Application of a central small molecule protein ILF3 in the preparation of antihypertensive drugs

By studying the function of ILF3 in RVLM, it was found that ILF3 reduces NO production by regulating the PI3K/Akt pathway and participates in the central regulation of hypertension, solving the problems of poor compliance and high cost of existing hypertension treatment methods, and providing a method to target the central nervous system for the treatment of hypertension.

CN114984186BActive Publication Date: 2025-06-17CHINESE PEOPLES LIBERATION ARMY NAVAL SPECIALTY MEDICAL CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210691055.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-18
Publication Date
2025-06-17
Estimated Expiration
2042-06-18

AI Technical Summary

Technical Problem

The existing treatment methods for hypertension have poor compliance and expensive treatment costs, and in-depth study of the pathogenesis of hypertension is still of great significance.

Method used

By studying the expression and function of the central small molecule protein ILF3 in the ventral and lateral medulla (RVLM), it was found that ILF3 reduces the production of NO in RVLM by regulating the PI3K/Akt pathway, thus participating in the central regulation of cardiovascular activity in patients with hypertension.

Benefits of technology

Overexpression of ILF3 increased blood pressure and heart rate in WKY rats, but decreased NO production and nNOS expression in RVLM. Downregulation of ILF3 significantly reduced blood pressure and plasma norepinephrine concentration in SHR rats, but increased NO production and nNOS expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114984186B_ABST
    Figure CN114984186B_ABST
Patent Text Reader

Abstract

Application of a central small molecule protein ILF3 in the preparation of antihypertensive drugs. Essential hypertension is characterized by overactive sympathetic nerves and is closely related to the abnormal excitation of presympathetic neurons in the rostral ventrolateral medulla. Interleukin enhancer-binding factor 3 (ILF3) has multiple biological functions, such as promoting RNA synthesis, transfer, and stability. Moreover, ILF3 is expressed in blood vessels, the heart, and the central nervous system and plays an important role in maintaining normal cardiovascular function. In addition, the phosphatidylinositol 3-kinase / protein kinase B signaling pathway is involved in the regulation of the activities of various tissue cells. Therefore, by studying the role of ILF3 in the regulation of carbon monoxide production in hypertension in the RVLM, the present invention provides a feasible theoretical basis and method for treating hypertension by targeting the central small molecule protein ILF3, aiming to solve the problems of poor compliance of long-term drug treatment for the existing prevention and treatment of hypertension and high drug treatment costs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to the use of a central small molecule protein ILF3 in the preparation of antihypertensive drugs. Background Art

[0002] Essential hypertension is a common chronic disease, accounting for more than 95% of all hypertensive patients. There is literature indicating that a variety of antihypertensive drugs have been widely used in clinical practice and achieved good antihypertensive effects. However, the incidence of serious complications of hypertension such as stroke, heart failure, and chronic kidney disease is still relatively high. Therefore, in-depth study of the pathogenesis of hypertension still has important significance. Excessive sympathetic activity is the main feature and pathological basis of hypertension. The rostral ventrolateral medulla (RVLM) of the brainstem is a key area for regulating blood pressure and sympathetic nerve activity, and its dysfunction is the main cause of excessive sympathetic activity and hypertension. Therefore, understanding the role and mechanism of RVLM in enhancing sympathetic excitability under hypertensive conditions has important practical significance for the prevention and treatment of hypertension and can also provide new insights into the treatment of hypertension.

[0003] Interleukin enhancer-binding factor 3 (ILF3) is encoded by the ILF3 gene located on human chromosome 19 and is a member of the double-stranded RNA-binding protein family. It has been demonstrated that ILF3 has a variety of biological functions, such as promoting RNA synthesis, transfer, and stability. Studies have shown that ILF3 is expressed in blood vessels, the heart, and the central nervous system. Under the stimulation of angiogenic factors, the mRNA and protein expression levels of ILF3 in endothelial cells increase, which plays an important stabilizing role in cytokine-induced angiogenesis. Previous studies of the present invention have also reported a significant decrease in the expression of ILF3 in a rat model of myocardial hypertrophy. These results indicate that ILF3 plays an important role in maintaining normal cardiovascular function. However, it is currently unclear whether ILF3 plays other roles in the central nervous system, such as participating in the neural regulation of blood pressure.

[0004] Nitric oxide (NO) is an endogenous signaling molecule with multiple biological activities, which plays a regulatory role in many physiological functions of mammals and participates in regulating neuronal activities as a neuromodulator. It has been reported that microinjection of the NO precursor L-arginine into the rostral ventrolateral medulla (RVLM) of spontaneously hypertensive rats (SHR) can reduce blood pressure. In addition, overexpression of neuronal nitric oxide synthase (nNOS) in the RVLM improves the baroreflex function in rats with chronic heart failure. These results suggest that nNOS-derived NO, as an important neuromodulator in the cardiovascular center, has a protective effect on the function of presympathetic neurons, thus maintaining basal cardiovascular function. Interestingly, previous studies before the present invention have confirmed that ILF3 inhibits the development of myocardial hypertrophy by regulating the production of NO in cardiomyocytes. In addition, the phosphatidylinositol 3-kinase (PI3K) / protein kinase B (Akt) signaling pathway is involved in the regulation of the activities of various tissue cells. Previous studies have confirmed that the PI3K / Akt pathway is activated in the RVLM of hypertensive rats. In addition, numerous studies have shown that the PI3K / Akt pathway increases the expression and phosphorylation of nNOS, but whether ILF3 regulates the production of NO mediated by the PI3K / Akt pathway remains unclear. Summary of the Invention

[0005] The first object of the present invention is to provide an application of a central small molecule protein ILF3 in the preparation of antihypertensive drugs.

[0006] Essential hypertension is characterized by excessive sympathetic nerve activity and is closely related to the abnormal excitation of presympathetic neurons in the rostral ventrolateral medulla (RVLM). Nitric oxide (NO) has been reported to be an important neuromodulator involved in the central cardiovascular regulation of the RVLM. Interleukin enhancer-binding factor 3 (ILF3) is one of the double-stranded RNA-binding proteins, and the mechanism by which it directly participates in the central regulation of blood pressure is still unclear. Therefore, the present invention aims to study the role of ILF3 in the RVLM in regulating NO production in hypertension. The study shows that the expression level of ILF3 in the RVLM of spontaneously hypertensive rats (SHRs) is up-regulated. Overexpression of ILF3 in the RVLM increased blood pressure and heart rate in awake and anesthetized WKY rats, while significantly reducing NO production and nNOS expression in the RVLM. Down-regulating ILF3 in the RVLM of SHR patients significantly reduced blood pressure and plasma norepinephrine concentration, but increased NO production and nNOS expression. The present invention also found that after overexpressing ILF3, the PI3K / Akt pathway in the RVLM was activated, while in SHRs, the PI3K / Akt pathway was weakened. In addition, inhibiting PI3K attenuated the increase in Akt protein phosphorylation, the decrease in nNOS expression and NO production in the RVLM caused by overexpressing ILF3, and ultimately attenuated the high BP induced by overexpressing ILF3. In summary, the present invention shows that ILF3 reduces NO production in the RVLM through the PI3K / Akt pathway, which is involved in the central regulation of cardiovascular activities in hypertensive patients.

[0007] The present invention mainly solves the problems of poor patient compliance and high drug treatment costs in the existing long-term drug treatment for preventing and treating hypertension, and provides a method for treating hypertension by targeting interleukin enhancer-binding factor 3 (ILF3) in the central nervous system.

[0008] To solve the above problems, the technical solution adopted by the present invention is as follows.

[0009] (1) Animal selection.

[0010] Sixteen-week-old male Wistar-kyoko (WKY) rats and spontaneously hypertensive rats (SHRs) used in this study were purchased from Life River Laboratory Animal Technology Co., Ltd. (Beijing, China). Their body weights were between 250-350 grams, and they were raised in a 12-hour light room and a 12-hour dark animal room respectively. The experimental rats were allowed free access to food and water.

[0011] (2) Gene chip gene expression analysis.

[0012] First, gene chips (Affymetrix Rat230 2.0 array) were used to screen for differential genes in the RVLM between WKY rats and SHRs. According to the manufacturer's instructions, the RNeasy Mini Kit (Cat#74106, QIAGEN, GmbH, Germany) was used to extract and purify the total RNA of the RVLM in WKY rats and SHRs. The Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA) was used to check the RNA integrity number (RIN) number and examine RNA integrity. To obtain biotin-labeled cRNA, the GeneChip 3' IVT PLUS Reagent Kit (Cat#902416, Affymetrix, Santa Clara, USA) was used to amplify and purify 6 qualified total RNA samples according to the manufacturer's instructions. Array hybridization and washing were performed using the GeneChip® Hybridization, Wash, and Stain Kit (Cat#900720, Santa Clara, USA), the Hybridization Oven 645 (Cat#00-0331-220V, Santa Clara, CA, USA), and the Fluidics Station 450 (Cat#00-0079, Santa Clara, USA) following the manufacturer's instructions. The GeneChip® Scanner 3000 (Cat#00-00212, Santa Clara, CA, USA) and the Command Console Software 4.0 (Santa Clara, CA, USA) were used for scanning. The raw data was normalized using the MAS5.0 algorithm and GeneSpring Software 12.6.1 (Agilent Technologies, Santa Clara, CA, USA). The original microarray data was submitted to the Gene Expression Omnibus in NCBI (brainstem: GSE194325).

[0013] (3)Construction of ILF3 overexpressing adenovirus and ILF3 knockout adeno-associated virus (AAV).

[0014] Based on the advantages of the complete adenovirus genome information and the method of inserting large fragments of foreign genes into the adenovirus genome. Considering the large size of the ILF3 gene fragment, the present invention selects adenovirus as a vector to overexpress ILF3 and adeno-associated virus (AAV) as a vector to interfere with ILF3. The overexpressing adenovirus and the AAV specifically knocking out ILF3 were constructed by Shanghai Genechem Co., Ltd. (Shanghai, China). The adenovirus overexpressing ILF3 in rats carried the cDNA of ILF3 (GenBank ID: NM_053412) (AdILF3). The control adenovirus contained all sequences except the ILF3 gene and was labeled with green fluorescent protein (AdGFP). Due to the large size of the ILF3 gene fragment, to ensure the successful construction of the specific interfering ILF3-AAV, the present invention constructed a total of 3 short hairpin RNA (shRNA) sequences targeting ILF3 mRNA, including AAV-shILF3-1, AAV-shILF3-2, and AAV-shILF3-3. The AAV carrying green fluorescent protein inserted a scrambled sequence as a control.

[0015] AAV-ILF3-1:

[0016] Forward primer sequence: gatccccgcaaagcattcttcagtatttcaagagaatactgaagaatgctttgcttttt;

[0017] Reverse primer sequence: tcgaaaaaagcaaagcattcttcagtattctcttgaaatactgaagaatgctttgcggg.

[0018] AAV-ILF3-2:

[0019] Forward primer sequence: gatccccgcatctagacagacagcaattcaagagattgctgtctgtctagatgcttttt;

[0020] Reverse primer sequence: tcgaaaaaagcatctagacagacagcaatctcttgaattgctgtctgtctagatgcggg.

[0021] AAV-ILF3-3:

[0022] Forward primer sequence: gatccccgcgctggatatggaagctattcaagagatagcttccatatccagcgcttttt;

[0023] Reverse primer sequence: tcgaaaaaagcgctggatatggaagctatctcttgaatagcttccatatccagcgcggg。

[0024] (4)Inject adenovirus and adeno-associated virus into the RVLM.

[0025] WKY rats and SHRs were anesthetized by inhaling a 3% isoflurane mixture gas and fixed on a stereotaxic frame. First, after exposing the skull surface of the anesthetized rats, two holes were symmetrically drilled on the dorsal surface of the skull. Then, according to the standard brain atlas of rats, the coordinates of the RVLM microinjection site were: 2.0 mm lateral to the midline, 3.0 - 4.0 mm caudal to Lamda, and 9.5 - 10 mm deep from the skull surface. Adenovirus and adeno-associated virus were slowly injected into the RVLM using a Hamilton syringe. Four injection sites (250 nl) were performed on each side. After the microinjection of virus particles was completed, the incision was sutured. To prevent infection, 1000 units of penicillin were injected into the quadriceps femoris of the rats. The rats injected with AAV were divided into 4 groups: WKY+AAV-GFP, WKY+AAV-shILF3, SHR+AAV-GFP, and SHR+AAV-shILF3, and the effect of ILF3 knockdown was observed.

[0026] (5)Intrathoracic infusion of PI3K inhibitor.

[0027] Rats were anesthetized by inhaling a 3% isoflurane mixture gas and fixed on a stereotaxic apparatus. After incising and exposing the occipital membrane of the rats, the dura mater was punctured with a sterile syringe needle. If cerebrospinal fluid was observed flowing out of the meningeal hole, it indicated that the needle had entered the cisterna magna (fourth ventricle). Then, a PE-10 catheter (model 1007D, Alzet, USA) of a micro-osmotic pump containing the PI3K inhibitor PI-103 (S1038, Selleck) was inserted into the fourth ventricle, and PI-103 was continuously pumped into the ventricle. The dose of PI-103 was 5 mg / kg / day for 7 consecutive days, and at the same time, the dura mater was sealed with tissue glue. A 5%DMSO, 40%PEG300, 5%Tween80, and 50% aqueous solution was used as a control agent and was used to dissolve PI-103. After overexpressing ILF3 adenovirus was injected into the RVLM of WKY rats, PI-103 or the control agent was simultaneously injected into the sternum. According to different treatment methods, they were divided into the following four groups: AdGFP+Veh, AdGFP+PI-103, AdILF3+Veh, AdILF3+PI-103.

[0028] (6)Measure blood pressure and heart rate.

[0029] The systolic blood pressure and heart rate of conscious rats were continuously monitored before and after injecting adenovirus and AAV into the RVLM using a non-invasive tail cuff system (ALC-NIBP, Shanghai, Alcott Biotech). Before sacrificing the rats, the mean arterial pressure and heart rate of anesthetized rats (urethane 800 mg / kg and α-chloralose 40 mg / kg, ip) were recorded by femoral artery cannulation with a Powerlab system.

[0030] (7) Immunofluorescence.

[0031] The research protocol for immunofluorescence detection was based on previous studies of the present invention. First, anesthetized rats were perfused with 0.9% normal saline. After the circulating blood of the rats was completely drained, they were perfused with 4% paraformaldehyde in PBS until the rat tissues were fixed. Then, the brain tissues were collected and stored in a 4% paraformaldehyde solution. After the fixed brain tissues were dehydrated with 20% sucrose solution for 12 hours, they were quickly frozen at -20°C and then sectioned on a cryostat. The brains were cut into 10-μm-thick slices. To observe the expression of GFP in rat brain sections, they were directly adsorbed on glass slides, and a fluorescent anti-fading reagent was dropped, and then covered with a coverslip for sealing. To observe the expression and distribution of ILF3, they were first permeabilized with 0.1% Triton X-100, and then incubated with the primary antibody against ILF3 (NO. ab232546, abcam) (1:200) overnight at 4°C, washed three times, and then incubated with the primary antibody against NeuN (NO. ab104224, abcam) (1:200) overnight at 4°C and washed three times. After the above steps were completed, the sections incubated with the two primary antibodies were incubated with species-specific secondary antibodies with green and red fluorescence for 2 hours at room temperature for separate labeling. After washing three times, the treated sections were directly flattened on glass slides, and a fluorescent anti-fading reagent containing DAPI dye was dropped, and then covered with a coverslip for sealing. The fluorescence of GFP, ILF3, NeuN, and DAPI was detected using a fluorescence microscope (Leica, Germany).

[0032] (8) Western blot.

[0033] After completing the recording of cardiovascular parameters, the rats were euthanized with an overdose of anesthetic solution (α-chloralose 120 mg / kg and urethane 2.4 g / kg, intraperitoneal injection). The brain tissues were rapidly collected, frozen in liquid nitrogen, and stored at -80 °C. After collecting the RVLM tissues by puncturing with a needle with an inner diameter of 1.5 mm, cell lysate was added and lysed on ice for 10 minutes. The RVLM samples added with cell lysate were sonicated and centrifuged. The protein concentration in the supernatant of the RVLM samples was measured using a BCA kit. Most of the remaining supernatant was used for protein denaturation, buffer was added, and heated to 100 °C for 10 min for denaturation. After the samples were denatured, 30 μg of protein was added to each sample well for 10% SDS-PAGE gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane. After blocking the PVDF membrane with 5% milk (TBST) dissolved in tris buffer, the membrane was reacted with primary antibodies [anti-ILF3 (NO. ab50832, abcam); anti-nNOS (NO. ab76067, abcam); anti-eNOS (NO. ab252439, abcam); anti-iNOS (NO. ab49999, abcam); anti-PI3K (p110δ, NO. 3295-1, Epitomics); anti-p-Akt (Ser473, NO. 4060, CST); anti-Akt (NO. 9272, CST); and anti-GAPDH (NO. sc-32233, Santa Cruz)] overnight at 4 °C. The PVDF membrane was reacted with a horseradish peroxidase-conjugated secondary antibody at room temperature for 2 hours. The PVDF membrane was photographed with a chemiluminescent agent, and the density of each sample band was analyzed using GeneTools software (Gene Company). Using GAPDH as an internal reference, the ratio of the target protein to GAPDH reflected the expression level of the target band.

[0034] (9)Elisa analysis.

[0035] Before euthanizing the rats, 2 ml of whole blood was collected, anticoagulated with heparin, centrifuged at 3000 rpm for 20 min, the supernatant was taken, and the concentration of norepinephrine (NE) in the plasma was measured using an Elisa kit (Shanghai, Xitang Biotechnology Co., Ltd.) according to the manufacturer's instructions. First, an NE standard solution was prepared. Then, different concentrations of NE standard solutions and samples were added to the reaction wells of the enzyme-labeled plate to be tested, and then an enzyme-labeled antibody solution and a reaction termination solution were added. The absorbance values of each well at a wavelength of 450 nm were detected with an enzyme-labeled instrument. The NE content of the samples was calculated according to the standard curve.

[0036] (10)Total NO content detection.

[0037] The steps for extracting the supernatant of the RVLM tissue were the same as those for Western blot. The protein concentration of each sample was measured using a BCA kit. The concentrations of nitrate and nitrite, the metabolites of NO in the RVLM tissue supernatant, were measured using a Total Nitric Oxide Assay Kit (Beyotime Biotechnology Co., Ltd., No. S0023). The absorbance value (OD) of each sample at a wavelength of 540 nm was automatically measured by an enzyme-linked immunosorbent assay reader. The contents of nitrate and nitrite were calculated according to the standard curve.

[0038] (11)Data analysis.

[0039] All values were expressed as mean ± standard error, and statistical analysis was performed using Graphpad Prism 6.0 version (GraphPad Software, San Diego, CA, USA). Repeated measures analysis of variance was used to analyze the systolic blood pressure and heart rate of conscious rats. When the data were only compared between SHR and WKY rats or AdGFP and AdILF3 groups, an unpaired t-test was used. In the experiment for testing the ILF3 knockout efficiency, one-way analysis of variance and Bonferroni post hoc test were used for the expression differences of ILF3. All other data were analyzed using two-way analysis of variance and Turkey's post hoc test. When the P < value was 0.05, the present invention considered the difference to be statistically significant. Description of the Drawings

[0040] Figure 1 : Expression and distribution of ILF3 in the RVLM. A: Heat map of the RVLM gene chip detection results of SHR and WKY rats. B: Original image and statistical chart of Western blot showing the expression of ILF3 protein in the RVLM of SHR and WKY rats, *P < 0.05 vs WKY group; n = 5 groups. C: Distribution of ILF3 in the RVLM of WKY rats. The expression of ILF3 was observed in the RVLM, showing red fluorescence. Neurons specifically labeled with NeuN showed green fluorescence, and DAPI labeled the cell nucleus showing blue fluorescence. Cells expressing NeuN and ILF3 showed yellow fluorescence in the merged picture, and white arrows pointed to double-labeled neurons with red and green fluorescence. The upper row of fluorescence pictures was at low magnification (5×), the scale bar was 500 μm, the yellow box represented the RVLM, and the lower row of pictures was the magnified view (20×) corresponding to the yellow box, with the scale bar being 100 μm. (ILF3: Interleukin enhancer-binding factor; NeuN: Neuronal nuclei antigen; DAPI: Nuclear fluorescent dye; Merge: Composite picture).

[0041] Figure 2: To verify the location and efficiency of overexpression of ILF3 in the RVLM of WKY rats by adenovirus transfection. A: The left side is a schematic diagram of a standard atlas containing the RVLM. The fluorescence images on the right show local GFP in the RVLM 7 days after transfection with AdGFP in WKY rats (middle: 5×, scale bar = 500 μm; right: 20×, scale bar = 100 μm). B: Western blot was used to detect the expression level of ILF3 protein in the RVLM, *P<0.05 vs AdGFP group, n = 4 groups.

[0042] Figure 3 : Effects of ILF3 overexpression on cardiovascular function in WKY rats. A: Changes in SBP (left) and HR (right) of WKY rats were monitored via the tail artery in the awake state before and after adenovirus transfection of the RVLM. The red arrow indicates the injection of adenovirus into the RVLM, *P<0.05 vs AdGFP group; #P<0.05 vs the BP level before transfection (day 0); n = 4 groups. B: Original recording charts of BP and HR measured under anesthesia in WKY rats after overexpression of ILF3 in the RVLM. C-D: Statistical charts of MAP and HR under anesthesia in WKY rats after overexpression of ILF3 in the RVLM. E: Plasma NE level in WKY rats after overexpression of ILF3 in the RVLM. *P<0.05 vs AdGFP group; n = 5 groups. (SBP: systolic blood pressure; HR: heart rate; ABP: pulse pressure; MAP: mean arterial pressure; NE: norepinephrine).

[0043] Figure 4 : Effects of ILF3 knockdown on cardiovascular function. A: To verify the efficiency of ILF3 knockdown after transfection of ILF3 AAV into the RVLM of WKY rats. Western blot was used to detect the expression level of ILF3 protein in the RVLM, *P<0.05 vs AAV-GFP group, n = 4 groups. B: Knockdown of ILF3 expression in the RVLM decreased the SBP of SHR. Changes in SBP (left) and HR (right) of SHR and WKY rats were monitored via the tail artery cuff in the awake state before and after ILF3 knockout. The red arrow represents the injection of AAV-ILF3 into the RVLM, *P<0.05 vs AAV-GFP group; #P<0.05 compared with before transfection (0W); n = 5 groups. C-D: Statistical charts of the recorded MAP (left) and HR (middle) of anesthetized SHR and WKY rats after ILF3 knockdown in the RVLM. E: Plasma NE level in SHR and WKY rats after ILF3 knockdown in the RVLM. *P<0.05 vs WKY rats; #P<0.05 compared with the AAV-GFP group; n = 5 groups. (SBP: systolic blood pressure; HR: heart rate; MAP: mean arterial pressure; NE: norepinephrine).

[0044] Figure 5: Effects of ILF3 overexpression on NOS and NO production in WKY rats. A: NO production in the RVLM of WKY rats after ILF3 overexpression did not occur, *P < 0.05 vs AdGFP; n = 5 groups. B - D: Expression levels of nNOS, eNOS, and iNOS in the RVLM of WKY rats after overexpression of ILF3, *P < 0.05 vs AdGFP; n = 5 groups. (nNOS: neuronal nitric oxide synthase; eNOS: endothelial nitric oxide synthase; iNOS: inducible nitric oxide synthase).

[0045] Figure 6 : Effects of ILF3 knockdown on NOS and NO production in WKY rats. A: NO production levels in the RVLM of SHR and WKY rats after ILF3 knockdown, *P < 0.05 vs WKY rats; #P < 0.05 compared with the AAV - GFP group; n = 5 groups. B - D: Expression levels of nNOS, eNOS, and iNOS in the RVLM of SHR and WKY rats after ILF3 knockdown, *P < 0.05 compared with WKY rats; #P < 0.05 compared with the AAV - GFP group; n = 4 groups. (nNOS: neuronal nitric oxide synthase; eNOS: endothelial nitric oxide synthase; iNOS: inducible nitric oxide synthase).

[0046] Figure 7 : Expression levels of PI3K and phosphorylated Akt in the RVLM of SHR with ILF3 knockdown and WKY rats with ILF3 overexpression. A: Changes in the expression levels of PI3K and phosphorylated Akt in the RVLM of WKY rats after ILF3 overexpression, *P < 0.05 vs AdGFP; n = 5 groups. B: Changes in the expression of PI3K and the level of phosphorylated Akt in the RVLM of SHR and WKY rats after ILF3 knockdown in the RVLM, *P < 0.05 compared with WKY rats; #P < 0.05 compared with the AAV - GFP group; n = 4 groups. (PI3K: phosphatidylinositol trihydroxy kinase; p - Akt: phosphorylated protein kinase; t - Akt: total protein kinase).

[0047] Figure 8: Inhibiting the effect of PI3K on the changes after overexpression of ILF3 in the RVLM. A: Phosphorylation level of Akt in the RVLM after inhibiting PI3K and overexpressing ILF3. B-D: Expression levels of nNOS, eNOS, and iNOS in the RVLM after inhibiting PI3K and overexpressing ILF3. E: Production level of NO in the RVLM after inhibiting PI3K and overexpressing ILF3. F: Statistical chart of MAP of WKY rats under anesthesia after inhibiting PI3K and overexpressing ILF3 in the RVLM. *P < 0.05 compared with AdGFP; #P < 0.05 vs Veh; n = 5 groups. (PI3K: Phosphatidylinositol trihydroxy kinase; p-Akt: Phosphorylated protein kinase; t-Akt: Total protein kinase; nNOS: Neuronal nitric oxide synthase; eNOS: Endothelial nitric oxide synthase; iNOS: Inducible nitric oxide synthase; MAP: Mean arterial pressure; NO: Nitric oxide).

[0048] Figure 9 : The mechanism by which ILF3 regulates NO production through the PI3K / Akt pathway and participates in the excessive sympathetic excitation in hypertension. (Blood pressure, Sympathetic outflow, L-arginine, L-citrulline, NO, Nitric oxide, nNOS, Neuronal nitric oxide synthase, PI3K, Phosphoinositide-3-kinase, AKT, Protein kinase B, ILF3, Interleukin enhancer-binding factor 3). Detailed implementation mode

[0049] The present invention will be further described by the following examples in conjunction with the accompanying drawings.

[0050] 1. Effect of ILF3 in the RVLM on BP regulation.

[0051] 1.1 Expression and difference of ILF3 gene in the RVLM of WKY rats and SHRs.

[0052] Six RVLM tissue samples from 3 WKY rats and 3 SHRs were detected using a gene chip (Affymetrix Rat 230 2.0 Array). As Figure 1 shown, the present invention found that 128 genes changed significantly in the RVLM of WKY rats and SHRs. Compared with WKY rats, 80 genes were significantly upregulated and 48 genes were significantly downregulated in the RVLM of SHRs ( Figure 1A). Among them, the expression level of ILF3 in the RVLM of SHR mice was up-regulated by 4.24 times compared with that of WKY rats. The results of immunoblotting were also consistent with those of gene chips, showing that the expression of ILF3 protein in the RVLM of SHR was significantly increased by 2.41 times compared with that of WKY rats ( Figure 1 B). Immunofluorescence detection further confirmed the expression of ILF3 in RVLM neurons.

[0053] 1.2 Overexpression of ILF3 in RVLM increases blood pressure in WKY rats.

[0054] To ensure the successful overexpression of ILF3 in RVLM, the present invention detected the expression of GFP in RVLM on the 7th day after injecting adenovirus carrying the GFP gene. As Figure 2 shown in A, GFP was locally expressed in RVLM. Western blot was further used to detect the expression of ILF3 in RVLM. The results showed that the expression of ILF3 in RVLM of the AdILF3 group was significantly increased compared with that of the AdGFP group. Before and after injecting AdILF3 into the RVLM of WKY rats, the SBP and HR of conscious rats were monitored by tail artery cuff. It was observed that the SBP level in the AdILF3 group began to gradually increase on the 3rd day after transfection and was significantly different from that of the AdGFP group on the 7th day (164.7 ± 4.4 mmHg vs. 144.0 ± 3.6 mmHg, P < 0.05), while there was no obvious change in HR before and after adenovirus transfection. There were no obvious changes in BP and HR of the AdGFP group before and after adenovirus transfection ( Figure 3 A). Therefore, in subsequent experiments, the present invention chose to observe the cardiovascular function and molecular changes on the 7th day after overexpression of ILF3 in WKY rats. In anesthetized WKY rats, the blood pressure (117.7 ± 3.9 mmHg vs. 154.8 ± 5.0 mmHg, P < 0.05) and plasma NE level (132.9 ± 9.1 ng / ml vs. 331.5 ± 20.4 ng / ml, P < 0.0001) of the AdILF3 group were significantly increased on the 7th day after adenovirus injection compared with those of the AdGFP group. However, there was no significant difference in HR between the two groups of rats ( Figure 3 B-D).

[0055] 1.3 Down-regulation of ILF3 in RVLM reduces BP in SHR.

[0056] To observe the effect of ILF3 in the RVLM on the blood pressure of SHRs, the present invention first detected the interference effect of the constructed AAV on the expression of ILF3 protein. The present invention designed three AAVs carrying shRNA sequences targeting the mRNA of ILF3. It was found that, compared with AAV-GFP, four weeks after injection of AAV-shILF3, the expression level of ILF3 protein in the RVLM of SHRs was significantly decreased by AAV-shILF3. Since the interference effect of AAV-shILF3-1 was more obvious ( Figure 4 A), therefore, the present invention selected AAV-shILF3-1 to interfere with the expression of ILF3 protein in subsequent experiments. Blood pressure monitoring data in the awake state showed that, in the first week after injection of AAV-shILF3 into the RVLM of SHRs, the SBP began to decrease until the fourth week (187.2 ± 2.7 mmHg vs. 171.3 ± 5.0 mmHg, P < 0.05). This blood pressure-lowering effect could be maintained until the fifth week. There was no obvious change in HR before and after injection of AAV-shILF3. In addition, compared with the SHR-AAV-GFP group, the SBP of the SHR-AAV-shILF3 group was also significantly decreased at the fourth week (195.9 ± 1.4 mmHg vs. 171.3 ± 5.0 mmHg, P < 0.05). However, there were no obvious changes in SBP and HR of WKY rats before and after transfection with AAV-shILF3 ( Figure 4 B). Therefore, in subsequent experiments, the effect of interfering with the expression of ILF3 protein was observed at the fourth week after injection of AAV-shILF3 into the RVLM of SHRs. At the fourth week after injection of AAV-shILF3, in anesthetized WKY rats and SHRs, after interfering with the expression of ILF3 in the RVLM of SHRs, compared with SHR-AAV-GFP, the BP (186.4 ± 2.7 mmHg vs. 154.8 ± 5.0 mmHg, P < 0.05) and the level of plasma (436.8 ± 37.5 ng / ml vs. 253.1 ± 35.4 ng / ml, P < 0.05) were significantly decreased. However, there was no significant difference in HR between SHRs and WKY rats treated with AAV-shILF3 and AAV-GFP ( Figure 4 C).

[0057] 2. Effect of ILF3 on NO production in the RVLM.

[0058] 2.1 Overexpression of ILF3 in the RVLM decreased the expression of nNOS and the production of NO in WKY rats.

[0059] As Figure 5As shown, compared with the AdGFP group, the production level of NO in the RVLM of the AdILF3 group (2.7 ± 0.1 0.1 nmol / mg vs. 0.2 ± 0.1 nmol / mg, P<0.0001) and the expression level of nNOS were significantly reduced ( Figure 5 A). However, after overexpressing ILF3 in the RVLM, the protein expression levels of eNOS and iNOS did not change significantly ( Figure 5 B-D).

[0060] 2.2 Downregulating ILF3 increased the expression of nNOS and the production of NO in the RVLM of SHRs.

[0061] As Figure 6 shown, compared with SHR-AAV-GFP, after interfering with the RVLM, the production in the RVLM increased (2.7 ± 0.1 nmol / mg vs. 0.2 ± 0.1 nmol / mg, P<0.0001) ( Figure 6 A). SHR and WKY rats were injected with AAV-GFP RVLM. In the present invention, it was observed that the expression level of nNOS in the RVLM of SHRs was significantly lower than that in WKY rats, while the expression level of nNOS increased significantly after ILF3 knockout ( Figure 6 b). Similar to the overexpression of ILF3 in WKY rats, after downregulating ILF3 in SHR and WKY rats, the expression levels of eNOS and iNOS did not change significantly ( Figure 6 C and 6D).

[0062] 3. Effects of ILF3 on the PI3K / Akt pathway in the RVLM.

[0063] As Figure 7 shown, compared with injecting AdGFP into the RVLM of WKY rats, after overexpressing ILF3, the expression levels of the P110δ subunit of PI3K protein and the phosphorylation of Akt protein in the RVLM of WKY rats increased significantly, suggesting that overexpressing ILF3 can activate the PI3K / Akt pathway in the RVLM. On the other hand, in the present invention, after injecting AAV-GFP into the RVLM, compared with WKY rats, the expression level of the P110δ subunit of PI3K protein and the phosphorylation of Akt protein in SHRs increased significantly, while the contents of the above two proteins decreased significantly after ILF3 knockout ( Figure 7 b). However, in the RVLM of WKY rats, after knocking down the ILF3 gene, the PI3K / Akt pathway was not significantly activated.

[0064] 4. Effects of PI3K blockade on the changes in blood pressure and NO production induced by ILF3 overexpression in the RVLM.

[0065] As Figure 8As shown, the phosphorylation level of Akt increased after overexpressing ILF3, while the PI3K inhibitor PI-103 inhibited the increase in the phosphorylation level of Akt protein caused by ILF3. Overexpressing ILF3 downregulated the expression of nNOS in the RVLM and reduced the production of NO in WKY rats, while inhibiting PI3K increased the expression level of nNOS protein and the production of NO in the RVLM, ultimately reducing the blood pressure of WKY rats overexpressing ILF3( Figure 8 F).

[0066] As Figure 9 shown, the above experimental results indicate that ILF3 in the RVLM downregulates nNOS / NO mediated by the PI3K / Akt pathway, thereby leading to excessive sympathetic nerve excitation and increased blood pressure ( Figure 9 ).

[0067] Although the preferred embodiments of the present invention are disclosed for illustration, those of ordinary skill in the art understand that various improvements, additions, and substitutions are possible without departing from the scope and spirit defined by the appended claims of the present invention, and all are within the protection scope of the present invention. Sequence Listing <110> Naval Medical Center of Chinese People's Liberation Army <120> Application of a Central Small Molecule Protein ILF3 in the Preparation of Antihypertensive Drugs <160> 6 <170> SIPOSequenceListing 1.0 <210> 2 <211> 59 <212> DNA <213> Artificial Sequence <400> 2 gatccccgca aagcattctt cagtatttca agagaatact gaagaatgct ttgcttttt 59 <210> 2 <211> 59 <212> DNA <213> Artificial Sequence <400> 2 tcgaaaaaag caaagcattc ttcagtattc tcttgaaata ctgaagaatg ctttgcggg 59 <210> 3 <211> 59 <212> DNA <213> Artificial Sequence <400> 3 gatccccgca tctagacaga cagcaattca agagattgct gtctgtctag atgcttttt 59 <210> 4 <211> 59 <212> DNA <213> Artificial Sequence <400> 4 tcgaaaaaag catctagaca gacagcaatc tcttgaattg ctgtctgtct agatgcggg 59 <210> 5 <211> 59 <212> DNA <213> Artificial Sequence <400> 5 gatccccgcg ctggatatgg aagctattca agagatagct tccatatcca gcgcttttt 59 <210> 6 <211> 59 <212> DNA <213> Artificial Sequence <400> 6 tcgaaaaaag cgctggatat ggaagctatc tcttgaatag cttccatatc cagcgcggg 59

Claims

1. Use of an shRNA targeting the mRNA of ILF3 in the preparation of antihypertensive drugs, characterized in that, The shRNA is AAV-shILF3-1, AAV-shILF3-2 or AAV-shILF3-3; The forward primer sequence of AAV-ILF3-1 is: gatccccgcaaagcattcttcagtatttcaagagaatactgaagaatgctttgcttttt, The reverse primer sequence is: tcgaaaaaagcaaagcattcttcagtattctcttgaaatactgaagaatgctttgcggg; The forward primer sequence of AAV-ILF3-2 is: Gatccccgcatctagacagacagcaattcaagagattgctgtctgtctagatgcttttt, The reverse primer sequence is: tcgaaaaaagcatctagacagacagcaatctcttgaattgctgtctgtctagatgcggg; The forward primer sequence of AAV-ILF3-3 is: Gatccccgcgctggatatggaagctattcaagagatagcttccatatccagcgcttttt, The reverse primer sequence is: tcgaaaaaagcgctggatatggaagctatctcttgaatagcttccatatccagcgcggg.