQ ID NO.3) B.fragilis-R TATTCCTCACTGCTGCCTC(SEQ ID NO.4)

[0103] Using the primers in Table 6, the PCR reaction system and conditions are the same as those in Tables 2 and 3 of Example 1.

[0104] Figure 3 Images of PCR products from B. fragilis. Figure 3 In the sample dilution tables, Sample-1000x: the sample was diluted 1000-fold using ddH2O; Sample-100x: the sample was diluted 100-fold using ddH2O; Sample-10x: the sample was diluted 10-fold using ddH2O. Figure 3 It can be seen that the higher the concentration of plasmid standards and samples, the brighter the image will be, and the higher the grayscale value will be.

[0105] Table 7. Gray values ​​corresponding to B. fragilis plasmid standards

[0106] Plasmid standard initial copy number concentration index grayscale value 3 44.282 4 47.598 5 89.262 6 142.943 7 164.142

[0107] Figure 4 The graph shows the relationship between the gray value of B. fragilis plasmid standards and the copy number index.

[0108] By substituting the sample's grayscale value into the B. fragilis grayscale formula curve and following the calculation order in the table below, the cell count can be obtained. The results show that for the same sample, even with different dilution factors, the calculated cell counts are very close.

[0109] Table 8. Number of B. fragilliis cells in fecal samples based on grayscale value.

[0110]

[0111] In one embodiment, the present invention can calculate the number of cells using grayscale curves, breaking away from the traditional method of directly counting cells.

[0112] In one embodiment, the present invention is simple to operate, and the experimental part only requires PCR reaction and optical imaging, without the need for cell culture.

[0113] In one embodiment, the present invention can use the products after PCR detection to incidentally calculate the number of cells, without the need to perform a separate PCR experiment.

[0114] In one embodiment, once the grayscale value formula is determined, it can be directly applied in subsequent detection without the need to repeatedly construct the grayscale value formula.

[0115] In one embodiment, it is not necessary to order a cell counter or prepare a large amount of materials for culturing cells, which can save costs.

[0116] In one embodiment, the present invention is simple to operate and can quickly and accurately calculate the cell number concentration.

[0117] The above examples illustrate the present invention only to aid in understanding it and are not intended to limit the scope of the invention. Those skilled in the art can make various simple deductions, modifications, or substitutions based on the principles of this invention. SEQUENCE LISTING <110> Yihong (Shenzhen) Gene Co., Ltd. <120> A method for calculating microbial unit number concentration using grayscale values <130> 20I31085 <160> 5 <170> PatentIn version 3.3 <210> 1 <211> twenty one <212> DNA <213> Artificial sequence <400> 1 acgattgatt atgaggtcga g 21 <210> 2 <211> 18 <212> DNA <213> Artificial sequence <400> 2 ttgttctgtg agcacctg 18 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 atggataggg gttctgagag 20 <210> 4 <211> 19 <212> DNA <213> Artificial sequence <400> 4 tattcctcac tgctgcctc 19 <210> 5 <211> 718 <212> DNA <213> Artificial sequence <400> 5 ctggtactcg acggtaagaa ggtttccagc tctctgctgc gcggtgcgga cagcattgaa 60 ctggacaatg gaccgcatca gttagtgttt cgcgttgaga agacgattca tctttccaat 120 agtgaagaac ggctctatat ctcccctcca ctggtggtta gttttaatac ccagctcatc 180 aaccaggtca attttcgcct gcctcgcctg gagaatgagc gggaagctaa ccattttgat 240 gccgcgccgc gccttgaatt gttggatggc gatgcgacgc cgattccggt aaagctggat 300 attctcgcca ttacctcaac tgcaaaaacg attgattatg aggtcgaggt tgaacgctat 360 aacaaatccg cgaaacgcgc ttcactaccg caatttgcca cgatgatggc agatgacagt 420 acgctgcttt cgggtgtttc cgagctggat gctattccgc cgcagtctca ggtgctcaca 480 gaacaacggc tgaagtattg gtttaaactg gctgacccac aaacgcgaaa tactttcctg 540 caatgggcgg aaaaacaacc atcctcctga gatttttgtg cctgtgcgca ggctttttca 600 gtctttatct tgcagcgata agtacttaca gtaatctgta ggaaagttaa ctacggatgt 660 acattatgga actgacgact cgcactttac cttcgcggaa acatattgcg ctggtggc 718

Claims

1. A method for calculating the concentration of microbial units using grayscale values, characterized in that, include: Based on the gray value of the PCR amplification product of the target gene of the microorganism in the sample to be tested, and the functional relationship between the initial copy number concentration of different plasmid standards and the gray value of the PCR amplification product of each plasmid standard, the unit concentration of the microorganism in the sample to be tested is calculated, and each plasmid standard contains the target gene of the corresponding microorganism. In the PCR amplification reaction system containing fluorescent reagent, the nucleic acid of the microorganism to be tested and each plasmid standard in the sample to be tested are subjected to PCR amplification reaction to obtain PCR amplification products bound to the fluorescent reagent. Photographs were taken of each PCR amplification product to obtain the gray values ​​of the target gene PCR amplification product of the nucleic acid of the microorganism to be tested in the sample and the gray values ​​of the PCR amplification products of each plasmid standard. The PCR amplification reaction has 23-40 cycles, with each cycle as follows: 94-95℃, 5-30s; 60-65℃, 5-30s. Using copy number as a conversion medium, the gray value is correlated with the unit number concentration of the microorganism to be tested; Based on the gray value of the PCR amplification product of the target gene of the microorganism in the test sample, and the functional relationship between the initial copy number concentration index of different concentrations of plasmid standards and the gray value of the PCR amplification product of each plasmid standard, the copy number index of the target gene of the microorganism in the test sample is calculated, thereby obtaining the copy number concentration of the target gene of the microorganism in the test sample. Based on the copy number concentration of the target gene of the microorganism in the test sample and the copy number of the target gene in a single microbial unit, the unit number concentration of the microorganism in the test sample is calculated.

2. The method as described in claim 1, characterized in that, The fluorescent reagent is selected from at least one of SYTO-82, SYTO-9, SYTO-13, SYBR Green I, SYBR Gold, and EvaGreen.

3. The method as described in claim 2, characterized in that, The nucleic acid of the microorganism to be tested, the PCR amplification system of each plasmid standard, and the PCR amplification reaction conditions in the sample to be tested are completely identical.

4. The method as described in claim 1, characterized in that, The PCR amplification reaction system also contains heat-stable DNA polymerase and its buffer, primers for specific amplification of the target gene, and dNTPs; The thermostable DNA polymerase is selected from at least one of Ex-Taq polymerase, Taq polymerase, and Pyrobest DNA polymerase.

5. The method as described in claim 1, characterized in that, The PCR amplification reaction also includes pre-denaturation before cycling. The pre-denaturation step is performed at a temperature of 94-95℃ for 1-5 minutes.

6. The method as described in claim 1, characterized in that, The nucleic acid and plasmid standards are both DNA molecules; wherein the nucleic acid is a DNA molecule extracted from the microorganism to be tested, or the nucleic acid is a DNA molecule obtained by reverse transcription of RNA molecules extracted from the microorganism to be tested; In the sample to be tested, the copy number of the target gene in a single microbial unit is known; wherein, the target gene includes an rRNA gene.

7. The method as described in claim 6, characterized in that, The rRNA gene refers to an rRNA gene with a certain sedimentation coefficient; wherein the rRNA gene is selected from at least one of 16S rRNA gene, 5S rRNA gene, 23S rRNA gene, 28S rRNA gene, 5.8S rRNA gene, and 18S rRNA gene. If the microorganism is a cellular microorganism, the unit number concentration of the microorganism to be tested refers to the cell number concentration; if the microorganism is a non-cellular microorganism, the unit number concentration of the microorganism to be tested refers to the copy number concentration.

8. The method as described in claim 1, characterized in that, The initial copy number concentration of each plasmid standard is known; the plasmid standards of different concentrations refer to plasmid standards of different initial copy number concentrations; the plasmid standards of different concentrations are obtained by diluting the original plasmid standards to different copy number concentrations.

9. The method as described in claim 8, characterized in that, The different concentrations include different concentration gradients; the copy number exponent gradient of plasmid standards with different initial copy number concentrations is 1-7.

10. The method as described in claim 1, characterized in that, The microorganism to be tested is at least one of cellular microorganisms and acellular microorganisms; wherein, the microorganism to be tested is at least one of bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasma, chlamydiae, and spirochetes. The sample to be tested is at least one of feces, saliva, sputum, and nasal secretions.

Images