Self-assembly-cladding-based immunosensor with adjustable linear range, signal amplification system, and its high-throughput supporting equipment and applications

By self-assemblying the polystyrene cladding and the CRISPR-Cas12a signal amplification system, the problems of complex operation and insufficient stability of traditional immune sensors are solved, and high-throughput detection with simplified operation, improved sensitivity and stability are achieved.

CN114994022BActive Publication Date: 2025-07-29HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210467475.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-04-29
Publication Date
2025-07-29
Estimated Expiration
2042-04-29

AI Technical Summary

Technical Problem

Traditional immune sensors have complicated operation steps and poor stability. Traditional optical immunoassay methods require complex chemical modification processes and multiple washing steps, which affect detection efficiency and accuracy.

Method used

The self-assembled polystyrene cladding is used to directly adsorb biometric molecules, and the linear range can be adjusted by changing the number of claddings. In combination with the CRISPR-Cas12a signal amplification system, the chemical modification process is simplified, the optical signal loss is reduced, and the detection sensitivity is improved.

Benefits of technology

It has achieved simplified operational processes, improved the stability and sensitivity of detection, reduced detection costs, and is suitable for high-throughput automated detection, reducing human error.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114994022B_ABST
    Figure CN114994022B_ABST
Patent Text Reader

Abstract

The present invention discloses an immunosensor with adjustable linear range based on self-assembled cladding, a signal amplification system, and its high-throughput supporting equipment and applications. A cladding is assembled on an optical fiber, and biorecognition molecules are directly immobilized on the surface of the polystyrene cladding, and then biochemical reactions can be directly carried out on the surface of the cladding. By assembling different numbers of claddings, a detection method with an adjustable linear range is constructed to achieve physical signal amplification. For target substances with lower contents, the CRISPR-Cas12a signal amplification strategy can be used to further achieve precise detection. At the same time, the sensor is equipped with a multifunctional automated high-throughput device, which can assemble different numbers of claddings according to specific detection schemes. The present invention not only simplifies the preparation process of carriers in traditional immunoassays, but also realizes an adjustable linear range while further reducing the detection cost, improving the sensitivity, and meeting the requirements of on-site rapid detection by combining with the supporting automated high-throughput detection equipment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biosensing, and particularly relates to an immunosensor with adjustable linear range based on self-assembled cladding, a signal amplification system, and its high-throughput supporting equipment and applications. Background Art

[0002] With the rapid economic development and the improvement of living standards, people's demand for accurate, sensitive, and rapid detection of harmful factors in in vitro diagnosis, food safety, and environmental monitoring is increasing day by day. Therefore, it is of great practical significance to develop a low-cost, excellent-performance, and easy-to-operate device suitable for on-site rapid detection.

[0003] For the harmful factors in the above fields, the traditional detection methods mainly include instrumental analysis and biosensing analysis. Among them, instrumental analysis has high detection accuracy and good stability, but it usually requires complex sample pretreatment steps, expensive large-scale precision instrument equipment, and professionally trained operators.

[0004] In recent years, the immunosensing method in biosensing has attracted extensive attention in the detection of harmful factors due to its high specificity and rapid detection. The immunosensor combines traditional immunoassay and biosensing technologies, which not only reduces the analysis time but also improves the sensitivity and test accuracy.

[0005] In the immunosensing method, the optical immunosensor has broad application prospects because it can analyze the target highly sensitively. The optical immunosensor refers to realizing the reaction of specific substrates or excitors for complexes such as horseradish peroxidase and fluorescent labels in the immunoreaction products through immunoreaction, generating special optical signals. Finally, the optical signal is used as the signal readout method to achieve the qualitative and quantitative detection of the target to be measured in the immunoreaction. Traditional optical immunoassay methods include enzyme-linked immunosorbent assay, fluorescence immunoassay, and chemiluminescence immunoassay, etc. However, the traditional enzyme-linked immunosorbent assay usually requires multiple washing and plate tapping steps, which are prone to insufficient washing and difficult to automate, thus affecting the detection efficiency. At the same time, in chemiluminescence analysis, physical stripping and chemical corrosion treatment of optical fibers, and then using the method of silicon chemistry to fix biorecognition molecules on the surface of optical fibers through chemical bonds, the process is cumbersome and time-consuming and usually requires the use of organic reagents. Summary of the Invention

[0006] To solve the problems of complex operation steps and poor stability of existing immunosensors, the present invention provides an immunosensor with an adjustable linear range based on a self-assembled cladding, a signal amplification system, and its high-throughput supporting equipment and applications. For the first time, a multifunctional automated immunosensor is proposed, which directly adsorbs biorecognition molecules by using a self-assembled polystyrene cladding. By changing the number of polystyrene claddings, an adjustable linear range is achieved. Based on this sensor, we have constructed a set of high-throughput equipment with excellent performance, low cost, and automation. Moreover, the side of the cladding has a convex mirror structure, which can concentrate the optical signal inside the optical fiber for chemiluminescence and fluorescence analysis to achieve physical signal amplification, and is equipped with a mirror sleeve to reduce the loss of optical signal. This invention eliminates the complex chemical modification pretreatment processes such as antibody conjugation in the use of traditional fiber optic chemiluminescence immunoassay or fluorescence immunoassay, and also avoids the errors caused by multiple pipetting and washing in the enzyme-linked immunosorbent assay, greatly improving the simplicity and stability of the method, and effectively reducing the detection time and reagent consumption at the same time.

[0007] The present invention is based on a self-assembled polystyrene cladding as a solid-phase carrier. Through the action of hydrophobic bonds and ionic bonds of polystyrene, biorecognition molecules (antibodies or complete antigens) are directly modified on the surface of the cladding to carry out immune reactions. According to the detection requirements of the target, the number of self-assembled polystyrene claddings can be changed (the assembly numbers can be 2, 4, 6, 8, installed in the diagonal direction). When the target concentration is 1 μg / mL - 1 mg / mL, the number of assembled claddings is 2; when the target concentration is 1 ng / mL - 1 μg / mL, the number of claddings is 4; when the target concentration is 100 pg / mL - 10 ng / mL, the number of claddings is 6; when the target concentration is 1 pg / mL - 100 pg / mL, the number of claddings is 8. In this way, the linear range can be adjusted. In addition, the side of the self-assembled cladding has a convex lens structure. For chemiluminescence and fluorescence analysis, the light signal emitted from the side of the optical fiber can be refracted and concentrated inside the optical fiber, avoiding light signal loss while enhancing the light signal, and achieving a signal amplification effect and a multiple increase in the assembly number. At the same time, for targets with higher sensitivity requirements, the CRISPR-Cas12a signal amplification system is used. The amount of ssDNA1 is changed by the concentration of the target, and biotin-streptavidin is used to assemble ssDNA2-horseradish peroxidase (HRP). Then, ssDNA1 triggers Cas12a to cleave ssDNA2, resulting in a change in the number of HRPs on the polystyrene cladding. Moreover, the change amount of HRP is correlated with the content of the target. Due to the action of biotin-streptavidin, more HRP enzymes can be coupled, and finally, the chemiluminescence signal is amplified. Compared with traditional chemiluminescence, this sensor avoids coating or stripping the optical fiber material. Instead, a uniform and stable polystyrene cladding is directly used. The biorecognition molecules are simply and quickly modified on the cladding, and then biochemical reactions are carried out. Finally, the target molecule is indirectly quantitatively detected through the detected luminescence signal. Compared with the traditional enzyme-linked immunosorbent assay, this method does not require a plate washing step, and the whole process can be completed by an automated instrument, avoiding experimental errors caused by manual operation. Therefore, this method provides an immunosensing method with an adjustable linear range, uses CRISPR-Cas12a as a signal amplification strategy, improves the sensitivity of the method, and is equipped with a high-throughput and multifunctional automated instrument, avoiding experimental errors easily caused by manual operation. According to the experimental needs, corresponding reagents can be assembled, and steps such as washing and reaction can be completed through the control system, and up to 96 samples can be detected simultaneously.

[0008] The technical solution of the present invention is as follows:

[0009] An immunosensor with an adjustable linear range based on a self-assembled cladding, wherein the sensor is such that an outer sleeve 2 is provided on the outside of an optical fiber 1, and a plurality of claddings 3 modified with biorecognition molecules are provided on the sleeve 2. The side surface of the cladding 3 has a convex lens structure. According to different requirements for sensitivity for different target substances, different numbers of claddings 3 are assembled.

[0010] Preferably, the number of assembled claddings can be 2, 4, 6, 8 or others, and they are installed in a diagonal direction.

[0011] Preferably, the optical fiber 1 is a quartz optical fiber; the sleeve 2 is made of a light-transmitting material, is columnar, has a size of 3 - 8 mm in height and 1 - 3 mm in width, and has a through hole with a diameter of 396 μm inside. The material of the cladding 3 is polystyrene (PS), polyacrylamide (PAM), polymethyl methacrylate (PMMA), polydimethylsiloxane (PDMS), polyethylene terephthalate (PET) or others; the single size of the cladding 3 is 3 - 8 mm in height and 3 - 8 mm in outer perimeter;

[0012] The biorecognition molecule is a capture antibody or a detection antibody or a complete antigen;

[0013] The optical fiber 1 is for chemiluminescence and fluorescence analysis methods. For the enzyme-linked immunosorbent assay, the optical fiber can be a steel vertical bar, a plastic rod or others.

[0014] Preferably, the steps for modifying the surface of the cladding (3) with biorecognition molecules are as follows:

[0015] 1) Assemble the corresponding number of claddings on the optical fiber according to the requirements of the target substance to be measured to obtain the assembled optical fiber;

[0016] 2) Place the optical fiber assembled in step 1) in the biorecognition molecule for incubation and wash with PBST solution;

[0017] 3) Place the optical fiber processed in step 2) in a bovine serum albumin solution for blocking operation, and finally the surface of the polystyrene cladding is modified with the biorecognition molecule.

[0018] In step 2), in the PBST solution, the molar concentration of PBS is 0.01 M, and the mass fraction of Tween is 0.05%;

[0019] In step 3), the mass fraction of the bovine serum albumin solution is 5%.

[0020] A multifunctional automated high-throughput device for an immunosensor, the device consists of a reaction system and a control system. The reaction system consists of an up-and-down movement mechanism 4 controlled by a motor and a rotating mechanism 5. A number of reactors 6 are connected to the up-and-down movement mechanism 4. One end of the reactor 6 is provided with an immunosensor with a self-assembled cladding and adjustable linear range. The other end is connected to the up-and-down movement mechanism 4. Above the rotating mechanism 5 is an operation tank 7, and the operation tank 7 includes a reaction tank and a cleaning tank. The reactor 6 is placed into the operation tank 7 along with the up-and-down movement mechanism 4. The rotating mechanism 5 is used to rotate different operation tanks 7. The up-and-down movement mechanism 4, the rotating mechanism 5, and the control system are arranged on a base 8.

[0021] The control system is controlled by a display screen and a single-chip microcomputer. The entire control system can set the rotation speed of the motor and the height of the up-and-down motor through the display screen. In addition, the reaction time of the immunosensor in the reaction tank, the cleaning time and the number of cleaning times in the cleaning tank can also be set. Then, the automatic reaction can be carried out according to the set parameters.

[0022] The described sensor or device is used for the detection of various targets by chemiluminescence method, fluorescence immunoassay method or enzyme-linked immunosorbent assay. For targets with different detection requirements, the corresponding sensitivity can be selected and the number of polystyrene sleeves can be changed to achieve an adjustable linear range. It includes mycotoxins, pathogenic microorganisms, antibiotics, agricultural veterinary drugs, disease markers or others.

[0023] Preferably, it is applied to the detection of targets in a sample by chemiluminescence method. The detection includes the following steps:

[0024] S1: Select different numbers of claddings for assembly according to the concentration of the target to be measured. When the target concentration is 10 ng - 1 mg / mL, the number of assembled claddings is 2; when the target concentration is 1 ng / mL - 1 μg / mL, the number of claddings is 4; when the target concentration is 100 pg / mL - 10 ng / mL, the number of claddings is 6; when the target concentration is 1 pg / mL - 1 ng / mL, the number of claddings is 8. After assembly, insert the optical fiber;

[0025] S2: Directly modify the biorecognition molecule a on the cladding on the surface of the optical fiber, and carry out an immunoreaction with the solution containing the target to be measured and the enzyme-labeled biorecognition molecule b. The enzyme is HRP enzyme or ALP enzyme to form a complex;

[0026] S3: The complex catalyzes the chemiluminescent substrate, measure the chemiluminescence intensity, and complete the quantitative analysis of the target;

[0027] The number of complexes is related to the number of enzymes, so that the chemiluminescence intensity generated by catalyzing the chemiluminescent substrate is different, thereby realizing the quantitative analysis of the target.

[0028] Preferably, it is applied to the detection of a target in a sample by a chemiluminescence method. When the concentration of the target to be detected is pg / mL or less, a CRISPR-Cas12a signal amplification system can be used, including the following steps:

[0029] S1: Take two sleeves, and assemble 8 polystyrene convex lens claddings in each sleeve in the up-down direction to form Kit A and Kit B, which are used for immunoreaction and catalytic chemiluminescence substrate respectively;

[0030] S2: Couple the corresponding biorecognition molecule a on the surface of Kit A, and modify ssDNA1 on the biorecognition molecule b to obtain biorecognition molecule b-modified ssDNA1. The biorecognition molecule a and the biorecognition molecule b are matched. Couple streptavidin on the surface of Kit B, and couple it with biotinylated ssDNA2-enzyme to obtain Kit B-SA-bio-ssDNA2-enzyme. The enzyme is HRP enzyme or ALP enzyme or nanoenzyme. After the modification is completed, assemble Kit A and Kit B to the optical fiber; the function of biotin-streptavidin can make more ssDNA2-HRP coupled on the surface of Kit B, so that the luminescence intensity caused by catalyzing the chemiluminescence substrate is greater. The biorecognition molecule a and the biorecognition molecule b are matched. The biorecognition molecule a and the biorecognition molecule b are capture antibody and detection antibody, detection antibody and capture antibody, antibody and antigen or antigen and antibody;

[0031] S3: The Kit A coupled with the biorecognition molecule a and Kit B-SA-bio-ssDNA2-enzyme are first mixed with the test solution containing the target for reaction, and then reacted with the biorecognition molecule b-modified ssDNA1;

[0032] S4: React the optical fiber processed in step S3 with the Cas12a-RNA solution. The ssDNA1 in the complex on Kit A can perform base complementary pairing with the RNA in Cas12a-RNA, thereby activating the Cas12a enzyme and catalyzing it to cleave the ssDNA2 in Kit B-SA-bio-ssDNA2-enzyme, causing the enzyme to fall off. Insert the optical fiber into the chemiluminescence substrate, measure the chemiluminescence intensity, and realize the quantitative detection of the target.

[0033] As the target increases, the cleaved ssDNA2-HRP increases, resulting in a decrease in the amount of HRP on Kit B, and the luminescence intensity caused by catalyzing the chemiluminescence substrate is low, thereby realizing the quantitative analysis of the target.

[0034] The detection principle of the signal amplification system is as follows: The amount of the target is related to the biorecognition molecule b that modifies ssDNA1 in the reaction. ssDNA1 can perform base complementary pairing with the RNA in Cas12a-RNA, ultimately activating Cas12a to cleave ssDNA2 on ssDNA2-HRP. When ssDNA2 is cleaved, HRP detaches. Therefore, as the amount of the target increases, the amount of cleaved ssDNA2-HRP increases, the amount of HRP decreases, and the luminescence intensity caused by catalyzing the chemiluminescent substrate is low, thereby quantitatively analyzing the target.

[0035] Preferably, the ssDNA1 used has the nucleotide sequence GAAGACACCCTACCAACCCCCCCCTAAACC shown in SEQ ID NO.1; ssDNA2 has the nucleotide sequence shown in SEQ ID NO.2: TTATTTTATT; the RNA in Cas12a-RNA has the nucleotide sequence shown in SEQ ID NO.3: UAAUUUCUACUAAGUGUAGAUGGGGGGGGUUGGUAGGGUGUC.

[0036] More preferably, the amounts of ssDNA1 and ssDNA2 conjugated to IL-6-Ab2 are both 0.5 nmol.

[0037] More preferably, the concentration of the biomolecule b that modifies ssDNA1 is 10 μg / mL, and the concentration of ssDNA2-HRP is 0.5 μmol.

[0038] Preferably, the application can also be used in a fluorescence immunoassay method, including the following steps:

[0039] 1. After modifying the biorecognition molecule a on the polystyrene cladding, react with the solution containing the target to be detected;

[0040] 2. React the solution from step 1 with the biorecognition molecule b modified on the fluorescence-coded microspheres; The target in the test solution undergoes an immunoreaction with the biorecognition molecule a on the cladding and the biorecognition molecule b modified on the fluorescence-coded microspheres in the solution to form a complex. The excess biorecognition molecule b modified on the fluorescence-coded microspheres is washed. The biorecognition molecule a and the biorecognition molecule b are matched, and the biorecognition molecule a and the biorecognition molecule b are capture antibody and detection antibody, detection antibody and capture antibody, antibody and antigen, or antigen and antibody;

[0041] 3. Under the irradiation of ultraviolet excitation light, the fluorescence-coded microspheres generate fluorescence signals. The fluorescence-coded microspheres in the complex are related to the fluorescence signal intensity, and quantitative analysis is performed on it.

[0042] Further preferably, the amount of the biomolecule b modified on the fluorescently encoded microspheres is 30 mg.

[0043] Further preferably, the fluorescently encoded microspheres can be blue, green, but are not limited to the above types.

[0044] The application can also be used for enzyme-linked immunosorbent assay, including the following steps:

[0045] (I) By means of electrostatic adsorption and other effects, the biomolecule a is pre-modified on the polystyrene cladding on the optical fiber, and then a biorecognition reaction is carried out in sequence with a solution containing the target to be detected and a solution of the biomolecule b labeled with horseradish peroxidase to obtain a reaction mixture;

[0046] (II) The obtained reaction mixture is immersed in a TMB chromogenic solution containing hydrogen peroxide;

[0047] (III) By detecting the absorbance value, a quantitative curve between the target concentration and the absorbance value is established, so as to realize the quantitative analysis and detection of the target.

[0048] Since the enzyme-linked immunosorbent assay does not require the use of an optical fiber for light guiding, the optical fiber can be replaced with a wooden strip with a similar diameter.

[0049] Further preferably, the main technology of this method is as follows:

[0050] 1) Assemble 4 polystyrene claddings onto the wooden strip;

[0051] 2) Insert the assembled wooden strip into a solution containing the biomolecule a, incubate at 37 °C for 2 hours, and then wash with PBST;

[0052] 3) After washing, insert it into a BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour, then wash with PBST and store it in the dark at 4 °C. At this time, the biomolecule a has been modified on the cladding.

[0053] 4) Insert the modified wooden strip into 15 μL of target standard solutions with different concentrations, react at 37 °C for 30 min, and wash 3 times with PBST;

[0054] 5) Insert the above wooden strip into 15 μL of a solution of the biomolecule b labeled with 10 μg / mL horseradish peroxidase, react at 37 °C for 30 min, and wash 3 times with PBST;

[0055] 6) Insert the above wooden strip into a TMB chromogenic solution containing hydrogen peroxide. After reacting for 15 minutes, add dilute sulfuric acid to terminate the reaction, and then measure the absorbance of the solution at 450 nm;

[0056] 7) Plot a standard curve with the logarithm of the target concentration as the abscissa and the difference in absorbance values between the blank sample and PCT samples at different concentrations as the ordinate.

[0057] Even more preferably, in step 6), the concentration of the dilute sulfuric acid used to terminate the reaction is 2 mM.

[0058] The beneficial effects of the present invention are as follows:

[0059] 1. Simple operation and good stability: During the chemiluminescence detection process, the present invention simplifies the process of modifying biomolecules on the optical fiber. Only a polystyrene cladding is required, and biomolecules can be directly adsorbed, reducing the experimental error caused during the optical fiber treatment process, and improving the ease of operation, repeatability, and stability of the biosensor.

[0060] 2. Equipment automation and high throughput: Processes such as temperature control, sample injection, reaction time, and washing can all be controlled by a pre-set program, enabling unmanned operation, reducing errors and interference caused by operators during the analysis process, and simultaneously detecting up to 96 samples at a time. At the same time, the equipment is equipped with a mirror sleeve with a concave mirror shape at the bottom, effectively reducing the loss of optical signals during chemiluminescence and fluorescence immunoassay detection. Compared with the traditional enzyme-linked immunosorbent assay method, the present invention avoids multiple pipetting and washing steps, improving the overall sensitivity and reproducibility of the method.

[0061] 3. High sensitivity and adjustable linear range: Equipped with a CRISPR-Cas12a signal amplification system, it can achieve multi-functional detection: The self-assembled polystyrene cladding has a convex mirror structure on the side. For chemiluminescence and fluorescence detection, optical signals can be concentrated and focused on the optical fiber, effectively reducing light loss and achieving physical signal amplification; The self-assembled polystyrene cladding can select different numbers of claddings for assembly according to the detection requirements of the target. The more the number of polystyrene sleeves, the more biomolecular recognition molecules are coupled to its surface, thereby achieving an adjustable linear range. For targets with higher requirements for detection sensitivity, the CRISPR-Cas12a signal amplification system can be used to further amplify the signal and improve sensitivity; This method can not only achieve chemiluminescence detection, but also be applicable to fluorescence detection and automated ELISA detection. Description of the Drawings

[0062] Figure 1 Structural diagrams of the kit and the sleeve; where Figure 1 Figure a is a top view, Figure b is a side view of the cladding, Figure c is a side view of the reactor, and Figure d is a side view of the sleeve;

[0063] Figure 2 Front view of the multi-functional device;

[0064] Figure 3 Top view of the multifunctional device;

[0065] Figure 4 Optimization of the antigen concentration captured by PCT;

[0066] Figure 5 Optimization of the antibody concentration for detecting PCT by enzyme-labeled method;

[0067] Figure 6 Schematic diagram of detecting PCT by chemiluminescence method;

[0068] Figure 7 Standard curve of detecting PCT by chemiluminescence method;

[0069] Figure 8 Schematic diagram of detecting IL-6 by combining CRISPR-Cas12a signal amplification system;

[0070] Figure 9 Standard curve of detecting IL-6 by combining CRISPR-Cas12a signal amplification system;

[0071] Figure 10 Schematic diagram of detecting multiple inflammatory markers in samples by chemiluminescence method with adjustable linear range;

[0072] Figure 11 Standard curve of detecting multiple inflammatory markers in samples by chemiluminescence method with adjustable linear range;

[0073] Figure 12 Schematic diagram of detecting PCT by enzyme-linked immunosorbent assay;

[0074] Figure 13 Standard curve of detecting PCT by enzyme-linked immunosorbent assay;

[0075] Figure 14 Schematic diagram of detecting vomitoxin by enzyme-linked immunosorbent assay;

[0076] Figure 15 Schematic diagram of detecting PCT by fluorescence immunoassay;

[0077] Figure 16 Standard curve of detecting PCT by fluorescence immunoassay.

[0078] Wherein: optical fiber 1, sleeve 2, cladding 3, up-and-down moving mechanism 4, rotating mechanism 5, reactor 6, operation tank 7, base 8. Specific implementation mode

[0079] The technical solution of the present invention will be further described below through specific implementation modes. Those skilled in the art should understand that the embodiments are only for helping to understand the present invention and should not be regarded as specific limitations on the present invention.

[0080] Description of Test Materials and Related Terms

[0081] C-reactive protein (CRP), CRP capture antibody (CRP-Ab1), CRP enzyme-labeled antibody, procalcitonin (PCT), PCT capture antibody (PCT-Ab1), PCT enzyme-labeled antibody, interleukin-6 (IL6), IL6 capture antibody (IL6-Ab1), IL6 enzyme-labeled antibody: purchased from abcam.

[0082] Quartz optical fiber (SFS400 / 440 / 700T Superguide UV-Vis): purchased from Shanghai Wenyi Optoelectronic Technology Co., Ltd.

[0083] Example 1 Immuno-sensor with Adjustable Linear Range Based on Self-assembled Cladding

[0084] As Figure 1 shown, an immuno-sensor with adjustable linear range based on self-assembled cladding, wherein the sensor is such that a sleeve 2 is provided outside an optical fiber 1, and a plurality of claddings 3 modified with biorecognition molecules are provided on the sleeve 2. There are a plurality of the claddings 3, and the side surface of the cladding 3 is in a convex lens structure. According to different requirements for the sensitivity of different target substances, different numbers of claddings are assembled.

[0085] Preferably, the number of assembled claddings can be 4 and they are installed in a diagonal direction.

[0086] Preferably, the optical fiber 1 is a quartz optical fiber; the sleeve 2 is made of a light-transmitting material, with a size of 6 mm in height, 2 mm in width, and a through-hole with a diameter of 396 μm inside. The material of the cladding 3 is polystyrene; the size of the cladding 3 is 6 mm in height and 5 mm in outer perimeter;

[0087] The biorecognition molecule is a capture antibody or a detection antibody or a complete antigen;

[0088] Preferably, the steps for modifying the surface of the cladding 3 with a biorecognition molecule are as follows:

[0089] 1) Assemble a corresponding number of claddings on the optical fiber according to the requirements of the target substance to be measured to obtain the assembled optical fiber;

[0090] 2) Place the optical fiber assembled in step 1) in the biorecognition molecule for incubation and wash with PBST solution;

[0091] 3) Place the optical fiber processed in step 2) in bovine serum albumin for blocking operation, and finally the surface of the polystyrene cladding is modified with a biorecognition molecule.

[0092] In step 2), in the PBST solution, the molar concentration of PBS is 0.01 M and the mass fraction of Tween is 0.05%;

[0093] In step 3), the mass fraction of the bovine serum albumin is 5%.

[0094] Example 2 Construction of a Multifunctional Automated Detection Device

[0095] As Figures 2-3 shown, a multifunctional automated high-throughput device supporting an immunosensor, the device consists of a reaction system and a control system. The reaction system consists of an up-and-down moving mechanism 4 controlled by a motor and a rotating mechanism 5. A number of reactors 6 are connected to the up-and-down moving mechanism 4. One end of the reactor 6 is provided with an immunosensor with an adjustable linear range of self-assembled cladding, and the other end is connected to the up-and-down moving mechanism 4. Above the rotating mechanism 5 is an operation slot 7, and the operation slot 7 includes a reaction slot and a cleaning slot. The reactor 6 is placed in the operation slot 7 along with the up-and-down moving mechanism 4. The rotating mechanism 5 is used to rotate different operation slots 7. The up-and-down moving mechanism 4, the rotating mechanism 5, and the control system are arranged on a base 8. This device is mainly composed of a reaction part and a control part. The reaction part is mainly composed of an up-and-down moving part controlled by a 57-step motor and a rotating part controlled by an 86-step motor. The up-and-down moving part adopts a self-combined optical fiber structure. The rotating part can place 12 reaction slots at one time and can continuously complete 12 reaction actions. The control part is controlled by a Kunlun Tongtai control display screen and a Mitsubishi plc single-chip microcomputer.

[0096] After assembling the polystyrene cladding into the kit and sleeving the kit onto the optical fiber, the optical fiber can be fixed in the reactor of this device, and the corresponding number of optical fibers can be assembled according to experimental requirements. Put the corresponding biorecognition molecule solution and washing solution in the operation slot, and this instrument can control the up-and-down movement of the optical fiber to achieve the reaction and washing effects.

[0097] Example 3 Verification of the Stability of Biomolecule Coupling

[0098] Traditional methods for modifying biomolecules on the surface of optical fibers usually require introducing chemical bonds on the surface of the optical fiber. This step is complex in operation, and the stability of the coupled biomolecules is poor. In the present invention, through the action of hydrophobic bonds, ionic bonds, etc. on the surface of the polystyrene cladding, that is, directly modifying the biorecognition molecule (antibody or complete antigen) on the surface of the cladding, the use of hydrofluoric acid and organic reagents in introducing chemical bonds is avoided, the coupling step of biomolecules is simplified, and at the same time, the activity and stability of the coupled biomolecules are greatly improved. The specific verification process is as follows:

[0099] Preparation of traditional optical fibers modified with biomolecules:

[0100] 1) Cut the optical fiber into small segments with a length of 6 cm, and gently scrape off the acrylic protective layer with a length of 0.5 cm at one end of the optical fiber with a knife;

[0101] 2) Corrode the part without the acrylic protective layer with 24% hydrofluoric acid for 20 min to remove the silica coating layer, rinse it three times with 0.1 mol / L NaOH and water respectively, and dry it with nitrogen;

[0102] 3) Immerse the core part without the coating layer in 0.1 mol / L NaOH for 30 min to activate the silanol groups on the fiber surface. Rinse it twice with water and once with ethanol, and dry it with nitrogen;

[0103] 4) Immerse the core part in an ethanol solution of 1% (v / v) silane coupling agent KH-560 for 60 min to introduce epoxy groups to the fiber surface;

[0104] 5) React the above-mentioned optical fiber with the HRP enzyme solution at room temperature for 60 min to make the epoxy groups react with the enzyme and achieve enzyme labeling;

[0105] 6) Insert the above-mentioned optical fiber into a BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour, then wash it with PBST and store it in the dark at 4 °C.

[0106] 7) Store the optical fiber labeled with HRP enzyme at 4 °C, and record the absorbance of the enzyme-labeled optical fiber catalyzing the color development of TMB to verify the activity of the modified HRP.

[0107] Preparation of the optical fiber modified with biomolecules by this method:

[0108] 1) Assemble the polystyrene cladding to the sleeve and then put the optical fiber into it. The outer diameter of the optical fiber is 400 μm and the length is 6 cm. The size of sleeve 2 is 6 mm in height and 2 mm in width, with a through hole of 396 μm in diameter inside. The material of cladding 3 is polystyrene; the size of cladding 3 is 6 mm in height and 5 mm in outer perimeter. Four claddings are selected in this method;

[0109] 2) Insert the optical fiber modified with the polystyrene cladding into the HRP enzyme solution, soak it at room temperature for 60 min, and then wash it with PBST;

[0110] 2) Insert the above-mentioned optical fiber into a BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour, then wash it with PBST and store it in the dark at 4 °C.

[0111] 3) Store the optical fiber labeled with HRP enzyme at 4 °C, and record the absorbance of the enzyme-labeled optical fiber catalyzing the color development of TMB to verify the activity of the chemically modified HRP on the optical fiber.

[0112] As can be seen from Table 1, the activity of HRP enzyme conjugated by traditional modification methods decreased significantly after 120 days of storage, and almost completely lost its activity after 180 days; while the HRP enzyme conjugated by polystyrene cladding still had good catalytic activity after 300 days of storage.

[0113] Table 1 Comparison of the stability of enzymes conjugated by two different modification methods

[0114]

[0115] To further compare the two modification methods, we conjugated rabbit anti-goat IgG on the surface of the optical fiber and verified the activity of the conjugated antibody by enzyme-linked immunosorbent assay. The specific steps are as follows:

[0116] Preparation of traditional modified biomolecular optical fiber:

[0117] 1) Cut the optical fiber into small segments 6 cm long, and gently scrape off the acrylic protective layer with a knife at one end of the optical fiber for a length of 0.5 cm;

[0118] 2) Corrode the part without the acrylic protective layer with 24% hydrofluoric acid for 20 min to remove the silica coating, rinse it three times with 0.1 mol / L NaOH and water respectively, and dry it with nitrogen;

[0119] 3) Immerse the core part without the coating in 0.1 mol / L NaOH for 30 min to activate the silanol groups on the surface of the optical fiber. Rinse it twice with water and once with ethanol, and dry it with nitrogen;

[0120] 4) Immerse the core part in an ethanol solution of 1% (v / v) silane coupling agent KH-560 for 60 min to introduce epoxy groups to the surface of the optical fiber;

[0121] 5) React the above optical fiber with rabbit anti-goat IgG solution at room temperature for 60 min to allow the epoxy groups to react with the enzyme and achieve antibody labeling;

[0122] 6) Insert the above optical fiber into BSA solution (5%, w / v) to block non-specific sites at 37°C for 1 hour, then wash it with PBST and store it in the dark at 4°C.

[0123] 7) React the optical fiber conjugated with rabbit anti-goat IgG with 20 μg / mL rabbit anti-goat IgG and HRP enzyme-labeled human IgG respectively, finally catalyze TMB for color development, and measure the absorbance value of the solution.

[0124] Preparation of the modified biomolecular optical fiber by this method:

[0125] 1) Assemble the polystyrene cladding onto the sleeve, and then slip on the optical fiber. The outer diameter of the optical fiber is 400 μm and the length is 6 cm. The size of the sleeve 2 is 6 mm in height and 2 mm in width, with a through-hole of 396 μm in diameter inside. The material of the cladding 3 is polystyrene; the size of the cladding 3 is 6 mm in height and 5 mm in perimeter. Four claddings are selected in this method;

[0126] 2) Insert the optical fiber modified with the polystyrene cladding into the solution containing rabbit anti-goat IgG, soak it at room temperature for 60 min, and then wash it with PBST;

[0127] 2) Insert the above-mentioned optical fiber into the BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour, then wash it with PBST and store it in the dark at 4 °C.

[0128] 3) React the optical fiber conjugated with rabbit anti-goat IgG with 20 μg / mL rabbit anti-goat IgG and HRP-labeled human IgG respectively, finally catalyze TMB for color development, and measure the absorbance value of the solution.

[0129] As can be seen from Table 2, after being stored for 90 days, the activity of rabbit anti-goat IgG conjugated by the traditional modification method decreased significantly, and almost completely lost its activity after 150 days and could not undergo an immune reaction; while the rabbit anti-goat IgG conjugated by the polystyrene cladding still had good ability to participate in the immune reaction after being stored for 270 days.

[0130] Table 2 Comparison of the stability of antibodies conjugated by two different modification methods

[0131]

[0132] Example 4 Construction of a chemiluminescence method

[0133] Directly modify the biorecognition molecule on the polystyrene cladding, and the biorecognition molecule can be fixed on the cladding through the interaction of hydrophobic groups.

[0134] Taking the biorecognition molecule fixed by the optical fiber biosensor as the procalcitonin capture antibody (PCT-Ab1), the enzyme-labeled antibody as HRP-PCT-Ab2, and the chemiluminescence substrate as the mixed solution of luminol and hydrogen peroxide as an example, the preparation process is described as follows:

[0135] 1) Assemble the polystyrene cladding onto the sleeve, and then slip on the optical fiber. The outer diameter of the optical fiber is 400 μm and the length is 6 cm. The size of the sleeve 2 is 6 mm in height and 2 mm in width, with a through-hole of 396 μm in diameter inside. The material of the cladding 3 is polystyrene; the size of the cladding 3 is 6 mm in height and 5 mm in outer perimeter. Four claddings are selected in this method;

[0136] 2) Insert the optical fiber modified with a polystyrene cladding into a 20 μg / mL procalcitonin capture antibody (PCT-Ab1), incubate at 37 °C for 2 hours, and then wash with PBST;

[0137] 2) Insert the above optical fiber into a BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour, then wash with PBST and store in the dark at 4 °C.

[0138] At this time, the polystyrene cladding on the surface of the optical fiber has been successfully modified with biomolecular recognition molecules.

[0139] 2. Optimization of the concentration of procalcitonin capture antibody

[0140] The concentrations of the PCT capture antibody used to prepare the sensor were 1, 5, 10, 20, 25 μg / mL, the concentration of the enzyme-labeled PCT detection antibody was 1, 5, 10, 20, 25 μg / mL, the PCT concentration was 0, 10, 100, 1000, 10000, 100000 pg / mL, the sandwich immunoassay reaction time was 30 minutes, the dilution factor was 1:1000, and the chemiluminescent substrate was luminol. It can be seen from Figure 4 that there are obvious differences in the sensitivity of the sensors prepared with different concentrations of the complete antigen for the detection of the target substance. Among them, the best effect is obtained when the concentration of the procalcitonin capture antibody used is 20 μg / mL.

[0141] Example 5 Detection of procalcitonin in blood by chemiluminescence method

[0142] After assembling the polystyrene cladding and the optical fiber, the procalcitonin capture antibody (PCT-Ab1) is directly modified on the polystyrene cladding on the surface of the optical fiber through the action of hydrophobic groups. Then, the optical fiber is subjected to a sandwich immunoassay reaction with the procalcitonin in the sample to be tested and the enzyme-labeled procalcitonin detection antibody (HRP-PCT-Ab2). The PCT present in the sample specifically reacts with the modified PCT-Ab1. After the reaction, the enzyme-labeled PCT-Ab2 with a certain concentration is added, and the enzyme-labeled PCT-Ab2 can react with the PCT captured by PCT-Ab1 on the surface of the polystyrene cladding, thus forming a sandwich structure. After washing away the excess unreacted enzyme-labeled PCT-Ab2, the optical fiber probe is inserted into the chemiluminescent substrate. The HRP in the complex catalyzes hydrogen peroxide to produce an oxidative product, which reacts with luminol to produce a chemiluminescent signal, and the signal intensity is related to the concentration of PCT in the sample to be tested.

[0143] The specific process is as follows:

[0144] 1. Preparation of an optical fiber modified with biomolecules

[0145] 1) Assemble the polystyrene cladding to the sleeve, and then slip on the optical fiber. The outer diameter of the optical fiber is 400 μm and the length is 6 cm. The sleeve 2 has a size of 6 mm in height and 2 mm in width, with a through-hole of 396 μm in diameter inside. The cladding 3 is made of polystyrene; the size of the cladding 3 is 6 mm in height and 5 mm in outer circumference. Four claddings are selected in this method;

[0146] 2) Insert the assembled optical fiber into the procalcitonin capture antibody (PCT-Ab1) at 20 μg / mL, coat it at 37 °C for 2 hours, and then wash it with PBST;

[0147] 3) Insert the above optical fiber into the BSA solution (5%, w / v), block the non-specific sites at 37 °C for 1 hour, then wash it with PBST and store it in the dark at 4 °C.

[0148] 2. Optimization of the PCT capture antigen concentration

[0149] The concentrations of the PCT capture antibody used to prepare the sensor are 5, 10, 20, 25, 30 μg / mL respectively, the concentration of the enzyme-labeled PCT detection antibody is 10 μg / mL, and the PCT concentrations are 0, 10, 100, 1000, 10000, 100000 pg / mL. It can be seen from Figure 4 that the optimal concentration of the PCT capture antibody is 20 μg / mL.

[0150] 3. Optimization of the enzyme-labeled PCT detection antibody concentration

[0151] The concentration of the PCT capture antibody used to prepare the sensor is 20 μg / mL, the concentrations of the enzyme-labeled PCT detection antibody are 1, 5, 10, 20, 25 μg / mL, and the PCT concentrations are 0, 10, 100, 1000, 10000, 100000 pg / mL. It can be seen from Figure 5 that the optimal concentration of the PCT detection antibody is 10 μg / mL.

[0152] 4. Establishment of the PCT standard curve

[0153] Under the above optimized conditions, establish a standard curve, and the principle of this method is as Figure 6 shown.

[0154] 1) Assemble the polystyrene cladding to the sleeve, and then slip on the optical fiber. The outer diameter of the optical fiber is 400 μm and the length is 6 cm. The sleeve 2 has a height of 6 mm, a width of 2 mm, and a through-hole with a diameter of 396 μm inside. The material of the cladding 3 is polystyrene; the cladding 3 has a height of 6 mm and an outer circumference of 5 mm. Four claddings are selected in this method, and then the optical fiber is inserted into 20 μg / mL PCT-Ab1, incubated at 37 °C for 2 hours, and then washed with PBST; the above optical fiber is inserted into a BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour, and then washed with PBST and stored in the dark at 4 °C.

[0155] 1) Insert the optical fiber into 15 μL of PCT standard solutions with different concentrations respectively, react at 37 °C for 30 min, and wash the optical fiber 3 times with PBST.

[0156] 2) Insert the optical fiber in step 1) into 30 μL of 10 μg / mL enzyme-labeled PCT-Ab2 solution, react at 37 °C for 30 min, and wash the optical fiber three times with PBST.

[0157] 3) Insert the optical fiber into the detection device, and add freshly prepared chemiluminescent substrate solution (20 μL each of luminol and hydrogen peroxide, mixed immediately), and collect chemiluminescent signals and record data.

[0158] 4) Use the PCT concentration corresponding value as the abscissa and the difference in chemiluminescent intensity between the blank sample and each concentration of PCT as the ordinate to plot the standard curve.

[0159] The principle of this method is as Figure 6 shown. The greater the PCT concentration, the greater the difference in chemiluminescent intensity between the blank sample. There is a good linear relationship between the difference in chemiluminescent intensity between the blank sample and different concentrations of PCT samples and the logarithm of the PCT concentration. As Figure 7 can be obtained, the regression equation of this method is y = 2025.44x + 3559.76, and the correlation coefficient R 2 is 0.99.

[0160] 4. Detection of PCT in human serum

[0161] The standard addition method is used to detect PCT in serum samples. The detection results are shown in Table 3. The recovery rates are all between 89% - 109%, and the relative standard deviations are all less than 10%. The above results indicate that this method has high accuracy and precision and can be used for the quantitative analysis of PCT in serum samples.

[0162] Table 3 Detection results of PCT in human serum

[0163]

[0164] Example 6 Detection of Interleukin-6 in Blood Based on CRISPR-Cas12a Signal Amplification Strategy

[0165] The polystyrene cladding was assembled onto the sleeve and then sleeved onto the optical fiber. The outer diameter of the optical fiber was 400 μm and the length was 6 cm. The size of sleeve 2 was 6 mm in height and 2 mm in width, with a through-hole of 396 μm in diameter inside. The material of cladding 3 was polystyrene; the size of cladding 3 was 6 mm in height and 5 mm in outer perimeter. Eight claddings were selected in this method. The IL-6 capture antibody (IL-6-Ab1) was directly modified onto the polystyrene cladding on Kit A through the action of hydrophobic groups, and streptavidin was modified onto the polystyrene cladding on the surface of Kit B. The two kits were assembled onto the optical fiber in the up-down direction and reacted with bio-ssDNA2-HRP. ssDNA1-IL-6-Ab2 could react with IL-6 captured by IL-6-Ab1 on the surface of the polystyrene cladding, thus forming a sandwich structure. The amount of IL-6 in the sample was related to the reacted ssDNA1-IL-6-Ab2, and ssDNA1 could perform base complementary pairing with the RNA in Cas12a-RNA and activate Cas12a to cleave ssDNA2. When ssDNA2 was cleaved, HRP fell off. Therefore, as the amount of the target increased, the cleaved ssDNA2-HRP increased and the amount of HRP decreased, resulting in a lower luminescence intensity caused by catalyzing the chemiluminescent substrate, and thus quantitatively analyzing the target. Thereby making the luminescence intensity caused by catalyzing the chemiluminescent substrate greater. The principle of this method is as Figure 8 shown.

[0166] 1) Insert Kit A into 10 μg / mL IL-6-Ab1 solution, incubate at 37 °C for 2 hours, then wash with PBST. Put it into BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour; insert Kit 2 into 1 μg / mL streptavidin, incubate at 37 °C for 2 hours, then wash with PBST, and then add bio-ssDNA2-HRP, react at 37 °C for 10 min, and wash with PBST.

[0167] 2) Assemble the prepared Kit A and Kit B onto the optical fiber.

[0168] 3) Insert the prepared optical fiber into 15 μL standard solutions of different concentrations of IL-6, react at 37 °C for 30 min, and wash 3 times with PBST;

[0169] 4) Couple IL-6-Ab2 with streptavidin and biotinylate ssDNA1 respectively, and react the two to obtain ssDNA1-IL-6-Ab2..

[0170] 5) Insert the above optical fiber into 15 μL of the IL-6-Ab2 solution modified with ssDNA1, react at 37 °C for 30 minutes, and wash three times with PBST.

[0171] 6) Insert the optical fiber into 15 μL of the Cas12a-RNA solution, react at 37 °C for 30 minutes. The RNA in Cas12a-RNA binds to ssDNA1, activating Cas12a to cleave ssDNA2.

[0172] 7) Assemble the mirror sleeve, insert the optical fiber into the detection device and place it into a newly prepared chemiluminescent substrate solution (take 20 μL each of luminol and hydrogen peroxide and mix immediately), and perform data collection and recording of chemiluminescent signals;

[0173] 8) Plot a standard curve with the logarithm of the IL-6 concentration as the abscissa and the difference in chemiluminescent intensity between the blank sample and samples with different concentrations of IL-6 as the ordinate.

[0174] The linear regression equation for detecting IL-6 using the CRISPR-Cas12a signal amplification strategy is y = 2868.76x + 12276.30 ( Figure 9 ) To detect the IL-6 residue in serum samples using the standard addition method, the detection results are shown in Table 4. The recovery rates are all between 94% - 104%, and the relative standard deviations are all less than 10%. The above results indicate that this method has high accuracy and precision and can be used for the quantitative analysis of IL-6 in serum samples.

[0175] Table 4 Detection results of IL-6 in human serum

[0176]

[0177] Example 7 Detection of multiple inflammatory markers in samples by a chemiluminescent method with adjustable linear range

[0178] To verify that this method can meet the requirements of the detection concentration range for different subjects, three inflammatory markers CRP, PCT, and IL-6 in human serum were detected ( Figure 10). Since the CRP content in normal serum should be less than 1 mg / mL, the PCT content should be less than 5 ng / mL, and the IL-6 content should be less than 7 pg / mL. Therefore, for the detection of CRP and PCT, first, polystyrene claddings with quantities of 2 and 4 are assembled on each reactor, and capture antibodies for different targets are respectively modified on the cladding surfaces corresponding to reactor 1. Then, each reactor is placed into the corresponding standard product and the enzyme-labeled detection antibody solution for immunoreaction. After washing away the excess enzyme-labeled detection antibody, each optical fiber is inserted into the chemiluminescent substrate, and the target can be quantified through the chemiluminescent intensity. For the detection of IL-6, a higher detection sensitivity is required. Therefore, the CRISPR-Cas12a signal amplification strategy can be used for detection. The IL-6 capture antibody (IL-6-Ab1) is directly modified on the polystyrene cladding of kit 1 through the action of a hydrophobic group, and streptavidin is modified on the polystyrene cladding of the surface of kit 2. The two kits are assembled in the up-down direction on the optical fiber and react with bio-ssDNA2-HRP. ssDNA1-IL-6-Ab2 can react with the IL-6 captured by IL-6-Ab1 on the polystyrene cladding surface, thus forming a sandwich structure. The amount of IL-6 in the sample is related to the reacted ssDNA1-IL-6-Ab2, and ssDNA1 can perform base complementary pairing with the RNA in Cas12a-RNA and activate Cas12a to cleave ssDNA2. When ssDNA2 is cleaved, HRP falls off. Therefore, as the target increases, the cleaved ssDNA2-HRP increases, the amount of HRP decreases, and the chemiluminescent intensity caused by catalyzing the chemiluminescent substrate is low, and the target is quantitatively analyzed based on this.

[0179] For the detection of CRP and PCT:

[0180] 1) Assemble the polystyrene cladding onto the sleeve, and then slip it over the optical fiber. The outer diameter of the optical fiber is 400 μm and the length is 6 cm. The size of sleeve 2 is 6 mm in height and 2 mm in width, with a through hole of 396 μm in diameter inside. The material of cladding 3 is polystyrene; the size of the cladding 3 is 6 mm in height and 5 mm in outer perimeter. Among them, 2 claddings are selected for CRP and 4 claddings are selected for PCT. Insert them into the CRP-Ab1, PCT-Ab1, and IL-6-Ab1 solutions respectively, incubate at 37 °C for 2 hours, and then wash with PBST. Then place them into the BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour.

[0181] 2) Insert the prepared optical fiber into 15 μL of standard solutions of different concentrations of CRP, PCT, and IL-6, react at 37 °C for 30 min, and wash 3 times with PBST;

[0182] 3) Insert the above optical fiber into the solutions of enzyme-labeled CRP-Ab2, enzyme-labeled PCT-Ab2, and enzyme-labeled IL-6-Ab2.

[0183] 4) Insert the optical fiber into 15 μL of Cas12a-RNA solution and react at 37 °C for 30 minutes. The RNA in Cas12a-RNA binds to ssDNA1, activating Cas12a to cleave ssDNA2.

[0184] 5) Assemble the mirror sleeve, insert the optical fiber into the detection device, and place it in a newly prepared chemiluminescent substrate solution (take 20 μL each of luminol and hydrogen peroxide and mix immediately), and collect and record the chemiluminescent signal data;

[0185] 6) Plot a standard curve with the logarithm of the concentration of each inflammatory marker as the abscissa and the difference in chemiluminescent intensity between the blank sample and the target sample with different concentrations as the ordinate.

[0186] For the detection of IL-6:

[0187] 1) Insert Kit A into 10 μg / mL IL-6-Ab1 solution, incubate at 37 °C for 2 hours, then wash with PBST. Next, place it in BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour; insert Kit 2 into 1 μg / mL streptavidin, incubate at 37 °C for 2 hours, then wash with PBST. Then add bio-ssDNA2-HRP and react at 37 °C for 10 minutes, followed by washing with PBST.

[0188] 2) Assemble the prepared Kit A and Kit B onto the optical fiber.

[0189] 3) Insert the prepared optical fiber into 15 μL of standard solutions with different concentrations of IL-6, react at 37 °C for 30 min, and wash with PBST three times;

[0190] 4) Couple IL-6-Ab2 with streptavidin and biotinylate ssDNA1 respectively, and react the two to obtain ssDNA1-IL-6-Ab2.

[0191] 5) Insert the above optical fiber into 15 μL of IL-6-Ab2 solution modified with ssDNA1 and react at 37 °C for 30 min, then wash with PBST three times.

[0192] 6) Insert the optical fiber into 15 μL of Cas12a-RNA solution and react at 37 °C for 30 minutes. The RNA in Cas12a-RNA binds to ssDNA1, activating Cas12a to cleave ssDNA2.

[0193] 7) Assemble the mirror sleeve, insert the optical fiber into the detection device and place it in the newly prepared chemiluminescent substrate solution (take 20 μL each of luminol and hydrogen peroxide and mix immediately), and collect and record the chemiluminescent signal data;

[0194] 8) Use the logarithm of the IL-6 concentration as the abscissa and the difference in chemiluminescent intensity between the blank sample and samples with different concentrations of IL6 as the ordinate to plot a standard curve ( Figure 11 )

[0195] The standard addition method was used to detect CRP, PCT, and IL-6 residues in serum samples. The detection results are shown in Table 5. Their recoveries are all between 88% and 108%, and the relative standard deviations are all less than 10%. The above results indicate that this method has high accuracy and precision and can be used for the quantitative analysis of multiple symptom markers in serum samples.

[0196] Table 5 Detection results of three inflammatory markers in human serum

[0197]

[0198] Example 8 Construction of an enzyme-linked immunosorbent assay method

[0199] Assemble the polystyrene cladding with the probe. The biorecognition molecule can be directly modified on the polystyrene cladding, and the biorecognition molecule can be fixed on this cladding through the interaction of hydrophobic groups.

[0200] Taking the biorecognition molecule as the procalcitonin capture antibody (PCT-Ab1), the enzyme-labeled antibody as HRP-PCT-Ab2, and the chromogenic solution as a mixed solution of TMB and hydrogen peroxide as an example, the preparation process is described as follows:

[0201] 1) Assemble the polystyrene cladding onto the probe;

[0202] 2) Insert the probe modified with the polystyrene cladding into 20 μg / mL procalcitonin capture antibody (PCT-Ab1), incubate at 37 °C for 2 hours, and then wash with PBST;

[0203] 2) Insert the above probe into a BSA solution (5%, w / v), block non-specific sites at 37 °C for 1 hour, then wash with PBST and store in the dark at 4 °C.

[0204] At this time, the polystyrene cladding on the probe surface has been successfully modified with the biorecognition molecule.

[0205] 2. Optimization of procalcitonin antibody concentration

[0206] The concentrations of PCT capture antibodies used for preparing the sensor are 1, 5, 10, 20, 25 μg / mL respectively, the concentration of enzyme-labeled PCT detection antibody is 1, 5, 10, 20, 25 μg / mL, the PCT concentration is 0, 10, 100, 1000, 10000, 100000 pg / mL, the sandwich immunoassay reaction time is 30 min, the dilution factor is 1:1000, and the chromogenic solution is TMB. There are obvious differences in the sensitivity of sensors prepared with different concentrations of complete antigen for the detection of the target substance. Among them, the best effect is achieved when the concentration of the procalcitonin capture antibody used is 20 μg / mL.

[0207] Example 9 Detection of Procalcitonin in Blood by Enzyme-Linked Immunosorbent Assay

[0208] After the polystyrene cladding and the probe are assembled, the procalcitonin capture antibody (PCT-Ab1) is directly modified on the polystyrene cladding on the surface of the probe through the action of hydrophobic groups. Then, the probe is subjected to a sandwich immunoassay reaction with the procalcitonin in the test sample and the enzyme-labeled procalcitonin detection antibody (HRP-PCT-Ab2). The PCT present in the sample undergoes a specific reaction with the modified PCT-Ab1. After the reaction, the enzyme-labeled PCT-Ab2 with a certain concentration is added, and the enzyme-labeled PCT-Ab2 can react with the PCT captured by PCT-Ab1 on the surface of the polystyrene cladding, thus forming a sandwich structure. After washing away the excess unreacted enzyme-labeled PCT-Ab2, the optical fiber probe is inserted into the TMB solution, and the HRP in the complex catalyzes the color development of TMB. The absorbance intensity is related to the concentration of PCT in the test substance. The schematic diagram of this method is shown in Figure 12.

[0209] The specific process is as follows:

[0210] 2. Preparation of Biomolecule-Modified Optical Fiber

[0211] 1) Assemble the polystyrene cladding onto the sleeve, and then slip on the optical fiber. The outer diameter of the optical fiber is 400 μm, the length is 6 cm, the size of the sleeve 2 is 6 mm in height and 2 mm in width, and there is a through hole with a diameter of 396 μm inside. The material of the cladding 3 is polystyrene; the size of the cladding 3 is 6 mm in height and 5 mm in outer circumference. Four claddings are selected in this method;

[0212] 2) Insert the assembled optical fiber into the 20 μg / mL procalcitonin capture antibody (PCT-Ab1), coat it at 37 °C for 2 hours, and then wash it with PBST;

[0213] 3) Insert the above optical fiber into the BSA solution (5%, w / v), block the non-specific sites at 37 °C for 1 h, then wash it with PBST and store it in the dark at 4 °C.

[0214] 3. Optimization of the Concentration of PCT Capture Antigen

[0215] The concentrations of the PCT capture antibody used for preparing the sensor were 5, 10, 20, 25, 30 μg / mL respectively, the concentration of the enzyme-labeled PCT detection antibody was 10 μg / mL, and the PCT concentrations were 0, 10, 100, 1000, 10000, 100000 pg / mL. The optimal concentration of the PCT capture antibody was 20 μg / mL.

[0216] 3. Optimization of the concentration of the enzyme-labeled PCT detection antibody

[0217] The concentration of the PCT capture antibody used for preparing the sensor was 20 μg / mL, the concentrations of the enzyme-labeled PCT detection antibody were 1, 5, 10, 20, 25 μg / mL, and the PCT concentrations were 0, 10, 100, 1000, 10000, 100000 pg / mL. The optimal concentration of the PCT detection antibody was 10 μg / mL.

[0218] 4. Establishment of the PCT standard curve

[0219] Under the above optimized conditions, a standard curve was established

[0220] 1) Assemble the polystyrene cladding onto the probe, then insert the optical fiber into 20 μg / mL PCT-Ab1, incubate at 37 °C for 2 hours, and wash with PBST;

[0221] 2) Insert the probe into 15 μL of PCT standard solution with different concentrations respectively, react at 37 °C for 30 min, and wash the optical fiber with PBST three times.

[0222] 3) Insert the probe in step 2) into 30 μL of 10 μg / mL enzyme-labeled PCT-Ab2 solution, react at 37 °C for 30 min, and wash the optical fiber with PBST three times.

[0223] 4) Insert the probe into the detection device, add the TMB chromogenic solution for color development, add dilute sulfuric acid to terminate the reaction after color development. Then measure the absorbance value of the solution at 450 nm.

[0224] 5) Use the corresponding value of the PCT concentration as the abscissa and the difference in chemiluminescence intensity between the blank sample and each concentration of PCT as the ordinate to plot the standard curve.

[0225] As Figure 13 shown, the greater the PCT concentration, the greater the difference in absorbance between the blank sample. There is a good linear relationship between the difference in absorbance between the blank sample and the PCT samples with different concentrations and the logarithm of the PCT concentration. The regression equation is y = 0.31x + 0.213, and the correlation coefficient R 2 is 0.99.

[0226] 5. Detection of PCT in human serum

[0227] The standard addition method was used to detect the PCT residue in the serum sample. The detection results are shown in Table 6. The recovery rates are all between 89% - 109%, and the relative standard deviations are all less than 10%. The above results indicate that this method has high accuracy and precision and can be used for the quantitative analysis of PCT in serum samples.

[0228] Table 6 Detection results of PCT in human serum

[0229]

[0230] Example 10 Detection of canine distemper in serum by enzyme-linked immunosorbent assay

[0231] The canine distemper capture antibody was modified on the polystyrene cladding and assembled onto the probe. Then, it was biochemically reacted with the sample containing canine distemper and the enzyme-labeled canine distemper detection antibody. After the reaction, the unreacted enzyme-labeled canine distemper detection antibody was washed away, and the probe was placed in the TMB chromogenic solution containing hydrogen peroxide for reaction. Finally, the canine distemper in the sample was quantitatively analyzed by detecting the absorbance value of the solution after color development. The specific operation of this method is as follows:

[0232] 1) Assemble the polystyrene cladding onto the sleeve, and then insert it into the optical fiber. The outer diameter of the optical fiber is 400μm and the length is 6cm. The size of sleeve 2 is 6mm in height and 2mm in width, with a through-hole of 396μm in diameter inside. The material of cladding 3 is polystyrene; the size of cladding 3 is 6mm in height and 5mm in outer circumference. Four claddings were selected in this method. Then insert the probe into 40μL of 20μg / mL canine distemper - Ab1, incubate at 37°C for 2 hours, and wash with PBST; insert the above optical fiber into the BSA solution (5%, w / v) to block non-specific sites at 37°C for 1 hour, then wash with PBST and store in the dark at 4°C.

[0233] 2) Insert the probe into 15μL of canine distemper negative and positive sample solutions respectively, react at 37°C for 30min, and wash the optical fiber 3 times with PBST.

[0234] 3) Insert the probe in step 2) into the enzyme-labeled canine distemper - Ab2 solution, react at 37°C for 30min, and wash three times with PBST.

[0235] 4) Insert the above probe into the TMB chromogenic solution for color development. After color development, add dilute sulfuric acid to terminate the reaction. Then measure the absorbance value of the solution at 450nm.

[0236] Table 7 Canine distemper detection results

[0237]

[0238] As can be seen from Table 7, when this method is used to detect canine distemper negative and positive samples, the difference in absorbance between negative samples and positive samples is relatively large. Therefore, this method can be applied to the detection of canine distemper in serum.

[0239] Detection of deoxynivalenol in grains by the enzyme-linked immunosorbent assay method in Example 11

[0240] In the national standard GB2761-2011 of our country, the limited standard of deoxynivalenol DON in grains and grain products (including corn, corn flour, barley, wheat, oatmeal and wheat flour) is 1000 μg / kg. Therefore, 2 polystyrene claddings are assembled onto the probe and modified with the complete antigen of deoxynivalenol. Then, biochemical reactions are carried out with the sample containing deoxynivalenol and the enzyme-labeled deoxynivalenol antibody. The complete antigen of deoxynivalenol on the cladding surface and the deoxynivalenol in the sample compete for the enzyme-labeled deoxynivalenol antibody. Deoxynivalenol first binds to the enzyme-labeled antibody, occupying the reaction site, and the remaining enzyme-labeled antibody then binds to the complete antigen of deoxynivalenol on the cladding surface. After the reaction, the unreacted enzyme-labeled deoxynivalenol antibody is washed away, and the probe is placed in the TMB chromogenic solution containing hydrogen peroxide for reaction. Finally, the deoxynivalenol in the sample is quantitatively analyzed by detecting the absorbance value of the solution after color development ( Figure 14 ). The specific operation of this method is as follows:

[0241] 1) Assemble the polystyrene cladding onto the sleeve, and then put it on the optical fiber. The outer diameter of the optical fiber is 400 μm and the length is 6 cm. The size of sleeve 2 is 6 mm in height and 2 mm in width, with a through hole of 396 μm in diameter inside. The material of cladding 3 is polystyrene; the size of cladding 3 is 6 mm in height and 5 mm in outer perimeter. Two claddings are selected in this method. Then insert the probe into 40 μL of 20 μg / mL deoxynivalenol complete antigen solution, incubate at 37 °C for 2 hours and then wash with PBST; insert the above optical fiber into the BSA solution (5%, w / v) to block non-specific sites at 37 °C for 1 hour, then wash with PBST and store in the dark at 4 °C.

[0242] 2) Insert the probe into the solution containing deoxynivalenol and the enzyme-labeled deoxynivalenol antibody, react at 37 °C for 30 min, and wash the optical fiber 3 times with PBST.

[0243] 3) Insert the above probe into the TMB chromogenic solution for color development, add dilute sulfuric acid to terminate the reaction after color development. Then measure the absorbance value of the solution at 450 nm.

[0244] The standard addition method was used to detect deoxynivalenol in grains. The detection results are shown in Table 8, and the recovery rates are all between 87% and 108%, and the relative standard deviations are all less than 10%. The above results indicate that this method has high accuracy and precision and can be used for the quantitative analysis of deoxynivalenol in grains.

[0245] Table 8 Detection Results of Deoxynivalenol in Grains

[0246]

[0247] Example 12 Detection of Procalcitonin in Blood by Fluorescence Immunoassay Method

[0248] The polystyrene cladding was assembled onto the sleeve and then the optical fiber was inserted. The procalcitonin capture antibody (PCT-Ab1) was directly modified on the polystyrene cladding on the surface of the optical fiber through the action of hydrophobic groups. Then, the procalcitonin in the sample to be tested, as well as the procalcitonin detection antibody (FMs-PCT-Ab2) modified with fluorescent microspheres, were subjected to a sandwich immunoassay with this optical fiber. The PCT present in the sample specifically reacts with the modified PCT-Ab1. After the reaction, FMs-PCT-Ab2 with a certain concentration was added. FMs-PCT-Ab2 can react with the PCT captured by PCT-Ab1 on the surface of the polystyrene cladding, thus forming a sandwich structure. After washing away the excess unreacted FMs-PCT-Ab2, an excitation light source was applied to this optical fiber, causing the fluorescent microspheres to change from the ground state to the excited state. When it returns from the excited state to the ground state, a fluorescent signal will be generated, and the signal intensity is related to the concentration of PCT in the analyte. The principle of this method is as Figure 15 shown.

[0249] The specific process is as follows:

[0250] 1) The polystyrene cladding was assembled onto the sleeve and then the optical fiber was inserted. The outer diameter of the optical fiber is 400 μm and the length is 6 cm. The size of the sleeve 2 is 6 mm in height and 2 mm in width, with a through-hole of 396 μm in diameter inside. The material of the cladding 3 is polystyrene; the size of the cladding 3 is 6 mm in height and 5 mm in outer circumference. Four claddings were selected in this method. Then the optical fiber was inserted into 20 μg / mL PCT-Ab1 and incubated at 37 °C for 2 h and then washed with PBST;

[0251] 1) The optical fiber was inserted into 15 μL of PCT standard solution with different concentrations respectively and reacted at 37 °C for 30 min, and the optical fiber was washed 3 times with PBST.

[0252] 2) The optical fiber in step 1) was inserted into 30 μL of 10 μg / mL FMs-PCT-Ab2 solution and reacted at 37 °C for 30 min, and the optical fiber was washed three times with PBST.

[0253] 3) Apply an excitation light source with an ultraviolet excitation wavelength of 365 nm to the optical fiber and measure the fluorescence intensity generated thereby.

[0254] 4) Using the PCT concentration corresponding value as the abscissa and the difference in fluorescence intensity between the blank sample and each concentration of PCT as the ordinate, plot a standard curve.

[0255] As Figure 16 shown, the greater the PCT concentration, the greater the difference in fluorescence intensity from the blank sample. There is a good linear relationship between the difference in chemiluminescence intensity between the blank sample and PCT samples at different concentrations and the logarithm of the PCT concentration. The regression equation is y = 0.338x + 0.151, and the correlation coefficient R 2 is 0.99.

[0256] 1. Detection of PCT in human serum

[0257] The standard addition method was used to detect the PCT residue in the serum sample. The detection results are shown in Table 9. The recovery rates are all between 82% - 105%, and the relative standard deviations are all less than 10%. The above results indicate that this method has high accuracy and precision and can be used for the quantitative analysis of PCT in serum samples.

[0258] Table 9 Detection results of PCT in human serum

[0259] SEQUENCE LISTING <110> Huazhong Agricultural University <120> Immune Sensor with Adjustable Linear Range Based on Self-Assembled Cladding, Signal Amplification System, and Its High-Throughput Matching Equipment and Applications <130> 9 <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <400> 1 gaagacaccc taccaacccc cccctaaacc 30 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <400> 2 ttattttatt 10 <210> 3 <211> 42 <212> RNA <213> Artificial sequence <400> 3 uaauuucuac uaaguguaga uggggggggu ugguagggug uc 42

Claims

1. An immunosensor with an adjustable linear range based on a self-assembled cladding layer, characterized in that: The sensor is such that a sleeve (2) is provided outside an optical fiber (1), and a plurality of claddings (3) modified with biorecognition molecules are provided on the sleeve (2). There are a plurality of the claddings (3), and the side surface of the cladding (3) is in a convex lens structure. Different numbers of claddings are assembled according to different requirements for the sensitivity of different target substances. The optical fiber (1) is used for chemiluminescence method, fluorescence analysis method or enzyme-linked immunosorbent assay. When used for enzyme-linked immunosorbent assay, the optical fiber can be replaced with an iron vertical bar or a plastic rod.

2. The immunosensor with adjustable linear range based on self-assembled cladding according to claim 1, characterized in that: The claddings are installed in a diagonal direction.

3. The immunological sensor with adjustable linear range based on a self-assembled cladding according to claim 1, characterized in that: The optical fiber (1) is a quartz optical fiber; the sleeve (2) is made of a light-transmitting material, is columnar, has a size of 3 - 8 mm in height and 1 - 3 mm in width, and has a through hole with a diameter of 380 - 400 μm inside. The material of the cladding (3) is polystyrene, polyacrylamide, polymethyl methacrylate, polydimethylsiloxane or polyethylene terephthalate; for the cladding (3), the individual size is 3 - 8 mm in height and 3 - 8 mm in outer perimeter. The biorecognition molecule is a capture antibody, a detection antibody or a complete antigen.

4. The immunological sensor with adjustable linear range based on a self-assembled cladding according to claim 1, characterized in that, The steps for modifying the surface of the cladding (3) with biorecognition molecules are as follows: 1) Assemble a corresponding number of claddings on the optical fiber, iron vertical bar or plastic rod according to the requirements of the target substance to be detected, to obtain the assembled optical fiber, iron vertical bar or plastic rod. 2) Incubate the optical fiber, iron vertical bar or plastic rod assembled in step 1) in a solution containing biorecognition molecules, and wash with PBST solution. 3) Place the optical fiber, iron vertical bar or plastic rod processed in step 2) in bovine serum albumin for blocking operation, and finally the surface of the polystyrene cladding is modified with biorecognition molecules.

5. Use of the sensor according to any one of claims 1-4 in the detection of various targets by combining chemiluminescence method or fluorescence immunoassay method or enzyme-linked immunosorbent assay with a CRISPR-Cas12a signal amplification system, characterized in that: The target substances include mycotoxins, pathogenic microorganisms, antibiotics, agricultural and veterinary drugs or disease markers.

6. The application according to claim 5, characterized in that: When detecting the target substance in a sample by chemiluminescence method, when the concentration of the target substance to be detected is pg / mL - mg / mL, the detection includes the following steps: S1: Select different numbers of claddings for assembly according to the concentration of the target substance to be detected. When the target substance concentration is 1 μg / mL - 1 mg / mL, the number of assembled claddings is 2; when the target substance concentration is 1 ng / mL - 1 μg / mL, the number of claddings is 4; when the target substance concentration is 100 pg / mL - 1 ng / mL, the number of claddings is 6; when the target substance concentration is 1 pg / mL - 100 pg / mL, the number of claddings is 8; after assembly, insert the optical fiber. S2: Directly modify a biorecognition molecule a on the cladding on the surface of the optical fiber, and perform an immune reaction with the solution containing the target substance to be detected and an enzyme-labeled biorecognition molecule b. The enzyme is horseradish peroxidase (HRP enzyme) or alkaline phosphatase (ALP enzyme), and the biorecognition molecule a matches the biorecognition molecule b to form a complex. S3: The complex catalyzes the chemiluminescent substrate, and measures the chemiluminescence intensity to complete the quantitative analysis of the target substance.

7. The application according to claim 5, wherein: When detecting the target substance in a sample by chemiluminescence method, when the concentration of the target substance to be detected is pg / mL and lower, use the CRISPR-Cas12a signal amplification system, including the following steps: S1.1: Take two sleeves, and assemble 8 polystyrene convex lens claddings for each sleeve. Assemble them in the up-down direction to form Kit A and Kit B, which are used for immune reaction and catalytic chemiluminescent substrate respectively; S2.1: Couple the corresponding biorecognition molecule a on the surface of Kit A, modify ssDNA1 on the biorecognition molecule b to obtain biorecognition molecule b-modified ssDNA1, couple streptavidin on the surface of Kit B, and couple it with biotinylated ssDNA2-enzyme to obtain Kit B-SA-bio-ssDNA2-enzyme. The enzyme is HRP enzyme or ALP enzyme or nanoenzyme. After the modification is completed, assemble Kit A and Kit B onto the optical fiber; S3.1: The Kit A coupled with biorecognition molecule a and the Kit B modified with ssDNA2-enzyme are first mixed with the test solution containing the target for reaction, and then reacted with biorecognition molecule b-modified ssDNA1; S4.1: React the optical fiber processed in step S3.1 with the Cas12a-RNA solution, insert the optical fiber into the chemiluminescent substrate, measure the chemiluminescent intensity, and realize the quantitative detection of the target.

8. The application according to claim 7, characterized in that: The ssDNA1 has the nucleotide sequence shown in SEQ ID NO.1; ssDNA2 has the nucleotide sequence shown in SEQ ID NO.2; the RNA in Cas12a-RNA has the nucleotide sequence shown in SEQ ID NO.3; the biorecognition molecule a and the biorecognition molecule b are matched, and the biorecognition molecule a and the biorecognition molecule b are capture antibody and detection antibody, detection antibody and capture antibody, or antigen and antibody.

9. The application according to claim 5, characterized in that, Detect the target in the sample by fluorescence immunoassay, including the following steps: Step 1: After modifying the biorecognition molecule a on the polystyrene cladding, react it with the solution containing the test target; Step 2: React the solution from Step 1 with the biorecognition molecule b modified with fluorescently encoded microspheres; the target in the test solution undergoes an immune reaction with the biorecognition molecule a on the cladding and the biorecognition molecule b modified with fluorescently encoded microspheres in the solution to form a complex, and the excess biorecognition molecule b modified with fluorescently encoded microspheres is washed; Step 3: Under the irradiation of ultraviolet excitation light, the fluorescent microspheres generate fluorescent signals. The fluorescently encoded microspheres in the complex are related to the fluorescent signal intensity, and quantitative analysis is performed on it; Detect the target in the sample by enzyme-linked immunosorbent assay, including the following steps: (1) Through electrostatic adsorption, modify the biorecognition molecule a on the polystyrene cladding on the optical fiber, and then successively perform biorecognition reactions with the solution containing the test target and the solution of the biorecognition molecule b labeled with horseradish peroxidase to obtain a reaction mixture; (2) Immerse the obtained reaction mixture in the TMB chromogenic solution containing hydrogen peroxide; (3) By detecting the absorbance value, establish a quantitative curve between the target concentration and the absorbance value, so as to realize the quantitative analysis and detection of the target; In the above enzyme-linked immunosorbent assay, the optical fiber can also be replaced with a wooden strip or an iron strip or a steel strip.

Citation Information

Patent Citations

  • Optical fiber biosensor probe, preparation method and application thereof

    CN101750483A