An engineering design method and a series of nucleic acid aptamers for cross-linked spore phenol and sensors using the same

Abstract

The present invention relates to a kind of engineering design method and a series of nucleic acid aptamers of cross-linked spore phenol and a sensor using the same, belonging to the field of biotechnology and analytical testing. A nucleic acid aptamer (AOH-59) with an original length of 59 bases of AOH is sheared, split, and multiple engineering designs of base conversion are performed. The characteristic that the fluorescence emission of AOH is enhanced after binding with the nucleic acid aptamer is used to conveniently determine the key binding domain of 5 bases of AOH-59 and AOH; the nucleic acid aptamer AOH 6C with only 23 bases is truncated and optimized; the nucleic acid aptamer AOH 6C-5-7-L with only 15 bases is obtained by splitting; and a divalent nucleic acid aptamer and a trivalent nucleic acid aptamer with a length of only 30 bases and 39 bases are designed according to the binding domain. The present invention also constructs two evanescent wave optical fiber sensors respectively using the above-mentioned truncated and split nucleic acid aptamers, and realizes ultrasensitive and specific detection of AOH.

Description

Technical Field

[0001] The invention relates to a series of nucleic acid aptamers of the fungal toxin cross-linked spore phenol obtained by engineering design and an ultrasensitive sensor using the same, and specifically to an engineering design method and a series of nucleic acid aptamers of cross-linked spore phenol and a sensor using the same, belonging to the field of biotechnology and analytical testing. Background Art

[0002] Mycotoxins are a class of biologically active substances produced by fungi or enzymes parasitic on crops such as grains or fruits under suitable conditions. There are many types of mycotoxins. According to incomplete statistics, there are more than 400 types. Among them, the main ones that are more harmful to humans and animals are: aflatoxin (AF), ochratoxin A (OTA), deoxynivalnol (DON), zearalenone (ZEN), fumonisin B1 (FB1), hydroxysporulin (AOH), hydroxysporulin monomethyl ether (AME), etc. Mycotoxins widely contaminate plant-derived products such as crops, food and feed, which can not only cause the mildew and deterioration of agricultural products, loss of nutrients, and reduced quality, but also cause mycotoxin poisoning by inhibiting the synthesis of DNA, RNA, and protein in the body and destroying the cell structure. Because they easily cause food contamination and pose a great threat to human health, the contamination of mycotoxins in food has become a problem of concern worldwide.

[0003] In order to strengthen the monitoring of mycotoxins in food, all countries have set limit standards for mycotoxins in different foods. Common detection methods for mycotoxins in laboratories are various methods based on chromatography and mass spectrometry. Although these methods have the advantages of high accuracy and simultaneous detection of multiple targets, they have the disadvantages of complicated sample pretreatment steps, long time consumption, expensive instruments, need for professional technicians to operate, and not suitable for on-site operation. In order to solve the above problems and meet the needs of rapid detection, some rapid detection products have been developed in recent years. The mainstream is antibody-based rapid detection product methods, such as enzyme-linked immunosorbent assay kits and colloidal gold test strips. The biggest advantage of this method is that it is simple to operate, fast, and has low detection cost. The disadvantage is that antibodies for highly specific small molecule targets are difficult to obtain, and the performance of antibodies varies greatly from batch to batch.

[0004] Aptamers are single-stranded or double-stranded DNA or RNA obtained by SELEX technology (Systematic Evolution of Ligands by Exponential Enrichment, i.e., systematic exponential enrichment of aptamer system evolution technology) (Nature, 1990, 346, 818-822; Nature, 1992, 355, 564-566). Aptamers can specifically recognize a variety of target molecules including proteins, small molecules, cells and tissues. Compared with antibodies, aptamers have stable chemical and physical structures and are obtained by chemical synthesis, so they are cheaper and have small performance differences between batches. In recent years, aptamers have received much attention in the field of analytical testing, and a series of new methods for rapid detection of fungal toxins in food have been reported. At present, the fungal toxins that have been successfully screened for aptamers mainly include aflatoxin, ochratoxin A, vomitoxin, zearalenone, fumonisin, and crosslinked spore phenol.

[0005] In addition to affinity and specificity, the length and number of binding sites of aptamers also directly affect the effect of their practical applications. For example, in the application of affinity columns, the synthesis cost of short aptamers is lower, and aptamers with multiple binding sites (multivalent aptamers) have higher column capacity than aptamers with a single binding domain (monovalent aptamers). In the application of sensors, in addition to being conducive to reducing costs, short aptamers are easy to fix on solid phase carriers, which is convenient for sensor probe design. However, the number of bases of the original aptamer is generally around 60 to 100, the synthesis cost is high, and it is difficult to be compatible with downstream applications, so it needs to be truncated and engineered. Unfortunately, due to the large workload and difficulty of truncation and engineering design, most aptamers have not yet been truncated and the key binding domains have not been determined, and there are very few reports on multivalent aptamers for small molecule targets, which greatly limits their downstream applications. Summary of the invention

[0006] In the present invention, we truncated, split, and base-changed the original 59-base AOH aptamer AOH-59. By utilizing the property that the fluorescence emission of AOH is enhanced after binding to the aptamer, the key binding domain of AOH-59 and AOH is conveniently identified; the aptamer AOH 6C with only 23 bases of AOH is optimized; the aptamer AOH 6C-5-7-L with only 15 bases of AOH is obtained by splitting; and the bivalent aptamer (AOH 6C-D-1) and trivalent aptamer (AOH6C-H-1) with lengths of only 30 bases and 39 bases, respectively, are successfully designed based on the binding domain. The design of multivalent nucleic acid aptamers includes the following steps: (1) identifying the key binding domain of the original length nucleic acid aptamer by truncation and base conversion; (2) designing a sequence containing multiple key binding domains, each binding domain is separated by a number of complementary base pairs, and a number of complementary base pairs are added at the end to stabilize the key binding domain at the end; (3) the affinity and specificity of the designed series of multivalent nucleic acid aptamers are tested to screen out the sequence with the best performance; (4) the actual binding ratio of each sequence to the target is determined. The present invention also uses the nucleic acid aptamers obtained by the above truncation and splitting to construct two evanescent wave optical fiber sensors, respectively, to achieve ultra-sensitive detection of AOH, and the detection limits of AOH in the buffer solution are 42fM and 7.4fM, respectively, and the detection limits of AOH added to the wheat extract are 0.096ng / g and 0.015ng / g, respectively, both of which are lower than the national limit of 10ng / g.

[0007] The AOH series of nucleic acid aptamers of the present invention have the following advantages:

[0008] 1) The length of the AOH series of nucleic acid aptamers obtained by the present invention is much shorter than the length of the original nucleic acid aptamer (59 bases). Short nucleic acid aptamer length is conducive to reducing synthesis costs and has better compatibility with downstream applications.

[0009] 2) The present invention identified the key binding site (5-base binding domain) between AOH and nucleic acid aptamers, laying the foundation for the engineering design of AOH nucleic acid aptamers.

[0010] 3) The truncated and split aptamers obtained by the method of the present invention have only 23 and 15 bases, respectively, which is beneficial to improve the loading density of aptamers on the sensor interface, especially to simplify the design of complementary DNA chains (usually 12-15 bases) of aptamers.

[0011] 4) The present invention obtains bivalent and trivalent AOH aptamers, which have higher affinity than the original aptamers, and each aptamer can bind to 2 or 3 AOHs, which is beneficial to improve the column capacity of AOH in affinity column applications.

[0012] 5) The evanescent wave sensors constructed by the method of the present invention using truncated and split nucleic acid aptamers are one million times and six million times more sensitive than the fluorescence enhancement-based method using the original-length AOH nucleic acid aptamer, respectively.

[0013] 6) The evanescent wave sensors constructed by the method of the present invention using truncated and split nucleic acid aptamers have achieved ultra-high sensitivity and specificity in the detection of AOH in wheat extract, with the detection limits being 100 and 600 times lower than the national limit standards, respectively.

[0014] 7) The method of the present invention uses an evanescent wave sensor constructed with truncated and split nucleic acid aptamers to detect AOH in wheat extract without the need for sample enrichment and purification, which greatly reduces the detection cost and shortens the detection time from 1-2 days to 1 hour. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figures 1A-1D This is the performance characterization diagram of the original length AOH nucleic acid aptamer AOH-59: Figure 1A The fluorescence spectrum of AOH-59 titrating AOH. Figure 1B The standard curve of AOH-59 titration of AOH. Figure 1C Indicates the target selectivity of AOH-59. Figure 1D Shows the effect of AOH on the secondary conformation of AOH-59.

[0016] Figure 2A and 2B AOH-59 fluorescence detection of AOH in buffer solution Figure 2A ) and wheat flour spiked with AOH( Figure 2B ) working curve diagram.

[0017] Figure 3 Schematic diagram of the design of truncation of AOH-59.

[0018] Figure 4 This is a diagram showing the secondary structure prediction results based on 12 short chains truncated from AOH-59.

[0019] Figure 5 The figure shows the relative affinity of the 12 short chains designed based on AOH-59 to AOH. The numbers on the horizontal axis in the figure are the abbreviations of the corresponding sequence names, for example, AOH 1 is recorded as 1, and so on; AOH 6C is recorded as 6.

[0020] Fig. 6A and 6B The base composition is AOH 6C, AOH 6CT, AOH 6CA, AOH 6CG and AOH 7 ( Fig. 6A) and their relative affinity for AOH ( Figure 6B ). In the abscissa, AOH represents the negative control sample containing only AOH.

[0021] Fig. 7A and 7B AOH 6C is a series of short chains obtained by changing the base composition around the unpaired C base (from AOH 6C-1 to AOH 6C-10). Fig. 7A ) and their relative affinity for AOH ( Figure 7B ) schematic diagram. The numbers on the horizontal axis in the figure are the abbreviations of the corresponding sequence names, for example, AOH 6C-1 is 1, and so on.

[0022] Fig. 8A and 8B AOH series of bivalent nucleic acid aptamers ( Fig. 8A ) and their relative affinity to AOH ( Figure 8B ) Schematic diagram. The numbers on the horizontal axis in the figure are the abbreviations of the corresponding bivalent nucleic acid aptamers, for example, AOH 6C-A1 is marked as 1, and so on.

[0023] Figures 9A-9D For the monovalent nucleic acid aptamer AOH 6C ( Fig.9A , Fig. 9C ) and bivalent nucleic acid aptamer AOH 6C-D-1( Fig. 9B , Fig.9D The dissociation constant (K D ) and selectivity test result graphs.

[0024] Fig. 10A and 10B AOH series trivalent nucleic acid aptamers ( Fig. 10A ) and their relative affinity to AOH ( Fig. 10B ) Schematic diagram. The numbers on the horizontal axis in the figure are the abbreviations of the corresponding trivalent nucleic acid aptamers, for example, AOH 6C-E1 is denoted as E1, and so on.

[0025] Fig.11A and 11B is the dissociation constant (K) of AOH trivalent nucleic acid aptamer AOH 6C-H1 D )( Fig.11A ) and selectivity ( Fig. 11B )’s measurement diagram.

[0026] Figures 12A-12C To determine the AOH monovalent nucleic acid aptamer AOH 6C ( Fig. 12A ), bivalent nucleic acid aptamer AOH 6C-D1 ( Fig. 12B ) and trivalent nucleic acid aptamer AOH 6C-H1( Fig. 12C) and AOH binding ratio.

[0027] Figures 13A-13C The evanescent wave fiber sensor based on the monovalent nucleic acid aptamer AOH 6C achieves ultrasensitive and highly specific detection of AOH. Fig.13A ) working curve for detecting AOH in buffer solution, ( Fig. 13B ) for other toxin small molecules (alternaria monomethyl ether (AME), patulin (Patulin), zearalenone (ZEN), ochratoxin (OTA), deoxynivalenol (DON)) and ( Fig. 13C ) Working curve for the detection of standard added AOH in wheat extract. All tests were performed in buffer (0.9 mM calcium chloride, 2.685 mM potassium chloride, 1.47 mM potassium dihydrogen phosphate, 0.49 mM magnesium chloride, 137 mM sodium chloride, 8.1 mM sodium dihydrogen phosphate, pH 7.4).

[0028] Figures 14A-14E The evanescent wave fiber sensor constructed based on the split AOH nucleic acid aptamers AOH 6C-5-7-L and AOH 6C-5-7-R achieved ultrasensitive and highly specific detection of AOH. Fig.14A ) Design of split nucleic acid aptamers; Fig. 14B ) Working curve for detecting AOH in buffer solution (AOH and AOH 6C-5-7-R-Cy5.5 are simultaneously introduced into the optical fiber reaction pool); ( Fig. 14C ) Working curve for detecting AOH in buffer solution (first AOH is introduced into the optical fiber reaction pool, and then AOH 6C-5-7-R-Cy5.5 is introduced); ( Fig.14D ) Selectivity test bar graph for other toxin small molecules (alternaria monomethyl ether (AME), patulin (Patulin), zearalenone (ZEN), ochratoxin (OTA), deoxynivalenol (DON)); ( Fig.14E ) Working curve for the detection of standard added AOH in wheat extract. ( Figures 14D-14E ) are all adopted ( Fig. 14C All tests were performed in a buffer solution (0.9 mM calcium chloride, 2.685 mM potassium chloride, 1.47 mM potassium dihydrogen phosphate, 0.49 mM magnesium chloride, 137 mM sodium chloride, 8.1 mM sodium dihydrogen phosphate, pH 7.4). DETAILED DESCRIPTION

[0029] Table 1. DNA probes used in the present invention

[0030]

[0031]

[0032] Example 1. Dissociation constant K of AOH original length nucleic acid aptamer AOH-59 D , selectivity, and characterization of secondary structure.

[0033] AOH emits weak fluorescence under ultraviolet light excitation. We found that when AOH is mixed with its nucleic acid aptamer AOH-59, the fluorescence value at 400nm (nanometers) increases significantly. Therefore, we conveniently determine the dissociation constant K of the AOH nucleic acid aptamer based on the properties of fluorescence intensity. D , selectivity.

[0034] K D Determination: First, use 1×AOH to screen the buffer solution (0.9 mM (millimoles per liter) CaCl 2 ,2.7mM KCl,1.5mM KH 2 PO 4 , 0.5 mM MgCl 2 ,137mM NaCl and 8mM Na 2 HPO 4 , pH 7.5) to prepare 1μM (micromoles per liter) AOH solution. Then, AOH-59 solutions with concentrations of 0, 20, 100, 400, 1000, 2000 and 4000nM (nanomoles per liter) were prepared in 1×AOH screening buffer solution. Then, the above AOH solution was mixed with AOH-59 solutions of different concentrations in a volume ratio of 1:1, and incubated at room temperature in the dark for 30 minutes. After the incubation, fluorescence detection was performed with a fluorescence excitation wavelength of 260nm and a scanning range of 300-480nm.

[0035] Selectivity test: First, use 1×AOH to screen the buffer solution (i.e., the K D The buffer for determination) was used to prepare an AOH-59 solution with a concentration of 0.4 μM. Then, 1 μM solutions of AOH, AME, DON, Patulin and ZEN were prepared with 1×AOH screening buffer solution. Then the prepared AOH-59 solution was mixed with each target solution in a volume ratio of 1:1, and incubated at room temperature in the dark for 30 minutes. After the incubation, the fluorescence instrument was used for detection. The fluorescence excitation wavelength was 260 nm, and the scanning range was 300-480 nm.

[0036] The changes in the secondary conformation of AOH-59 caused by the binding of AOH-59 to AOH were characterized by circular dichroism. D A series of AOH solutions of 0, 1, 10, and 20 μM were prepared in the buffer solution for determination. Then 1 μL of 100 μM original length nucleic acid aptamer AOH-59 was added to the prepared 100 μL AOH solutions of different concentrations, and incubated at room temperature in the dark for 30 minutes. After the incubation, circular dichroism spectrometer was used for detection. The parameters of CD were as follows: scanning range was 180-400 nm, Data Pitch was 1 nm, scanning mode was continuous scanning, scanning speed was 100 nm / min, response time was 1 s, bandwidth was 2 nm, and scanning times were 3 times.

[0037] The results of the above experiments are as follows Figures 1A-1D As shown. Figure 1A The fluorescence spectra obtained by titrating a fixed concentration of AOH with different concentrations of AOH-59. Figure 1B is the standard curve of the fluorescence value of AOH at 400nm changing with the concentration of AOH-59. As the concentration of AOH-59 increases, the fluorescence intensity at 400nm gradually increases. According to the 1:1 binding ratio, the K value of AOH-59 is obtained by nonlinear fitting. D The results showed that AOH-59 had a moderate affinity for AOH. Figure 1C As shown in the figure, the fluorescence value of the mixed sample of AOH and AOH-59 is set to 100%, the signal response to AME is 75%, and for other mycotoxins, the signal change is about 15%. AME is a homologue of AOH, and the molecular structures of the two differ only by one methyl group. The selectivity test results show that the affinity of AOH-59 for AOH and AME is much higher than that for other types of mycotoxins, and therefore it has good specificity for AOH and AME. Figure 1D As shown in the circular dichroism experiment, different concentrations of AOH titrated a fixed concentration of AOH-59. As the concentration of AOH increased, the positive peak of AOH-59 at 275nm gradually increased, and the negative peak at 250nm gradually weakened. This result shows that AOH-59 has a stem-loop structure, and the combination of AOH and AOH-59 enhances the stability of the stem-loop structure.

[0038] Example 2. Fluorescence determination of AOH in buffer and wheat flour using the original length AOH nucleic acid aptamer AOH-59.

[0039] For the determination of AOH in buffer, first use 1×AOH to screen the buffer solution (i.e., the AOH-59K DThe AOH-59 was diluted to 0.4 μM in the buffer solution for determination. AOH solutions with concentrations of 0 nM, 20 nM, 100 nM, 400 nM, 1 μM, 2 μM, 4 μM and 10 μM were prepared with 1×AOH screening buffer solution. The prepared AOH-59 solution was then mixed with AOH of different concentrations in a volume ratio of 1:1 and incubated at room temperature in the dark for 30 minutes. After the incubation, the fluorescence was detected using a fluorescence instrument. The fluorescence excitation wavelength was 260 nm and the scanning range was 300-480 nm.

[0040] For the determination of AOH in wheat samples, the current detection of fungal toxins in real samples mainly relies on large analytical instruments. The removal of complex matrix components in real samples is often too cumbersome, which is also one of the disadvantages of traditional detection methods. Nucleic acid aptamer affinity column is a new solid phase extraction technology that couples nucleic acid aptamers to solid phase filling materials by chemical methods to retain and purify the target. We used AOH-59 affinity column to pre-treat wheat flour samples, and detected the purified AOH using the above-mentioned fluorescence enhancement method. The specific operation process is described as follows:

[0041] 1. Spiking: Take 1g (gram) of wheat flour, add 5ml of 50% pure acetonitrile, and then add 0, 258ppb, 645ppb, 1290ppb, 2580ppb AOH respectively (final concentrations are: 0nM, 200nM, 500nM, 1μM, 2μM).

[0042] 2. Extraction: The wheat flour mixture with AOH added was shaken for 30 minutes, and then centrifuged at 10,000 rpm for 10 minutes. The supernatant was filtered, 1 ml of the filtrate was taken, and 9 ml of 1×AOH screening buffer solution was added.

[0043] 3. Column: Activate the AOH aptamer affinity column with 5 ml of 1×AOH screening buffer solution for later use, then take 5 ml of the diluted extract and pass it through the column, and discard the column solution.

[0044] 4. Wash: Wash the affinity column with 1 ml of 1×AOH screening buffer solution and discard the eluent.

[0045] 5. Elution: Elute with 1 ml of pure methanol and collect the eluate. 6. Fluorescence detection of AOH: Take the above 20 μL (microliter) methanol eluate, add 80 μL 1×AOH screening buffer solution, then add 1 μL 100 μM AOH-59, incubate in the dark for 30 minutes and measure the fluorescence.

[0046] The fluorescence detection results of AOH added to the buffer and wheat flour are as follows: Figure 2A and2B As shown. Figure 2A As shown in Figure 2, within the tested concentration range (0-5 μM), the fluorescence intensity increased linearly with the increase in AOH concentration (R 2 =0.986). The detection limit (LOD) of AOH calculated based on three times the signal-to-noise ratio was 20 nM.

[0047] like Figure 2B As shown in the figure, AOH added to wheat flour was detected. Since wheat flour itself has a complex composition, in order to eliminate the interference of the matrix on identification and testing as much as possible, we first used the AOH nucleic acid aptamer affinity column to purify the AOH in wheat flour. The LOD of AOH added to wheat flour is 50nM. Considering the dilution process in the entire pretreatment, the LOD converted to the spiked concentration is 645ng / g, which is higher than the national limit standard.

[0048] Example 3. Engineering design of shearing (truncation), splitting, and base conversion of AOH-59.

[0049] like Figure 3 As shown in Figure 1, AOH-59 consists of 59 bases and has a stem-loop structure according to the simulation of the mfold software. We designed 12 different truncations for AOH-59. The sequences of all designed probes are shown in Table 1 and the predicted secondary structures are shown in Table 2. Figure 4 .

[0050] ① Split AOH-59 into two short chains AOH 1 and AOH 2 at the position indicated by the arrow;

[0051] ② Since there is a large loop in the middle of AOH-59, in order to determine whether this loop region is involved in the recognition of AOH, the bases in the dotted circle were cut off to obtain AOH 3;

[0052] ③, ④ Since the stem of AOH-59 is relatively long, in order to determine whether the stem is the binding site of AOH, the bases below the part indicated by the arrow were cut off to obtain AOH 4 and AOH 5, respectively.

[0053] ⑤Through experiments, we found that the affinity of AOH 3 with the macrocycle removed and AOH 4 with the base below arrow ③ removed to AOH is comparable to that of AOH-59 ( Figure 5 ), so we removed the bases below the macroloop and ③ at the same time and obtained AOH 6C.

[0054] ⑥AOH 6C has an unpaired C base (red circle area). In order to explore whether it is the key site for binding with AOH, we removed the C base and obtained AOH 7.

[0055] ⑦, ⑧, ⑨ To determine whether there is an AOH binding site in the stem, we cut AOH 6C from the positions of arrows ⑦, ⑧, and ⑨, removed the bases below the arrows, and obtained AOH 10, AOH 9, and AOH 8, respectively.

[0056] ⑩ In order to verify whether AOH 6C can be designed as a split nucleic acid aptamer, AOH 6C was split into two short chains AOH 11 and AOH 12 at the position indicated by the arrow.

[0057] We used the above fluorescence method to measure the recognition ability of these truncated nucleic acid short chains to AOH. Figure 5 As shown in the figure, the responses of each short chain to AOH are very different. Based on the splitting of AOH-59, AOH 1 and AOH 2, the fluorescence intensity increases significantly only when both exist at the same time, indicating that AOH-59 can be split and still maintain its binding ability with AOH. A single split chain cannot bind to AOH. AOH 3, AOH 4, AOH 5 and AOH 6C can all bind to AOH, causing an increase in fluorescence, indicating that they all contain the binding domain of AOH. As the length of the double-stranded region shortens (from AOH 3 to AOH6C), the fluorescence increase gradually decreases, indicating that the double-stranded structure can stabilize the binding of AOH to its binding domain.

[0058] In order to further explore the details of the binding between the target and the aptamer, we designed a truncation of AOH 6C. Figure 3 As shown. By comparing the changes in fluorescence values, we can see that the fluorescence enhancement values ​​of the truncated short chains AOH 8, AOH 9 and AOH 10 are lower than that of AOH 6C. The results show that complementary base pairs do play a role in stabilizing the binding of AOH to its binding domain. AOH 11 and AOH 12, obtained based on the splitting of AOH 6C, cannot cause an increase in fluorescence intensity when they exist alone or at the same time. This shows that AOH 6C cannot split. At the same time, we found that AOH 7 has one less unpaired C base than AOH 6C, and it has completely lost its ability to bind to AOH ( Figure 5 ). This indicates that the C base is the key binding site for AOH.

[0059] Example 4. Using base substitution to identify the key binding site between AOH 6 and AOH.

[0060] like Fig. 6A As shown in Figure 1, we replaced the C base in AOH 6C and obtained new short chains AOH 6T, AOH 6A and AOH 6G. Figure 6BAs shown, the fluorescence enhancement caused by the interaction of AOH 6T, AOH 6A and AOH 6G with AOH is not as high as that of AOH 6C, indicating that the C base is the key binding site for the interaction with AOH.

[0061] Example 5. Effect of the sequence and type of bases surrounding the unpaired C base in AOH 6C on its binding affinity to AOH.

[0062] like Fig. 7A As shown, the two groups of base pairs "AT" and "TA" around the unpaired C base were transformed. By introducing other types of base pairs and changing the composition order, we obtained 9 short chains with different "structural domains".

[0063] from Figure 7B It can be seen that the complementary base pairs around the C base have a greater effect on the recognition of AOH. When the C base is surrounded by "AT" base pairs, the fluorescence enhancement is the largest; when they are all surrounded by "CG" base pairs, the fluorescence enhancement is the smallest; when the base pairs are "AT" and "CG" respectively, the fluorescence value is slightly higher than the fluorescence value when they are all "CG" base pairs. The results show that the "AT" base pair is the key binding site for recognizing AOH. Combined with the experimental results of Example 4, it is determined that the key binding domain of AOH 6C and AOH is two pairs of "AT" base pairs and an unpaired C base forming a "pocket" structure. Among them, "AT" and "TA" have no effect on the binding affinity of the nucleic acid aptamer to AOH.

[0064] Example 6. Engineering design of AOH 6C bivalent nucleic acid aptamer.

[0065] We constructed a bivalent nucleic acid aptamer by introducing the structural domain composed of the five bases "AT", "TA" and "C" mentioned above into AOH 6C. We studied the effects of the number of complementary bases at the tail end of the nucleic acid aptamer (1-3) and the number of complementary bases between two adjacent binding domains (shared base pairs, 0-2) on affinity. Fig. 8A The secondary structures of 12 bivalent nucleic acid aptamers designed based on AOH 6C. Figure 8BIt can be seen that when the number of complementary bases between adjacent binding domains remains unchanged, as the complementary base pairs at the tail end of the nucleic acid aptamer shorten, the fluorescence signal gradually decreases, which means that when the number of complementary bases at the tail end is small, the structure of the entire bivalent aptamer is in an unstable state, which is very unfavorable for the recognition of target molecules; at the same time, when the number of complementary bases at the tail end remains unchanged, as the number of complementary bases between adjacent binding domains increases, its signal response also shows an increasing trend. As mentioned above, a large number of complementary bases can not only maintain the structural stability of the bivalent probe, but also avoid mutual interference in target binding caused by adjacent binding domains being too close. AOH 6C-D-1, which has the largest number of complementary bases, has the highest affinity for AOH among the 12 bivalent aptamers.

[0066] Example 7. Dissociation constants K of monovalent and bivalent aptamers D and selective characterization.

[0067] In order to confirm that the engineered monovalent and bivalent aptamers have more outstanding performance than the original long aptamers, the affinity and selectivity of these two probes were tested respectively with reference to the characterization method of the original long aptamer AOH-59. Fig.9A and 9B As shown, the K of AOH 6C and AOH 6C-D-1 D The affinity of the bivalent aptamer AOH 6C-D-1 was comparable to that of AOH-59, but its length was only 30 bases, which was nearly half of the original length of 59 bases. Fig. 9C and 9D As shown, due to the specificity of the binding domain in recognizing AOH, the monovalent and bivalent nucleic acid aptamers also showed similar results, that is, in addition to recognizing AOH, they also showed strong affinity for AOH's homologue AME.

[0068] Example 8. Engineering design of AOH trivalent nucleic acid aptamer and determination of dissociation constant and specificity

[0069] According to the design ideas and methods of bivalent nucleic acid aptamers, we constructed a series of trivalent nucleic acid aptamers based on AOH 6C. Fig. 10A , Fig. 10B The secondary structures and relative affinity test results of 12 trivalent nucleic acid aptamers are shown. The change pattern is consistent with that of bivalent nucleic acid aptamers: as the number of complementary bases at the tail end and the number of complementary bases between two adjacent binding domains gradually increase, the signal response of trivalent nucleic acid aptamers also gradually increases. Finally, the most obvious recognition effect among the trivalent nucleic acid aptamers is AOH 6C-H-1, which has the largest number of complementary bases and the longest length.

[0070] Referring to the characterization method of the original length aptamer AOH-59 (Figure 1), the dissociation constant K of the trivalent nucleic acid aptamer AOH 6C-H-1 was calculated. D and specificity were tested. Fig.11A As shown, K D The affinity is 274±233nM, which is higher than AOH-59. However, the length is only 39 bases, which is 20 bases less than the original length. At the same time, it can be seen that as the number of binding domains increases, the multivalent nucleic acid aptamer has a stronger ability to recognize AOH. Fig. 11B As shown in the figure, thanks to the specificity of the binding domain in recognizing AOH, the trivalent nucleic acid aptamer also showed similar results, that is, in addition to recognizing AOH, it also showed a strong affinity for AOH's homologue AME. According to this design method, multivalent nucleic acid aptamers with a higher number of binding sites and affinity can also be designed.

[0071] Example 9. Determination of the Binding Ratio of AOH Divalent and Trivalent Aptamers to AOH

[0072] In order to further explore whether the bivalent and trivalent aptamers are consistent with what we imagined: the target and the aptamer are bound in a ratio of 2:1 and 3:1 respectively. Therefore, we chose AOH 6C, AOH 6C-D-1 and AOH 6C-H-1 as representatives of monovalent, bivalent and trivalent aptamers, respectively, and used the Job Plot method to test the binding ratio of these three probes to recognize AOH. By fixing the total concentration of the probe and toxin unchanged, adjusting the concentration ratio of the two, and combining with the fluorescence method, the Job Plot curves of the three probes were obtained, as shown below: Figures 12A-12C shown.

[0073] The fluorescence values ​​of the three systems all showed a trend of increasing first and then decreasing with the increase of the concentration ratio of the probe in the system, and reached the maximum value at different inflection points. After analysis, the monovalent, divalent and trivalent aptamers showed the maximum signal response at concentration ratios of 0.5, 0.38 and 0.33, respectively. The conversion showed that the binding ratios of AOH to the three probes were 1:1, 1.63:1 and 2.03:1, respectively. Except for AOH 6C, which was bound at a ratio of 1:1 as we imagined, AOH6C-D-1 and AOH 6C-H-1 were smaller than the 2:1 and 3:1 we imagined, which means that the binding ratio of the multivalent nucleic acid aptamer to the target is not a simple proportional relationship with the number of monovalent binding domains in its entire structure, but is higher than 1:1.

[0074] Example 10. Construction of an evanescent wave optical fiber sensor based on the monovalent nucleic acid aptamer AOH 06 for ultrasensitive and highly specific detection of AOH.

[0075] The amino-modified nucleic acid aptamer NH 2 -AOH 6C (Table 1) is coupled to the surface of the optical fiber. For specific experimental conditions, please refer to the patent (PCT / CN2020 / 079442). Before testing the sample, the optical fiber was blocked with Tween 80 at a concentration of 1%. AOH standard solutions with different final concentrations (0, 10fM, 100fM, 1pM, 10pM, 100pM (picomoles per liter), 1nM, 10nM, 100nM,) were prepared in a buffer solution (0.9mM calcium chloride, 2.69mM potassium chloride, 1.47mM potassium dihydrogen phosphate, 8.1mM disodium hydrogen phosphate, 0.49mM magnesium chloride, 137mM sodium chloride, pH 7.4). They were mixed with 50nM fluorescently modified complementary chains (c-AOH 6C-Cy 5.5, Table 1) and passed into the optical fiber sensor from low concentration to high concentration. After each test, the interface was regenerated and the pipeline was cleaned to reduce the fluorescence signal to the baseline. The changes in fluorescence over time at different concentrations were recorded, and the working curve was drawn with the percentage of relative fluorescence signal reduction at different target concentrations as the ordinate. Other toxin small molecules AME, Patulin, ZEN, OTA and DON standard solutions with a final concentration of 100pM were prepared for target selectivity testing.

[0076] For the determination of spiked AOH in wheat extract, the sample preparation process is as follows: take 1g of wheat flour, add 6mL of pure acetonitrile, vortex the mixture for 3min, and centrifuge for 10min (9000r / min). Take 1mL of supernatant, dilute 100 times with buffer without passing through the membrane. Use this solution to prepare AOH solutions of different concentrations, and the final concentrations are 0, 10pM, 100pM, 1nM, 10nM, 100nM, 1μM and 10μM.

[0077] The detection results of AOH in buffer solution are as follows: Fig.13A As shown in the figure, the detection limit obtained according to the 3-fold signal-to-noise ratio is 42±3.4fM, and the linear kinetic range is 100fM-100pM. Fig. 13B As shown in the figure, except for AME, the fluorescence signal of 100fM AOH decreased more than that of 100pM other toxin small molecules, indicating that the sensor has extremely high target selectivity (>1000) for AOH. Fig. 13C As shown, the detection limit was 62±7.2pM, i.e. 0.096ng / g, and the linear kinetic range was 10pM–10nM (R 2=0.999). This detection limit is much lower than the national standard limit of 10ng / g for AOH in wheat. Therefore, the short-chain monovalent nucleic acid aptamer AOH 6C obtained by the present invention can be conveniently used in the construction of sensors to achieve highly sensitive and specific detection of AOH in wheat extracts. In the present invention, the concentration of Tween 80 when the optical fiber is blocked is 1% (w / v), and in the PCT patent (PCT / CN2020 / 079442) we applied for previously, the concentration of Tween 80 when blocked is 0.1% (w / v). The present invention greatly improves the detection sensitivity and specificity of AOH. The detection limit is reduced from 666fM to 42fM, and the selectivity is increased from >100 to >1000.

[0078] Example 11. The evanescent wave fiber sensor based on the split-design AOH nucleic acid aptamers AOH 6C-5-7-L and AOH 6C-5-7-R was used for ultrasensitive and highly specific detection of AOH.

[0079] The probe design is as follows ( Fig.14A ): Two pairs of GC complementary base pairs are added at the upper and lower ends of the AOH 6C pocket binding domain, and two short chains are obtained from the middle position, namely AOH-6C-5-7-L and AOH-6C-5-7-R. Among them, AOH-6C-5-7-L has a stronger binding affinity with AOH than AOH-6C-5-7-R. When both exist at the same time, the binding affinity with AOH is the strongest.

[0080] The sensor preparation and AOH detection process were the same as in Example 10, except that NH 2 -AOH 6C-5-7-L was fixed on the optical fiber, and AOH 6C-5-7-R-Cy 5.5 was used as the detection probe. We first followed the detection mode of Example 10 (simultaneously introducing a mixture of the target and the fluorescently modified AOH 6C-5-7-R), and the results were as follows: Fig. 14B As shown. The fluorescence signal at the low concentration end (1fM-1pM) is higher than that of the blank sample, while the high concentration end (10pM-100nM) still maintains the signal reduction detection mode. This result shows that there are multiple competitive interactions in this detection system. Therefore, we changed the detection mode to simplify the interaction on the interface: first, the target is incubated, and then the fluorescent modified chain is introduced, while ensuring that the incubation time of the two with the nucleic acid aptamer is the same. The results are shown in Fig. 14C As shown in the figure, the fluorescence signal gradually decreases with the increase of AOH concentration. The detection limit obtained according to the 3-fold signal-to-noise ratio is 7.4 fM, and the linear kinetic range is 1 fM-1 pM. Its sensitivity is 6 times higher than that of Example 10. Fig.14DAs shown, except for AME (corresponding to the fluorescence results), the fluorescence signal of 100fM AOH decreased more than that of 100pM other toxin small molecules, indicating that the sensor has extremely high target selectivity (>1000). Fig.14E As shown in the figure, the wheat extract containing AOH was diluted 100 times and directly detected without any sample pretreatment. The detection limit was 10pM, i.e. 0.015ng / g, and the linear kinetic range was 10pM–10nM (R 2 =0.991). This detection limit is much lower than the national standard limit of AOH in wheat, 10 ng / g (6 nM).

[0081] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention. Sequence Listing <110> Capital Normal University <120> An engineering design method and a series of nucleic acid aptamers for cross-linked spore phenol and sensors using the same <130> P1II210147 <160> 53 <170> PatentIn version 3.3 <210> 1 <211> 59 <212> DNA <213> Artificial sequence <220> <223> AOH-59 <400> 1 ggcactccac gcataggcat acttaactag tgttcaagtt atcctgtgcg tggatgtcc 59 <210> 2 <211> 29 <212> DNA <213> Artificial sequence <220> <223> AOH 1 <400> 2 ggcactccac gcataggcat acttaacta 29 <210> 3 <211> 30 <212> DNA <213> Artificial sequence <220> <223> AOH 2 <400> 3 gtgttcaagt tatcctgtgc gtggatgtcc 30 <210> 4 <211> 49 <212> DNA <213> Artificial sequence <220> <223> AOH 3 <400> 4 ggcactccac gcatagctta actagtgttc aagctgtgcg tggatgtcc 49 <210> 5 <211> 33 <212> DNA <213> Artificial sequence <220> <223> AOH 4 <400> 5 taggcatact taactagtgt tcaagttatc ctg 33 <210> 6 <211> 41 <212> DNA <213> Artificial sequence <220> <223> AOH 5 <400> 6 cgcataggca tacttaacta gtgttcaagt tatcctgtgc g 41 <210> 7 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C <400> 7 tagcttaact agtgttcaag ctg 23 <210> 8 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> AOH 7 <400> 8 tagcttaact agtgttaagc tg 22 <210> 9 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> AOH 8 <400> 9 agcttaacta gtgttcaagc t 21 <210> 10 <211> 19 <212> DNA <213> Artificial sequence <220> <223> AOH 9 <400> 10 gcttaactag tgttcaagc 19 <210> 11 <211> 17 <212> DNA <213> Artificial sequence <220> <223> AOH 10 <400> 11 cttaactagt gttcaag 17 <210> 12 <211> 11 <212> DNA <213> Artificial sequence <220> <223> AOH 11 <400> 12 tagcttaact a 11 <210> 13 <211> 12 <212> DNA <213> Artificial sequence <220> <223> AOH 12 <400> 13 gtgttcaagc tg 12 <210> 14 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6CT <400> 14 tagcttaact agtgtttaag ctg 23 <210> 15 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6CA <400> 15 tagcttaact agtgttaaag ctg 23 <210> 16 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6CG <400> 16 tagcttaact agtgttgaag ctg 23 <210> 17 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-2 <400> 17 tagctaaact agtgttctag ctg 23 <210> 18 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-3 <400> 18 tagctttact agtgtacaag ctg 23 <210> 19 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-4 <400> 19 tagctcgact agtgtccgag ctg 23 <210> 20 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-5 <400> 20 tagctggact agtgtcccag ctg 23 <210> twenty one <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-6 <400> twenty one tagctccact agtgtgcgag ctg 23 <210> twenty two <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-7 <400> twenty two tagcttcact agtgtgcaag ctg 23 <210> twenty three <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-8 <400> twenty three tagcttgact agtgtccaag ctg 23 <210> twenty four <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-9 <400> twenty four tagctacact agtgtgctag ctg 23 <210> 25 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> AOH 6C-10 <400> 25 tagctagact agtgtcctag ctg 23 <210> 26 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> AOH 6C-A-1 <400> 26 tagcataact agtgttcact gctg 24 <210> 27 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> AOH 6C-A-2 <400> 27 tagataacta gtgttcactc tg 22 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <220> <223> AOH 6C-A-3 <400> 28 taataactag tgttcacttg 20 <210> 29 <211> 26 <212> DNA <213> Artificial sequence <220> <223> AOH 6C-B-1 <400> 29 tagctataac tagtgttcat cagctg 26 <210> 30 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> AOH 6C-B-2 <400> 30 tagtataact agtgttcatc actg 24 <210> 31 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> AOH 6C-B-3 <400> 31 tatataacta gtgttcatca tg 22 <210> 32 <211> 28 <212> DNA <213> Artificial sequence <220> <223> AOH 6C-C-1 <400> 32 tagcatataa ctagtgttca tactgctg 28 <210> 33 <211> 26 <212> DNA <213> Artificial sequence <220> <223> AOH 6C-C-2 <400> 33 tagatataac tagtgttcat actctg 26 <210> 34 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> AOH 6C-C-3 <400> 34 taatataact agtgttcata cttg 24 <210> 35 <211> 30 <212> DNA <213> Artificial sequence <220> <223> AOH 6C-D-1 <400> 35 tagctatata actagtgttc atatcagctg 30 <210> 36 <211> 28 <212> DNA <213> Artificial sequence <220> <223> AOH 6C-D-2 <400> 36 tagtatataa ctagtgttca tatcactg 28 <210> 37 <211> 26 <212> DNA <213> Artificial sequence <220> <223> AOH 6C-D-3 <400> 37 tatatataac tagtgttcat atcatg 26 <210> 38 <211> 27 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-E-1 <400> 38 tagctataac tagtgttcac tcagctg 27 <210> 39 <211> 25 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-E-2 <400> 39 tagtataact agtgttcact cactg 25 <210> 40 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> DNA 6C-E-3 <400> 40 tatataacta gtgttcactc atg 23 <210> 41 <211> 31 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-F-1 <400> 41 tagctatata actagtgttc atcatcagct g 31 <210> 42 <211> 29 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-F-2 <400> 42 tagtatataa ctagtgttca tcatcactg 29 <210> 43 <211> 27 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-F-3 <400> 43 tatatataac tagtgttcat catcatg 27 <210> 44 <211> 35 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-G-1 <400> 44 tagctatata taactagtgt tcatactatc agctg 35 <210> 45 <211> 33 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-G-2 <400> 45 tagtatatat aactagtgtt catactatca ctg 33 <210> 46 <211> 31 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-G-3 <400> 46 tatatatata actagtgttc atactatcat g 31 <210> 47 <211> 39 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-H-1 <400> 47 tagctatata tataactagt gttcatatca tatcagctg 39 <210> 48 <211> 37 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-H-2 <400> 48 tagtatatat ataactagtg ttcatatcat atcactg 37 <210> 49 <211> 35 <212> DNA <213> Artificial sequence <220> <223> DNA 6C-H-3 <400> 49 tatatatata taactagtgt tcatatcata tcatg 35 <210> 50 <211> 33 <212> DNA <213> Artificial sequence <220> <223> NH2-AOH 6C <400> 50 aaaaaaaaaa tagcttaact agtgttcaag ctg 33 <210> 51 <211> 12 <212> DNA <213> Artificial sequence <220> <223> c-AOH 6C-Cy 5.5 <400> 51 cagcttgaac ac 12 <210> 52 <211> 25 <212> DNA <213> Artificial sequence <220> <223> NH2-AOH 6C-5-7-L <400> 52 aaaaaaaaaa tagctgctag cacta 25 <210> 53 <211> 16 <212> DNA <213> Artificial sequence <220> <223> AOH 6C-5-7-R-Cy 5.5 <400> 53 gtgtgctcag cagctg 16

Claims

1. An engineering design method, It is characterized in that The method truncated, split, and base-changed the original 59-base AOH aptamer AOH-59 through various engineering designs. The base sequence (5'-3') of the nucleic acid aptamer AOH-59 is GGCACTCCACGCATAGGCATACTTAACTAGTGTTCAAGTTATCCTGTGCGTG GATGTCC. The characteristic that the fluorescence emission of AOH is enhanced after binding to the nucleic acid aptamer is conveniently identified to conveniently identify the key binding domain of AOH-59 and AOH; the nucleic acid aptamer AOH 6C with only 23 bases of AOH is optimized. The base sequence (5'-3') of the nucleic acid aptamer AOH 6C is TAGCTTAACTAGTGTTCAAGCTG, and the key binding site of AOH and the nucleic acid aptamer is identified: a 5-base binding domain, and the AOH aptamer is determined. The key binding domain of 6C and AOH is a "pocket" structure formed by two pairs of "AT" base pairs and an unpaired C base; the nucleic acid aptamer AOH 6C-5-7-L with a length of only 15 bases was obtained by splitting, and the base sequence (5'-3') of the nucleic acid aptamer AOH 6C-5-7-L is TAGCTGCTAGCACTA; and based on the binding domain, a bivalent nucleic acid aptamer (AOH 6C-D-1) and a trivalent nucleic acid aptamer (AOH 6C-H-1) with a length of only 30 bases and 39 bases, respectively, were successfully designed. The base sequences (5'-3') of 6C-H-1) are TAGCTATATAACTAGTGTTCATATCAGCTG and TAGCTATATATATAACTAGTGTTCATATCATATCAGCTG, respectively, and their affinity is higher than that of the original nucleic acid aptamer, and each nucleic acid aptamer binds to 2 or 3 AOHs.

2. The engineering design method according to claim 1, It is characterized in that The design of multivalent nucleic acid aptamers includes the following steps: (1) identifying the key binding domain of the original length nucleic acid aptamer by truncation and base conversion; (2) designing a sequence containing multiple key binding domains, each binding domain is separated by a number of complementary base pairs, and a number of complementary base pairs are added at the end to stabilize the key binding domain at the end; (3) testing the affinity and specificity of the designed series of multivalent nucleic acid aptamers to screen out the sequence with the best performance; (4) Determine the actual binding ratio of each sequence to the target.

3. The engineering design method according to claim 1, It is characterized in that The various engineering designs of truncation, splitting, and base conversion include the following processes: ① Split AOH-59 into two short chains AOH 1 and AOH 2 from the position indicated by the arrow. The base sequences (5'-3') of AOH 1 and AOH 2 are GGCACTCCACGCATAGGCATACTTAACTA and GTGTTCAAGTTATCCTGTGCGTGGATGTCC, respectively; ② Since there is a large loop in the middle of AOH-59, in order to determine whether this loop region is involved in the recognition of AOH, the bases in the dotted circle were cut off to obtain AOH 3. The base sequence (5'-3') of AOH 3 is GGCACTCCACGCATAGCTTAACTAGTGTTCAAGCTGTGCGTGGATGTCC; ③, ④ As the stem of AOH-59 is relatively long, in order to determine whether the stem is the binding site of AOH, the bases below the arrows were cut off to obtain AOH 4 and AOH 5, respectively. The base sequences (5'-3') of AOH 4 and AOH 5 are TAGGCATACTTAACTAGTGTTCAAGTTATCCTG and CGCATAGGCATACTTAACTAGTGTTCAAGTTATCCTGTGCG, respectively; ⑤ Through experiments, it was found that the affinity of AOH 3 with the macrocyclic ring removed and AOH 4 with the base below arrow ③ removed to AOH was comparable to that of AOH-59, so the macrocyclic ring and the base below ③ were removed at the same time to obtain AOH 6C; ⑥AOH 6C has an unpaired C base. In order to explore whether it is the key site for binding with AOH, the C base was removed to obtain AOH 7. The base sequence (5'-3') of AOH 7 is TAGCTTAACTAGTGTTAAGCTG; ⑦, ⑧, and ⑨ To determine whether there is an AOH binding site in the stem, AOH 6C was cut from the positions of arrows ⑦, ⑧, and ⑨, respectively, and the bases below the arrows were removed to obtain AOH 10, AOH 9, and AOH 8, respectively. The base sequences (5'-3') of AOH 10, AOH 9, and AOH 8 were CTTAACTAGTGTTCAAG, GCTTAACTAGTGTTCAAGC, and AGCTTAACTAGTGTTCAAGCT, respectively; ⑩ In order to verify whether AOH 6C can be designed as a split nucleic acid aptamer, AOH 6C was split into two short chains AOH 11 and AOH 12 at the position indicated by the arrow. The base sequences (5'-3') of AOH 11 and AOH 12 are TAGCTTAACTA and GTGTTCAAGCTG, respectively.

4. A series of nucleic acid aptamers of crosslinked spore phenol obtained according to the method of claim 1, It is characterized in that The nucleic acid aptamer AOH 6C has only 23 bases of AOH, and the base sequence (5'-3') of the nucleic acid aptamer AOH 6C is TAGCTTAACTAGTGTTCAAGCTG; the nucleic acid aptamer AOH 6C-5-7-L has only 15 bases of AOH, and the base sequence (5'-3') of the nucleic acid aptamer AOH 6C-5-7-L is TAGCTGCTAGCACTA; the bivalent nucleic acid aptamer (AOH 6C-D-1), the base sequence (5'-3') of AOH 6C-D-1 is TAGCTATATAACTAGTGTTCATATCAGCTG; and / or a trivalent nucleic acid aptamer (AOH 6C-H-1) with a length of only 39 bases, the base sequence (5'-3') of AOH 6C-H-1 is TAGCTATATATATAACTAGTGTTCATATCATATCAGCTG.

5. A sensor using the series of nucleic acid aptamers of crosslinked spore phenol according to claim 4, It is characterized in that The invention has an optical fiber, on the surface of which nucleic acid aptamer AOH 6C, nucleic acid aptamer AOH 6C-5-7-L or a bivalent nucleic acid aptamer (AOH 6C-D-1) and a trivalent nucleic acid aptamer (AOH6C-H-1) with lengths of only 30 bases and 39 bases respectively are coupled or fixed.

Images