Method for preparing double-stranded RNA

Abstract

The present invention relates to an isolated nucleotide sequence comprising: a) cDNA of two strands of a target double-stranded RNA (dsRNA), separated by an autocatalytic intron flanking exon fragments, and b) a plant viroid, wherein element (a) is inserted into the plant viroid sequence. The expression of this nucleotide sequence together with a tRNA ligase in a host cell (such as E. coli) allows the production of large amounts of dsRNA specific for a target gene. This dsRNA can be used in interference RNA technology to silence gene expression. In addition, the present invention also relates to a method for preparing said dsRNA.

Description

Technical Field

[0001] The present invention relates to a nucleotide sequence comprising: a) cDNA of two strands of a target double-stranded RNA (dsRNA), separated by autocatalytic introns flanking exons, and b) a plant viroid, wherein element (a) is inserted into the plant viroid sequence. The expression of this nucleotide sequence together with a tRNA ligase in a host cell (such as Escherichia coli) allows the production of large amounts of dsRNA specific for a target gene. This dsRNA can be used in interfering RNA technology to silence gene expression. Furthermore, the present invention belongs to the field of biotechnology, in particular to the field of preparation of recombinant RNA. Background Art

[0002] Gene silencing mediated by RNA or RNA interference (RNAi) is a natural defense mechanism against exogenous (e.g., viruses) and endogenous (e.g., transposons) genetic elements that has evolved in most eukaryotic organisms to become an important mode of regulation of gene expression. RNAi is triggered by the presence of double-stranded RNA (dsRNA) and has the end result of silencing or inhibiting the homologous messenger RNA (mRNA). Very simply put, dsRNA is processed by the Dicer endonuclease to produce small RNAs (sRNAs), which are recognized by the RNase H Argonaute (Ago), which carries one strand of the sRNA to form an RNA-induced silencing complex (RISC). In the cell, this complex tracks its target RNA based on the complementarity of the sRNA, and when it finds it, it cuts it, inactivates it, or joins it, thereby inhibiting its translation. In some taxa, such as nematodes or plants, RNA-dependent RNA polymerase (RDR) activity uses the sRNA as a primer to produce more homologous dsRNA, which feeds the cycle from the beginning and amplifies the interference signal.

[0003] RNAi can be efficiently induced by the administration of exogenous RNA, so it has been widely used in basic research to study gene function in many classes of organisms. At the same time, its conceptual simplicity (highly specific gene inhibition based on simple base complementarity) has led to the development of numerous promising biotechnological applications. One of these is the use of RNA against pests: the ingestion of dsRNA by nematodes, insects and other arthropods induces silencing of endogenous homologous genes, leading to their death or affecting their development, mobility or feeding behavior, in any case reducing the damage they cause. dsRNA-induced silencing has also been demonstrated in pathogens such as viruses and fungi. In this way, RNA, an environmentally benign natural compound, has become a promising agent against pests and pathogens. In addition, its mechanism of action based on base complementarity makes it highly specific and easily adaptable to any new species or pest lineage or emerging pathogen. Its application in crops has attracted great interest, but its potential goes beyond agricultural biotechnology.

[0004] However, biotechnological applications of dsRNA require systems that can rapidly and economically produce large quantities of such compounds. Classical strategies for RNA production based on chemical synthesis or in vitro transcription are not feasible due to their cost and yield. The most logical alternative is to produce dsRNA in biofactory systems, such as bacterial cultures, such as Escherichia coli.

[0005] Patent application WO 2015 / 177100 discloses the production of RNA by co-expressing a tRNA ligase and a chimeric RNA molecule comprising a target RNA and a plant viroid scaffold in a host cell. This co-expression results in the production of a large number of chimeric RNA molecules in the host cell and can be useful in the production of, for example, RNA aptamers and other RNA molecules. Recently, a system based on viroid biological elements has been developed that can produce a large amount of recombinant RNA in Escherichia coli (Daros et al., 2018. Sci. Rep. 8: 1904).

[0006] Viroids are a class of plant infectious agents that consist only of relatively small noncoding circular RNAs (246-401 nucleotides, in species known so far). Despite not encoding its own proteins, viroid RNAs manage to replicate themselves and move around the plant, for which it must recruit proteins and exploit the host's cellular structures. Daros et al. 2018 (cited in adsupra) disclose a system for producing recombinant RNA in E. coli, based on the co-expression of RNA from Eggplant latent viroid (ELVd), containing the RNA of interest, and the chloroplast isoform of eggplant (Solanum melongena L.) tRNA ligase, an enzyme that mediates this viral cycle in infected plants. ELVd does not replicate in E. coli. However, when a precursor containing it is transcribed, its hammerhead ribozyme produces a linear monomer that is inserted into the RNA of interest. This monomer is recognized and circularized by the tRNA ligase. The resulting product is a hybrid molecule consisting of a highly structured viroid scaffold, on which the RNA of interest is presented, which accumulates in large quantities in bacterial cells due to its circularity and the formation of a ribonucleoprotein complex with the tRNA ligase. Using this system, approximately 100 mg of RNA aptamers and other structured RNAs were produced per liter of culture. However, due to the known instability of inverted DNA repeats in E. coli, this system proved from the outset incapable of producing large amounts of dsRNA, a molecule necessary to induce gene silencing in pests and pathogens. Therefore, there remains a need to develop methods and processes that allow the production of large amounts of dsRNA, overcoming the shortcomings of the systems already available in the prior art. SUMMARY OF THE INVENTION

[0008] Due to the use of autocatalytic introns in E. coli, the present invention allows overcoming the limitations of the prior art described above and producing large quantities of dsRNA that can be used to combat pests and pathogens. In addition, using these same autocatalytic intron replacements, the dsRNA of interest can be cleaved from its transcribed viroid scaffold, thereby producing pure circular dsRNA molecules without viroid residues.

[0009] To address the instability of inverted DNA repeats in E. coli, the repeats were separated by a cDNA corresponding to the group I intron of the 26S ribosomal RNA (rRNA) of the granular cilia Tetrahymena termophila (order Hymenostomatia). Since this intron is autocatalytic and requires only guanosine nucleosides for its processing, once the transcript is expressed in E. coli, the intron cleaves itself with extraordinary efficiency and forms a dsRNA hairpin closed by a 20-nucleotide loop corresponding to two 10-nucleotide-long fragments of the exon flanking the intron. Thus, in the culture of E. coli, large amounts of a hybrid circular molecule consisting of the ELVd scaffold on which the insecticide dsRNA hairpin is located ( Figure 1 ).

[0010] Using this system, 100 bp double-stranded RNAs targeting essential genes of insect pests were generated and their insecticide activity was demonstrated. However, it is understood that the commercial potential of this technology may be limited by the presence of viroid-derived residues in the target dsRNA molecules.

[0011] To eliminate the virus-like part, a new element consisting of a replaced intron-exon sequence was added to the system ( Figure 2 When the group I intron is divided into two parts, the first part is fused to the second part, and the self-cleavage reaction continues at the boundary between exon 1 and the 5' end of the intron, and continues from the 3' end of exon 1 to the boundary between the 3' end of the intron and exon 2, self-catalyzing the generation of a circular RNA molecule formed by two exons ( Figure 3 In this way, the viroid part ( Figure 4 ) from the final dsRNA product ( Figure 3 ) is completely removed.

[0012] In summary, the present invention allows the production of large amounts of dsRNA in E. coli. To this end, the cDNAs of the two strands of the dsRNA are inserted into the cDNA of the viroid and separated by the cDNA of the type I intron. The co-expression of the resulting RNA with the eggplant tRNA ligase in E. coli produces a large accumulation of hybrid molecules in which the dsRNA is fused to the viroid. The autocatalytic intron disappears during precursor processing. In addition, if a displaced type I intron is added to the construct, the circular form of the target dsRNA can be separated from the viroid molecule.

[0013] In view of the foregoing, in one aspect, the present invention relates to an isolated nucleotide sequence comprising:

[0014] a) cDNAs for the two strands of the target dsRNA, separated by an autocatalytic intron flanked by exons or exon fragments, and

[0015] b) plant viroid sequences,

[0016] Wherein element (a) is inserted into the plant viroid sequence.

[0017] In addition, in another aspect of the invention, the present invention relates to a method for preparing a dsRNA specific for a target gene, comprising co-expressing in a host cell:

[0018] a) a nucleotide sequence according to the above aspects, and

[0019] b) a nucleotide sequence encoding a tRNA ligase,

[0020] The nucleotide sequences of a) and b) are in the same or different nucleic acid molecules. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The production of dsRNA in E. coli is shown, with the system derived from ELVd using the autocatalytic intron of T. termophila to separate the inverted repeats.

[0023] Figure 2 Schematic diagram of the intron-exon replacement strategy (IEP) and the group I intron self-cleavage reaction, which results in the ligation of exons and circularization of dsRNA.

[0024] Figure 3 It refers to a circular double-stranded miniRNA with an extensive fully double-stranded region homologous to an endogenous gene of a target pest or pathogen, which is closed on both sides by fragments of exons.

[0025] Figure 4 The sequence and predicted structure of the minimum free energy of Eggplant latent viroid (ELVd; GenBank Accession No. AJ536613.1 (SEQ ID NO: 7) are shown. The hammerhead ribozyme domain and the self-cleavage site are indicated by a grey background and arrow, respectively. The position U245-U246 where the recombinant RNA was inserted is indicated by an arrow.

[0026] Figure 5 1% agarose gel stained with ethidium bromide, in which the electrophoretic migration of empty plasmid pLELVd (lane 2) is compared with that of five independent pLELVd-β-actin clones (lanes 3 to 7). Lane 1 corresponds to the ladder of DNA markers, whose sizes in base pairs (bp) are indicated on the left.

[0027] Figure 6is a 5% polyacrylamide gel containing 8 M urea, stained with ethidium bromide, in which total E. coli RNA preparations were analyzed. Lanes 1 to 4 correspond to E. coli clones transformed with empty pLELVd, lane 5 corresponds to the ladder of RNA markers, whose nucleotide (nt) sizes are shown on the left, and lanes 6 to 7 correspond to E. coli clones transformed with pLELVd-β-actin. White, gray, and black arrows point to ELVdRNA, ELVd-dsRNA-β-actin, and spliced ​​intron RNA, respectively.

[0028] Figure 7 Two 5% polyacrylamide gels, the second containing 8M urea and stained with ethidium bromide. Total RNA preparations from E. coli clones transformed with pLELVd-β-actin were separated in the first gel (left) under non-denaturing conditions. After staining the gel, the band indicated by the arrow was cut from the gel and applied to the second gel (right) run under denaturing conditions. The arrow on the right points to the spliced ​​circular dsRNA, which is also schematically shown. Both gels contain RNA markers on the left.

[0029] Figure 8 RNA from E. coli clones was co-transformed with plasmids to produce dsRNA, with or without the ELVd scaffold and with or without tRNA ligase, purified and analyzed by PAGE and ethidium bromide staining as indicated. Recombinant dsRNA accumulation was quantified (in arbitrary units of fluorescence) using an image analyzer. Normalized mean fluorescence was plotted. Error bars represent standard deviations (n=5).

[0030] Fig. 9 RNA from E. coli clones was co-transformed with plasmids to express tRNA ligase, and constructs for expressing different versions of 100-bp dsRNA with different exon sizes were purified and analyzed by denaturing PAGE. The gel was stained with ethidium bromide. Lane 1, RNA marker with size (in nt) on the left; lanes 2 to 5, RNA from constructs with 10, 8, 4, and 2 exons, respectively. Black and gray arrows point to the positions of recombinant dsRNA and spliced ​​introns, respectively. DETAILED DESCRIPTION OF THE INVENTION

[0032] In one aspect, the present invention relates to an isolated nucleotide sequence, hereinafter referred to as "the nucleotide sequence of the present invention", comprising:

[0033] a) cDNAs for the two strands of the target dsRNA, separated by an autocatalytic intron flanked by exons or exon fragments, and

[0034] b) plant viroid sequences,

[0035] Wherein element (a) is inserted into the plant viroid sequence.

[0036] As used herein, the term "double-stranded RNA" or "dsRNA" refers to an RNA molecule comprising two nucleic acid strands containing sequences complementary to each other, wherein one strand is referred to as the sense strand (direction 5'-3') and the other is referred to as the antisense strand (direction 3'-5'). Thus, the nucleotide sequence of the present invention comprises an inverted repeat sequence comprising the sense strand and the antisense strand of the target RNA, separated by an intervening sequence comprising a group I intron, which is flanked by an exon or exon fragment.

[0037] As used herein, the term "target dsRNA" is a dsRNA that can induce the silencing of the expression of a specific target gene with homology thereto. In the context of the present invention, two nucleotide sequences are considered to have homology when the sequence identity between them is at least 75% by their optimal alignment. The following discloses a tool for determining the sequence identity between two nucleotide sequences. Any dsRNA molecule that needs to be generated in large quantities can be used as a target dsRNA. The target dsRNA can be non-naturally occurring. Suitable target dsRNAs can include sequences of up to 100 bases, up to 200 bases, or up to 300 bases or more. Preferably, the target dsRNA is not derived from a plant viroid and is not naturally associated with a plant viroid sequence (i.e., the target dsRNA is heterologous). Examples of specific target genes include, but are not limited to, the target genes shown in Table 1.

[0038]

[0039]

[0040] Table 1. Target genes for combating pests and pathogens

[0041] In a specific embodiment, the target dsRNA is the gene beta-actin from Ceratitis capitata (Diptera: Tephritidae). In a more specific embodiment, the cDNA sequence of the sense strand of the target dsRNA comprises or consists of a nucleotide sequence having at least 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% sequence identity to SEQ ID NO: 1. In a more specific embodiment, the cDNA sequence of the sense strand of the target dsRNA comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 1. In another specific embodiment, the cDNA sequence of the antisense strand of the target dsRNA comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 1. In a more specific embodiment, the cDNA sequence of the antisense strand of the target dsRNA comprises or consists of a nucleotide sequence having at least 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% sequence identity. In a more specific embodiment, the cDNA sequence of the sense strand of the target dsRNA comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO:2.

[0042] SEQ ID NO:1

[0043]

[0044] SEQ ID NO:2

[0045]

[0046] As used herein, the term "sequence identity" refers to the degree of similarity between two nucleotide (or amino acid) sequences obtained by optimal alignment of the two sequences. The degree of identity expressed as a percentage will be obtained based on the number of common residues in the aligned sequences. The degree of identity between two nucleotide (or amino acid) sequences can be determined by conventional methods, for example, standard sequence alignment algorithms known in the art, such as BLAST [Altschul SF et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215 (3): 403-10]. BLAST programs, such as BLASTN, BLASTX and TBLASTX, BLASTP and TBLASTN are part of the public domain on the website of the National Center for Biotechnology Information (NCBI). Specific nucleotide sequence variants can be different from the reference sequence by insertion, addition, substitution or deletion of 1 base, 2, 3, 4, 5-10, 10-20, 20-30 or more bases.

[0047] The cDNA of the two chains of the target dsRNA in the nucleotide sequence of the present invention is separated by an autocatalytic intron flanking an exon or an exon fragment. As used herein, the term "autocatalytic intron" refers to a self-splicing intron that can be removed from the nucleotide sequence without the action of a spliceosome. Self-splicing introns are divided into three types: type I, type II, and type III. Any of them can be used in the present invention. Therefore, in a specific embodiment of the nucleotide sequence of the present invention, the autocatalytic intron is a type I autocatalytic intron, a type II autocatalytic intron, or a type III autocatalytic intron.

[0048] Type I introns (or group I) are a large class of self-splicing ribozymes that catalyze their own excision from RNA precursors. They perform two consecutive transesterification reactions. The core structure consists of nine pairs of regions (P1-P9). Exogenous guanosine or guanosine nucleotides (exoG) first dock on the active G binding site in P7, and its 3'-OH is aligned to attack the phosphodiester bond located at the 5' splice site in P1. This results in a free 3'-OH group at the upstream exon, while exoG is attached to the 5' end of the intron. Then, the terminal G (omega G) of the intron replaces exoG and occupies the G binding site to organize the second transesterification reaction. In this reaction, the 3'-OH group of the upstream exon of P1 is aligned to attack the 3' splice site in P10, resulting in the connection of adjacent upstream and downstream exons and the release of the catalytic intron. Examples of type I introns include, but are not limited to, type I autocatalytic introns from rRNA 26S of Tetrahymena termophila, Ankistrodesmus stipitatus LSU rRNA intron, Saccharomyces cerevisiae LSU rRNA mitochondrial intron, or Podospora anserina mitochondrial alipocytochrome b intron.

[0049] Type II introns (Group II) are a large class of self-splicing ribozymes and mobile genetic elements in which, unlike Group I introns, excision occurs in the absence of guanosine nucleotides and forms a lasso structure. The lasso contains an A residue branch point, similar to the branch point found in the lasso formed during nuclear pre-mRNA splicing. The secondary structure of Group II introns is characterized by six typical stem-loop structures, domains I to VI (DI to DVI, or D1 to D6). The domains radiate from a central core that brings the 5' and 3' splice sites into proximity. The proximal helical structures of the six domains are connected by a few nucleotides in the central region.

[0050] Group III introns (group III) are a class of self-splicing ribozymes with a conventional group II-type DVI with a bulged adenosine, a streamlined DI, no DII-DV, and a relaxed splice site consensus. Splicing is accomplished by two transesterification reactions, with the DVI bulged adenosine acting as the initiating nucleophile. Introns are also excised as a lariat.

[0051] In a more specific embodiment of the nucleotide sequence of the present invention, the autocatalytic intron is a type I autocatalytic intron. In a more specific embodiment, the type I autocatalytic intron is a type I autocatalytic intron of rRNA 26S from Tetrahymena termophila (GenBank accession number V01416.1 [SEQ ID NO: 23]) or a fragment thereof having autocatalytic activity. The term "fragment" refers to a nucleotide sequence lacking one or more (e.g., several) nucleotides at the 5' and / or 3' end of a reference nucleotide sequence, wherein the fragment encodes a protein sequence having the same activity as the reference nucleotide sequence, and is therefore a functionally equivalent fragment. In a more specific embodiment, the type I autocatalytic intron of rRNA 26S from T. termophila comprises or consists of a nucleotide sequence having at least 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% sequence identity with SEQ ID NO: 3. In a more specific embodiment, the autocatalytic intron comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO:3.

[0052] SEQ ID NO:3

[0053]

[0054] In the present invention, the autocatalytic intron is flanked by exons or exon fragments, which may be from the same or different microorganisms as the autocatalytic intron. The term "fragment" has been defined above. In a specific embodiment, the autocatalytic intron and the exon (or exon fragment) are from the same microorganism, in particular, the microorganism is T.termophila. Similarly, relative to the autocatalytic intron, the exons (or exon fragments) at the 5' and 3' positions may be from the same or different microorganisms. In a more specific embodiment, the exon (or exon fragment) at the 5' position of the autocatalytic intron comprises or consists of the sequence SEQ ID NO:4 and / or the exon (or exon fragment) at the 3' position of the autocatalytic intron comprises or consists of the sequence SEQ ID NO:5.

[0055] SEQ ID NO:4–

[0056] SEQ ID NO:5-

[0057] Thus, in a more specific embodiment, the autocatalytic intron flanked by an exon (or exon fragment) comprises or consists of the sequence SEQ ID NO: 6, wherein the exon is underlined.

[0058] SEQ ID NO:6

[0059]

[0060] The nucleotide sequences of the present invention also include plant viroid sequences. The plant viroid sequence is considered to be the scaffold of the nucleotide sequence of the present invention, and the remaining components (cDNA of the two chains of dsRNA, separated by the self-catalytic introns flanking the exons) are inserted thereon. As used herein, the term "plant viroid" refers to the smallest known infectious pathogen, which contains only a short chain of circular single-stranded RNA without protein coating. The viroid replication mechanism uses the host cell enzyme RNA polymerase II or chloroplast RNA polymerase, which catalyzes the "rolling circle" synthesis of new RNA using viroid RNA as a template. Taxonomically, plant viroids are divided into two families: the Pospiviroidae family, including the genera Pospiviroid, Hostuviroid, Cocadviroid, Apscaviroid and Coleviroid; and the Avsunviroidae family, including the genera Avsunviroid, Pelamoviroid and Elaviroid. Any viroid belonging to one of these families can be used in the context of the present invention. Examples of viroids include, but are not limited to, Potato spindle tuber viroid (PSTVd), Citrus exocortis viroid (CEVd), Chrysanthemum chlorotic mottle viroid (CChMVd), Hop stunt viroid (HSVd), Peach latent mosaic viroid (PLMVd), Coconut cadang-cadang viroid (CCCVd), Apple scarskin viroid (ASSVd), Coleus blumei viroid 1 (CbVd-1), Avocado sunblotch viroid (ASBVd), Peach latent mosaic viroid (PLMVd) and Eggplant latent viroid (ELVd). In the case where the plant viroid sequence used in the present invention does not contain a hammerhead ribozyme domain, i.e. it belongs to the family Pospiviroidae, the enzyme responsible for viroid strand scission is co-expressed with the plant viroid, or the nucleotide sequence of the present invention is expressed in a host cell containing said enzyme. Alternatively, if the plant viroid sequence used in the present invention contains a hammerhead domain, i.e., belongs to the family Avsunviroidae, then two functional hammerhead domains, one on each side of the plant viroid sequence, must be added to the plant viroid sequence, duplicating the hammerhead domain of the plant viroid. In a specific embodiment, the plant viroid sequence contains a hammerhead ribozyme domain.In another specific embodiment, the plant viroid sequence is an ELVd sequence, an ASBVd sequence, a PLMVd sequence or a CChMVd sequence.

[0061] The plant viroid sequence may include all or part of the plant viroid. The full-length (333 nt) genomic sequence of ELVd is publicly available under GenBank accession number AJ536613.1GI:29825431 (SEQ ID NO:7). The sequence and structure of ELVd are as follows Figure 4 The hammerhead ribozyme region of ELVd corresponds to nucleotides 327 to 46 (positive) and nucleotides 153-203 (negative).

[0062] SEQ ID NO:7

[0063] 1 GGGTGGTGTG TGCCACCCCT GATGAGACCG AAAGGTCGAA ATGGGGTTTC GCCATGGGTC

[0064] 61 GGGACTTTAA ATTCGGAGGA TTCGTCCTTT AAACGTTCCT CCAAGAGTCC CTTCCCCAAA

[0065] 121 CCCTTACTTT GTAAGTGTGG TTCGGCGAAT GTACCGTTTC GTCCTTTCGG ACTCATCAGG

[0066] 181 GAAAGTACAC ACTTTCCGAC GGTGGGTTCG TCGACACCTC TCCCCCTCCC AGGTACTATC

[0067] 241 CCCTTTCAAG GATGTGTTCC CTAGGAGGGT GGGTGTACCT CTTTTTGGATT GCTCCGGCCT

[0068] 301 TCCAGGAGAGATAGAGGACGACCTCTCCCCATA

[0069] The full-length (247 nt) genomic sequence of ASBVd is publicly available under GenBank Accession No. NC_001410.1 GI:11496574 (SEQ ID NO:8).

[0070] SEQ ID NO:8

[0071] 1 TTTATTAGAA CAAGAAGTGA GGATATGATT AAACTTTGTT TGACGAAACC AGGTCTGTTC

[0072] 61 CGACTTTCCG ACTCTGAGTT TCGACTTGTG AGAGAAGGAG GAGTCGTGGT GAACTTTTAT

[0073] 121 TAAAAAAATT AGTTCACTCG TCTTCAATCT CTTGATCACT TCGTCTCTTC AGGGAAAGAT

[0074] 181 GGGAAGAACA CTGATGAGTC TCGCAAGGTT TACTCCTCTA TCTTCATTGT TTTTTTACAA

[0075] 241 AATCTTG

[0076] The full-length (399 nt) genomic sequence of CChMVd is publicly available under GenBank accession number NC_003540.1 GI:20095240 (SEQ ID NO:9).

[0077] SEQ ID NO:9

[0078] 1 GGCACCTGAC GTCGGTGTCC TGATGAAGAT CCATGACAGG ATCGAAACCT CTTCCAGTTT

[0079] 61 CGGCTTGTGT GGGAGTAAAG CTTTCGCTCT CTCCACAGCC TCATCAGGAA ACCCACTTCA

[0080] 121 GGTCTCGACT GGAAGGTCGT TAAACTTCCC CTCTAAGCGG AGTAGAGGTA AATACCTCCG

[0081] 181 TCCAACCCCG GGAGGAAAGG GGTTGGGACC CGGAACAGAT CCAGTTCCGG TCCTTTGGAG

[0082] 241 TCCATTTCTC TCGTTGGATA TTCTCCTCGG AGAAGGGAGA TGGGGCCAGT CCCAGTCGGT

[0083] 301 TCGCTCTCGT AGTCACAGCC ACTGGGGAAC CTAGGCAGAT GGCTGGACGG AGTCTTAGTC

[0084] 361 CACTCCAGAG GACCTTGGGT TTGAAAACCCC CAAGAGGTC

[0085] The full-length (337 nt) genomic sequence of PLMVd is publicly available under GenBank Accession No. NC_003636.1 GI:20177433 (SEQ ID NO: 10). The hammerhead ribozyme region of PLMVd corresponds to nucleotides 282 to 335 (positive) and nucleotides 2-57 (negative).

[0086] SEQ ID NO:10

[0087] 1 GTCATAAGTT TCGTCGCATT TCAGCGACTC ATCAGTGGGC TTAGCCCAGA CTTATGAGAG

[0088] 61 AGTAAAGACC TCTCAGCCCC TCCACCTTGG GGTGCCCTAT TCGGAGCACT GCAGTTCCCG

[0089] 121 ATAGAAAGGC TAAGCACCTC GCAATGAGGT AAGGTGGGAC TTTTCCTTCT GGAACCAAGC

[0090] 181 GGTTGGTTCC GAGGGGGGTG TGATCCAGGT ACCGCCGTAG AAACTGGATT ACGACGTCTA

[0091] 241 CCCGGGATTC AAACCCGTCC CCTCCAGAAG TGATTCTGGA TGAAGAGTCT GTGCTAAGCA

[0092] 301 CACTGACGAGTCTCTGAGATGAGACGAAACTCTCTT

[0093] Variants of the reference plant viroid sequences listed above (e.g., the genomic sequences of ELVd, ASBVd, CChMVd or PLMVd (SEQ ID NOs: 7 to 10, respectively); or truncated forms thereof, as shown above) may comprise or consist of a nucleotide sequence having at least 70, 75, 80, 85, 90, 95, 96, 97, 98, 99% sequence identity with the sequence of the reference plant viroid scaffold.

[0094] In some embodiments, the plant viroid sequence can be a truncation of a full-length plant viroid sequence, such as the full-length plant viroid genomic sequence of any one of SEQ ID NOs: 7 to 10. The plant viroid sequence can include, or consist of, a full-length plant viroid sequence with one or more deletions. The plant viroid sequence can be a synthetic plant viroid sequence that does not exist in nature.

[0095] In a more specific embodiment, the plant viroid sequence comprises an Eggplant latent viroid sequence (ELVd), which in a more specific embodiment comprises or consists of a nucleotide sequence having at least 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% sequence identity to SEQ ID NO: 11. In another specific embodiment, ELVd comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 11.

[0096] SEQ ID NO:11

[0097] CCCCAT GGTGGTGTGTGCCACCCTGATGAGACCGAAAGGTCGAAATGGGG TTTCGCCATGGGTCGGGACTTTAAATTCGGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACCCTTACTTTGTAAGTGTGGTTCGGCGAATGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACTTTCCGACGGTGGGTTCGTCGACACCTCTCCCCCTCCCAGGTACTATCCCCT CAAGGATGTGTTCCCTAGGAGGGGTGGGTGTACCTCTTTTGGATTGCTCCGGCCTTCCAGGAGAGATAGAGGACGACCTCT CCCCAT GGTGGTGTGTGCCACCCCTGATGAGA CCGAAAGGTCGAAATGGGG

[0098] UnderlineHammerhead ribozyme sequence

[0099] The insertion site of an inverted repeat sequence comprising the sense and antisense strands of the target RNA is separated by an insertion sequence comprising a group I intron flanked by an exon or exon fragment.

[0100] Bold: ribozyme cleavage site

[0101] In a specific embodiment of the nucleotide sequence of the present invention, the plant viroid comprises a hammerhead ribozyme domain (motif) or a fragment thereof at the 5' and 3' ends of the plant viroid sequence. As used herein, the term "hammerhead ribozyme domain" is a small self-cleaving RNA that can promote chain breakage by internal phosphate transfer. The term "fragment" has been defined above. Suitable plant viroid sequences may include a hammerhead ribozyme region of a plant viroid, which may be located, for example, at nucleotides 327 to 46 (positive) and nucleotides 153-203 (negative) in ELVd and at corresponding nucleotides in other plant viroids. Standard sequence alignment tools can be used to identify corresponding nucleotides in other plant viroid genomes. In a specific embodiment of the present invention, the hammerhead ribozyme domain at the 5' end comprises nucleotides 1 to 53 of SEQ ID NO:11, and / or the hammerhead ribozyme domain at the 3' end comprises nucleotides 334 to 386 of SEQ ID NO:11.

[0102] The inverted repeat sequence, including the sense and antisense strands of the target RNA, separated by an insertion sequence containing an autocatalytic intron, flanked by exons or exon fragments, can be located anywhere within the plant viroid scaffold as long as it does not disrupt viroid activity. Thus, the inverted repeat sequence can be located at any site between the viroid hammerhead ribozyme domains of the plant viroid sequence. In a more specific embodiment, the insertion site of the inverted repeat sequence is located between nucleotides 252 and 253 of SEQ ID NO: 11.

[0103] In a more specific embodiment, the nucleotide sequence of the present invention comprises or consists of the sequence SEQ ID NO:12.

[0104] SEQ ID NO:12

[0105] CCCCAT GGTGGTGTGTGCCACCCTGATGAGACCGAAAGGTCGAAATGGGG CCCCAT GGTGGTGTGTGCCACCCTGATGAGACCGAAAGGTC GAAATGGGG

[0106] Underline : Hammerhead ribozyme sequences show the ribozyme cleavage site in bold.

[0107] cDNA from ELVd (C327 to G46 from GeneBank Accession No. AJ536613.1; SEQ ID NO: 7), with the insertion site of the inverted repeats comprising the sense and antisense strands of the target RNA double underlined, separated by an insertion sequence comprising an intron type I flanked by exons.

[0108] Italics: 100 bp of the β-actin gene of Ceratitis capitata in sense and antisense orientation.

[0109] 5' and 3' exonic fragments of the autocatalytic intron of the rRNA26S gene of T. thermophila.

[0110] Autocatalytic intron of rRNA26S gene of T. thermophila.

[0111] As disclosed in the preceding paragraph, the nucleotide sequence of the present invention allows those skilled in the art to produce a large amount of dsRNA when it is cloned into a host cell such as Escherichia coli together with a tRNA ligase. Therefore, the coexpression of the nucleotide sequence of the present invention and a tRNA ligase is shown herein to cause the high-level production of dsRNA molecules in a host cell. As known to those skilled in the art, the single-stranded 5'-hydroxyl end of the tRNA ligase catalyzed RNA is covalently linked to the single-stranded 2'-3'-cyclic phosphodiester end of the RNA, thereby forming a circular RNA comprising the dsRNA of interest. The tRNA ligase can be combined with the nucleotide sequence of the present invention to produce a chimeric complex, or can be present in a vector for cloning the nucleotide sequence in a host cell, or can be present in a host cell. In a specific embodiment, the nucleotide sequence of the present invention further comprises a nucleotide sequence encoding a tRNA ligase.

[0112] The tRNA ligase can be a plant tRNA ligase, such as a plant chloroplast or plant nuclear tRNA ligase. Preferably, the tRNA ligase is a plant chloroplast tRNA ligase. The tRNA ligase can be from a eukaryotic organism other than a plant. Suitable tRNA ligases can be homologues or orthologues of plant tRNA ligases, and can be easily identified using standard techniques. In some embodiments, suitable tRNA ligases can be combined with plant viroid sequences to form ribonucleoprotein complexes. In some preferred embodiments, the plant viroid sequence and the tRNA ligase can be from the same plant species.

[0113] Suitable plant tRNA ligases are well known in the art and include, but are not limited to, Solanum melongena (eggplant) tRNA ligase. The amino acid sequence of Solanum melongena tRNA ligase is publicly available under GenBank Accession No. AFK76482.1 GI:388604525 (SEQ ID NO: 13), and the nucleotide coding sequence is publicly available under GenBank Accession No. JX025157.1 GI:388604524 (SEQ ID NO: 14).

[0114] SEQ ID NO:13

[0115] 1 MSVSHRVIYS FTHYKLYNLS SSLSLPSRI FFPFQSPSFH TFSSLMPNNQ ERGGYEGKKW

[0116] 61 QVRPSSNRVP GSSSNVEPVS AATAEAITDR LKSVDITESG AQSSVPVTSL QFGSVGLAPQ

[0117] 121 SPVQHQKVIW KPKSYGTVSG APVVEAGKTP VEQKSALLSK LFKGNLLENF TVDNSTFSRA

[0118] 181 QVRATFYPKF ENEKSDQEIR TRMIEMVSKG LAIVEVTLKH SGSLFMYAGH EGGAYAKNSF

[0119] 241 GNIYTAVGVF VLGRMFREAW GTKASKKQAE FNEFLERNRM CISMELVTAV LGDHGQRPRD

[0120] 301 DYAVVTAVTE LGNGKPTFYS TPDVIAFCRE WRLPTNHVWL FSTRKSVTSF FAAYDALCEE

[0121] 361 GTATTVCEAL SEVADISVPG SKDHIKVQGE ILEGLVARIV KRESSEHMER VLRDFPPPPS

[0122] 421 EGEGLDLGPT LREICAANRS EKQQIKALLQ SAGTAFCPNY LDWFGDENSG SHSRNADRSV

[0123] 481 VSKFLQSHPA DLYTGKIQEM VRLMREKRFP AAFKCHYNLH KINDVSSNNL PFKMVIHVYS

[0124] 541 DSGFRRYQKE MRHKPGLWPL YRGFFVDLDL FKVNEKKTAE MAGSNNQMVK NVEEDNSLAD

[0125] 601 EDANLMVKMK FLTYKLRTFL IRNGLSTLFK EGPSAYKSYY LRQMKIWNTS AAKQRELSKM

[0126] 661 LDEWAVYIRR KYGNKPLSSS TYLSEAEPFL EQYAKRSPQN HALIGSAGNF VKVEDFMAIV

[0127] 721 EGEDEEGDLE PAKDIAPSSP SISTRDMVAK NEGLIIFFPG IPGKAKSALC KEILNAPGGL

[0128] 781 GDDRPVNSLM GDLIKGRYWQ KVADERRRKP YSIMLADKNA PNEEVWKQIE NMCLSTGASA

[0129] 841 IPVIPDSEGT ETNPFSIDAL AVFIFRVLHR VNHPGNLDKS SPNAGYVMLM FYHLYDGKSR

[0130] 901 QEFESELIER FGSLVRIPVL KPERSPLPDS VRSIIEEGLS LYRLHTTKHG RLESTKGTHIEF

[0131] 961 QEWVKWEKQL RDILLGNADY LNSIQVPFEF AVKEVLEQLK VIARGEYAVP AEKRKLGSIV

[0132] 1021 FAAISLPVPE ILGLLNDLAK KDPKVGDFIK DKSMESSIQK AHLTLAHKRSHGVTAVANYG

[0133] 1081 SFLHQKVPVD VAALLFSDKL AALEAEPGSV EGEKINSKNS WPHITLWSGAGVAAKDANTL

[0134] 1141 PQLLSQGKAT RIDINPPVTI TGTLEFF

[0135] SEQ ID NO:14

[0136] 1 GTGACTGGCT CAAAGGCGGT ATTAGTGGCT CTTCTTCCCC GCTGGAATTT CTCGCCTATT

[0137] 61 TTTATTGAT TGACAGCAGC CGAGTCTTCC TTTTGTGTAG AACTGAATGT CGGTTTCGCA

[0138] 121 TAGGGTCATT TACTCTTTCA CTCATTACAA ACTCTATAAT CTCTCTTCTT CTTTATCATC

[0139] 181 TTTGCCTTCT AGAATCTTCT TCCCTTTTCA ATCTCCTTCC TTTCACACGT TCTCTTCACT

[0140] 241 CATGCCCAAC AATCAGGAAA GGGGTGGTTA TGAAGGAAAA AAATGGCAAG TGAGGCCAAG

[0141] 301 TTCCAATAGG GTACCAGGCT CGTCTTCAAA TGTGGAACCT GTATCTGCTG CAACTGCTGA

[0142] 361 AGCCATTACC GACCGTCTAA AGTCCGTGGA TATTACTGAA AGTGGTGCAC AGTCTAGTGT

[0143] 421 TCCAGTCACA TCTCTTCAGT TTGGCAGCGT TGGATTAGCA CCCCAGTCAC CTGTGCAACA

[0144] 481 TCAAAAAGTA ATCTGGAAAC CCAAATCATA TGGAACAGTG TCTGGAGCCC CAGTGGTTGA

[0145] 541 AGCTGGAAAA ACACCAGTTG AACAAAAAAG TGCTCTTTTA AGTAAATTAT TCAAGGGTAA

[0146] 601 TTTATTGGAA AATTTTACTG TAGATAACTC AACATTCTCG AGAGCCCAAG TAAGGGCCAC

[0147] 661 TTTCTACCCA AAATTTGAGA ATGAGAAATC AGATCAGGAG ATCAGGACAA GGATGATAGA

[0148] 721 GATGGTCTCC AAAGGCTTGG CTATAGTCGA GGTCACACTT AAGCATTCTG GATCTCTTTT

[0149] 781 TATGTATGCT GGGCATGAAG GTGGAGCATA TGCCAAGAAT AGCTTCGGGA ATATCTATAC

[0150] 841 TGCCGTTGGC GTCTTTGTTC TTGGACGGAT GTTTCGTGAG GCATGGGGAA CTAAAGCAAG

[0151] 901 CAAGAAGCAA GCAGAGTTCA ATGAGTTTCT TGAGCGCAAT CGTATGTGCA TATCAATGGA

[0152] 961 GTTGGTCACG GCAGTGTTGG GGGACCACGG ACAACGCCCA CGAGATGATT ATGCGGTTGT

[0153] 1021 GACTGCAGTC ACGGAGTTGG GAAATGGAAA ACCAACTTTC TATTCAACTCCCGATGTAAT

[0154] 1081 TGCTTTTTGC AGGGAATGGC GATTACCAAC AAATCATGTA TGGCTGTTCTCAACAAGGAA

[0155] 1141 ATCAGTGACT TCCTTCTTTG CTGCGTATGA TGCACTTTGC GAGGAAGGTACAGCAACCAC

[0156] 1201 CGTTTGCGAG GCTCTCAGCG AAGTTGCTGA TATTTCTGTA CCTGGATCAAAAGACCATAT

[0157] 1261 AAAAGTGCAG GGTGAAATTT TGGAGGGTCT CGTGGCCCGC ATCGTAAAACGTGAGAGCTC

[0158] 1321 AGAGCATATG GAGCGGGTTC TGAGAGATTT TCCTCCTCCG CCATCAGAGGGTGAGGGTTT

[0159] 1381 GGACCTGGGA CCTACGTTAC GTGAAATTTG TGCTGCAAAC AGATCAGAAAAGCAGCAAAT

[0160] 1441 AAAGGCACTT CTTCAGAGTG CTGGCACGGC TTTCTGCCCG AATTATTTGGACTGGTTTGG

[0161] 1501 AGATGAAAAC TCTGGTTCAC ATTCAAGAAA TGCTGATCGA TCTGTTGTCTCAAAGTTCTT

[0162] 1561 ACAATCACAT CCTGCTGATC TTTATACAGG AAAAAATACAG GAAATGGTTCGCTTGATGAG

[0163] 1621 GGAAAAGCGC TTTCCTGCTG CTTTCAAGTG TCATTATAAC TTACATAAAATTAATGATGT

[0164] 1681 ATCGAGTAAC AACCTGCCTT TCAAAATGGT GATCCATGTA TATAGTGATTCAGGCTTCCG

[0165] 1741 CCGGTACCAG AAAGAGATGA GGCACAAACC AGGACTATGG CCTTTGTATCGAGGCTTTTT

[0166] 1801 TGTTGACCTG GATTTATTCA AGGTCAATGA GAAGAAAACT GCTGAAATGGCAGGAAGCAA

[0167] 1861 CAATCAAATG GTAAAAAATG TGGAAGAGGA CAACAGTTTA GCTGATGAAGATGCAAATCT

[0168] 1921 GATGGTCAAG ATGAAATTTC TTACTTACAA GTTGAGAACT TTTTTGATCCGTAATGGCTT

[0169] 1981 GTCGACTCTT TTCAAAGAAG GACCTTCTGC GTATAAGTCT TATTACCTGAGGCAAATGAA

[0170] 2041 AATTTGGAAT ACTTCAGCAG CCAAGCAACG AGAACTCAGC AAGATGCTTGATGAATGGGC

[0171] 2101 FATHER CGCAGAAAAT ATGGGAACAA ACCATTGTCA TCATCCACATACCTAAGTGA

[0172] 2161 AGCTGAGCCT TTCCTTGAAC AATATGCAAA GCGTAGTCCA CAAAATCATGCTTTGATAGG

[0173] 2221 ATCTGCTGGA AATTTTGTCA AAGTTGAAGA TTTCATGGCT ATTGTTGAAGGAAGATGA

[0174] 2281 AGAGGGTGAT CTCGAGCCTG CGAAAGATAT TGCTCCTTCA AGCCCTAGTATTTCCACCAG

[0175] 2341 AGACATGGTG GCAAAGAATG AGGGTCTCAT TATTTTCTTT CCAGGAATACCAGGTTGTGC

[0176] 2401 TAAATCTGCA CTTTGTAAGG AAATACTGAA TGCTCCAGGA GGGCTTGGAGATGATCGACC

[0177] 2461 CONTACT TTAATGGGTG ATCTTATTAA CONTACT TGGCAAAAAGTTGCTGATGA

[0178] 2521 ACGTCGAAGA AAACCTTACT CGATCATGCT TGCTGACAAG AATGCACCAAATGAGGAAGT

[0179] 2581 ATGGAAACAA ATTGAGAACA TGTGCCTAAG CACCGGAGCA TCTGCTATTCCAGTTATACC

[0180] 2641 TGATTCAGAA GGAACTGAAA CTAATCCATT CTCTATTGAT GCACTTGCGGTTTTTATATT

[0181] 2701 CCGAGTACTT CACCGTGTCA ATCATCCGGG AAATCTTGAC AAGTCATCTCCAAATGCTGG

[0182] 2761 ATATGTGATG CTTATGTTTT ATCACCTTTA TGATGGAAAG AGCCGTCAGGAGTTCGAGAG

[0183] 2821 TGAGCTTATT GAACGTTTTG GATCGCTTGT CAGAATTCCT GTACTGAAACCTGAGAGGTC

[0184] 2881 TCCTCTTCCG GATTCTGTGA GGTCTATTAT CGAGGAGGGA CTCAGTCTGTACAGACTTCA

[0185] 2941 TACAACGAAA CATGGAAGAT TGGAGTCTAC AAAAGGGACA TATGTACAAGAGTGGGTTAA

[0186] 3001 ATGGGAGAAG CAATTGAGAG ATATTCTACT TGGAAATGCA GACTATCTCAATTCAATACA

[0187] 3061 GGTTCCATTT GAATTTGCCG TTAAAGAAGT CCTTGAACAA CTGAAAGTTATTGCGAGGGG

[0188] 3121 CGAATATGCA GTGCCTGCTG AGAAGAGGAA GCTAGGATCC ATTGTATTCGCCGCTATCAG

[0189] 3181 CCTGCCAGTT CCAGAAATTC TAGGTCTTCT AAATGATCTA GCAAAGAAAGATCCAAAGGT

[0190] 3241 TGGCGATTTC ATTAAGGACA AGAGCATGGA GAGCAGCATT CAGAAGGCCCATCTTACCCT

[0191] 3301 GGCTCACAAG AGAAGTCACG GTGTCACTGC AGTTGCCAAT TACGGTTCCTTTCTTCATCA

[0192] 3361 AAAGGTGCCA GTAGACGTGG CTGCTTTGTT GTTCTCCGAT AAATTGGCTGCACTAGAAGC

[0193] 3421 TGAGCCTGGC TCTGTTGAAG GTGAAAAGAT CAATTCTAAA AACTCATGGCCCCATATCAC

[0194] 3481 ATTATGGTCT GGTGCAGGAG TTGCCGCAAA AGATGCCAAT ACACTACCACAGTTACTTTC

[0195] 3541 CCAAGGGAAG GCTACCCGCA TTGATATAAA TCCACCGGTC ACTATAACTGGCACTCTCGA

[0196] 3601 ATTCTTTTGA ACTCTACTTG TAATTCCTCT TGTGTGGATT TACATAATGTGAACCCTACA

[0197] 3661 TGGGTTCTGA GTGAATCATG TAATGATTCT CCTGAGTTTT AGGAACAATTTTGTAGCAGT

[0198] 3721 CTTGCAGTTG CAGGATAGAA CTAGATCTAG AGAAAATGTA AAGATGTTTAAGGCAATAAA

[0199] 3781 GGTCTTGAGC TGTGGGCATA TTGAAAATCC CCAGTAGCAT TTTTCTTGAGCAAAAAAAAA

[0200] 3841 AAAAAAAA

[0201] Thus, in a specific embodiment of the present invention, the tRNA ligase is an eggplant tRNA ligase. In a more specific embodiment, the tRNA ligase from eggplant comprises or consists of a nucleotide sequence having at least 70, 75, 80, 85, 90, 96, 97, 98 or 99% sequence identity to SEQ ID NO: 14. In a more specific embodiment, the tRNA ligase from eggplant comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 14.

[0202] Other suitable tRNA ligases for use in the present invention may be orthologs from plant species other than Solanum melongena (eggplant), such as Arabidopsis thaliana (GenBank Accession No. NM_100665.3 [SEQ ID NO: 18]), Solanum lycopersicum (XM_004251213). 4 [SEQ ID NO: 19]), Hevea brasiliensis (XM_021784835.1 [SEQ ID NO: 20]), Prunus avium (XM_021975205.1 [SEQ ID NO: 21]), Malus domestica (XM_029088496.1 [SEQ ID NO: 22]), Triticum spp. or Oryza sativa. Suitable orthologs may be identified using standard sequence analysis techniques.

[0203] In a specific embodiment, the plant viroid and the tRNA ligase can be from the same plant species. For example, the eggplant tRNA ligase can be expressed using the ELVd sequence, or the avocado tRNA ligase can be expressed using the Avocado sunblotch viroid (ASBVd) sequence. The dsRNA molecule and the tRNA ligase can be encoded by the same or different nucleic acids in the host cell. The nucleic acid can be heterologous or exogenous to the host cell and can be introduced into the host cell by transformation or transfection as described below.

[0204] As a result of expressing the nucleotide sequence of the invention on a host cell in conjunction with a tRNA ligase, a large amount of hybrid circular molecules comprising a plant viroid in which a dsRNA hairpin is present are efficiently produced. For example, more than 10 mg, more than 20 mg, more than 30 mg, more than 50 mg, or more than 100 mg of dsRNA can be produced per liter of host cell culture. For example, the data herein show that 50 mg is produced per liter of E. coli culture.

[0205] However, it is desirable to avoid the presence of plant viroids in dsRNA molecules to increase the commercial potential of the technology. In order to remove residues derived from plant viroids, the inventors added new elements to the nucleotide sequence of the present invention, which includes a replaced intron-exon sequence. When the I group intron is divided into two parts, after the first part is fused to the second part, the self-cleavage reaction continues at the boundary between exon 1 and the 5' end of the intron, and continues to attack from exon 1 to the boundary between the 3' end of the intron and exon 2 at the 3' end, and self-catalyzes the generation of a circular RNA molecule consisting of two exons.

[0206] Therefore, in another specific embodiment, the nucleotide sequence of the present invention may further comprise a displaced autocatalytic intron-exon sequence between the plant viroid sequence and the cDNAs sequence. Examples of displaced autocatalytic intron-exon sequences include, but are not limited to, tRNA introns from Anabaena sp. strain PCC7120 or introns from the thymidylate synthase (td) gene of bacteriophage T4. In a specific embodiment, the displaced autocatalytic intron-exon sequence is an autocatalytic intron from the 26S rRNA gene of T. termophila.

[0207] In a more specific embodiment, the replaced autocatalytic intron-exon sequence at 5' of the cDNA sequence of the sense strand of the target dsRNA comprises or consists of a nucleotide sequence having at least 70, 75, 80, 85, 90, 95, 96, 97, 98, 99% sequence identity to SEQ ID NO: 15. In a more specific embodiment, the autocatalytic intron-exon sequence arranged 5' of the cDNA sequence of the sense strand of the target dsRNA comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 15.

[0208] SEQ ID NO: 15 (exons are underlined)

[0209]

[0210] In another specific embodiment, the replacement autocatalytic intron-exon sequence 3' of the cDNA sequence of the antisense strand of the target dsRNA comprises or consists of a nucleotide sequence having at least 70, 75, 80, 85, 90, 95, 96, 97, 98, 99% sequence identity to SEQ ID NO: 16. In a more specific embodiment, the replacement autocatalytic intron-exon sequence 3' of the cDNA sequence of the sense strand of the target dsRNA comprises or consists of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 16.

[0211] SEQ ID NO: 16 (exons are underlined)

[0212]

[0213] In a more specific embodiment, the nucleotide sequence of the present invention comprises the sequence of SEQ ID NO:17.

[0214] SEQ ID NO:17

[0215] CCCCAT GGTGGTGTGTGCCACCCTGATGAGACCGAAAGGTCGAAATGGGG

[0216] CCCCAT GGTGGTGTGTGCCACCCTGATGAGACCGAAAGGTCGA AATGGGG

[0217] Underline : Hammerhead ribozyme sequences show the ribozyme cleavage site in bold.

[0218] cDNA from ELVd (C327 to G46 from GenBank accession number AJ536613.1), with the insertion site containing the inverted repeats of the sense and antisense strands of the target RNA double underlined, separated by an insertion sequence containing a group I intron flanked by exonic fragments.

[0219] Italics: 100 bp of the β-actin gene of Ceratitis capitata in sense and antisense orientation.

[0220] The 5' and 3' exons of the autocatalytic intron of the rRNA 26S gene of T. termophila.

[0221] Autocatalytic intron of the rRNA 26S gene of T. termophila.

[0222] Bold: autocatalytic intron-exon sequences are aligned 5' and 3' to the sense and antisense cDNA sequences of the target dsRNA, respectively, with exons shown as underlined.

[0223] In summary, the nucleotide sequence of the present invention allows the production of large amounts of dsRNA. To this end, the cDNA of the two chains of the target dsRNA is inserted into the cDNA of the plant viroid and separated by the cDNA of the autocatalytic intron. The resulting RNA is co-expressed with the tRNA ligase to produce a large amount of hybrid molecules accumulated, in which the dsRNA is fused to the viroid. The autocatalytic intron disappears during the precursor processing. In addition, if the displaced autocatalytic intron is added to the structure, the dsRNA of interest can be separated from the viroid molecule in a circular form. Figure 1 and Figure 2 The process disclosed in this paragraph is explained.

[0224] As will be appreciated by those skilled in the art, the nucleotide sequences of the present invention may also contain regulatory sequences, such as enhancers and promoters, replication origins, ribosomal terminators, resistance genes, etc., which allow the nucleotide sequence to be expressed in a host cell.

[0225] In another aspect, the present invention relates to a vector comprising the nucleotide sequence of the present invention, hereinafter referred to as "the vector of the present invention".

[0226] According to the present invention, the term "vector" refers to a plasmid, cosmid, virus, phage or another vector conventionally used in genetic engineering that carries the nucleotide sequence of the present invention. Therefore, the nucleotide sequence of the present invention can be inserted into several commercially available vectors. Non-limiting examples include prokaryotic plasmid vectors, such as the pUC series, pBluescript (Stratagene), the pET series of expression vectors (Novagen) or pCRTOPO (Invitrogen) and vectors compatible with expression in mammalian cells such as pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, plZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems) pTriEx-Hygro (Novagen) and pCINeo (Promega). Plasmid vector samples suitable for Pichia pastoris include, but are not limited to, plasmids pAO815, pPIC9K, and pPIC3.5K (all Invitrogen).

[0227] Nucleotide sequence of the present invention can be inserted into a vector, thereby producing (further) translation fusion with another nucleotide sequence. Other nucleotide sequences can encode proteins, which can, for example, increase the solubility of the dsRNA encoded by the nucleotide sequence of the present invention and / or promote purification. In order to produce the nucleotide fusions, overlap extension PCR can be used. The resulting product is called fusion protein and will be further described below.

[0228] In addition to the nucleotide sequence of the present invention, the vector of the present invention may comprise a nucleotide sequence encoding a tRNA ligase. Alternatively, the present invention further comprises a pair of vectors, the first vector comprising the nucleotide sequence of the present invention, and the second vector comprising a nucleotide sequence encoding a tRNA ligase as described in the preceding paragraph.

[0229] Plasmids that can be used to introduce the nucleotide sequence of the present invention into host cells are pUC18 / 19 (Roche Biochemicals), pBluescript II, pKK-177-3H (Roche Biochemicals), pBTac2 (Roche Biochemicals), pKK223-3 (Amersham Pharmacia Biotech), pKK-233-3 (Stratagene) or pET (Novagen).

[0230] Typically, a vector may comprise one or more origins of replication (ori) and a genetic system for cloning or expression, one or more markers for selection in a host, such as antibiotic resistance, and one or more expression cassettes. Suitable origins of replication include, but are not limited to, pUC, p15A, ColE1, viral SV40 or M13 origins of replication.

[0231] The nucleotide sequence inserted into the vector can be synthesized, for example, by standard methods. The connection of the nucleotide sequence to the transcriptional regulatory element and / or other nucleotide sequences can be carried out using established methods well known to those skilled in the art. The transcriptional regulatory elements (parts of the expression cassette) that ensure expression in prokaryotes or eukaryotic cells are well known to those skilled in the art. These elements include regulatory sequences (e.g., translation initiation codons, transcription termination sequences, promoters, enhancers and / or insulators) and internal ribosome entry sites (IRES) that ensure transcription initiation. Additional regulatory elements can include transcribed and / or naturally associated or heterologous promoter regions. The regulatory element can be a heterologous regulatory element. Preferably, the nucleotide sequence of the present invention is operably connected to such expression control sequences that allow expression in prokaryotes or eukaryotic cells. Cotransfection with selectable markers such as kanamycin, chloramphenicol or ampicillin resistance genes for cultivation in Escherichia coli or other bacteria allows identification and separation of transfected cells. Using these markers, cells are grown in selective media, and the cells with the highest resistance are transfected cells.

[0232] In another aspect, the present invention relates to a host cell, hereinafter referred to as "the cell of the invention", comprising, for example, as a result of transformation, transduction, microinjection or transfection, a nucleotide sequence or a vector of the invention.

[0233] The technology for introducing nucleic acid into cells is fully established in the art, and any suitable technology can be adopted according to the specific circumstances. For eukaryotic cells, suitable technology can include calcium phosphate transfection, DEAE-dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other viruses, such as adenovirus, AAV, slow virus or vaccinia. For bacterial cells, suitable technology can include calcium chloride transformation, electroporation and transfection using bacteriophage. As is well known in the art, marker genes such as antibiotic resistance or sensitivity genes can be used to identify clones containing target nucleic acids. The nucleic acid introduced can be on an intracellular extrachromosomal vector, or the nucleic acid can be integrated into the genome of the host cell. According to standard techniques, integration can be promoted by including a sequence that promotes recombination with the genome in nucleic acid or a vector.

[0234] Various host expression systems can be used to express the nucleotide sequence or vector of the present invention. The host cell of the present invention can be produced by introducing the nucleotide sequence or vector of the present invention into the host cell.

[0235] In a specific embodiment, the host cell of the present invention comprises

[0236] (a) the vector of the present invention, or

[0237] (c) a pair of vectors, the first vector comprising the nucleotide sequence of the present invention, and the second vector comprising the nucleotide sequence encoding the tRNA ligase as described in the previous paragraph.

[0238] The host of the host cell source can be any eukaryotic or prokaryotic cell. Suitable eukaryotic host cells can be vertebrate cells, amphibian cells, fish cells, insect cells, fungi / yeast cells, nematode cells or plant cells. Insect cells can be Spodoptera frugiperda cells, Drosophila S2 cells or Spodoptera Sf9 cells, and fungi / yeast cells can be Saccharomyces cerevisiae cells, Pichia pastoris cells or Aspergillus cells.

[0239] Preferably, the vertebrate cell is a mammalian cell, such as a human cell, CHO, COS, 293 or Bowes melanoma cell. The plant cells are preferably independently selected from cells of the genera Anulatus, Anona, Arachis, Artocarpus, Asparagus, Atropa, Avena, Brassica, Carica, Citrus, Citrus, Capsicum, Carthamus, Cocos nucifera, Coffea, Cucumber, Cucurbita, Daucus, Rapeseed, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Barley, Hyoseyamus, Lactuca, Flax, Lolium, Lupinus, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Olea, Oryza, Panieum, Pannesetum, Passiflora, Persea, Phaseolus, Pistachio, Pisum, Pyrus, Prunus, Psidium, Raphanus, Ricinus, Secale, Senecio, Sinapis, Solanum, Sorghum, Theobroma cacao, Trigonella, Triticum, Vicia, Vitis, Vigna and Zea. The cell may be part of a cell line.The cell from a plant may for example originate from roots, leaves, bark, needles, rape or stems.

[0240] Suitable prokaryotes (bacteria) that can be used as hosts of the present invention are those commonly used for cloning and / or expression, including but not limited to Escherichia coli (e.g., Escherichia coli strains BL21, HB101, DH5a, XL1 Blue, Y1090, JM101 and HT115), Salmonella typhimurium, Serratia marcescens, Burkholderia glumae, Pseudomonas putida, Pseudomonas fluorescens, Pseudomonas stutzeri, Streptomyces lividans, Lactococcus lactis, Mycobacterium smegmatis, Streptomyces or, Bacillus subtilis. Suitable culture media and conditions for the above host cells are known in the art.

[0241] Preferred examples of host cells that can be genetically engineered with the nucleotide sequence or vector of the present invention are cells of yeast, E. coli and / or Bacillus species (eg Bacillus subtilis).

[0242] In some embodiments, host cells can express exogenous tRNA ligase. For example, host cells may have previously been transformed with nucleotide sequences encoding tRNA ligase. Methods as described herein may include introducing nucleic acids encoding nucleotide sequences of the present invention into host cells expressing exogenous tRNA ligase. After introduction, nucleotide sequences can be expressed to produce dsRNA molecules and / or tRNA ligase. In some embodiments, host cells (which may include actual transformed cells, although these cells are more likely to be descendants of transformed cells) can be cultured in vitro under nucleic acid expression conditions to produce encoded dsRNA molecules and / or tRNA ligase. When using an inducible promoter, expression may require activation of the inducible promoter. The dsRNA molecules can then be recovered from the host cells or surrounding culture medium.

[0243] In another aspect, the present invention relates to a plant, hereinafter referred to as "the plant of the present invention", comprising the isolated nucleotide sequence of the present invention, or the vector of the present invention, or the host cell of the present invention.

[0244] Another aspect of the present invention provides a recombinant host cell expressing a dsRNA molecule and a tRNA ligase as described herein. The host cell may contain a heterologous nucleotide sequence encoding a tRNA ligase and a heterologous nucleotide sequence encoding a dsRNA molecule (nucleotide sequence of the present invention). The nucleotide sequence may be contained in an expression vector that is the same or different from the above. Another aspect of the present invention provides a recombinant host cell that expresses an exogenous tRNA ligase and is suitable for transformation with the nucleotide sequence of the present invention disclosed herein. The host cell, chimeric RNA molecule and tRNA ligase are described in more detail above.

[0245] After being produced from host cells and / or culture medium, the dsRNA specifically expressed by the target RNA can be isolated and / or purified. This can be achieved using any convenient method known in the art. The technology for purifying and / or isolating RNA is well known in the art and includes, for example, HPLC, FPLC or affinity chromatography.

[0246] After isolation and / or purification, the dsRNA molecules can then be used as desired, for example in the formulation of a composition that may include one or more additional components, such as a pharmaceutical or phytosanitary composition that includes one or more acceptable excipients, vehicles, or carriers. The dsRNA produced as described herein can be further studied, for example, pharmacological properties and / or activities can be determined. Methods and means of RNA analysis are well known in the art.

[0247] In some embodiments, the dsRNA can be modified or adapted after being isolated from the host cell. For example, the 2'-OH group of one or more nucleotides in the dsRNA can be chemically modified, for example, by adding a substituent, such as a methyl group (e.g., 2'-O-methyl), a halogen (e.g., 2'-fluoro), or an amine (e.g., 2'-NH3), or reduced to 2'-H (e.g., 2' deoxy).

[0248] As explained throughout this specification, when the nucleotide sequence of the present invention is expressed in a host cell, it allows the production of a large amount of target dsRNA. Therefore, on the other hand, the present invention relates to the use of the nucleotide sequence of the separation of the present invention, or the vector of the present invention, or the host cell of the present invention, or the plant of the present invention for producing a dsRNA specific to a target gene. The terms used to define this aspect and their specific embodiments have been explained in the previous paragraphs and can be applied to aspects of the present invention. The separation nucleotide sequence of the present invention, or the vector of the present invention, or the host cell of the present invention, or the plant of the present invention may include a nucleotide sequence encoding a tRNA ligase. However, as described in the previous paragraphs, a tRNA ligase (or a nucleotide sequence encoding a tRNA ligase) may be present in another vector or in the genome of the host cell itself. Therefore, in a specific embodiment, the present invention relates to the nucleotide sequence of the separation of the present invention, or the vector of the present invention, or the host cell of the present invention, or the plant of the present invention and a tRNA ligase (or a nucleotide sequence encoding a tRNA ligase) for producing a dsRNA specific to a target gene.

[0249] Similarly, in another aspect, the present invention relates to a method for producing a dsRNA specific for a target gene, hereinafter referred to as "the method of the present invention", comprising co-expressing in a host cell:

[0250] The nucleotide sequence of the present invention, and

[0251] a) a nucleotide sequence encoding a tRNA ligase,

[0252] b) wherein the nucleotide sequences of a) and b) are in the same or different nucleic acid molecules.

[0253] In a specific embodiment of the method of the invention, the host cell is Escherichia coli.

[0254] In another specific embodiment, the tRNA ligase is a tRNA ligase from Eggplant.

[0255] The terms "dsRNA", "host cell" and "tRNA ligase" have been defined and explained in the previous aspects of the present invention. The co-expression of the above elements (a) and (b) is carried out by culturing a host cell comprising the two elements under suitable conditions. Suitable conditions for culturing prokaryotic or eukaryotic host cells are well known to those skilled in the art. Suitable conditions for culturing Escherichia coli are provided in the embodiments of the present invention. In general, suitable conditions for culturing bacteria are to cultivate them under aeration conditions in Luria Bertani (LB) medium. In order to increase the yield and solubility of the expression product, the medium can be buffered or supplemented with known suitable additives to enhance or promote both. Escherichia coli can be cultured at about 4°C to 37°C, the exact temperature or temperature sequence depending on the molecule to be overexpressed. In general, Aspergillus sp. can be grown on Sabouraud dextrose agar or potato dextrose agar at about 10°C to about 40°C, preferably about 25°C. Suitable conditions for yeast culture are known. The technician is also aware of all these conditions and can further adapt these conditions to the needs of the specific host species and the needs of the expressed polypeptide. If an inducible promoter controls the nucleotide sequence of the invention in a vector present in a host cell, the expression of the dsRNA can be induced by adding a suitable inducing agent. Suitable expression protocols and strategies are known to the skilled person. Depending on the cell type and its specific requirements, mammalian cell culture can be carried out, for example, in RPMI or DMEM medium containing 10% (v / v) FCS, 2mM L-glutamine and 100U / ml penicillin / streptomycin. The cells can be maintained at 37° C. in a 5% CO2, water-saturated atmosphere. Suitable expression protocols for eukaryotic cells are well known to the skilled person.

[0256] After culturing the host cells, the dsRNA produced can be isolated and / or purified. Isolation methods are well known in the art and include, but are not limited to, steps such as ion exchange chromatography, gel filtration chromatography (size exclusion chromatography), affinity chromatography, high pressure liquid chromatography (HPLC), reverse phase HPLC, or disk gel electrophoresis.

[0257] In another aspect, the present invention relates to a phytosanitary composition comprising a dsRNA obtained by the method of the present invention.

[0258] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Methods and materials similar or equivalent to the methods and materials described herein can be used to implement the present invention. Throughout the description and claims, the term "comprising" and its variations are not intended to exclude other technical features, additives, components or steps. Other objects, advantages and features of the present invention will become apparent to those skilled in the art after examining the description, or may be understood through the practice of the present invention. The following examples, drawings and sequence listings are provided for illustration and are not intended to limit the present invention. Example

[0259] Due to the instability of DNA inverted repeats in E. coli cells when constructing plasmids that produce dsRNA to induce RNAi in pests and pathogens, it was not possible to obtain bacterial colonies with the desired construct. To alleviate the well-known problem of DNA inverted repeats in E. coli, the cDNAs corresponding to the two strands of the target dsRNA were separated by 10 bp corresponding to the T. termophila 26S rRNA group I intron (GenBank accession number V01416.1 [SEQ ID NO: 23]) plus two native flanking exons. In this way, although the intron cDNA will separate the inverted repeats at the DNA level, the intron will self-splice from the transcript to form the dsRNA.

[0260] To this end, we amplified two different DNAs corresponding to a 100 bp fragment of C. capitata β-actin mRNA (GenBank accession number EU665679.1 [SEQ ID NO:24]) in both directions (SEQ ID NO:1 and SEQ ID NO:2) by PCR using Phusion High-Fidelity DNA Polymerase (Thermo Scientific). We also amplified a DNA corresponding to a T. termophila 26S rRNA group I intron and flanking exon fragment (SEQ ID NO:6) by PCR from a plasmid obtained by gene synthesis. The PCR products were separated by electrophoresis in a 1% agarose gel stained with ethidium bromide. DNA of the expected size was eluted from the gel using a silica spin column. Three DNA assemblies were assembled between positions T245 and T246 of ELVd-AJ536613.1 cDNA with a repeated hammerhead ribozyme domain (SEQ ID NO: 11) in the plasmid pLELVd (Daròs, JA, Aragonés, V., and Cordero, T. (2018) Sci. Rep., 8, 1904) by Gibson assembly reaction using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Finally, qualified E. coli cells were electroporated with the products of the Gibson assembly reaction, and transformed bacteria were selected on Luria-Bertani (LB) plates containing 50 μg / ml ampicillin. We grew five independent E. coli clones in liquid LB culture and purified the corresponding plasmids. Electrophoresis analysis in 1% agarose gel stained with ethidium bromide showed that all of them had the same size and exhibited a migration delay consistent with the inserted DNA ( Figure 5, compare lane 2 and lanes 3 to 7). The expected sequence SEQ ID NO: 12 was experimentally confirmed in one of these plasmids. This plasmid was used to co-electroporate the RNase III-deficient HT115 (DE3) strain of Escherichia coli lacking RNase III (Timmons, L., Court, DL, and Fire, A. (2001) Gene, 263, 103–112), together with the plasmid pLtRnlSm (Daròs et al., 2018, cited above) constitutively expressing the eggplant tRNA ligase (SEQ ID NO: 13 and SEQ ID NO: 14). As a control, pLtRnlSm was also co-electroporated with a plasmid to express empty ELVd (pLELVd) (Daròs et al., 2018, cited above). Nine independent colonies (four for empty ELVd controls) were picked from LB plates containing 50 μg / ml ampicillin and 34 μg / ml chloramphenicol and grown in liquid Terrific Broth (TB) medium for 24 h. Total RNA was extracted from cells using a 1:1 mixture of phenol and chloroform (pH 8.0) (Daròs et al., 2018) and analyzed by polyacrylamide gel electrophoresis (PAGE) under denaturing conditions (8 M urea) (Daròs et al., 2018, cited above). Two prominent bands above the 600-nt and slightly below the 400-nt RNA marker were observed in RNA extracts from bacteria transformed with plasmids to express dsRNA ( Figure 6 , lanes 6 to 14, gray and black arrows, respectively). It is noteworthy that these bands exhibit fluorescence intensities comparable to those from endogenous E. coli rRNA ( Figure 6 , upper part of the gel), indicating a large accumulation in E. coli. According to our previous analysis (Fadda, Z., Daròs, JA, Fagoaga, C., Flores, R. and Duran-Vila, N. (2003) J. Virol., 77), the circular ELVd RNA corresponding to 333 nt long ( Figure 6 , lanes 1 to 4, white arrows). Under denaturing conditions, circular RNAs migrate slower than their linear counterparts of the same size. Figure 2 The identities of the different RNA species shown in the Figure 1 were determined by using RNA complementary to ELVd and T. termophila intronic RNAs. 32 The results were confirmed by Northern-blot hybridization analysis using a P-labeled RNA probe.

[0261] Together, these results indicate that, while T. thermophila cDNA is used to stabilize the inverted repeats in the E. coli expression plasmid, the intron is very efficiently self-spliced ​​from the primary transcript in the bacterial cell, promoting the accumulation of a large circular RNA product consisting of the ELVd scaffold bulging from the dsRNA. Figure 1 This is illustrated. dsRNA produced in E. coli using this method showed the same insecticide activity as counterparts of the same sequence obtained using standard methods, such as double-stranded transcription from two opposing promoters.

[0262] Next, we designed a new strategy to separate the active dsRNA from the unwanted ELVd scaffold. To this end, we took advantage of the replacement intron-exon (PIE) reaction (Price, JV, Engberg, J. and Cech, TR (1987) J. Mol. Biol., 196, 49–60; Puttaraju, M. and Been, M. (1992) Nucleic Acids Res., 20, 5357–5364). We constructed a new plasmid in which the cDNA corresponding to the T. termophila 26S rRNA group I intron and 10 flanking exons (SEQ ID NO: 6) were split and aligned, the 3' fragment (SEQ ID NO: 15) was inserted between the 5' part of ELVd and the positive strand of the dsRNA, and the 5' fragment (SEQ ID NO: 16) was inserted between the negative strand of the dsRNA and the 3' part of ELVd (see Figure 2 ). We constructed this plasmid by amplifying the DNA by PCR using Phusion high-fidelity DNA polymerase and assembling the fragments by Gibson reaction. The sequence of the plasmid was confirmed by sequencing. The selected plasmid co-expressed the eggplant tRNA ligase with pLtRnlSm and was used to electroporate competent E. coli cells. The transformed bacteria were selected in LB plates containing ampicillin and chloramphenicol. Next, we grew liquid cultures in TB containing the same antibiotics and extracted total RNA from the bacteria using phenol:chloroform. The RNA preparations were analyzed by PAGE under non-denaturing and denaturing (8 M urea) conditions ( Figure 7 The shift in electrophoretic migration from non-denaturing to denaturing conditions confirmed the production of circular RNA molecules in E. coli, which consisted of a 100-bp dsRNA locked at both ends by exonic fragments ( Figure 3 ), which is a result of itself - the cleavage of the conventional intron I and the replacement intron I ( Figure 2 ).

[0263] To analyze the importance of the viroid sequence in the production of recombinant double-stranded RNA (dsRNA), the viroid sequence from a previously described construct (SEQ ID NO: 17) that expresses Ceratitis capitata β-acting 100-bp dsRNA using a viroid type I intron system was removed using standard molecular biology techniques to generate a new version of this plasmid (SEQ ID NO: 26).

[0264] Escherichia coli was transformed with both plasmids and those expressing eggplant tRNA ligase or its empty version. Five colonies were picked from each transformation, selected in ampicillin and chloramphenicol, and liquid cultures were grown for 24 hours. Bacterial dsRNA RNA production was extracted and analyzed by polyacrylamide gel electrophoresis (PAGE), followed by ethidium bromide staining of the gel. Bands corresponding to dsRNA products were quantified using an image analyzer. The results showed that the viroid scaffold had a significant positive effect on recombinant dsRNA accumulation, as the average accumulation in E. coli co-transformed with plasmids expressing viroid sequences and tRNA ligase was two times more than that of those co-transformed with plasmids without viroid sequences and an empty version of tRNA ligase ( Figure 8 ).

[0265] In addition, in order to gain insight into the exon segment requirements in a viroid-based system to produce recombinant dsRNA in Escherichia coli, intron processing and recombinant dsRNA accumulation and continuous exon deletion were analyzed starting from a construct expressing a 100-bp dsRNA corresponding to the cephalosporin β-actin mRNA. Escherichia coli was co-transformed with a plasmid to express tRNA ligase and those produced recombinant dsRNAs with 10, 8, 6, and 2-nt long exons (SEQ ID NO: 27, 28, 29, and 30). Transformed clones were selected on plates with ampicillin and chloramphenicol, and liquid cultures were grown for 24 hours. RNA was extracted from the bacteria and analyzed by PAGE and ethidium bromide staining. The results showed that exon size from 10 to 2 nucleotides had no effect on intron self-cleavage efficiency and recombinant dsRNA production ( Fig. 9 ).

[0266] In summary, we have developed a new method to produce dsRNA that can be used for RNAi-based biotechnological applications. The new method is based on the activity of two versions of a self-splicing group I intron, the second version being a displaced form. The first intron stabilizes the inverted DNA repeat required for transcription of dsRNA in E. coli and is efficiently processed from the final transcript. The second (displaced) intron cleaves the dsRNA from the viroid scaffold, resulting in a circular molecule consisting of the dsRNA with the exonic fragment locked at both ends ( Figure 3 ). Sequence Listing <110> Spanish Higher Council for Scientific Research Polytechnic University of Valencia, Spain <120> Method for preparing double-stranded RNA <130> PCT1641.1485 <150> EP 19382997 <151> 2019-11-13 <160> 30 <170> PatentIn version 3.5 <210> 1 <211> 100 <212> DNA <213> Ceratitis capitata <400> 1 gctgaccgaa gcaccgttga acccgaaggc taaccgcgag aagatgaccc agatcatgtt 60 cgagaccttc aactcgccgg ccatgtatgt ggccatccag 100 <210> 2 <211> 100 <212> DNA <213> Ceratitis capitata <400> 2 ctggatggcc acatacatgg ccggcgagtt gaaggtctcg aacatgatct gggtcatctt 60 ctcgcggtta gccttcgggt tcaacggtgc ttcggtcagc 100 <210> 3 <211> 413 <212> DNA <213> Tetrahymena thermophila <400> 3 aatagcaat atttaccttt ggagggaaaa gttatcaggc atgcacctgg tagctagtct 60 ttaaaccaat agattgcatc ggtttaaaag gcaagaccgt caaattgcgg gaaaggggtc 120 aacagccgtt cagtaccaag tctcagggga aactttgaga tggccttgca aagggtatgg 180 tataagctg acggacatgg tcctaaccac gcagccaagt cctaagtcaa cagatcttct 240 gttgatatgg atgcagttca cagactaaat gtcggtcggg gaagatgtat tcttctcata 300 agatatagtc ggacctctcc ttaatgggag ctagcggatg aagtgatgca acactggagc 360 cgctgggaac taatttgtat gcgaaagtat attgattagt tttggagtac tcg 413 <210> 4 <211> 10 <212> DNA <213> Tetrahymena thermophila <400> 4 atgactctct 10 <210> 5 <211> 10 <212> DNA <213> Tetrahymena thermophila <400> 5 tagtagcc 10 <210> 6 <211> 433 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Autocatalytic intron flanked by exonfragments <400> 6 atgactctct aaatagcaat atttaccttt ggagggaaaa gttatcaggc atgcacctgg 60 tagctagtct ttaaaccaat agattgcatc ggtttaaaag gcaagaccgt caaattgcgg 120 gaaaggggtc aacagccgtt cagtaccaag tctcagggga aactttgaga tggccttgca 180 aagggtatgg taataagctg acggacatgg tcctaaccac gcagccaagt cctaagtcaa 240 cagatcttct gttgatatgg atgcagttca cagactaaat gtcggtcggg gaagatgtat 300 tcttctcata agatatagtc ggacctctcc ttaatgggag ctagcggatg aagtgatgca 360 acactggagc cgctgggaac taatttgtat gcgaaagtat attgattagt tttggagtac 420 tcgtaaggta gcc 433 <210> 7 <211> 333 <212> DNA <213> Eggplant latent viroid <400> 7 gggtggtgtg tgccacccct gatgagaccg aaaggtcgaa atggggttc gccatgggtc 60 gggactttaa attcggagga ttcgtccttt aaacgttcct ccaagagtcc cttccccaaa 120 cccttacttt gtaagtgtgg ttcggcgaat gtaccgtttc gtcctttcgg actcatcagg 180 gaaagtacac actttccgac ggtgggttcg tcgacacctc tccccctccc aggtactatc 240 ccctttcaag gatgtgttcc ctaggagggt gggtgtacct cttttggatt gctccggcct 300 tccaggagag atagaggacg acctctcccc ata 333 <210> 8 <211> 247 <212> DNA <213> Avocado sunblotch viroid <400> 8 tttattagaa caagaagtga ggatatgatt aaactttgtt tgacgaaacc aggtctgttc 60 cgactttccg actctgagtt tcgacttgtg agagaaggag gagtcgtggt gaacttttat 120 taaaaaatt agttcactcg tcttcaatct cttgatcact tcgtctcttc agggaaagat 180 gggaagaaca ctgatgagtc tcgcaaggtt tactcctcta tcttcattgt ttttttacaa 240 aatcttg 247 <210> 9 <211> 399 <212> DNA <213> Chrysanthemum chlorotic mottle viroid <400> 9 ggcacctgac gtcggtgtcc tgatgaagat ccatgacagg atcgaaacct cttccagttt 60 cggcttgtgt gggagtaaag ctttcgctct ctccacagcc tcatcaggaa acccacttca 120 ggtctcgact ggaaggtcgt taaacttccc ctctaagcgg agtagaggta aatacctccg 180 tccaaccccg ggaggaaagg ggttgggacc cggaacagat ccagttccgg tcctttggag 240 tccattctc tcgttggata ttctcctcgg agaagggaga tggggccagt cccagtcggt 300 tcgctctcgt agtcacagcc actggggaac ctaggcagat ggctggacgg agtcttagtc 360 cactccagag gaccttgggt ttgaaacccc caagaggtc 399 <210> 10 <211> 337 <212> DNA <213> Peach latent mosaic viroid <400> 10 gtcataagtt tcgtcgcatt tcagcgactc atcagtgggc ttagcccaga cttatgagag 60 agtaaagacc tctcagcccc tccaccttgg ggtgccctat tcggagcact gcagttcccg 120 atagaaaggc taagcacctc gcaatgaggt aaggtgggac ttttccttct ggaaccaagc 180 ggttggttcc gaggggggtg tgatccaggt accgccgtag aaactggatt acgacgtcta 240 cccgggattc aaacccgtcc cctccagaag tgattctgga tgaagagtct gtgctaagca 300 cactgacgag tctctgagat gagacgaaac tcttctt 337 <210> 11 <211> 386 <212> DNA <213> Eggplant latent viroid <400> 11 ccccataggg tggtgtgtgc cacccctgat gagaccgaaa ggtcgaaatg gggttcgcc 60 atgggtcggg actttaaatt cggaggattc gtcctttaaa cgttcctcca agagtccctt 120 ccccaaaccc ttactttgta agtgtggttc ggcgaatgta ccgtttcgtc ctttcggact 180 catcagggaa agtacacact ttccgacggt gggttcgtcg acacctctcc ccctcccagg 240 tactatcccc tttcaaggat gtgttcccta ggagggtggg tgtacctct ttggattgct 300 ccggccttcc aggagagata gaggacgacc tctccccata gggtggtgtg tgccacccct 360 gatgagaccg aaaggtcgaa atgggg 386 <210> 12 <211> 1019 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> A plant viroid comprising the cDNAs of two strands of atarget dsRNA separated by autocatalytic introns flanking exonic fragments inserted into its nucleotide sequence dsRNA Separated by an autocatalytic intron flanked by exon fragmentsinserted in its nucleotide sequence.) <400> 12 ccccataggg tggtgtgtgc cacccctgat gagaccgaaa ggtcgaaatg gggtttcgcc 60 atgggtcggg actttaaatt cggaggattc gtcctttaaa cgttcctcca agagtccctt 120 ccccaaaccc ttactttgta agtgtggttc ggcgaatgta ccgtttcgtc ctttcggact 180 catcagggaa agtacacact ttccgacggt gggttcgtcg acacctctcc ccctcccagg 240 tactatcccc ttgctgaccg aagcaccgtt gaacccgaag gctaaccgcg agaagatgac 300 ccagatcatg ttcgagacct tcaactcgcc ggccatgtat gtggccatcc agatgactct 360 ctaaatagca atatttacctttggagggaa aagttatcag gcatgcacct ggtagctagt 420 ctttaaacca atagattgca tcggtttaaa aggcaagacc gtcaaattgc gggaaagggg 480 tcaacagccg ttcagtacca agtctcaggg gaaactttga gatggccttg caaagggtat 540 ggtaataagc tgacggacat ggtcctaacc acgcagccaa gtcctaagtc aacagatctt 600 ctgttgatat ggatgcagtt cacagactaa atgtcggtcg gggaagatgt attcttctca 660 taagatatag tcggacctct ccttaatggg agctagcgga tgaagtgatg caacactgga 720 gccgctggga actaatttgt atgcgaaagt atattgatta gttttggagt actcgtaagg 780 tagccctgga tggccacata catggccggc gagttgaagg tctcgaacat gatctgggtc 840 atcttctcgc ggttagcctt cgggttcaac ggtgcttcgg tcagctcaag gatgtgttcc 900 ctaggagggt gggtgtacct cttttggatt gctccggcct tccaggagag atagaggacg 960 acctctcccc atagggtggt gtgtgccacc cctgatgaga ccgaaaggtc gaaatgggg 1019 <210> 13 <211> 1167 <212> PRT <213> Solanum melongena <400> 13 Met Ser Val Ser His Arg Val Ile Tyr Ser Phe Thr His Tyr Lys Leu 1 5 10 15 Tyr Asn Leu Ser Ser Ser Leu Ser Ser Leu Pro Ser Arg Ile Phe Phe 20 25 30 Pro Phe Gln Ser Pro Ser Phe His Thr Phe Ser Ser Leu Met Pro Asn 35 40 45 Asn Gln Glu Arg Gly Gly Tyr Glu Gly Lys Lys Trp Gln Val Arg Pro 50 55 60 Ser Ser Asn Arg Val Pro Gly Ser Ser Ser Asn Val Glu Pro Val Ser 65 70 75 80 Ala Ala Thr Ala Glu Ala Ile Thr Asp Arg Leu Lys Ser Val Asp Ile 85 90 95 Thr Glu Ser Gly Ala Gln Ser Ser Val Pro Val Thr Ser Leu Gln Phe 100 105 110 Gly Ser Val Gly Leu Ala Pro Gln Ser Pro Val Gln His Gln Lys Val 115 120 125 Ile Trp Lys Pro Lys Ser Tyr Gly Thr Val Ser Gly Ala Pro Val Val 130 135 140 Glu Ala Gly Lys Thr Pro Val Glu Gln Lys Ser Ala Leu Leu Ser Lys 145 150 155 160 Leu Phe Lys Gly Asn Leu Leu Glu Asn Phe Thr Val Asp Asn Ser Thr 165 170 175 Phe Ser Arg Ala Gln Val Arg Ala Thr Phe Tyr Pro Lys Phe Glu Asn 180 185 190 Glu Lys Ser Asp Gln Glu Ile Arg Thr Arg Met Ile Glu Met Val Ser 195 200 205 Lys Gly Leu Ala Ile Val Glu Val Thr Leu Lys His Ser Gly Ser Leu 210 215 220 Phe Met Tyr Ala Gly His Glu Gly Gly Ala Tyr Ala Lys Asn Ser Phe 225 230 235 240 Gly Asn Ile Tyr Thr Ala Val Gly Val Phe Val Leu Gly Arg Met Phe 245 250 255 Arg Glu Ala Trp Gly Thr Lys Ala Ser Lys Lys Gln Ala Glu Phe Asn 260 265 270 Glu Phe Leu Glu Arg Asn Arg Met Cys Ile Ser Met Glu Leu Val Thr 275 280 285 Ala Val Leu Gly Asp His Gly Gln Arg Pro Arg Asp Asp Tyr Ala Val 290 295 300 Val Thr Ala Val Thr Glu Leu Gly Asn Gly Lys Pro Thr Phe Tyr Ser 305 310 315 320 Thr Pro Asp Val Ile Ala Phe Cys Arg Glu Trp Arg Leu Pro Thr Asn 325 330 335 His Val Trp Leu Phe Ser Thr Arg Lys Ser Val Thr Ser Phe Phe Ala 340 345 350 Ala Tyr Asp Ala Leu Cys Glu Glu Gly Thr Ala Thr Thr Val Cys Glu 355 360 365 Ala Leu Ser Glu Val Ala Asp Ile Ser Val Pro Gly Ser Lys Asp His 370 375 380 Ile Lys Val Gln Gly Glu Ile Leu Glu Gly Leu Val Ala Arg Ile Val 385 390 395 400 Lys Arg Glu Ser Ser Glu His Met Glu Arg Val Leu Arg Asp Phe Pro 405 410 415 Pro Pro Pro Ser Glu Gly Glu Gly Leu Asp Leu Gly Pro Thr Leu Arg 420 425 430 Glu Ile Cys Ala Ala Asn Arg Ser Glu Lys Gln Gln Ile Lys Ala Leu 435 440 445 Leu Gln Ser Ala Gly Thr Ala Phe Cys Pro Asn Tyr Leu Asp Trp Phe 450 455 460 Gly Asp Glu Asn Ser Gly Ser His Ser Arg Asn Ala Asp Arg Ser Val 465 470 475 480 Val Ser Lys Phe Leu Gln Ser His Pro Ala Asp Leu Tyr Thr Gly Lys 485,490,495 Ile Gln Glu Met Val Arg Leu Met Arg Glu Lys Arg Phe Pro Ala Ala 500 505 510 Phe Lys Cys His Tyr Asn Leu His Lys Ile Asn Asp Val Ser Ser Asn 515,520,525 Asn Leu Pro Phe Lys Met Val Ile His Val Tyr Ser Asp Ser Gly Phe 530 535 540 Arg Arg Tyr Gln Lys Glu Met Arg His Lys Pro Gly Leu Trp Pro Leu 545 550 555 560 Tyr Arg Gly Phe Phe Val Asp Leu Asp Leu Phe Lys Val Asn Glu Lys 565,570,575 Lys Thr Ala Glu Met Ala Gly Ser Asn Asn Gln Met Val Lys Asn Val 580,585,590 Glu Glu Asp Asn Ser Leu Ala Asp Glu Asp Ala Asn Leu Met Val Lys 595,600,605 Met Lys Phe Leu Thr Tyr Lys Leu Arg Thr Phe Leu Ile Arg Asn Gly 610 615 620 Leu Ser Thr Leu Phe Lys Glu Gly Pro Ser Ala Tyr Lys Ser Tyr Tyr 625 630 635 640 Leu Arg Gln Met Lys With Thr Asn Ser Ala Ala Lys Gln Arg Glu 645 650 655 Leu Ser Lys Met Leu Asp Glu Trp Ala Val Tyr Ile Arg Arg Lys Tyr 660 665 670 Gly Asn Lys Pro Leu Ser Ser Ser Thr Tyr Leu Ser Glu Ala Glu Pro 675 680 685 Phe Leu Glu Gln Tyr Ala Lys Arg Ser Pro Gln Asn His Ala Leu Ile 690 695 700 Gly Ser Ala Gly Asn Phe Val Lys Val Glu Asp Phe Met Ala Ile Val 705 710 715 720 Glu Gly Glu Asp Glu Glu Gly Asp Leu Glu Pro Ala Lys Asp Ile Ala 725 730 735 Pro Ser Ser Pro Ser Ile Ser Thr Arg Asp Met Val Ala Lys Asn Glu 740 745 750 Gly Leu Ile Ile Phe Phe Pro Gly Ile Pro Gly Cys Ala Lys Ser Ala 755 760 765 Leu Cys Lys Glu Ile Leu Asn Ala Pro Gly Gly Leu Gly Asp Asp Arg 770 775 780 Pro Val Asn Ser Leu Met Gly Asp Leu Ile Lys Gly Arg Tyr Trp Gln 785 790 795 800 Lys Val Ala Asp Glu Arg Arg Arg Lys Pro Tyr Ser Ile Met Leu Ala 805 810 815 Asp Lys Asn Ala Pro Asn Glu Glu Val Trp Lys Gln Ile Glu Asn Met 820 825 830 Cys Leu Ser Thr Gly Ala Ser Ala Ile Pro Val Ile Pro Asp Ser Glu 835 840 845 Gly Thr Glu Thr Asn Pro Phe Ser Ile Asp Ala Leu Ala Val Phe Ile 850 855 860 Phe Arg Val Leu His Arg Val Asn His Pro Gly Asn Leu Asp Lys Ser 865 870 875 880 Ser Pro Asn Ala Gly Tyr Val Met Leu Met Phe Tyr His Leu Tyr Asp 885 890 895 Gly Lys Ser Arg Gln Glu Phe Glu Ser Glu Leu Ile Glu Arg Phe Gly 900 905 910 Ser Leu Val Arg Ile Pro Val Leu Lys Pro Glu Arg Ser Pro Leu Pro 915 920 925 Asp Ser Val Arg Ser Ile Ile Glu Glu Gly Leu Ser Leu Tyr Arg Leu 930 935 940 His Thr Thr Lys His Gly Arg Leu Glu Ser Thr Lys Gly Thr Tyr Val 945 950 955 960 Gln Glu Trp Val Lys Trp Glu Lys Gln Leu Arg Asp Ile Leu Leu Gly 965 970 975 Asn Ala Asp Tyr Leu Asn Ser Ile Gln Val Pro Phe Glu Phe Ala Val 980 985 990 Lys Glu Val Leu Glu Gln Leu Lys Val Ile Ala Arg Gly Glu Tyr Ala 995 1000 1005 Val Pro Ala Glu Lys Arg Lys Leu Gly Ser Ile Val Phe Ala Ala 1010 1015 1020 Ile Ser Leu Pro Val Pro Glu Ile Leu Gly Leu Leu Asn Asp Leu 1025 1030 1035 Ala Lys Lys Asp Pro Lys Val Gly Asp Phe Ile Lys Asp Lys Ser 1040 1045 1050 Met Glu Ser Ser Ile Gln Lys Ala His Leu Thr Leu Ala His Lys 1055 1060 1065 Arg Ser His Gly Val Thr Ala Val Ala Asn Tyr Gly Ser Phe Leu 1070 1075 1080 His Gln Lys Val Pro Val Asp Val Ala Ala Leu Leu Phe Ser Asp 1085 1090 1095 Lys Leu Ala Ala Leu Glu Ala Glu Pro Gly Ser Val Glu Gly Glu 1100 1105 1110<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Lys Ile Asn Ser Lys Asn Ser Trp Pro His Ile Thr Leu Trp Ser<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 1115 1120 1125<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Gly Ala Gly Val Ala Ala Lys Asp Ala Asn Thr Leu Pro Gln Leu<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 1130 1135 1140<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Leu Ser Gln Gly Lys Ala Thr Arg Ile Asp Ile Asn Pro Pro Val<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 1145 1150 1155<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Thr Ile Thr Gly Thr Leu Glu Phe Phe<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 1160 1165<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <210> 14<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <211> 3848<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <212> DNA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <213> Solanum melongena<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <400> 14<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtgactggct caaaggcggt agtagtggct cttcttcccc gctggaattt ctcgcctatt 60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttatattgat tgacagcagc cgagtcttcc ttttgtgtag aactgaatgt cggtttcgca 120<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tagggtcatt tactctttca ctcattacaa actctataat ctctcttctt ctttatcatc 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tttgccttct agaatcttct tcccttttca atctccttcc tttcacacgt tctcttcact 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> catgcccaac aatcaggaaa ggggtggtta tgaaggaaaa aaatggcaag tgaggccaag 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttccaatagg gtaccaggct cgtcttcaaa tgtggaacct gtatctgctg caactgctga 360<h2 style=";text-align:left;direction:ltr"> agccattacc gaccgtctaa agtccgtgga tattactgaa agtggtgcac agtctagtgt 420 tccagtcaca tctcttcagt ttggcagcgt tggattagca ccccagtcac ctgtgcaaca 480 tcaaaaagta atctggaaac ccaaatcata tggaacagtg tctggagccc cagtggttga 540 agctggaaaa acaccagttg aacaaaaaag tgctctttta agtaaattat tcaagggtaa 600 tttattggaa aattttactg tagataactc aacattctcg agagcccaag taagggccac 660 tttctaccca aaatttgaga atgagaaatc agatcaggag atcaggacaa ggatgataga 720 gatggtctcc aaaggcttgg ctatagtcga ggtcacactt aagcattctg gatctctttt 780 tatgtatgct gggcatgaag gtggagcata tgccaagaat agcttcggga atatctatac 840 tgccgttggc gtctttgttc ttggacggat gtttcgtgag gcatggggaa ctaaagcaag 900 caagaagcaa gcagagttca atgagtttct tgagcgcaat cgtatgtgca tatcaatgga 960 gttggtcacg gcagtgttgg gggaccacgg acaacgccca cgagatgatt atgcggttgt 1020 gactgcagtc acggagttgg gaaatggaaa accaactttc tattcaactc ccgatgtaat 1080 tgctttttgc agggaatggc gattaccaac aaatcatgta tggctgttct caacaaggaa 1140 atcagtgact tccttctttg ctgcgtatga tgcactttgc gaggaaggta cagcaaccac 1200 cgtttgcgag gctctcagcg aagttgctga tatttctgta cctggatcaa aagaccatat 1260 aaaagtgcag ggtgaaattt tggagggtct cgtggcccgc atcgtaaaac gtgagagctc 1320 agagcatatg gagcgggttc tgagagattt tcctcctccg ccatcagagg gtgagggttt 1380 ggacctggga cctacgttac gtgaaatttg tgctgcaaac agatcagaaa agcagcaaat 1440 aaaggcactt cttcagagtg ctggcacggc tttctgcccg aattatttgg actggtttgg 1500 agatgaaaac tctggttcac attcaagaaa tgctgatcga tctgttgtct caaagttctt 1560 acaatcacat cctgctgatc tttatacagg aaaaatacag gaaatggttc gcttgatgag 1620 ggaaaagcgc tttcctgctg ctttcaagtg tcattataac ttacataaaa ttaatgatgt 1680 atcgagtaac aacctgcctt tcaaaatggt gatccatgta tatagtgatt caggcttccg 1740 ccggtaccag aaagagatga ggcacaaacc aggactatgg cctttgtatc gaggcttttt 1800 tgttgacctg gatttattca aggtcaatga gagaaact gctgaatgg caggaagca 1860 caatcaatg gtaaaaaatg tggaagga caacaattta gctgatgaag atgcaatct 1920 gatggtcaag atgaatttc ttacttacaa gttgagaact ttttgatcc gtaatggctt 1980 gtcgactctt ttcaagaag gaccttctgc gtataagtct tattacctga ggcaaatgaa 2040 aatttggaat acttcagcag ccaagcaacg agactcagc aagatgcttg atgaatgggc 2100 agtatatata cgcagaaaat atgggaacaa accattgtca tcatccacat acctaagtga 2160 agctgagcct ttccttgaac aatgcaaa gcgtagtcca caaatcatg ctttgatagg 2220 atctgctgga aattttgtca aagttgaga ttcatggct attgttgaag gagaagatga 2280 agagggtgat ctcgagcctg cgaaagatat tgctccttca agccctagta tttccaccag 2340 agacatggtg gcaagaatg agggtctcat tattttctt ccaggaatac caggttgtgc 2400 taaatctgca ctttgtagg aaatactgaa tgctccagga gggcttggag atgatcgacc 2460 agttaacagt ttaatgggtg atcttattaa agttagatat tggcaaaag ttgctgatga 2520 acgtcgaaga aaaccttact cgatcatgct tgctgacaag aatgcaccaa atgaggaagt 2580 atggaaacaa attgagaaca tgtgcctaag caccggagca tctgctattc cagttatacc 2640 tgattcagaa ggaactgaaa ctaatccatt ctctattgat gcacttgcgg tttttatatt 2700 ccgagtactt caccgtgtca atcatccggg aaatcttgac aagtcatctc caaatgctgg 2760 atatgtgatg cttatgtttt atcaccttta tgatggaaag agccgtcagg agttcgagag 2820 tgagcttatt gaacgttttg gatcgcttgt cagaattcct gtactgaaac ctgagaggtc 2880 tcctcttccg gattctgtga ggtctattat cgaggaggga ctcagtctgt acagacttca 2940 tacaacgaaa catggaagat tggagtctac aaaagggaca tatgtacaag agtgggttaa 3000 atgggagaag caattgagag atattctact tggaaatgca gactatctca attcaataca 3060 ggttccattt gaatttgccg ttaaagaagt ccttgaacaa ctgaaagtta ttgcgagggg 3120 cgaatatgca gtgcctgctg agaagaggaa gctaggatcc attgtattcg ccgctatcag 3180 cctgccagtt ccagaaattc taggtcttct aaatgatcta gcaaagaaag atccaaaggt 3240 tggcgatttc attack attack attack attack attack ggctcacaag agaagtcacg gtgtcactgc agttgccat tacggttcct ttcttcatca 3360. 3420. aaaggtgcca gtagacgtgg ctgctttgtt gttctccgat aaattggctg cactagaagc tgagcctggc tctgttgaag gtgaaagat caattctaaa aactcatggc cccatatcac attatggtct ggtgcaggag ttgccgcaaa agatgccaat acactaccac agttactttc 3540 3600. ccagggag gctacccgca ttgatataaa tccaccggtc actataactg gcactctcga attcttttga actctacttg taattcctct tgtgtggatt tacataatgt gaaccctaca tgggttctga gtgaatcatg taatgattct cctgagtttt aggaacaatt ttgtagcagt cttgcagttg caggatagaa ctagatctag agaaaatgta aagatgttta aggcaataaa 3840. ggtcttgagc tgtgggcata ttgaaaatcc ccagtagcat ttttcttgag caaaaaaaaa aaaaaaaa 3848 <210> 15 <211> 188 <212> DNA <213> Tetrahymena thermophila <400> 15 cttctgttga tatggatgca gttcacagac taaatgtcgg tcggggaaga tgtattcttc tcataagata tagtcggacc tctccttaat gggagctagc ggatgaagtg atgcaacact ggagccgctg ggactaatt tgtatgcgaa agtatattga ttagttttgg agtactcgta aggtagcc 188 <210> 16 <211> 245 <212> DNA <213> Tetrahymena thermophila <400> 16 atgactctct aaatagcaat atttaccttt ggagggaaaa gttatcaggc atgcacctgg tagctagtct ttaaaccaat agattgcatc ggtttaaaag gcaagaccgt caaattgcgg 180. gaaaggggtc aacagccgtt cagtaccaag tctcagggga aactttgaga tggccttgca aagggtatgg fathercctg acggacatgg tcctaaccac gcagccaagt cctaagtcaa cagat 245 <210> 17 <211> 1452 <212> DNA <213> Private Sequence(Artificial Sequence) <220> <221> <222> <223>

[0013] [PubMed] (Nucleotide sequence of the invention) <400> 17 ccccataggg tggtgtgtgc cacccctgat gagaccgaaa ggtcgaaatg gggtttcgcc 60 atgggtcggg actttaaatt cggaggattc gtcctttaaa cgttcctcca agagtccctt 120 ccccaaaccc ttactttgta agtgtggttc ggcgaatgta ccgtttcgtc ctttcggact 180 catcagggaa agtacacact ttccgacggt gggttcgtcg acacctctcc ccctcccagg 240 tactatcccc ttcttctgtt gatatggatg cagttcacag actaaatgtc ggtcggggaa 300 gatgtattct tctcataaga tatagtcgga cctctcctta atgggagcta gcggatgaag 360 tgatgcaaca ctggagccgc tgggaactaa tttgtatgcg aaagtatatt gattagtttt 420 ggagtactcg taaggtagcc gctgaccgaa gcaccgttga acccgaaggc taaccgcgag 480 aagatgaccc agatcatgtt cgagaccttc aactcgccgg ccatgtatgt ggccatccag 540 atgactctct aaatagcaat atttaccttt ggagggaaaa gttatcaggc atgcacctgg 600 tagctagtct ttaaaccaat agattgcatc ggtttaaaag gcaagaccgt caaattgcgg 660 gaaaggggtc aacagccgtt cagtaccaag tctcagggga aactttgaga tggccttgca 720 aagggtatgg tataagctg acggacatgg tcctaaccac gcagccaagt cctaagtcaa 780 cagatcttct gttgatatgg atgcagttca cagactaaat gtcggtcggg gaagatgtat 840 tcttctcata agatatagtc ggacctctcc ttaatgggag ctagcggatg aagtgatgca 900 acactggagc cgctgggaac taatttgtat gcgaaagtat attgattagt tttggagtac 960 tcgtaaggta gccctggatg gccacataca tggccggcga gttgaaggtc tcgaacatga 1020 tctgggtcat cttctcgcgg ttagccttcg ggttcaacgg tgcttcggtc agcatgactc 1080 tctaaatagc aatatttacc tttggaggga aaagttatca ggcatgcacc tggtagctag 1140 tctttaaacc aatagattgc atcggtttaa aaggcaagac cgtcaaattg cgggaaaggg 1200 gtcaacagcc gttcagtacc aagtctcagg ggaaactttg agatggcctt gcaaagggta 1260 tggtaataag ctgacggaca tggtcctaac cacgcagcca agtcctaagt caacagattc 1320 aaggatgtgt tccctaggag ggtgggtgta cctctttttgg attgctccgg ccttccagga 1380 gagatagagg acgacctctc cccatagggt ggtgtgtgcc acccctgatg agaccgaaag 1440 gtcgaaatgg gg 1452 <210> 18 <211> 3820 <212> DNA <213> Arabidopsis thaliana <400> 18 agaaacgacg ttgtgttcaa gttactaaat cgcgtgtgtt tttactttt ctgcaactaa 60 atcgtgtttc ttcctaagaa ccctaaatct gaactgtctc atcttctccg atatcagtga 120 gatcaataa tcatcttctc acccttagacg acagggaaac tcggggattg attcggaaaa 180 240 ccgaagatgg atgctccatt tgaatccggt gatagttcgg caacagttgt tgcagaagca 300 gtaaacaacc aatttggcgg gttaagtctt aaggaaagca acactaatgc gccagtctta 360 ccgagtcaaa ctacaagtaa ccaccgtgtt caaaatctag tatggaaacc taagtcatat 420 ggaacagtta gtggatcatc ttcggcaaca gaagttggta aaacatcggc tgtctcacag 480 ataggttctt ctggagatac aaaagttggt ctcaatctga gcaaaatttt cggaggtaat 540 ttgttggaaa aattttcggt ggacaaatcg acttattgtc atgctcagat cagagccact 600 ttctatccaa aatttgagaa cgaaaagact gaccaagaga taagaacaag aatgattgag 660 atggtatcta aaggattggc aactggag gtatctctta agcattcagg ctctctcttt 720 atgtacgccg gtcacaaggg gggagcatat gcaaagaaca gttttggtaa tatttatact 780 gcggttggtg ttttgttct ttcacggatg ttcagggagg cttggggaac taaggctcca 840 aagaaagaag cagagttcaa tgatttcttt gagaaaaatc gcatgtgcat atctatggaa 900 ctggtaaccg ctgttcttgg agatcatggt caacgcccac tggatgatta tgtggtagtg 960 actgctgtta ccgagttagg taatgggaag ccccagttct attcaacttc cgaaataatt 1020 tcattttgcc ggaaatggcg tctacccaca aatcatgttt ggctgttttc cacaaggaaa 1080 tcagtgacct cttttttcgc ggcgtttgat gcactgtgtg aagaagggat agcaacctcg 1140 gtctgtagag ctcttgatga agtagctgat atatcagtcc cagcctcaaa ggaccatgtt 1200 aaggtgcagg gtgagatatt agagggtctt gttgctcgta tcgtgagcag tcagagctca 1260 agagatatgg aaaatgtctt gagagatcat cctccaccac cctgtgatgg agctaatctt 1320 gatctgggac tcagtctaag agagatatgt gctgcccata gatctaacga gaacagca 1380 atgagagcac tttaggag tgttgggcca agctttgcc ccagtgacgt ggaatggttc 1440 ggagatgaat ctcatccgaa aagtgctgac aaatctgtta taacaaattt cctgcaatct 1500 cagcctgcag attattcac tagtaatta caggaatgg tacgctgat gaaggaaaaa 1560 cgtcttccag ccgcattcaa gtgttaccat aatttcata gagctgagga catacacct 1620 gataaccttt tttataaatt gttgtccat gtgcacagcg attcaggatt taggcgttac 1680 cacaagaga tgaggcacat gcctagtttg tggcctttat atcgaggtttt ctttgttgat 1740 attaatttgt tcaagtcaa caagggagg gatctgatgg ctctgaaag cattgaataat 1800 gccagtgaaa atgatggtcg aggaaaag gatggtttgg ctgatgatga tgctaactta 1860 atgattaaaa tgaagttct cacatacaag ttgagaacct ttgatccg taatggccta 1920 tcaatctat ttaagacgg ggcagcagct tacaaactt actaccttag gcaatgaaa 1980 atctggggta cgtcagatgg aaagcagaaa gaactttgca agatgcttga tgaatgggct 2040 gcttacataa gaaaagtg tgggaatgat cagctatctt catcaacata cttaagtgaa 2100 gctgagccat tcctggagca gtacgcgaaa cggagcccaa agaaccatat tttgataggg 2160 tctgctggga acctagttag aactgaggac ttcttggcca ttgttgacgg tgatctagat 2220 gaagaggcg atcttgtgaa gaacaagga gtgacaccag ctactcctga gccagctgtg 2280 aaagctg tccaaaagga tgaggggtta attgtattct ttccaggaat tcctggatct 2340 gctaaatctg cactttgcaa ggagttattg aacgccccag gaggctttgg agatgatagg 2400 ccagtgcata ctctgatggg tgatcttgtc aaaggaaaat attggccaaa ggttgctgat 2460 gaacgtcgta aaaaaccaca atcgattatg ttggctgaca aaaatgcccc aaatgaagat 2520 2580 gctgattctg aaggaaccga tacaaatcca tattcacttg atgccttggc tgtattcatg 2640 ttccgtgtac ttcaacgagt taaccatccg ggaaagctcg acaaggaatc ttcaaatgca 2700 ggttatgtgc tattgatgtt ttatcacctt tatgagggaa agaaccgtaa tgaatttgag 2760 agtgaattga ttgagcgctt tggctccctc atcaagatgc cactattgaa atcagacagg 2820 actcctttac ctgatcctgt taaatcagtt cttgaggagg gcattgattt gttcaatctc 2880 catagtagaa gacatgggag actcgagtca acaaaaggaa catatgcagc ggaatggacc 2940 aaatggaga aacaactacg agatactcta gttgcaaatt ctgagtatct cagttctatt 3000 caggttccat ttgagtctat ggttcatcaa gtgcgagaag agctaaaaac aatagcgaag 3060 ggtgattaca agccaccaag ttcggagaaa agaaaacacg ggtctattgt tttcgctgcc 3120 atcaacttgc ctgctactca agttcacagt cttcttgaaa agttggctgc agcaaaccca 3180 aaatgagat cttttctaga gggaaaaaa aagagcatac aggaaaaaact tgaacggtct 3240 cacgtgacgc tcgcccaa gagaagccat ggcgtagcaa ctgtagccag ctatagtcag 3300 cacttgaaca gagaggtacc cgtagagctc accgagctca tctacaacga caagatggct 3360 gctctaacag cccatgttgg atctgtggac ggagagaccg tagtctccaa gaacgaatgg 3420 ccacatgtta cattgtggac agcggaaggc gttactgcga aagaggccaa cacgttacct 3480 cagctttact tagaaggaaa ggcgagccgc ttggtgatag atcctccggt gtcaatctca 3540 ggtcctctgg agttttctg aatacttgat taaacatgga agttctctc ttgagggagg 3600 ttgctcgtgg aatgggacac atatggttgt tataataaac catttccatt gtcatgagat 3660 tttgaggtta atatatactt tacttgttca ttattttatt tggtgtttga ataaatgata 3720 taaatggctc ttgataatct gcattcattg agatatcaaa tatttactct agagaagagt 3780 gtcatataga ttgatggtcc acaatcaatg aaatttttgg 3820 <210> 19 <211> 3876 <212> DNA <213> Solanum lycopersicum <400> 19 tatggaaccc aattggagag tgccggttcc ccctgaaatt ttctggcttc atctgtatac 60 aacagttgag tcttcctttt ctatagcact gaatgcggt tttcgttcac tctttcactg 120 ctaaactcca tctccctcac aatctctctt cttctttcttc ccatatttc cctctagaa 180 tctctttcg ctttcaatct cgtccctca cacacagtac ctcgctattc tcttcactca 240 tgccaaacaa tcagagaaag ggtggttata aagaaaaaaa atggcaagtg aggagttcca 300 atagggtacc aggttcatct tcaaatgcg aacctgcatc tcctgcaact actggagcca 360 ttgctgaccg tctaagttcc ttgaatatta ctgaaagtgg tgcacagtct agtgttccag 420 ttgcatctct tcagtttggc agcgttggat tagcacccca atcacctgtg cagcatcaaa 480 aagtcatctg gaaacccaag tcatatggaa cagtgtctgg agccccaaag attgaagctg 540 taaaaacacc aaatgaacaa aaaagtgctc ttttgagcaa attatttaag ggtagtttat 600 tggaaaattt tactgtagat aactccacat tctcaaaagc ccaaataagg gccactttct 660 acccaaaatt tgagaatgag aaatcagatc aggagattag gacaaggatg atagagatgg 720 tctccaaagg cttggctaca gtggaggtct ctcttaagca ttctggatct ctttttatgt 780 atgctgggca taagggtgga gcatatgcca agaatagctt tggaaatatc tatactgccg 840 ttggtgtctt tgttcttgga cggatgtttc gtgagacatg gggtactcaa gcaagtaaga 900 agcaagcaga gttcaatgag tttcttgagc gcaatcgcat gtgtatatca atggagttgg 960 tcacggcagt gttgggggac cacggacaac gcccacgaga tgattatgcg gttgtgactg 1020 cagtcacgga gttgggaagt ggaaaaccaa atttctattc aactcccgat gtaattgctt 1080 tttgcagaga atggagatta ccaacaaatc atatatggct gttctcaaca aggaaatcag 1140 ttacttcctt ctttgctgcg tttgatgcac tctgtgagga aggtacagca acctctgttt 1200 gccaggctct tgctgaagtt gctgacattt ctgtacctgg atcaaaagac catataaaag 1260 tgcagggtga aattttggag ggcctcgtgg cacgcattgt aaaacgtgag agctcagagc 1320 atatggagcg ggttctaaga gattttcctc ctcctccatt agagggtgag ggtttggact 1380 tgggacctac gctgcgtgag gtttgtgctg caaatagatc agaaaagcag caaatcaagg 1440 cgcttcttca gagtgctggc acggctttct gcccgaatta tttggactgg tttggagatg 1500 atgattctgg ctcacattca agaaatgctg atcgctctgt tgtgtcaaag ttcttacagt 1560 handicapcctgc tgatttttct acaggaaaat tacaggaaat ggttcgtttg atgagggaaa 1620 aacgctttcc tgctgctttc aagtgttact ataacttcca taaaattaat gattatcga 1680 gtgacaacct gcctttcaaa atggtgatcc acgtacatag tgattcaggc ttccgccggt 1740 accagaaaga gatgagacac aaaccaggac tgtggcctttt gtatcgaggc ttttttgttg 1800 acctggattt attcaaggtc aatgagaaga aaactgccga aatggtagga agtagcaatc 1860 aaatggtaaa aaatgaggaa gaggatagcc gtttagctga tgaagatgca aatttgatgg 1920 tcaagatgaa attccttcct tacaagttga gaactttttt gatccgtaat ggcttgtcga 1980 ctcttttcaa agaaggccct tctgcgtata aggcttatta cctgaggcaa atgaaaatat 2040 ggaatacttc agcagccaag caacgagaac tcagcaagat gcttgatgaa tgggcagtat 2100 atatacgcag aaaatatggg aacaaaccat tgtcatcatc cacataccta agtgaagctg 2160 agcccttcct tgagcaatat gcaaagtgta gtccacaaaa tcaggcgttg ataggatctg 2220 ctggaaattt tgtcaaagtt gaagacttca tggctattgt tgaaggagaa gatgtagagg 2280 gtgatcttga gccgaccaaa gatattgctc cttcaagccc tatattcc agcaaagaca 2340 tggtcgcaaa gaatgagggt ctcatcgttt tttttccagg aataccaggt tgtgctaaat 2400 ctgcactttg taaggaaata ctgaatgctc caggagggct tgaagatgat cggccaattc 2460 atagtttaat gggtgatctt atcaaaggta gatatggca aaaagttgct gatgaacgtc 2520 gaaaaacc ttactcgatc atgcttgctg acaagaatgc accaaatgag gaagtatgga 2580 aaaattga gaacatgtgt ctaagcacca aagcatctgc tattccagtt atacctgatt 2640 cgaaggaac tgaaatcaat ccattctcta ttgatgcact ggcggttttt atattccgag 2700 tacttcagcg tgttaatcat ccgggaaatc ttgacaagtc atctccaaat gctggatatg 2760 tgatgttaat gtttatcac ctttatgatg gaagagccg tcaggagttc gagagtgaac 2820 ttattgaacg ttttggatca cttgtcagaa ttcctctact gaaacctgaa aggtctctct 2880 ttccggattc tgtgaggtct attgttgagg agggaatcaa tctgtacagg cttcatacta 2940 acaaacatgg aagattggag tctacaaaag ggacttttgt aaaagagtgg gttaaatggg 3000 agaagcaatt gagggatatt ctacatggaa atgcggacta tctcaattca atacaggttc 3060 catttgaatt tgctgttaaa aaagtccttg aacaactgaa agctattgcg aggggcgaat 3120 atgcagctcc ttcttctgag aagagaagc taggatccat tgtgtttgcc gctatcagcc 3180 tgccagttcc agaattcta ggtcttctga atgatctagc caagaagat ctgaaggttg 3240 gtgatttctt gaaggacaaa agcctggaga gctgcattca gaagcccat ttgacctag 3300 ctcacaagag aagtcatggt gtcactgcag ttgccaatta cggttccttt cttcaccaaa 3360 acgtcccagt agacgtggct gctttgttgt tctccgataa attggctgcc ctagaagctg 3420 agcctggttc tgtcgaaggt gaaaaggtcg attctaaaa cccatggccc cacgtcacaa 3480 tatggactgg ggcaggagct acagccaaag atgccaacac actaccacag ttactttctc 3540 aagggaaggc tatccgcatt gataatc caccgtcac tataactggc actctcgaat 3600 tctttgaac tctacatgta attcctcatc tgtgtggat ttacctaatg taaaccctac 3660 atgggttctg agtgaatatc atgtaatgac actcccgagt tgtaggaca attttgtagg 3720 atcgtgcgct ttggctatat agcagcttg cagttgcagg atagaatag atttagagaa 3780 aatgtaaga tgttgaggca ataaggtct taagtcgtgg gcgttttgaa atccccgatg 3840 gcattttctg aaaagcac accattctct accctt 3876 <210> 20 <211> 3860 <212> DNA <213> Hevea brasiliensis <400> 20 gcctgctaac tccttctccc ctttttttct cctactggca gttagtagag acattgaacc 60 ccaaaacctc tccagaaacc tccacctgca actttttgcg ctactgagtc acccactctc 120 tctctctccc tctctctctc tctctccctc tctctccgtt ctttcggtta ctatttatag 180 ccattgccac accaactatg cgaagcatcc tcttcacact ttctctgact ctcccgtttt 240 ctcctccttc cctaaacctc aaatctaaaa gcttcatttt ccttcgatct tctccttcct 300 ttttagccct acctcgctct tcttctcttt ccatttctca tctaatcatg tctcagagaa 360 agggcgggct tgaaggacaa cagtggaaac cgaatccaac cacggaccag ccgtctccct 420 ccggtctggg tgcatcggtt gcggcggtta ccgatagaat tggtggtttg agtatagccg 480 aaagcagtgg ccagagtcat gttgtggagc cattgcccgt gccgtttggt aatgcgcaag 540 tggttaatca gtgtaacttg caaggtcaaa aggctatatg gaagcctatg tcctatggaa 600 cagtaagtgg agcttcaact gtggaagttg aaaatgtgcc ttctaatgga atgctggttg 660 atgtccagag cagtgcgtct ggtacagctt cggtggcagc tcggaagagt agtgttaact 720 tgagtcaatt ctttaggggt aatctgttag aaaattttgc tgtggataat tcgacttatt 780 cacaagccca aattagagcc actttctatc ccaaatttga aaatgagaag tctgatcagg 840 agattaggat cagaatgata gagatggtat ctaaagggct ggctacattg gaggtcacac 900 tcaagcattc tgggtctctt tttatgtatg cgggtcataa gggtggagca tatgcaaaaa 960 atagcttcgg aaatatatac actgctgttg gtgtctttgt tcttggtcga atgtttcatg 1020 aggcatgggg aaccgcagct gcaaaaaagc aagcagagtt caatgagttt cttgagagaa 1080 accgaatgtg tatatcaatg gaattggtaa ctgcagttct aggagaccat gggcaacgac 1140 cccgagagga ttatgtggtg gtcacagcag tcacagagtt aggcaatgga aagccaaagt 1200 tctactcaac tcctgaattg attgcctttt gtcgaaaatg gcgccttcca acaaatcatg 1260 tttggctgtt ctcaacgagg aaatcagtaa cgtctttttt tgctgcctat gatgcactat 1320 gtgaagaagg aacagcaacc actgtatgta gggctcttga tgaagttgct gatatttctg 1380 tcccaggttc aaaagaccat ataaaggtgc agggtgaaat cctggagggt cttgttgctc 1440 ggattgtagg tcctgacagc tcaaaacaca tggaggatgt cttgagggaa catcctcctt 1500 caccagctga aagagcggac cttgatttgg gactaagtct aagagaaatt tgtgctgcta 1560 atagggctga tgaaaaacag caaataaag cgctacttca gagcattggc tcttcttttt 1620 gccctgacaa ttcagactgg tttgggattg aaggtggtga tacccattca agaaatgctg 1680 acagatctgt tgtttcaaaa tttttacaag ctcaccccac tgattattca accaagaagt 1740 tgcaggaaat ggttcgtttg ctgagaagaa gacgcttccc agctgctttt aaatgttacc 1800 ataacttcca aaaaattgat tctgtatcaa gtgacaacct tttctacaag atggttattc 1860 atgtccacag tgactctgga tttcggcgat atcaaaaaga gatgaggcac aagccagggt 1920 tgtggccatt gtatcgaggt ttttttgttg acatcaattt attcaaggca aacaaggaga 1980 gagctgctga aattgcaaaa aataacaata acatggagga aactattaat ggcaatgatg 2040 ctgtatctgc aaaagatggt atagctgacg aagatgcaaa tttaatgata aaattaaaat 2100 ttcttacata taagttaaga acctttttga tccgcaatgg tttgtcgatt cttttcaagg 2160 atggtccatc tgcttacaag gcctactacc tgaggcagat gaaaatatgg ggcacatcag 2220 ctggaaagca gagagaactc agcaagatgc ttgatgaatg ggctgtctac atccgaagaa 2280 aacatggaaa gaaacagttg tcatcctcaa tataccttag tgaagctgag ccttttcttg 2340 aacagtatgc aagtcgaagt ccagagaatc aggctctgat aggatctgct ggaagtttag 2400 ttagggctga agatttcttg gccattatag gagacaggga tgaagagggt gatcttgaga 2460 cagagcgaga ggtggcgccc ccgagcccta tgtcctcagt caaggacact gttcaaaaga 2520 atgagggttt aattgtattt tttccaggaa tacctggttg tgctaagtct gctctttgca 2580 aggaattact aaatgcccct ggaggacttg gagatgatcg ccctgtccat agtttgatgg 2640 gggaccttat caaaggaaag tattggcaga aggttgctga ggagcgcagg agaaaaccat 2700 attctataat gctggctgac aagaatgcac caaatgaaga agtttggaga cagattgaag 2760 atatgtgccg tagcacccga gcgtcagctg ttcctgttat acctgattct gaaggaacag 2820 attcaaatcc atttctctt gatgcattat cagtttcat ttccgtgtt cttcaacgag 2880 ttaatcatcc gggaaatctg ugaraagcat ctccaaatgc tggttacgtg cttttaatgt 2940 tttatcatct ttatgatggc agagtcaac agagtttga gagtgaatta attgaacgtt 3000 ttggctctct agtgaagagatg ccattgctga aatcggatag gagtccctctg ccagatccctg 3060 tgaggtcaat ttggaagg ggaataaatc tatacgggct tcacaccac agccatggca 3120 gatggaatc taccaagggg tcatatgcaa aggaatggggc aaattgggag aagcggttgc 3180 gtgaagttct attcagcaat gcggagtacc tcattccat tcaggttcct ttgagtctg 3240 cagttaagca agtgctggaa cagctaagaa aaattgctaa gggtgaatac acaaccaa 3300 ttattgagag gaggaaactt ggaacaattg ttttgctgc tattcgattg ccagttccag 3360 aaatctgtag ttccctcaac aatttggctc agagaaccc caggttgaa gccttctctc 3420 aggacaagca cttggagcac aaccttaaga agactcactt gaccttgcc cacaagagaa 3480 gtcatggcgt tacagcggta gcaagttatg gactgttctct caatcagaag gtcccagtag 3540 aattgactgc acttctcttc acagataaaa tggctgccct agaagcacaa ccaggttctg ttgatggcga aaaagtagtt tcaaaaaatg agtggccgca tattaccata tggaccgcag atggagtagc acccaaagaa gccaacacac tgcctcaatt gttctcagag gggaaagcaa ctcgtgttga attcagtccg ctcatcacca tatcgggcac agtgcaattt tattgagttc aatttttttt ttaacaaatt ggatttgaag cttagtttttt tagctgctga gaagtaattt gtataggcga aaacaaggtg <210> 21 <211> 4470 <212> DNA <213> Prunus avium <400> 21 tgcccttgcc ctttgcagtg gaagtggcct taggctttg gttcatcggc gtagcggaag gtgaaaaata tgaaattatg gatttttata gaggaagag tcggcgtagg tgtgatcgga 180. gagcgggcat gaaagccgca tcgacaaccg ccattgctat gcacgaagat atcttcgagg cagcccatgg atatctggat aaagatttga gctttacttt gatcggattt ctaagttcga tattcatgg gcgtaattc aaatgtctca aatatctatg tgagcatgaa cctcttcagc ggcaacccct ctcctccagt gaggtggggt ggctgaccag aagggacaga tgtcaagaaa 360 gtagataggt acgagggagg tacaggcaaa aaggaaaaca ggaaaattgg aatcccgagc 420 acctctctct cccctgaacc cggtcgccgc ttgttcctac ttccaaggtt tataacacac 480 aaaatcccag tgcagcaacc tccataaccc gccgtgtgtc tcttccactt ggctactcat 540 ccacattctc tctctctctc tctctctcat ataaaaatac aagcgtagaa ggttgcacgt 600 cgaaagcagc gattgaatgt gggcgtcaca gaaaatcatc tatgctctcg ctctccctct 660 tgccttctcg tcttcgtcta cagccctcgt ttccggaacc ttcctcttcc tcaggtcctc 720 ctctccttcg tacgcataca cagccaaacc tcgctttctc tcgctctctt tctcctcttc 780 caattctccc tcgcattcga ccatgcctta caaccagaga aggggcgggc ttagagaaca 840 aaagtggaca gaaaaacaaa agactgacag ccaaccaacc tccacagggg attcatcagc 900 agctgctgtg gaagttgcca ctaacagagt tggcggattg agtctcagtg gaagcagtgg 960 gcagaccaat gcttcagtta aacccataca gtttgggaag gtccagtcgg taaatcaggg 1020 tctagtccaa ggtcagaaag gaatctggat tcctaaatca tattcgacag tcagtggagc 1080 tagacaata gaagttgaag cacctgttga taaagtaca gttggaatct caggcaatgg 1140 agctggcaa gcagcagata aaaaaaccag tgttggttta agtaagttgt tcaagggtga 1200 cctgttggaa aattttactg tggacaactc cacatatgct caggtgcaag tgcgcgctac 1260 1320 gatggtatct aatggcttgg ctaccttgga ggtttcactt aaacactctg ggtctctttt 1380 tatgtacgct ggtgataagg gtggggcata tgccaaaaac agctttggga atatatacac 1440 tgctgtaggt gtatttgttc ttggacggat gtttcgggag gcatggggac gtgaagcagc 1500 1560 actcgtaact gctgttctag gagaccacgg acagcgccct aaagagatt tcgttgtagt 1620 gacagcagtc acagatttgg gcaatgggaa gccaaagttc tatgcaaccc ctgagataat 1680 tgctttctgt agaaaatggc gtctaccgac aaatcatgta tggctgttct caaaaggaa 1740 agcagtgaca tcactttg ctgcctttga tgctctctgc gagaaggaa ctgcacacc 1800 tgtatgcata gctcttaatg aaattgcaga tatatccata cctggttca aagagcatgt 1860 aagggagcag ggtgaaatct taggaggtat tgttgctcgt attgtaagcc aggagagctc 1920 aaaacacatg gagaaagtcc tgaatgattt ccctcctcca ccaatggatg gagttggtct 1980 tgatttggga cctagcgtaa gggagctttg tgctgcaaat aggtcgagtg aaagcagca 2040 aaaaagcg attcttgagg gtgttggctc ctctttgc cctgaccatt cagactggct 2100 tggaactgga gctggtgatg cccattccag aaatgcagat ataaattgg tgctatcaa 2160 acttttacaa tctcatgctg ctgatttttc taccaccaaa ttgcaggaaa tgatcgttt 2220 gatgaaagag aaacgttatc ctgctgcctt taaatgttac tataactacc acaaattga 2280 ttccatatca agtgacaacc tttttata aatggtcgtc catgtccata gtgattccgc 2340 atttcgacgt taccagaag agatgaggtc aaagccagga ttgtggcctt tatatcgagg 2400 ttttttgtt gataattt tattcaggc aagcaggag agagctgctg agatagcaaa 2460 agacaaaagt agcattgtgg aagacgttag cagtgatatg cctggaaaat atggattggg 2520 tgatgaagat gcaaacttaa tgataaaatt gaaatttctt acatataagc tgcgaacctt 2580 tttgattcgt aatggttgt caattctttt taaagaaggt ccagctgctt ataaagccta 2640 ttacttgagg caaatgaaag tatggggaac ttcagcagca aagcagaggg aactcagcaa 2700 gatgcttgat gaatgggctg tgtatacg aaggaaatgt ggaaacaaac agctgtcgtc 2760 atcagtgtac ctcagtgagg ctgagccttt tcttgaacag tatgcaaaac gcagtccaca 2820 aaatcaggct ctcataggat ctgctggaaa cttagtaagg actgaagatt tcttggccat 2880 tgttgaggga ggaagagacg aagaaggtga tcttgagagg gaccgggagg ttgcaccatc 2940 aagccccagt gcctcagcca gggacaccat tccaaaggct gagggtctga ttgtctttctt 3000 tcctggacta cctggttctg ctaagtcagc actatgcaag gaactactaa atgccccagg 3060 tggaatggga gacgatcggc caattcaaag cctgatgggt gaccttatca aaggaagata 3120 ttggcagaag gttgctgatg agcgcaggag aaaaccatat tcaataatgc ttgcagacaa 3180 gaatgcacca aatgaaag tatggagaca gatagaagac atgtgccaca gcaccagggc 3240 ctccgcagtt ccagttgttc ctgattctga aggaaccgat tcaaatccgt tttcgcttga 3300 tgcattagcg gttttcatgt ttcgggtgct tcaacgtgct aatcatccgg gaaaccttga 3360 caaggaatct ccaaatgctg gctatgtgct gctaatgttc tatcaccttt atgagggcaa 3420 gagtcgccgg gagtttgacg gcgaattagt agagcgtttt ggctcacttg tcaagatgcc 3480 attgctgaaa tctgatagga atccattgcc cgatcctgtg aagtctattc tggaggggg 3540 aataatcta tacaagcttc acactgccaa acatggagaa gtggagtcaa caaagggaac 3600 3660 aggattctt aattctgttc aggttccctt tgagtctgct gttaagggacg tatcagaaca 3720 gctgagaaa attgcacaag gtgagtacaa aactccagat actgggaaga agaagtttgg 3780 ggccattgtt tttgctgccg ttagcttgcc tgttacggaa atcagtgatc tgcttgataa 3840 tttggctgcg aaaaatagtg aagctgggagc tttccttaaa gacaagcatt tggagaatct 3900 taataggct catgttactc ttgcacataa gagaagtcac ggtgttactg ccgtggctag 3960 ttatggcacc ttcctccaca aaacggtccc tgtggatcta actaagctgt tcttctcgga 4020 taaaatggct gcacttgaag ccagccttgg ctctgttgaa ggagaaagg tagtatcgaa 4080 aaatgagtgg ccacatgtca ccttatggac cgcagaaggg gttgcagcaa aggaggccaa 4140 caagttaccc cagttgcatt cagagggaaa ggtacctgt attgcattg accacctgc 4200 caccattgat ggcacgctgg aatttctg aggtttgtat tcattttaga ggcatgatgg 4260 accagaccag gccaggccag attgacctcg tacaatttcc tttgatgatg ccagtgttct 4320 atgaagagat agctcactg ctcaatgaa ggagaaatt ttgtagtca ggagaaggaa 4380 attttgacga gttgattcta ttgagaagtt ttgtgtatat agcaattga agttttgaaa 4440 tagattgg gaaaaaaaa atttgaata 4470 <210> 22 <211> 4196 <212> DNA <213> Malus domesticated <400> 22 atattgtgta tcgcggaaca ccgaaacctca ttgcgctct cccctgaacc cggtcgctgc 60 tacctagttc caaggatttt acaccaaaac ctcagagcag cccaggtacg gacacgccgc 120 aaactccaga agttgtctct cttccacttg gcggctcatc agccacatcc gcattcgttc 180 tctgggaaac tctctctctc tctctcatat aaatatagaa gcgtagtggt ggcacgtcca 240 gagtagcaat tatatgtggg cgtcgcagag aatcatctat gctctcgctc tcgctcatcc 300 cctctcgtct tcgtcagcct tcgtttccgg aattttcctc ttcctccggt cctcctctcc 360 ttcctccgcc catcctcgct ttctccctcc ctcgctttct ctctcctctt ccatctcgct 420 cccccattcc agcatgcctt acaaccagca aaggggtggg cgtacagaac aaaagtggac 480 acaaaagcaa aagactgaca gcccgtcaat gtccactggg gattcttcag cagctgtcac 540 taacagagtt ggtgagttga gtcttactgg aagcaatggg caggccaatg cttcagttga 600 acccacacag tttgggaagg tccaattggc aaatcagggt ccagttcaag ggcagaaagg 660 aatttggatg cctaaatcat atgtgacagt gagcggagct aaggcggtag aagttgaagc 720 aaatgttgat gaaagtacag ttggaaccca aggaaatgga gctggacaag cagcagctca 780 aaaaaccaga gttggtttaa gtaagctgtt caatggtaat ctgttggaaa atttactgt 840 ggacaactcc acttatgctc aggtgcaaat acgagctact ttctatccca aatttgaaaa 900 tgagaagaca gatggggaga ttaggacaag gatgatagag atggtatcta acggcttggc 960 taccttggag gtttcactta aacactcagg gtctcttttt atgtacgccg gtaataaggg 1020 tggggcatat gccaaaaaca gctttgggaa tatatatacg gctgtaggtg tatttgttct 1080 tggacggatg ttcgggagg catggggacg tgaagcacca aaaatgcaag aagagtttaa 1140 tgattcctt gagaggaatc gtatgtgcat atcaatggaa cttgtaactg ctgttctagg 1200 agaccatgga caacgcccga aagaagattt tgctgtagtg acggcagtca cagatttggg 1260 caatggaaag ccaaagttct actcaacccc tgagataatt gctttctgta gaaaatggcg 1320 cctaccaaca aatcatgtat ggctgttctc aacaaggaaa tcagtgacat cattttttgc 1380 tgcctttgat gcactctgcg aagaaggaac tgcaacacct gtatgcatgg ctcttaatga 1440 agttgcagat atatctatac caggttcaaa agatcatgta aaggagcagg gtgaaatctt 1500 agagggcatt gttgctcgta ttgtaagcca ggaaagctca gaacatgtgg aaaaagtctt 1560 gaaagatttc cctcctccac caatcgatgg agctggtctt gatttgggac cgagcgcacg 1620 agatatttgt gctgcaaata ggtcgagtga aaagcagcaa atagaagcgc ttcttgaggg 1680 tgttggctcc tctttttgcc ctgaccattc ggactggtttt ggagttggag ctggtgatga 1740 ccattccaga aacgcagata aatctgtgct atcaaaactt ttgcaatctc atcctgcaga 1800 ttttctacc accaaattgc aggaaatgat tcggttaatg aaagaaaagc gttttcctgc 1860 tgcctttaaa tgttaccatg actaccacaa agttgattcc atatcaagtg acaacctttt 1920 ctataaaatg gtcatccatg tccatagtga ctccgcattt aggcgttacc agaaagagat 1980 gaggtctaag ccaggactgt ggcctttata tcgaggtttt tttgttgaca ttaatttatt 2040 caaggcaagc aaggagagag ctgctgagat agcaaaaggc aaaagcagca ttgtggaaga 2100 tgggaacaat ggtatgcctg gaaaatatgg attggctgat gaagatgcaa acttaatgat 2160 aaaactgaaa tttcttacat acaagctgcg aacctttttg attcgcaatg gtttgtcaat 2220 tctgtttaaa gaggtacag ctgcttacaa gacctattac gagcggcaa tgaaaatatg 2280 gatacttca gaaccaaga agagggact cagaagatg cttgatgaat gggctgtgta 2340 catacgaagg aaatgtggaaaaccgct ttcatca gtttaccca gtgaggctga 2400 gccttttctt gaacagtag caaacgcag tccacagaat cagtctctca ttggatctgc 2460 tggaaacttt gtaagggctg aagatttcct ggccattgtt gagggaggaa gagatgaaga 2520 gggtgatctt gagagggagc aggaggttgc accatcaagc cccagtgcct caggcaggga 2580 cactaccca aaggctgagg gtctgattgt attctttcct ggactacctg gttctgctaa 2640 gtcagcatta tgcaggac tactcaggac cccaggaga atgggagatg atcgaccaat 2700 tcaagcctg atgggtgacc ttatcaagg aaatattgg cagaaggttg ctgaagagcg 2760 caagaaaaaa ccatattcca taatgcttgc agacaagaat gcaccaatg aagaagtag 2820 gagacagatt gaacacatgt gcacagcac taggcctcc gcggttccag tcgtgcctga 2880 ttctgaagga accgattca atccattttc tctgatgca ttagcaattt tcatgtttcg 2940 ggtgcttcaa cgtgctaatc atccaggaaa ccttgacaag gaatctttaa atgctggcta 3000 tgtgctgcta atgttctatc acctttacga gggcaagagt cgccgagagt ttgatgggga 3060 attagttgag cgttttggct cacttgtaaa gatgccgttg ctgaagtctg ataggaatcc 3120 attacctgat cccgtgaaga atattctgga ggagggaata aatctataca agcttcacac 3180 cgccaaacat ggaagattgg agtcgaccaa gggaacctat gcaaaggagt gggctaaatg 3240 ggagaaacag ttgcgggata ttttatttgg caatgctgag tatctgaatt ctgttcaggt 3300 tccttttgag tctgctgtaa aggaagtgtc agaacagctg aaaaaggtcg caaaaggtga 3360 gtacaaaact ccagatactg ggaagaggaa gttcggcgcc attgtctttg ctgccgttag 3420 cctgcctgtt atggaagtca gtggtctgct tgatagcttg gctgtgaaac atagtgaagc 3480 cgaagctttc ctcaaagaca agcatttgga taaacttaac aaggctcatg ttactcttgc 3540 acacaagaga agtcatggtg ttactgccgt ggctagttac ggaaccttcc ttcacaaaac 3600 ggtccctgtg gatataacta agcttttctt ctcggataaa atggctgcat ttggagccag 3660 ccttgggtct gtcgaaggtg aaagagtagt gtctaaaaat gagtggccgc atgtcacctt 3720 atggactgca gaaggggttc cggccaagga cgccaacaac ttaccccaat tgcattcgga 3780 ggggaaagct acctgcattg caattgaccc acctgccacc attgatggca cgctggaatt 3840 tttctgaggt ttgatcggcc aggccagatt gagctcggca tacgattgga gtgaaatttc 3900 atttgacgat gcgggtgttc aatgaagaga gaacttaact gcttaagtga aggagaaaat 3960 tttgtaagcc atgaggaaaa ggaaattttg ttgagttgat ttcttttcag aggttttgta 4020 tacataaggc aattaaaatt ttaaagtctc agcgttgctt catcagcttt taccaattga 4080 ggggtgttta gccgcggtg catcgctcgt atctgtttac acgattcggt atgattgcgc 4140 agctgcaact cccccaagtt ttatgacact tgaaatgttg acactgcatt tttta 4196 <210> 23 <211> 517 <212> DNA <213> Tetrahymena thermophila <400> 23 tgacgcaatt caaccaagcg cgggtaaacg gcgggagtaa ctatgactct ctaaatagca 60 attattacct ttggagggaa aagttatcag gcatgcacct ggtagctagt cttaaacca 120 atagattgca tcggtttaaa aggcaagacc gtcaaattgc gggaaagggg tcaacagccg 180 ttcagtacca agtctcaggg gaaactttga gatggccttg caaagggtat ggtaataagc 240 tgacggacat ggtcctaacc acgcagccaa gtcctaagtc aacagatctt ctgttgatat 300 ggatgcagtt cacagactaa atgtcggtcg gggaagatgt attcttctca taagatatag 360 tcggacctct ccttaatggg agctagcgga tgaagtgatg caacactgga gccgctggga 420 actaatttgt atgcgaaagt atattgatta gttttggagt actcgtaagg tagccaaatg 480 cctcgtcatc taattagtga cgcgcatgaa tggatta 517 <210> 24 <211> 174 <212> DNA <213> Ceratitis capitata <400> 24 gatgacatgg agaagatctg gcaccacacc ttctacaacg agttgcgtgt cgcccccgag 60 gagcaccccg ttctgctgac cgaagcaccg ttgaacccga aggctaaccg cgagaagatg 120 acccagatca tgttcgagac cttcaactcg ccggccatgt atgtggccat ccag 174 <210> 25 <211> 3114 <212> DNA <213> Ceratitis capitata <220> <221> promoter <222> 1..94 <223> / gene="E. coli murein lipoprotein promoter" <220> <221> misc_structure <222> 95..147 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 95..346 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 101..102 <223> / gene="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> misc_feature <222> 347..533 <223> / gene="Group-I Tetrahymena termophila 26S rRNA intron with intron-exon permutation between T235 and C236 inserted between T245 and T246 of ELVd cDNA" <220> <221> misc_feature <222> 525..533 <223> / gene="10 nt flanking exon" <220> <221> misc_feature <222> 534..633 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 634..643 <223> / gene="10-nt flanking exon of the non-permutated intron" <220> <221> misc_feature <222> 634..1065 <223> / gene="Non-permutated sequence of the group-I Tetrahymena termophila 26S rRNA intron" <220> <221> misc_feature <222> 1057..1065 <223> / gene="10-nt flanking exon of the non-permutated intron" <220> <221> misc_feature <222> 1066..1166 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 1166..1175 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 1166..1410 <223> / gene="Group-I Tetrahymena termophila 26S rRNA intron with intron-exon permutation between T235 and C236 inserted between T245 and T246 of ELVd cDNA" <220> <221> misc_feature <222> 1411..1544 <223> / note="ELVd AJ536613" <220> <221> misc_feature <222> 1492..1544 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 1498..1499 <223> / note="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> terminator <222> 1545..1588 <223> / note="E. coli ribosomal rrnC terminator" <220> <221> rep_origin <222> 1589..2202 <223> / note="pUC replication origin" <220> <221> gene <222> 2203..3114 <223> / gene="Ampicillin resistance gene in reverse orientation" <220> <221> promoter <222> 3064..3114 <223> / note="Promoter of the ampicillin resistance gene" <400> 25 cgatgcttct ttgagcgaac gatcaaaaat aagtgccttc ccatcaaaaa aatattctca 60 acataaaaaa ctttgtgtaa tacttgtaac gctgccccat agggtggtgt gtgccacccc 120 tgatgagacc gaaaggtcga aatggggttt cgccatgggt cgggacttta aattcggagg 180 attcgtcctt taaacgttcc tccaagagtc ccttccccaa acccttactt tgtaagtgtg 240 gttcggcgaa tgtaccgttt cgtcctttcg gactcatcag ggaaagtaca cactttccga 300 cggtgggttc gtcgacacct ctccccctcc caggtactat ccccttcttc tgttgatatg 360 gatgcagttc acagactaaa tgtcggtcgg ggaagatgta ttcttctcat aagatatagt 420 cggacctctc cttaatggga gctagcggat gaagtgatgc aacactggag ccgctgggaa 480 ctaatttgta tgcgaaagta tattgattag ttttggagta ctcgtaaggt agcgctgacc 540 gaagcaccgt tgaacccgaa ggctaaccgc gagaagatga cccagatcat gttcgagacc 600 ttcaactcgc cggccatgta tgtggccatc cagatgactc tctaaatagc aatatttacc 660 tttggaggga aaagttatca ggcatgcacc tggtagctag tctttaaacc aatagattgc 720 atcggtttaa aaggcaagac cgtcaaattg cgggaaaggg gtcaacagcc gttcagtacc 780 aagtctcagg ggaaactttg agatggcctt gcaaagggta tggtaataag ctgacggaca 840 tggtcctaac cacgcagcca agtcctaagt caacagatct tctgttgata tggatgcagt 900 tcacagacta aatgtcggtc ggggaagatg tattcttctc ataagatata gtcggacctc 960 tccttaatgg gagctagcgg atgaagtgat gcaacactgg agccgctggg aactaatttg 1020 tatgcgaaag tatattgatt agttttggag tactcgtaag gtagcctgga tggccacata 1080 catggccggc gagttgaagg tctcgaacat gatctgggtc atcttctcgc ggtagcctt 1140 cgggttcaac ggtgcttcgg tcagcatgac tctctaaata gcaatattta cctttggagg 1200 gaaaagttat caggcatgca cctggtagct agtctttaaa ccaatagatt gcatcggttt 1260 aaaaggcaag accgtcaaat tgcgggaaag gggtcaacag ccgttcagta ccaagtctca 1320 ggggaaactt tgagatggcc ttgcaaaggg tatggtaata agctgacgga catggtccta 1380 accacgcagc caagtcctaa gtcaacagat tcaaggatgt gttccctagg agggtgggtg 1440 tacctctttt ggattgctcc ggccttccag gagagataga ggacgacctc tccccatagg 1500 gtggtgtgtg ccacccctga tgagaccgaa aggtcgaaat gggggaaatc atccttagcg 1560 aaagctaagg atttttttta tctgaaatgc gttgctggcg tttttccata ggctccgccc 1620 ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 1680 ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 1740 gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 1800 ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 1860 cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 1920 cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 1980 gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag 2040 aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg 2100 tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca 2160 gcagattacg cgcagaaaaa aaggatctca agaagatcct ttttaccaat gcttaatcag 2220 tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt 2280 cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg caatgatacc 2340 gcgagagcca cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc 2400 cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg 2460 ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac 2520 aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg 2580 atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc 2640 tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact 2700 gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc 2760 aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat 2820 acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc 2880 ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac 2940 tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa 3000 aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact 3060 catactcttc ctttttcaat attattgaag catttatcag ggttattgtc tcat 3114 <210> 26 <211> 2728 <212> DNA <213> Ceratitis capitata <220> <221> promoter <222> 1..94 <223> / gene="E. coli murein lipoprotein promoter" <220> <221> misc_feature <222> 95..281 <223> / gene="Group-I Tetrahymena termophila 26S rRNA intron with intron-exon permutation between T235 and C236 inserted between T245 and T246 of ELVd cDNA" <220> <221> misc_feature <222> 273..281 <223> / gene="10 nt flanking exon" <220> <221> misc_feature <222> 282..381 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 382..391 <223> / gene="10-nt flanking exon of the non-permutated intron" <220> <221> misc_feature <222> 382..813 <223> / gene="Non-permutated sequence of the group-I Tetrahymena termophila 26S rRNA intron" <220> <221> misc_feature <222> 805..813 <223> / gene="10-nt flanking exon of the non-permutated intron" <220> <221> misc_feature <222> 814..913 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 914..923 <223> / gene="10 nt flanking exon" <220> <221> misc_feature <222> 914..1158 <223> / gene="Group-I Tetrahymena termophila 26S rRNA intron with intron-exon permutation between T235 and C236 inserted between T245 and T246 of ELVd cDNA" <220> <221> terminator <222> 1159..1202 <223> / note="E. coli ribosomal rrnC terminator" <220> <221> rep_origin <222> 1203..1816 <223> / note="pUC replication origin" <220> <221> gene <222> 1817..2728 <223> / gene="Ampicillin resistance gene in reverse orientation" <220> <221> promoter <222> 2678..2728 <223> / note="Promoter of the ampicillin resistance gene" <400> 26 cgatgcttct ttgagcgaac gatcaaaaat aagtgccttc ccatcaaaaa aatattctca 60 acataaaaaa ctttgtgtaa tacttgtaac gctgcttctg ttgatatgga tgcagttcac 120 agactaaatg tcggtcgggg aagatgtatt cttctcataa gatatagtcg gacctctcct 180 taatgggagc tagcggatga agtgatgcaa cactggagcc gctgggaact aatttgtatg 240 cgaaagtata ttgattagtt ttggagtact cgtaaggtag cgctgaccga agcaccgttg 300 aacccgaagg ctaaccgcga gaagatgacc cagatcatgt tcgagacctt caactcgccg 360 gccatgtatg tggccatcca gatgactctc taaatagcaa tatttacctt tggagggaaa 420 agttatcagg catgcacctg gtagctagtc tttaaaccaa tagattgcat cggtttaaaa 480 ggcaagaccg tcaaattgcg ggaaaggggt caacagccgt tcagtaccaa gtctcagggg 540 aaactttgag atggccttgc aaagggtatg gtaataagct gacggacatg gtcctaacca 600 cgcagccaag tcctaagtca acagatcttc tgttgatatg gatgcagttc acagactaaa 660 tgtcggtcgg ggaagatgta ttcttctcat aagatagatt cggacctctc cttaatggga 720 gctagcggat gaagtgatgc aacactggag ccgctgggaa ctaatttgta tgcgaaagta 780 tattgattag ttttggagta ctcgtaaggt agcctggatg gccacataca tggccggcga 840 gttgaaggtc tcgaacatga tctgggtcat cttctcgcgg ttagccttcg ggttcaacgg 900 tgcttcggtc agcatgactc tctaaatagc aatatttacc tttggaggga aaagttatca 960 ggcatgcacc tggtagctag tctttaaacc aatagattgc atcggtttaa aaggcaagac 1020 cgtcaaattg cgggaaaggg gtcaacagcc gttcagtacc aagtctcagg ggaaactttg 1080 agatggcctt gcaaagggta tggtaataag ctgacggaca tggtcctaac cacgcagcca 1140 agtcctaagt caacagatga aatcatcctt agcgaaagct aaggattttt tttatctgaa 1200 atgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac 1260 gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg 1320 gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct 1380 ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg 1440 tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct 1500 gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttacgccac 1560 tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 1620 tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc 1680 tgctgaagcc agttaccttc ggaaaagag ttggtagctc ttgatccggc aaaaaacca 1740 cggctgtag cggtggtttt ttgttttgca agcagcagat tacgcgcaga aaaaaaggat 1800 ctcaagaaga tccttttac caatgcttaa tcagtgaggc acctactca gcgatctctc 1860 tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg 1920 gcttaccatc tggccccagt gctgcaatga taccgcgaga gccacgctca ccggctccag 1980 atttatcagc ataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt 2040 tatccgcctc catccagctct atttattgtt gccgggaagc tagtagt agttcgccag 2100 ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt 2160 ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca 2220 tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg 2280 ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat 2340 ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta 2400 tgcggcgacc gagttgctct tgcccggcgt caatacggga tataccgcg ccacatagca 2460 gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct 2520 taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat 2580 cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa 2640 agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt 2700 gaagcattta tcagggttat tgtctcat 2728 <210> 27 <211> 2683 <212> DNA <213> Ceratitis capita <220> <221> <222> <223> pLELVd-b-actin expressing a 100-bp dsRNA corresponding to C. capitate b-actin with a 10-nt viroid type I intron system. capitate b-actin with the viroid-type I intron system with exons fragmentsof 10) <220> <221> promoter <222> 1..94 <223> / gene="E. coli murein lipoprotein promoter" <220> <221> misc_structure <222> 95..147 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 95..346 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 101..102 <223> / gene="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> misc_feature <222> 347..446 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 447..879 <223> / gene="Group-I Tetrahymena termophila 26S rRNA intron" <220> <221> misc_feature <222> 447..456 <223> / gene="10-nt flanking exon of the group-I Tetrahymena termophila 26SrRNA intron" <220> <221> misc_feature <222> 870..879 <223> / gene="10-nt flanking exon of the group-I Tetrahymena termophila 26SrRNA intron" <220> <221> misc_feature <222> 880..979 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 980..1113 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 1061..1113 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 1067..1068 <223> / note="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> terminator <222> 1114..1157 <223> / note="E. coli ribosomal rrnC terminator" <220> <221> rep_origin <222> 1158..1771 <223> / note="pUC replication origin" <220> <221> gene <222> 1772..2683 <223> / gene="Ampicillin resistance gene in reverse orientation" <220> <221> promoter <222> 2633..2683 <223> / note="Promoter of the ampicillin resistance gene" <400> 27 cgatgcttct ttgagcgaac gatcaaaaat aagtgccttc ccatcaaaaa aatattctca 60 acataaaaaa ctttgtgtaa tacttgtaac gctgccccat agggtggtgt gtgccacccc 120 tgatgagacc gaaaggtcga aatggggttt cgccatgggt cgggacttta aattcggagg 180 attcgtcctt taaacgttcc tccaagagtc ccttccccaa acccttactt tgtaagtgtg 240 gttcggcgaa tgtaccgttt cgtcctttcg gactcatcag ggaaagtaca cactttccga 300 cggtgggtc gtcgacacct ctccccctcc caggtactat cccttgctg accgaagcac 360 cgttgaaccc gaaggctaac cgcgagaaga tgacccagat catgttcgag accttcaact 420 cgccggccat gtatgtggcc atccagatga ctctctaaat agcaatattt acctttggag 480 ggaaaagtta tcaggcatgc acctggtagc tagtctttaa accaatagat tgcatcggtt 540 taaaaggcaa gaccgtcaaa ttgcgggaaa ggggtcaaca gccgttcagt accaagtctc 600 aggggaaact ttgagatggc cttgcaaagg gtatggtaat aagctgacgg acatggtcct 660 aaccacgcag ccaagtccta agtcaacaga tcttctgttg atatggatgc agttcacaga 720 ctaaatgtcg gtcggggaag atgtattctt ctcataagat atagtcggac ctctccttaa 780 tgggagctag cggatgaagt gatgcaacac tggagccgct gggaactaat ttgtatgcga 840 aagtatattg attagttttg gagtactcgt aaggtagccc tggatggcca catacatggc 900 cggcgagtg aaggtctcga acatgatctg ggtcatctttc tcgcggttag cctcgggtt 960 caacggtgct tcggtcagct caaggatgtg ttccctagga gggtgggtgt acctctttg 1020 gattgctccg gccttccagg agagatagag gacgacctct ccccataggg tggtgtgtgc 1080 cacccctgat gagaccgaaa ggtcgaaatg ggggaaatca tccttagcga aagctaagga 1140 ttttttttat ctgaaatgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 1200 atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 1260 aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 1320 gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 1380 ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 1440 ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 1500 acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 1560 gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 1620 ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 1680 ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 1740 gcagaaaaaa aggatctcaa gaagatcctt tttaccaatg cttaatcagt gaggcaccta 1800 tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa 1860 ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagagccac 1920 gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa 1980 gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag 2040 tagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg 2100 tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag 2160 ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg 2220 tcaagagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc 2280 ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat 2340 tctgagata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata 2400 ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa 2460 aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca 2520 actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc 2580 aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc 2640 tttttcaata ttattgaagc atttatcagg gttattgtct cat 2683 <210> 28 <211> 2679 <212> DNA <213> Ceratitis capitata <220> <221> <222> <223> pLELVd-b-actin expressing a 100-bp dsRNA corresponding to C. capitate b-actin with a viroid I-type intron system of 8 nt exon fragments. capitate b-actin with the viroid-type I intron system with exons fragmentsof 8 nt) <220> <221> promoter <222> 1..94 <223> / gene="E. coli murein lipoprotein promoter" <220> <221> misc_structure <222> 95..147 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 95..346 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 101..102 <223> / gene="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> misc_feature <222> 347..446 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 447..879 <223> / gene="Group-I Tetrahymena termophila 26S rRNA intron" <220> <221> misc_feature <222> 447..456 <223> / gene="8-nt GACTCTCT flanking exon of the group-I Tetrahymenatermophila 26S rRNA intron" <220> <221> misc_feature <222> 870..879 <223> / gene="8-nt TAAGGTAG flanking exon of the group-I Tetrahymenatermophila 26S rRNA intron" <220> <221> misc_feature <222> 880..979 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 980..1113 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 1061..1113 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 1067..1068 <223> / note="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> terminator <222> 1114..1157 <223> / note="E. coli ribosomal rrnC terminator" <220> <221> rep_origin <222> 1158..1771 <223> / note="pUC replication origin" <220> <221> gene <222> 1772..2683 <223> / gene="Ampicillin resistance gene in reverse orientation" <220> <221> promoter <222> 2633..2683 <223> / note="Promoter of the ampicillin resistance gene" <400> 28 cgatgcttct ttgagcgaac gatcaaaaat aagtgccttc ccatcaaaaa aatattctca 60 acataaaaaa ctttgtgtaa tacttgtaac gctgccccat agggtggtgt gtgccacccc 120 tgatgagacc gaaaggtcga aatggggttt cgccatgggt cgggacttta aattcggagg 180 attcgtcctt taaacgttcc tccaagagtc ccttccccaa acccttactt tgtaagtgtg 240 gttcggcgaa tgtaccgttt cgtcctttcg gactcatcag ggaaagtaca cactttccga 300 cggtgggttc gtcgacacct ctccccctcc caggtactat ccccttgctg accgaagcac 360 cgttgaaccc gaaggctaac cgcgagaaga tgacccagat catgttcgag accttcaact 420 cgccggccat gtatgtggcc atccaggact ctctaaatag caatatttac ctttggaggg 480 aaaagttatc aggcatgcac ctggtagcta gtctttaaac caatagattg catcggttta 540 aaaggcaaga ccgtcaaatt gcgggaaagg ggtcaacagc cgttcagtac caagtctcag 600 gggaaacttt gagatggcct tgcaaagggt atggtaataa gctgacggac atggtcctaa 660 ccacgcagcc aagtcctaag tcaacagatc ttctgttgat atggatgcag ttcacagact 720 aaatgcggt cggggaagat gtattcttct cataagatat agtcggacct ctccttaatg 780 ggagctagcg gatgaagtga tgcaacactg gagccgctgg gaactaattt gtatgcgaaa 840 gtatattgat tagttttgga gtactcgtaa ggtagctgga tggccacata catggccggc 900 gagttgaagg tctcgaacat gatctgggtc atcttctcgc ggttagcctt cgggttcaac 960 ggtgcttcgg tcagctcaag gatgtgttcc ctaggagggt gggtgtacct cttttggatt 1020 gctccggcct tccaggagag atagaggacg acctctcccc atagggtggt gtgtgccacc 1080 cctgatgaga ccgaaaggtc gaaatggggg aaatcatcct tagcgaaagc taaggatttt 1140 tttatctga aatgcgttgc tggcgtttt cataggctc cgcccccctg acgagcatca 1200 caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 1260 gttccccct ggaagctccc tcgtgcgctc tcctgttccg acctgccgc ttaccggata 1320 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 1380 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 1440. gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg tagcacga cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttttta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctattcgtt catccatagt tgcctgactc cccgtcgtgt agataactac 1860. gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag agccacgctc 1920 accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac 2160 atgatcccccc atgttgtgca aaaaagcggt tagctcctt ggtcctccga tcgttgtcag 2220 aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac 2280 tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg 2340 agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg samaaccgc 2400 gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact 2460 ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg 2520 atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa 2580 tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttccttt 2640 tcaatattat tgaagcattt atcagggtta ttgtctcat 2679 <210> 29 <211> 2671 <212> DNA <213> Ceratitis capitata <220> <221> <222> <223> pLELVd-b-actin expresses a 100 bp dsRNA corresponding to C. capitate b-actin with a 4 nt viroid type I intron system <220> <221> promoter <222> 1..94 <223> / gene="E. coli murein lipoprotein promoter" <220> <221> misc_structure <222> 95..147 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 95..346 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 101..102 <223> / gene="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> misc_feature <222> 347..446 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 447..879 <223> / gene="Group-I Tetrahymena termophila 26S rRNA intron" <220> <221> misc_feature <222> 447..456 <223> / gene="6-nt CTCT flanking exon of the group-I Tetrahymena termophila26S rRNA intron" <220> <221> misc_feature <222> 870..879 <223> / gene="6-nt TAAG flanking exon of the group-I Tetrahymena termophila26S rRNA intron" <220> <221> misc_feature <222> 880..979 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 980..1113 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 1061..1113 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 1067..1068 <223> / note="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> terminator <222> 1114..1157 <223> / note="E. coli ribosomal rrnC terminator" <220> <221> rep_origin <222> 1158..1771 <223> / note="pUC replication origin" <220> <221> gene <222> 1772..2683 <223> / gene="Ampicillin resistance gene in reverse orientation" <220> <221> promoter <222> 2633..2683 <223> / note="Promoter of the ampicillin resistance gene" <400> 29 cgatgcttct ttgagcgaac gatcaaaaat aagtgccttc ccatcaaaaa aatattctca 60 acataaaaaa ctttgtgtaa tacttgtaac gctgccccat agggtggtgt gtgccacccc 120 tgatgagacc gaaaggtcga aatggggttt cgccatgggt cgggacttta aattcggagg 180 attcgtcctt taaacgttcc tccaagagtc ccttccccaa acccttactt tgtaagtgtg 240 gttcggcgaa tgtaccgttt cgtcctttcg gactcatcag ggaaagtaca cactttccga 300 cggtgggttc gtcgacacct ctccccctcc caggtactat ccccttgctg accgaagcac 360 cgttgaaccc gaaggctaac cgcgagaaga tgacccagat catgttcgag accttcaact 420 cgccggccat gtatgtggcc atccagctct aatagcaat atttaccttt ggagggaaaa 480 gttatcaggc atgcacctgg tagctagtct ttaaaccaat agattgcatc gttttaaaag 540 gcaagaccgt caaattgcgg gaaaggggtc aacagccgtt cagtaccaag tctcagggga 600 aactttgaga tggccttgca aagggtatgg tataagctg acggacatgg tcctaaccac 660 gcagccaagt cctaagtcaa cagatcttct gttgatatgg atgcagttca cagactaaat 720 gtcggtcggg gaagatgtat tcttctcata agatatagtc ggacctctcc ttaatgggag 780 ctagcggatg aagtgatgca acactggagc cgctgggaac taatttgtat gcgaaagtat 840 attgatgt tttggagtac tcgtaagctg gatggccaca tacatggccg gcgagttgaa 900 ggtctcgaac atgatctggg tcatcttctc gcggttagcc ttcgggttca acggtgcttc 960 ggtcagctca aggatgtgtt ccctaggagg gtgggtgtac ctctttttgga ttgctccggc 1020 cttccaggag agatagagga cgacctctcc ccatagggtg gtgtgtgcca cccctgatga 1080 gaccgaaagg tcgaaatggg ggaaatcatc cttagcgaaa gctaaggatt ttttttatct 1140 gaaatgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc 1200 gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc 1260 ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 1320 cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt 1380 cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 1440 gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc 1500 cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 1560 agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg 1620 ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 1680 ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 1740 gatctcaaga agatcctttt taccaatgct taatcagtga ggcacctatc tcagcgatct 1800 gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg 1860 agggcttacc atctggcccc agtgctgcaa tgataccgcg aggccacgc tcaccggctc 1920 cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc 2160 ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt 2220 tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattgga aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag 2520. catcttttac tttcaccagc gtttctgggt gagcaaaac aggaggca aatgccgca aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt 2640 attgaagcat ttatcagggt tattgtctca t 2671 <210> 30 <211> 2667 <212> DNA <213> Ceratitis capitata <220> <221> <222> <223> pLELVd-b-actin expressing a 100-bp dsRNA corresponding to C. capitate b-actin with a 2-nt viroid type I intron system. capitate b-actin with the viroid-type I intron system with exons fragmentsof 2 nt) <220> <221> promoter <222> 1..94 <223> / gene="E. coli murein lipoprotein promoter" <220> <221> misc_structure <222> 95..147 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 95..346 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 101..102 <223> / gene="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> misc_feature <222> 347..446 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 447..879 <223> / gene="Group-I Tetrahymena termophila 26S rRNA intron" <220> <221> misc_feature <222> 447..456 <223> / gene="2-nt CT flanking exon of the group-I Tetrahymena termophila 26SrRNA intron" <220> <221> misc_feature <222> 870..879 <223> / gene="2-nt TA flanking exon of the group-I Tetrahymena termophila 26SrRNA intron" <220> <221> misc_feature <222> 880..979 <223> / gene="Inverted repeat of C. capitata ?actin gene" <220> <221> misc_feature <222> 980..1113 <223> / gene="ELVd AJ536613" <220> <221> misc_feature <222> 1061..1113 <223> / note="Hammerhead ribozyme" <220> <221> misc_feature <222> 1067..1068 <223> / note="Self-cleavage site of the hammerhead ribozyme domain" <220> <221> terminator <222> 1114..1157 <223> / note="E. coli ribosomal rrnC terminator" <220> <221> rep_origin <222> 1158..1771 <223> / note="pUC replication origin" <220> <221> gene <222> 1772..2683 <223> / gene="Ampicillin resistance gene in reverse orientation" <220> <221> promoter <222> 2633..2683 <223> / note="Promoter of the ampicillin resistance gene" <400> 30 cgatgcttct ttgagcgaac gatcaaaaat aagtgccttc ccatcaaaaa aatattctca 60 acataaaaaa ctttgtgtaa tacttgtaac gctgccccat agggtggtgt gtgccacccc 120 tgatgagacc gaaaggtcga aatggggttt cgccatgggt cgggacttta aattcggagg 180 attcgtcctt taaacgttcc tccaagagtc ccttccccaa acccttactt tgtaagtgtg 240 gttcggcgaa tgtaccgttt cgtcctttcg gactcatcag ggaaagtaca cactttccga 300 cggtgggttc gtcgacacct ctccccctcc caggtactat ccccttgctg accgaagcac 360 cgttgaaccc gaaggctaac cgcgagaaga tgacccagat catgttcgag accttcaact 420 cgccggccat gtatgtggcc atccagctaa atagcaatat ttacctttgg agggaaaagt 480 tatcaggcat gcacctggta gctagtcttt aaaccaatag attgcatcgg tttaaaaggc 540 aagaccgtca aattgcggga aaggggtcaa cagccgttca gtaccaagtc tcaggggaaa 600 ctttgagatg gccttgcaaa gggtatggta ataagctgac ggacatggtc ctaaccacgc 660 agccaagtcc taagtcaaca gatcttctgt tgatatggat gcagttcaca gactaaatgt 720 cggtcgggga agatgtattc ttctcataag atatagtcgg acctctcctt aatgggagct 780 agcggatgaa gtgatgcaac actggagccg ctgggaacta atttgtatgc gaaagtatat 840 tgattagttt tggagtactc gtactggatg gccacataca tggccggcga gttgaaggtc 900 tcgaacatga tctgggtcat cttctcgcgg ttagccttcg ggttcaacgg tgcttcggtc 960 agctcaagga tgtgttccct aggagggtgg gtgtacctct tttggattgc tccggccttc 1020 caggagagat agaggacgac ctctccccat agggtggtgt gtgccacccc tgatgagacc 1080 gaaaggtcga aatgggggaa atcatcctta gcgaaagcta aggatttttt ttatctgaaa 1140 tgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg 1200 ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg 1260 aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt 1320 tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt 1380 gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg 1440 cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact 1500 ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt 1560 cttgaagtgg tggcctaact acggctcac tagaaggaca gtatttggta tctgcgctct 1620 gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac 1680 cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc 1740 tcaagaagat cctttttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 1800 atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 1860 cttaccatct ggccccagtg ctgcaatgat accgcgagag ccacgctcac cggctccaga 1920 tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 1980 atccgcctcc atccagtcta ttaattgttg ccgggaagct agagaagta gttcgccagt 2040 taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 2100 tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 2160 gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 2220 cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 2280 cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 2340 gcggcgaccg agttgctctt gccggcgtc atacgggat aataccgcgc cacatagcag 2400 aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 2460 accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 2520 ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 2580 gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 2640 aagcatttat cagggttatt gtctcat 2667

Claims

1. An isolated nucleotide sequence comprising: a) cDNA of the two strands of the target dsRNA, separated by a type I autocatalytic intron from rRNA 26S of Tetrahymenathermophila flanked by an exon or exon fragment, and b) Eggplant latent viroid (ELVd) sequence, Wherein element (a) is inserted into the ELVd sequence.

2. The isolated nucleotide sequence according to claim 1, further comprising a type I autocatalytic intron-exon sequence substituted between the ELVd sequence and the cDNA sequence.

3. The isolated nucleotide sequence of claim 2, wherein the replaced type I autocatalytic intron-exon sequence is derived from a type I intron of rRNA 26S from Tetrahymena thermophila.

4. The isolated nucleotide sequence of claim 1, wherein the target RNA is a gene from a plant pathogen or pest.

5. The isolated nucleotide sequence according to claim 1, wherein the gene from an insect pest is a β-actin gene from Ceratitis capitata.

6. The isolated nucleotide sequence according to claim 1, further comprising a nucleotide sequence encoding a tRNA ligase.

7. The isolated nucleotide sequence according to claim 6, wherein the tRNA ligase is a tRNA ligase from Eggplant.

8. A vector comprising the isolated nucleotide sequence according to claim 1.

9. A host cell comprising the isolated nucleotide sequence according to claim 1 or the vector according to claim 8.

10. Use of the host cell according to claim 9 for preparing dsRNA specific to a target gene, wherein the host cell is Escherichia coli.

11. A method for preparing dsRNA specific for a target gene, comprising co-expressing in Escherichia coli cells: a) the nucleotide sequence according to claim 1, and b) a nucleotide sequence encoding a tRNA ligase, The nucleotide sequences of a) and b) are in the same or different nucleic acid molecules.

12. The method according to claim 11, wherein the tRNA ligase is tRNA ligase from Eggplant.

Images