An indel marker related to chicken shank length trait, detection primer thereof and application

By discovering the InDel marker in the chicken ZNF532 genome and designing detection primers and kits, the problem of low efficiency in traditional breeding was solved, enabling efficient and accurate molecular marker selection for chicken shank length, thus improving breeding efficiency and genetic resource protection.

CN114959060BActive Publication Date: 2026-03-24SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-01
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Traditional hybridization breeding methods are inefficient, labor-intensive, and yield unpredictable results in selecting chicken shank length traits. They may also lead to the loss of dominant genotypes. Existing molecular marker technologies, such as SNP markers, have not been applied in chicken shank length trait research.

Method used

InDel markers associated with tibia length were discovered in the chicken ZNF532 genome. Corresponding detection primers and kits were designed, and the genotypes of individual chickens were determined by PCR amplification and electrophoresis analysis. Individuals with superior tibia length traits were then selected.

Benefits of technology

This approach enables efficient, low-cost, and accurate marker-assisted breeding of chicken shank length, improving breeding efficiency while preserving the genetic characteristics of the chicken breed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114959060B_ABST
    Figure CN114959060B_ABST
Patent Text Reader

Abstract

The application discloses an InDel marker related to a chicken shank length character, a detection primer and application thereof. The application finds an InDel marker related to a chicken shank length character from a chicken ZNF532 gene, and provides a primer and a kit for detecting the InDel marker. The InDel marker has the advantages of convenient detection, low detection cost and high detection accuracy, can be used for molecular selection of the chicken shank length character, and is helpful to development of genetic breeding work of the chicken shank length character.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular markers. More particularly, it relates to an InDel marker related to chicken shank length trait, primers for detecting the marker and application thereof. BACKGROUND

[0002] The breeding direction of chicken is largely dependent on the consumption preferences of end consumers. The unique dietary habits of Chinese people have led to a huge demand for chicken claws, which are rich in collagen, phospholipids, copper and other nutrients, and have the effects of beautifying the skin, reducing fat and blood pressure, and promoting the development and repair of various tissue systems. At present, high-quality chicken claws provided by domestic wholesale markets, i.e. claws that are large, rich in collagen, and clean and neat in appearance without color spots, are mostly imported from abroad. Domestic chicken claws are not favored by consumers because of their shorter shank length, smaller overall size, and leaner appearance, and thus there is a need to breed chicken lines with better shank length.

[0003] The traditional crossbreeding method, i.e. forming genetic diversity by crossing parent generations, and then breeding offspring with better shank length according to the offspring, is a very slow process. Not only does it require a huge amount of manpower during the breeding period, but the breeding results are complex and unpredictable, and a large amount of seed production and selection work is required. In addition, unfavorable selection of poultry can also lead to the loss of certain advantageous genotypes. Therefore, in order to improve the economic traits of local livestock and poultry breeds while maintaining the characteristics of the germplasm, and to further protect, develop and utilize livestock and poultry genetic resources, it is particularly important to use modern molecular markers.

[0004] Molecular markers are a form of genetic markers developed after morphological markers, cellular markers and biochemical markers. They are based on mutations in proteins and nucleic acid molecules, and are widely used in research on crop hybrid variety identification, linkage map construction, genetic diversity analysis, comparative genomics and molecular assisted breeding. InDel markers, i.e. insertion-deletion markers, refer to the differences in the whole genome between two parents; relative to the other parent, the genome of one parent has a certain number of nucleotide insertions or deletions. As a third-generation high-throughput and low-cost molecular marker type, InDel markers have the advantages of being economical and practical, highly specific and stable, and provide a selectable method for molecular marker-assisted breeding.

[0005] With the increasing maturity and perfection of molecular marker technology, theoretical research and practical application of molecular markers in chicken shank length trait breeding have made great progress. For example, there are patents that disclose SNP molecular markers related to chicken shank length trait, but there is no report on InDel markers related to chicken shank length trait. SUMMARY

[0006] The application aims to enrich the InDel marker related to the chicken shank length trait, and provides an InDel marker related to the chicken shank length trait, a detection primer thereof and application thereof.

[0007] The first object of the application is to provide an InDel marker related to the chicken shank length trait.

[0008] The second object of the application is to provide a detection primer of the InDel marker.

[0009] The third object of the application is to provide a detection kit of the InDel marker.

[0010] The fourth object of the application is to provide a method for breeding a chicken individual with a more excellent shank length trait.

[0011] The fifth object of the application is to provide application of the InDel marker, the detection primer or the detection kit in molecular marker assisted breeding of the chicken shank length trait.

[0012] The above objects of the application are achieved by the following technical solutions.

[0013] The application finds an InDel marker related to the chicken shank length trait in the ZNF532 gene of the Z chromosome of the chicken reference genome, the InDel marker is located at 868584-868628 bp of the Z chromosome of the chicken reference genome, the InDel marker is an insertion / deletion polymorphism marker, that is, a single base A is deleted at 868584 bp, and a sequence shown in SEQ ID NO. 5 is inserted at 868585-868628 bp; or a single base A is inserted at 868584 bp, and the sequence shown in SEQ ID NO. 5 is deleted at 868585-868628 bp.

[0014] The application also provides a detection primer of the InDel marker.

[0015] As an alternative implementation manner, the nucleotide sequence of the upstream primer of the detection primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3.

[0016] The application also provides a detection kit of the InDel marker, the kit contains the detection primer of the InDel marker or the primers shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0017] Specifically, the kit also contains reagents required for PCR amplification reaction.

[0018] The application further provides a method for selecting a chicken individual with a better shank length, comprising the following steps:

[0019] S1. extracting genomic DNA of the chicken individual to be tested;

[0020] S2. using the DNA obtained in step S1 and the InDel marker insertion type control plasmid as templates respectively, and performing PCR amplification by using the detection primer of the application;

[0021] S3. performing electrophoresis analysis on the PCR amplification product obtained in step S2;

[0022] S4. result determination: if a single band with the same size as the band obtained by amplifying the control plasmid appears, it indicates that the chicken individual to be tested is a II genotype homozygote; if a single band 43 bp smaller than the band obtained by amplifying the control plasmid appears, it indicates that the chicken individual to be tested is a DD genotype homozygote; if a double band with a size difference of 43 bp and the larger one being the same as the band obtained by amplifying the control plasmid appears, it indicates that the chicken individual to be tested is an ID genotype heterozygote; wherein the chicken individual with the II genotype homozygote is a chicken individual with a better shank length.

[0023] If it is not accurate to determine whether the chicken individual to be tested is a II genotype homozygote by electrophoresis alone, the single band obtained can be sequenced, if the sequencing result shows that a single base A is deleted at the position corresponding to 868584 bp in the obtained sequence, and a sequence shown in SEQ ID NO. 5 is inserted at the position corresponding to 868585-868628 bp, it indicates that the chicken individual to be tested is a II genotype homozygote; otherwise, it indicates that the chicken individual to be tested is a DD genotype homozygote.

[0024] Specifically, the sample used for extracting DNA in step S1 is blood.

[0025] Specifically, the control plasmid of the application contains the fragment to be amplified of the detection primer, and in the fragment to be amplified, the sequence shown in SEQ ID NO. 5 can be contained or deleted; if the sequence shown in SEQ ID NO. 5 is contained, it is a II genotype control plasmid; if the sequence shown in SEQ ID NO. 5 is deleted, it is a DD genotype control plasmid.

[0026] In view of the significant association between the InDel marker of the application and the shank length of chicken, the application further protects the application of the InDel marker, the InDel marker detection primer and the InDel marker detection kit in the molecular marker assisted selection of the shank length of chicken.

[0027] Specifically, a chicken individual with a II genotype homozygote is selected, and the shank length of the chicken individual with this genotype is better.

[0028] The present application has the following advantages:

[0029] The present application finds an InDel marker related to chicken shank length from chicken ZNF532 gene, and provides primers and kits for detecting the InDel marker. On this basis, the present application further provides a method for breeding chicken individuals with good shank length. The InDel marker has the advantages of convenient detection, low detection cost and high detection accuracy, and can be used for molecular breeding of chicken shank length, and helps the development of chicken shank length genetic breeding. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 The electrophoresis results of the InDel marker of different genotypes of the present application are shown in the figure, and II, DD and ID correspond to different genotypes; wherein the InDel marker corresponding to the II genotype is deletion of a single base A, and insertion of the sequence shown in SEQ ID NO. 5; the InDel marker corresponding to the DD genotype is insertion of a single base A, and deletion of the sequence shown in SEQ ID NO. 5.

[0031] Figure 2 The sequencing peak chart of the InDel marker of the present application. DETAILED DESCRIPTION

[0032] The present application will be further described below in combination with the drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the technical field.

[0033] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0034] Example 1 PCR amplification of chicken ZNF532 gene InDel marker

[0035] 1. Animal material

[0036] The present application selects hens of 6 different local chicken breeds as animal material; the 6 different local chicken breeds are: Tianlu yellow chicken (N409, n=384), Mahuang chicken (MH, n=360), recessive white Locke x apricot chicken F2 generation resource group (F2, n=108), apricot dwarf chicken (XA, n=48), Wenchang chicken (WC, n=48), yellow Mahua chicken (HM, n=48), a total of 996, to determine the shank length data of the chicken; at the same time, 1.2 mL of venous blood under the wing is collected using a vacuum anticoagulant tube and stored in a-80℃ low temperature refrigerator for subsequent DNA extraction.

[0037] 2. Extraction of blood

[0038] The blood DNA of all chicken individuals was extracted according to the instructions of the OMEGA DNA extraction kit (NRBC Blood DNA Kit, D0715), and the extracted DNA was detected for concentration and purity and then stored in a -20°C low-temperature refrigerator for subsequent PCR amplification.

[0039] 3. Primer design

[0040] The InDel marker amplification primer was designed according to the chicken ZNF532 gene sequence (Gene ID: 100857356) provided by the NCBI (National Center for Biotechnology Information) official website, and the primer information is shown in Table 1. The designed primer sequence was synthesized by Beijing Qikang Biological Technology Co., Ltd. Guangzhou Branch.

[0041] Taking the amplification primer designed in the present embodiment as an example, if the length of the amplified sequence is 445 bp, it is the II genotype; if the length of the amplified sequence is 402 bp, it is the DD genotype.

[0042] Table 1 PCR amplification primer information of ZNF532 gene

[0043]

[0044] 4. PCR amplification of ZNF532 gene InDel marker

[0045] The PCR amplification of the InDel marker contained in the ZNF532 gene (Gene ID: 100857356) was performed using 2x Taq MasterMix (Dye) (Kangwei Century, CW0682) reagent, and the PCR amplification system is shown in Table 2. The PCR amplification program was performed according to the instructions of 2x Taq MasterMix (Dye), and the annealing temperature was 60°C.

[0046] Table 2 PCR amplification system

[0047]

[0048] 5. Detection of PCR amplification product

[0049] 10 μL of PCR amplification product was taken and subjected to 2.5% agarose gel electrophoresis (electrophoresis voltage: 120 V; electrophoresis time: 30 min) detection, and after electrophoresis, the amplified bands were observed by gel imaging system. The electrophoresis result of the PCR amplification product showing a single band was sent to Beijing Qikang Biological Technology Co., Ltd. Guangzhou Branch for Sanger sequencing, and the sequencing result was analyzed.

[0050] The electrophoresis results of the InDel marker of different genotypes are shown in Figure 1 As shown in the results shown in Figure 1 The three different band types amplified by the application correspond to three genotypes, namely II, DD and ID genotypes. The band size corresponding to the II genotype is 445bp, the corresponding InDel marker is a single base A deletion, and the inserted sequence is shown in SEQ ID NO. 5. The band size corresponding to the DD genotype is 402bp, the corresponding InDel marker is a single base A insertion, and the deleted sequence is shown in SEQ ID NO. 5. The band type corresponding to the ID genotype is double band. The InDel marker in the ZNF532 gene of one chromosome is the same as that of the II genotype, and the InDel marker on the allele of the other chromosome is the same as that of the DD genotype.

[0051] The sequencing peak chart of the InDel marker is shown in Figure 2 As shown in the results shown in Figure 2 As shown in the results shown in

[0052] The sequencing results of the single band amplified in this embodiment are shown as follows. One sequence is 445bp long, and the other is 402bp long, with a difference of 43bp.

[0053] The sequence of the II genotype is shown as follows (SEQ ID NO. 1):

[0054] CTTGGCACTGAGTCCTTGTTGTGAAACAGTGATTATTTTGGGGGAGGAAAACAGGAAAGCTAGATTTTTAAAGTATTTTTACTTGGGGAGGAAGGAAGATAAAAATATTTGGACTTTGCAGCTCATTGATGAGTTCTTAGTGCCCACCTACTCTTGAAATGGAAATTGCACACTGATGTGTTACATGAGCCTAAGTAGGAAGGAGCTGTTACTTCTTTTCCATCTCTCGTTGTAAAGGTAGAATGTTTAGTTTTGAATAAAAAAGATAGTAAAACATCTTTAGCAGTTAAGAAGTCTTCCCTGTAACATTACCTCTCTGCAGTCCCTCACTTCTGTTAGTAATCCTGTTAAAAGGAATGAGACCACTCAGTGATGGGTTTCATGGCTGAGCGAAGCCCTCACCAGCTTACTGAGCTACAGAGCAGCAACCCTGGTCTGATTCATG

[0055] The sequence of the DD genotype is shown below (SEQ ID NO. 4):

[0056] CTTGGCACTGAGTCCTTGTTGTGAAACAGTGATTATTTTGGGGGAGGAAAACAGGAAAGCTAGATTTTTAAAGTATTTTTACTTGGGGAGGAAGGAAGATAAAAATATTTGGACTTTGCAGCTCATTGATGAGTTCTTAGTGCCCACCTACTCTTGAAATGGAAATTGCACACTGATGTGTTACATGAGCCTAAGTAGGAAGGAGCTGTTACTTCTTTTCCATCTCTCGTTGTAAAGGTAGAATGTTTAGTTTTGAATAAAAAAGATAGTAAAACATCTTTAGCAGTTAAGAAGTCTTCCCTGTAACATTACCTCTCTGCAGTCCCTCACTTCTGTTAGTAATCCTGTTAAAAGGAATGAGACCACATGAGCTACAGAGCAGCAACCCTGGTCTGATTCATG

[0057] The nucleotide sequence of the insertion-deletion fragment is shown below (SEQ ID NO. 5):

[0058] TCAGTGATGGGTTTCATGGCTGAGCGAAGCCCTCACCAGCTTAC

[0059] Genotype frequency and genetic parameter estimation of example 2

[0060] The genotype frequency and genetic parameter estimation results are shown in Table 3. According to the statistical data in Table 3, the main genotype of the hen of the chicken breed in 6 different places is II. After testing, only the HM population is in Hardy-Weinberg equilibrium (P>0.05) at the InDel site in the 6 chicken breed hens, and the other 5 populations do not meet the Hardy-Weinberg equilibrium (P<0.05). Among the 6 populations, the PIC of the F2 resource population is less than 0.25, and the PIC of the other populations is between 0.25 and 0.5, which indicates that the F2 resource population is a low polymorphic population, and the other populations are moderate polymorphic populations; the He value is between 0.282 and 0.453, which indicates that the population has moderate genetic diversity, and the effective population size Ne value is between 1.393 and 1.829.

[0061] Table 3 Genotype frequency and genetic parameter estimation results of different chicken breeds at the InDel site

[0062]

[0063] Note: N409, Tianlu yellow chicken; MH, yellow chicken; F2, F2 generation resource population of recessive white Locke x Xinghua chicken; XA, Xingai chicken; WC, Wenchang chicken; HM, yellow chicken.

[0064] Example 3 Association analysis of different genotypes of InDel marker and shank length trait

[0065] The present application uses SAS 9.0 software to perform association analysis of different genotypes of ZNF532 InDel marker and shank length trait, and the model used is the Proc-GLMR function model, and the model formula is:

[0066] Y=u+F+M+G+e

[0067] Wherein, Y is the phenotype value, u is the population mean, F is the paternal effect, M is the maternal effect, G is the genotype effect, and e is the random residual.

[0068] The association analysis results show that the association of ZNF532 InDel marker and shank length trait of F2 population, N409 population and MH population reaches a significant level (P<0.05); among them, the shank length of the individual with II genotype is longer, and the shank length of the individual with DD genotype is relatively shorter, and the specific information is shown in Table 4.

[0069] Table 4 Association analysis results of InDel marker and shank length trait

[0070]

[0071]

[0072] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above embodiments, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are included in the protection scope of the present application. SEQUENCE LISTING <110> South China Agricultural University <120> An InDel marker related to chicken shank length trait and detection primer and application thereof <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 445 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 cttggcactg agtccttgtt gtgaaacagt gattattttg ggggaggaaa acaggaaagc 60 tagattttta aagtattttt acttggggag gaaggaagat aaaaatattt ggactttgca 120 gctcattgat gagttcttag tgcccaccta ctcttgaaat ggaaattgca cactgatgtg 180 ttacatgagc ctaagtagga aggagctgtt acttcttttc catctctcgt tgtaaaggta 240 gaatgtttag ttttgaataa aaaagatagt aaaacatctt tagcagttaa gaagtcttcc 300 ctgtaacatt acctctctgc agtccctcac ttctgttagt aatcctgtta aaaggaatga 360 GACCACTCAG TGATGGGTTT CATGGCTGAG CGAAGCCCTC ACCAGCTTAC TGAGCTACAG 420 AGCAGCAACC CTGGTCTGAT Tcatg 445 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <400> 2 CTTGGC ACTG AGTCCTTGTT G 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <400> 3 CATGAA TCAG ACCAGGTTGC 21 <210> 4 <211> 402 <212> DNA <213> Artificial Sequence <400> 4 CTTGGC ACTG AGTCCTTGTT GTGAAACAGT GATTATTTTG GGGGAGGAAA ACAGGAAAGC 60 TAGATTTTTT AAGTATTTTT ACTTGGGGAG GAAGGAAGAT AAAAATATTT GGACTTTGCA 120 GCTCATTGAT GAGTTCTTAG TGCCCACCTA CTCTTGAATG GAAATTGCA CACTGATGTG 180 TTACATGAGC CTAAGTAGGA AGGAGCTGTT ACTTCTTTTC ATCTCTCGTT GTA AAGGT A 240 GAA TGT TTAG TTTT GAAT A A A A A AGAT AGT AAA AC ATCTT TAG C AGTT A AGT CTTC C 300 ctgtaacatt acctctctgc agtccctcac ttctgttagt aatcctgtta aaaggaatga 360 gaccacatga gctacagagc agcaaccctg gtctgattca tg 402 <210> 5 <211> 44 <212> DNA <213> Artificial Sequence <400> 5 tcagtgatgg gtttcatggc tgagcgaagc cctcaccagc ttac 44

Claims

1. The application of a detection primer or kit for an InDel marker associated with chicken shank length in marker-assisted breeding of chicken shank length, characterized in that, The InDel marker is located in the chicken ZNF532 Genetically, the markers represent insertion / deletion polymorphisms, corresponding to three genotypes: II, DD, and ID. The band size for genotype II is 445 bp, as shown in SEQ ID NO.1, with an InDel marker indicating a single A base deletion and the insertion of the sequence shown in SEQ ID NO.

5. The band size for genotype DD is 402 bp, as shown in SEQ ID NO.4, with an InDel marker indicating a single A base insertion and the deletion of the sequence shown in SEQ ID NO.

5. The band type for genotype ID is a double band, with one band on one chromosome. ZNF532 The gene contains the same InDel marker as the II genotype, and the allele on another chromosome contains the same InDel marker as the DD genotype; the chicken is a Tianlu Huang chicken, Ma Huang chicken, or recessive White Locke × Xinghua chicken F2 generation resource group; when selecting chicken individuals with longer shank length, homozygous chicken individuals of the II genotype are selected.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the upstream primer of the detection primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

3. A method for selecting chicken individuals with superior shank length traits, characterized in that, Includes the following steps: S1. Extract genomic DNA from the chicken individuals to be tested; S2. Using the DNA obtained in step S1 and the InDel-labeled insert control plasmid as templates, PCR amplification is performed using the InDel-labeled detection primers or detection kits related to chicken shank length as described in claim 1; the InDel-labeled insert control plasmid contains the sequence shown in SEQ ID NO.1; S3. Perform electrophoretic analysis on the PCR amplification products obtained in step S2; S4. Result Determination: If a single band of the same size as the band obtained from the amplification of the control plasmid appears, it indicates that the tested chicken individual is homozygous for genotype II; if a single band 43 bp smaller than the band obtained from the amplification of the control plasmid appears, it indicates that the tested chicken individual is homozygous for genotype DD; if a double band of 43 bp larger size appears, which is the same as the band obtained from the amplification of the control plasmid, it indicates that the tested chicken individual is heterozygous for genotype ID; among them, the homozygous chicken individual for genotype II is a chicken individual with a superior tibia trait; the superior tibia trait means a longer tibia; the chicken is a Tianlu Yellow Chicken, Ma Huang Chicken, or a recessive White Locke × Xinghua Chicken F2 generation resource group.

4. The method according to claim 3, characterized in that, If electrophoresis alone cannot accurately determine whether the tested chicken individual is homozygous for genotype II, then the obtained single band is sequenced. If the sequencing result shows that the obtained sequence is the same as the sequence shown in SEQ ID NO.1, it indicates that the tested chicken individual is homozygous for genotype II; if the sequencing result shows that the obtained sequence is the same as the sequence shown in SEQ ID NO.4, it indicates that the tested chicken individual is homozygous for genotype DD.

5. The method according to claim 3, characterized in that, The sample used for DNA extraction in step S1 is blood.

Citation Information

Patent Citations

  • SNP molecular marker related to chicken shin length character, and application of SNP molecular marker

    CN113215270A

  • SNP molecular marker related to broiler chicken weight and shin length character, and application of SNP molecular marker

    CN113215271A