A SNP marker related to the low temperature tolerance of black sea porgy and its application

Abstract

The present invention relates to a SNP marker related to the low temperature resistance trait of black porgy, wherein the SNP marker is the 3125th base of the black porgy SCD1‑a gene sequence, and the base is A or T; the nucleotide sequence of the SCD1‑a gene is shown in SEQ ID No.1; the low temperature tolerance time of the AA genotype individual at the SNP marker site under the same breeding conditions is significantly higher than that of the TT genotype individual. The low temperature resistance trait of black porgy can be detected by using the SNP marker and its detection primer provided by the present invention. The method is accurate and reliable, simple to operate, and can effectively and quickly screen out the traits that meet the requirements, assist in the early realization of short-term and low-cost breeding of individuals of black porgy that tolerate low temperatures, thereby increasing the number of black porgy with good quality, cultivating black porgy cold-resistant varieties, improving the cultivation rate of black porgy, shortening the breeding cycle, thereby increasing the yield of black porgy, and promoting its sustainable and healthy breeding, which has broad application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding of aquatic animals, and particularly relates to a SNP marker related to the low-temperature resistance trait of black sea porgy and an application thereof. Background Art

[0002] Black sea bream (Acanthopagrus schlegelii) belongs to the genus Acanthopagrus of the family Sparidae of the order Perciformes. It is distributed in coastal areas of my country due to its wide temperature and salt range. It is an important economic fish for marine aquaculture in coastal areas of my country. The suitable water temperature for black sea bream is 15-25℃. It cannot survive for a long time when the water temperature is below 5℃. Therefore, when aquaculture is carried out in Jiangsu and other regions, most black sea bream cannot survive the winter naturally. In order to promote the development of black sea bream aquaculture and enhance the ability of black sea bream to survive the winter, it is very important to select and breed black sea bream varieties that are resistant to low temperatures.

[0003] The traditional breeding method of cold-resistant black sea porgy relies on phenotypic selection, which has disadvantages such as long cycle and instability. Molecular breeding, that is, molecular marker-assisted selection breeding, refers to the technology of selecting breeding materials using DNA molecular markers. The molecular breeding method selects backup parents based on effective molecular markers, which can improve the economic traits of the offspring more quickly. SNP (Single Nucleotide Polymorphism) refers to the polymorphism of single nucleotides on the genome and is the most widely used and newest molecular marker. At present, there are few studies on the development of molecular markers for the cold resistance of black sea porgy, and there is a lack of molecular markers that can be used for assisted breeding in the industry. Therefore, the development of molecular markers related to cold-resistant traits is of great significance for the cultivation of cold-resistant black sea porgy strains and healthy breeding.

[0004] Stearoyl-CoA desaturase-1 (SCD1), as the rate-limiting enzyme for the synthesis of monounsaturated fatty acids, is one of the key genes regulating the proportion of unsaturated fatty acids in cell membranes. Further studies on the SCD1 gene found that there are two subtypes of the SCD1 gene, scd1a and scd1b, in large yellow croaker and carp. Under different low temperature stress conditions, the two subtypes show different regulatory modes, indicating that different regulatory mechanisms may exist under different stimuli. At present, our research group has successfully cloned the cDNA sequences of the scd1a gene and scd1b gene in the liver of black sea porgy in the process of preliminary experiments, and found through q-PCR that there are significant differences in the expression of the scd1a gene in the low temperature tolerant group and the non-tolerant group of black sea porgy. The present invention aims to use the single base difference of the scd1a gene found in the low temperature tolerant group and the non-tolerant group of black sea porgy to screen out the low temperature tolerant individuals of black sea porgy, and provide a simple and feasible method for breeding black sea porgy varieties with low temperature resistance. Summary of the invention

[0005] The purpose of the present invention is to solve the shortcomings of the traditional breeding method for cold-resistant black sea porgy, and to provide a SNP marker related to the cold-resistant trait of black sea porgy. Black sea porgy with cold-resistant traits can be screened by identifying the SNP marker, which is helpful for the cultivation of new cold-resistant strains of black sea porgy and the development of aquaculture.

[0006] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions:

[0007] A SNP marker related to the low temperature resistance trait of black sea porgy, the SNP marker is the 3125th base of the black sea porgy SCD1-a gene sequence, and the base is A or T; the nucleotide sequence of the SCD1-a gene is shown in SEQ ID No.1; the low temperature tolerance time of the AA genotype individuals at the SNP marker site is significantly higher than that of the TT genotype individuals under the same breeding conditions.

[0008] The above SNP markers are used as detection targets in identifying or screening black sea porgy varieties with low temperature resistance traits.

[0009] A primer pair for detecting the above-mentioned SNP marker related to the low temperature resistance trait of black sea porgy, comprising SCD1-a-3125-F and SCD1-a-3125-R, the sequence of SCD1-a-3125-F is shown in SEQ ID No.2, and the sequence of SCD1-a-3125-R is shown in SEQ ID No.3.

[0010] SCD1-a-3125-F: 5'-GTCGACAGCCTGTATAATTCCCGTA-3';

[0011] SCD1-a-3125-R: 5'-TGTATGTGAAAGAGAAACACGACT-3'.

[0012] The primer pair is used in identifying or screening black sea bream varieties with low temperature resistance.

[0013] A method for detecting the low temperature resistance of black sea porgy: extracting genomic DNA of the black sea porgy to be tested, and using the genomic DNA as a template, performing PCR amplification using the above primer pair to obtain a PCR amplification product; sequencing the PCR amplification product, and determining the genotype of a SNP marker according to the sequencing result. When the genotype of the SNP marker is an AA genotype, the black sea porgy to be tested has the low temperature resistance trait.

[0014] Furthermore, the conditions for the PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, repeated for 32 cycles; and extra-cyclic extension at 72°C for 7 min.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] (1) The present invention screened out the SNP site at the 3125th base of the SCD1-a gene through transcriptome sequencing and bioinformatics analysis methods, and designed its amplification primers SCD1-a-3125-F and SCD1-a-3125-R, which can screen out black sea bream varieties with low-temperature resistance traits, thereby significantly accelerating the breeding process of black sea bream varieties and quickly breeding new black sea bream varieties with excellent low-temperature tolerance traits.

[0017] (2) The molecular marker SCD1-a-3125 and its detection primer provided by the present invention can be used to detect the low-temperature resistance of black sea bream. This method is accurate, reliable, and simple to operate. It can effectively and quickly screen out traits that meet the requirements, and assist in the early selection of individuals of black sea bream that are tolerant to low temperatures in a short time and at low cost, thereby increasing the number of high-quality black sea bream, cultivating black sea bream varieties that are resistant to low temperatures, improving the cultivation rate of black sea bream, shortening the breeding cycle, and thereby increasing the yield of black sea bream, promoting its sustainable and healthy breeding, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the genotype sequencing peak diagram of the SNP marker site;

[0019] Figure 2 These are the statistical results of the low temperature tolerance time of the low temperature tolerance group and the low temperature intolerance group. DETAILED DESCRIPTION

[0020] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0021] Example 1

[0022] The black sea bream used in the experiment were all from the Jiangsu Marine Fisheries Germplasm Innovation Center. The body length was 11.3±1.7cm and the weight was 39.6±5.3g. They were placed in three breeding ponds (3.9m×2.6m×0.9m) for 7 days. During the period of temporary breeding, the water temperature was maintained at 15±0.5℃, oxygen was continuously supplied, and fresh seawater was replaced at 8 am every day. After 7 days, black sea bream with good vitality and intact body surface were selected for subsequent experiments.

[0023] A low temperature tolerance experiment was conducted on 1000 black sea breams by chronic cooling at 5±0.5℃ as the stress condition. The tolerance time of individuals was counted, and the 100 black sea breams that died first were regarded as the low temperature intolerance group (UT), and the 100 black sea breams that survived were regarded as the low temperature tolerance group (T).

[0024] Through low temperature stress, tissue samples (gills, muscles, liver, etc.) of black sea porgy at 15℃, 10℃, and 5℃ were mixed, and transcriptome sequencing was performed to screen candidate SNP markers related to low temperature tolerance. The candidate molecular markers related to low temperature tolerance traits were verified in low temperature tolerant and low temperature intolerant groups by direct sequencing of PCR products:

[0025] (1) Genomic DNA was extracted from the tail fin samples of black sea porgy in the low-temperature intolerance group and the low-temperature tolerance group using an animal tissue genome extraction kit (Shanghai Biotechnology Co., Ltd.), 100 fish in each group.

[0026] (2) The full-length sequence of the SCD1-a gene is shown in SEQ ID NO. 1. Design of detection primers SCD1-a-3125-F and SCD1-a-3125-R:

[0027] SCD1-a-3125-F: 5'-GTCGACAGCCTGTATAATTCCCGTA-3' (SEQ ID NO. 2);

[0028] SCD1-a-3125-R: 5'-TGTATGTGAAAGAGAAACACGACT-3' (SEQ ID NO. 3);

[0029] Using the DNA materials of the low temperature tolerant group T and the low temperature intolerant group UT as templates, PCR amplification was performed to obtain PCR amplification products;

[0030] The conditions for the PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, repeated for 32 cycles; and extra-cyclic extension at 72°C for 7 min.

[0031] PCR system is shown in Table 1:

[0032] Table 1

[0033]

[0034]

[0035] (3) The PCR amplification products were sequenced, the genotype of each individual was counted based on the sequencing results, and the correlation between the marker and the cold tolerance trait was analyzed using SPSS software.

[0036] Figure 1 The peak graph of genotype sequencing of SNP marker sites can be used to determine the single peak or double peak at a single base to determine the genotype of the tested individual: a single peak is a homozygous type, and a double peak is a heterozygous type. Figure 1 a is the A / A homozygous genotype, which is a low temperature tolerant individual. Figure 1 b is A / T heterozygous genotype, which is low temperature tolerant and non-tolerant individuals. Figure 1 c is a T / T homozygous genotype, which is a low temperature intolerant individual.

[0037] Figure 2 The statistical results of low temperature tolerance time of the low temperature tolerant group and the low temperature intolerant group, and the association analysis between the SNP loci of the black sea porgy SCD1-a gene and the low temperature tolerance trait are shown in Table 2:

[0038] Table 2 Association analysis between SNP loci of SCD1-a gene and low temperature tolerance in black sea porgy

[0039]

[0040] Depend on Figure 2 As can be seen from Table 1, the low temperature tolerance time of individuals with AA genotype at the 3125th base position was significantly higher than that of individuals with TT genotype under the same breeding conditions.

[0041] Sequence Listing

[0042] SEQ ID No.1

[0043] SCD1-a gene sequence

[0044]

[0045] SEQ ID No.2

[0046] SCD1-a-3125-F

[0047] gtcgacagcctgtataatctccgta

[0048] SEQ ID No.3

[0049] SCD1-a-3125-R

[0050] tgtatgtgaaagagaaacacgact Sequence Listing <110> Jiangsu Marine Fisheries Research Institute <120> A SNP marker related to the low temperature tolerance of black sea porgy and its application <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 7599 <212> DNA / RNA <213> Artificial Sequence <400> 1 actgtagttt ttggataagc gaacctgctt catctccgtt aaacaccccc ccaaaatatc 60 tactactcgt ctcgtctttg gtgagtaatt tacccgctat gttttcactc cacaggtgtg 120 gtgccagcgt gaacacggcg cagcaaacgt ctttatgtcag ctctaaactc agcatcatcg 180 ttacatgacc atcctcttct tcaccagcgg cgcccgctag ctaacggttg ctaggctagc 240 gagcacgaac aataattaac ggtcagcgcg agaaggtgtg ttaaggctcc gtgacgttag 300 ctcgacacga aaacaccgag acaaaccgaa tttctctca ttttctctgc ccgctccaga 360 gcatcaccaa accgctgcca cgatgacgga ggcggaggcg tggagaga agcagcacaa 420 gtccagtaac caaatgggg atgttctcc agaggccacc agagagacg tgttcgatca 480 cacatacaa gagaaagagg gcccaaaacc tggcacgata atcgtctgga agaatgtcat 540 gttgatgact gtattacata taggtgccct gtacgccatc tccctcatcc cttccgcatc 600 tcctttgacc tgctttggt gtaagtacaa aaatcctac ctgttactgc atttcttttt 660 ttttttcttt ttttttcaa atttttttct ctgttagtgg aattacataa aaatgttttc 720 cctcagtcac atctgttatg tcagtagccc ggcccactct ctcaccactg gtgcatgcat 780 aaatctgcat gatcctcca gtagcctggg tgttgtggga ttaaagctca ctcatactgt 840 atatcataaa gagatttaat gtcacagcac ccgtcctgga gctgcgaact gctcagtgca 900 tgcttgtcag gaaataact tgaacttgaa cagcagaggc catgctttcc tgatcaagta 960 acagcgacaa tagtaggg atgcgacaa agggagtg gccagttaat tacataact 1020 gcatgctact ttggtacat tatgttcatt tggatgagtg ttttctaatg aaatcaaaac 1080 cacagaggtt gcacttctgc gtcttatcac acatgcaatc acctaatggc ttttcggat 1140 gttatatgat gtaatgacat catcatataa catgcatccg cttccttcat cttggttatc 1200 cttgtgaaac aagtaggcca gtacaaacca acaaaacact acaaaataca ccatcataaa 1260 aaaacatata tagttgatga gacttcagtt aataatcagg gaattttaaa aatgtttaaa 1320 tgctttatat atttaattt agcaatcata gaggtttata cacatcaagt gcaactttat 1380 aatgaccttc tgattctgag tatttcgtaa tcatttataa agaactgcaa acatcagttg 1440 caactataaa tgttaaaggt gcagtatgta attaaagga agaacaagca atttcaacca 1500 gaggtgaaaa actttattgg ttgatttca ttactgagta aactgaataa attaacttcc 1560 tttcacagtc aacataattt catactgttt aacttagttg atatgcggcg gactctgcca 1620 cctttggacc ttattttcct ctgagtacgg cttgcttgtg aagttatgga ataaagagtt 1680 ctgagtttgc cttatgtaaa ttatacattt acagagtttg aatttcttat tccaaaacta 1740 tatagtgccc ctttaaaca ataatgtttt atatctgtt ttgtacagca ttcattatt 1800 tgttacagt gaagtagcta taactgaaa tgttatta agtattatt tactaatgac 1860 agttatta aagtgttagc taaagtagtt aagtcaagg caaattgaa tgatttca 1920 gaaatattgt ataagagagc taatctatt catgtaattg taatgtgtat attccacctt 1980 ttatacaaat gaaaatgttg aacatgatta atttatgctt tttgaaaa ctattttgtg 2040 gttctgagag gatgctctcc ccttcattta cacataaatt atacatgac atagagtatt 2100 ttcttgtgat gatcatttc ttgcaggacg atgttttcag gcagatttct cataaacaat 2160 tttaagaatg tgttacttca gttgttgc agccgcctat gtctgtctgt agtcaccata 2220 gcactggtta cacgtcatga gtaacagcct vakaacactg ataatcaga gtctgaatca 2280 cttgttgctg gattaccctc ccagtactta gtcttggaaa atctaatgtc ctcagagtgg 2340 cacacaca tatagacata ttaaacac cacacaca cacaataaaaacacagc 2400 ttaagatcac cggtagtcat caatgtcatc acagtccagg caggtattta aagtgcatgt 2460 cacaattgt catgacaag atagttagt atactgcata tcgattgt accatttat 2520 tataatcccc tggttcatat aacactgaca gtacaaaac tgtctgatgc ataacattg 2580 caatgtgaat tactgcaata aagtattgat ganaggacga gatgagtagg aaatggtccg 2640 actaatttgt tgatgcattt ctctccccac agccgtactt tgttttga taagtgcttt 2700 aggagtcact gcaggagctc atcgcctgtg gagtcacaga tcctacaagg cctcattacc 2760 tctgaggatc ttcttggtg tgctactc catggcattt caggtactc aaaaaatgac 2820 agatagtaca gatctgcaca cttaacgttg agataatagc agttttcatt actgtgtaag 2880 taccacgttg tgtcgacagc ctgtataatc tccgtattta cttgaaccca cagaatgata 2940 tctttgaatg ggcccgggac cacaggggttc accacaata tcagagaca gatgctgacc 3000 ctcacaacgc cgtgcggggc ttctctttg ctcacatcgg ctggctgctg gtgcgcaac 3060 accccgacgt catcgagaaa ggacgcaagc tggactcac tgacctgctg tctgacaag 3120 ttgtaatgtt tcaaggaag taagtggcct cagccattgg ttgatttac atcttatgtt 3180 gtcttacatg gaacaggaag taggctgggg aagtcttcca ttctatttca gtcgtgtttc 3240 tctttcacat acaaatattc aacccaaca agttcagccc taacactatt tgtcaagggc 3300 actgtcaatg catcctgggc ttagagccgc ccaagacaat tatgactt taagaaaatc 3360 gagcgagtca aaatgtttgt tcccctttaa agcatactg tgaggttcca taagtaacca 3420 tttcattcat attctgaatc aaggatggtg attgtaaacc attatgttgt agccatccgt 3480 agctatgaga ttaaaacaat gataaatgct cccgtagag ccacaggtcc atatgatatc 3540 catcacattc ctgaagtgtg tcagcgatgt cactgattgg tagcacagac atgaagtca 3600 ggtcggccag agagttctg ccaccatgat tggaccgttt atgtgacatt taccagagag 3660 aaaccataat tttctttct aggatgcatg ttgcattca tgcaggggtt atttgtaatg 3720 atttaagaga caagtacttc tttagtcttt gtataattgt tttacaactg tttgtagtc 3780 aagactcatt ttctcctgg cttcgtttcc aggcttaaa ttcttac aaggattttc 3840 ttatacatga acatgaatga atgaatgaa aaaaaatgga gccatccaaa aaatggggcac 3900 taaaccagag tgataagggg gttatatgga acagcactaa aacagagtgt caggatagat 3960 ctggctacaa atacatagca aagaaagaaa agataactg ttaagttttg gccacactgc 4020 tgcagagttg tgcttgcagt gcaggctgta tgtcattg tattaaca aggtgacagt 4080 taccacatg ttattcatgt atgtccagat tgactcactg tggcttg ggagaactgt 4140 gtcatgtgaa agaagtgaa aggagtgaa caatcaggtg tctgatatgc agaatgattag 4200 gtcaagaccg gtgttgtacc gtgtaacag cttcattcct tctgctgtcc accacttta 4260 tgtcctcgac aggtattaca agctgtctgt gctgctcatg tgctcttcg tcccatgtc 4320 tgtgccttgg tactgtggg gggagtccct gtgggtggcc tactcgtcc cggccctgct 4380 gaggtacacc ctggtgttga acgccacctg gctggtcac agcgccgctc acatgtgggg 4440 gaaccgtccc tatgacaaga acatcaaccc acgggaac aagtttgtca cgttcagtgc 4500 cataggtag gataatgtgc acatgttatc gttttaaca aagaaaaat gagacagat 4560 taaaaacagg atggcagac aacagtcgt ggcacgtata aacaacgtga cgttaacgtt 4620 ttgcatgatc gctcagaagt tcaccttttg cctacatttg gcagcacagt gagttcaagt 4680 tcaagttcag tgcgtgtcga agaagttacg cctaaatgaa tctggcagca gatagcaaag 4740 ataggaaaac accattaaat actatctcca cctaattgca gagaatatga aatctctcct 4800 gttgtggcat ttacacatct gtttgaattg accgctaccg taagtctctg cattggttac 4860 aagaactcac ctgttgcacc atgatgaagt gctacaagct aacacatcaa ataaacaggg 4920 atctttacat accaaagcta atatttgctg gcgcctgtct taactgtctc cgacatctgt 4980 cagctagatt gcaagataag taacaaaaca agacaacctc tctgtggatt taatcagcat 5040 gagcgaaaat gatcattgct cgcgatcagg gaggtcactt ttcttttgtg ctacttgtta 5100 gtcctcaatc agtctaactg tccaataaac atcaggaaga atcgcagagt ctgatgcata 5160 tcttgtacca gtgttttcct cccagtgtgg gaggaaaacc cctggtgtcc tattacaggt 5220 ttccttgttt tagtatgatg tgttgaccac ttgtttcttg taccttacag gtgagggatt 5280 ccacaattat catcactctt tcccctacga ctatgctacc agcgagtttg gctgcaagat 5340 gaaccttacc acttgcttca tcgacctgat gtgctacctg ggcctggcca aggaccgcaa 5400 gagagtgtcc cacgagatgg tcctggcccg aatacagcgc accggagacg gaagccaccg 5460 gagtggctaa gcttgttgga gttgtggtca gcttcgaggc aaaaaaaccg aaaagaagaa 5520 gcttcacagt cctttgacag ctctacattt tctcatcctc tgaggataaa agtcagcttc 5580 atgaggcct caaccacatt ttgcttgttt ttgtggtttt tgtagctgta acttaaaaa 5640 aattgttcaa gatggataac aaacacattt tgctaagccc ttggcctcag tttctattgt 5700 tcgagtcagg ccaaggtctt gcaaagatgt tttagatttg aagtagatgc gtttaaaaaa 5760 aaagtcaact tcatcctccg ctgttttgcc actttggtgt gcattcttca tgcaaagtca 5820 tgtagccgat catttttatg taagtattac tcaattatta atcaaactag acaagaaagt 5880 ggagcactga aatgagggt aacgtctcag ctgattaggt gactgttgcc tttatcgcag 5940 tttacagcaa gtttttacag tcctgatata agttcatttt atgagcgctc aaagatctga 6000 aataaaagg gatgagagtt tgaaacatat tttgttaaaa aagaaaagaa aagttgcttt 6060 aatgaaatat ggcacatgat agaagagtga gggaacccag accatcttat aaactgacta 6120 gcagtacgcc aaaaccttat ggaaaccgag agtcatgctg tgtgttttgc tgtgtgtaac 6180 ctggttttct ttctaaccaa accaaatgta gttgcacacg ctgtatttag tgtgtgttat 6240 gattagagtt ttctcgagac aatataaggg acacatttat catgaattta aaactgccgt 6300 tcgatatgta taacagaaaa tgataaatgt aatttataga gccctgcaat gtttgacgtt 6360 tgactttttt gtgtttttac tgaatacatc gcagtgccaa gagcgtgcca atcgtcgaca 6420 tatttataac catctcaatg gtccactaga gcacactaaa gtcgatatcg cttcttcact 6480 catcgtggaa gttttttaaa cattgtggca tcagtggctt cgcttcttct cctccttttc 6540 attcccgaaa catctgcagc agagcgatcc cgttggttga cgtggccggc cagccgtgcg 6600 acagttccgg tgttacaaaa caacgtgcca cccatgcatg atgatattct gtagtaggtg 6660 tcgtagtgag gtgtttttcg tcggcagaac cgtgtctatt tttgtaacgt gccgtggagc 6720 cgcatcactt tttggatcat cagaactgtt gccgtggtga ttttctgagg cggggtctgg 6780 ttccctttga tgtcccacaa agctgattgt caatgcagga aaattcaggt gcatcgatgc 6840 ttatgttcat cttcaattct ggtgtgagga atgctaatct tatttatgta tttatttcaa 6900 aaaatgtttt atcccctttt tgacctaaaa atatattgct gtaacctgaa ctgctttttc 6960 tgcattccaa gattgacag tctcgtacaa aacaaaatat atcaaatttt agcacctgtt 7020 tgttttttta cccccccaag agtcaggata caacctaatg ccttatgact tgcatccatt 7080 cctgatctcc ttcacgtttt gccaatttaa aacaaaaaag gttccaaagt accacaaaac 7140 aagtctgacc gaggtccatg tttacaggct gaggcaccag gtggaacgtc atttttattc 7200 tgaaaccgca tttaatttag gcaaatggta gcatgacaac attaaggtac tgtaaatgca 7260 aatagaggac agaggttaat tcactcgacg cctggtgcaa acgttcaatc gtgagattta 7320 acttgcaaac tgtgtgccct ggtggatgtg ccaactagtc tcaacccatc atggcaaact 7380 tccagacaaa gttgccgtca tgagtaatct tagagcactt aacataaccc gacaatgaaa 7440 aatatcacaa gccaagcaaa caactcctgc tgccaagagc gccgaaaatc aacgcttatg 7500 acgaagagga tcaaaaggtt gtcactctga atgattacgt caaatctcaa ctgtattcta 7560 ttctgaaata aagttcacaa tattttcaat acaatcgta 7599 <210> 2 <211> 25 <212> DNA / RNA <213> Artificial Sequence <400> 2 gtcgacagcc tgtataatct ccgta 25 <210> 3 <211> 24 <212> DNA / RNA <213> Artificial Sequence <400> 3 tgtatgtgaa agagaaacac gact 24

Claims

1. A SNP marker related to the low temperature tolerance trait of black sea porgy, characterized in that: The nucleotide sequence of the SNP marker is shown in SEQ ID No.1, wherein the 3125th base on the sequence shown in SEQ ID No.1 is A or T; the AA genotype individuals at the SNP marker site have a significantly higher low temperature tolerance time than the TT genotype individuals under the same breeding conditions.

2. A method for detecting the low temperature resistance of black sea porgy, characterized in that: Extracting genomic DNA of the black sea bream to be tested, and using the genomic DNA as a template, performing PCR amplification using a primer pair to obtain a PCR amplification product; sequencing the PCR amplification product, and determining the genotype of the SNP marker according to claim 1 according to the sequencing result, when the genotype of the SNP marker is an AA genotype, the black sea bream variety to be tested has a low temperature resistance trait; The primer pair includes SCD1-a-3125-F and SCD1-a-3125-R, the sequence of SCD1-a-3125-F is shown as SEQ ID No.2, and the sequence of SCD1-a-3125-R is shown as SEQ ID No.

3.

3. The method for detecting the low temperature resistance of black sea porgy as claimed in claim 2, characterized in that: The conditions for the PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, repeated for 32 cycles; and extra-cyclic extension at 72°C for 7 min.

Images