Corynebacterium glutamicum for producing N-acetylglucosamine and application of corynebacterium glutamicum

Abstract

The invention discloses corynebacterium glutamicum for producing N-acetylglucosamine and application of the corynebacterium glutamicum, and belongs to the technical field of synthetic biology. Specifically, the corynebacterium glutamicum overexpresses a GNA1 gene from a brewer's yeast S288C controlled by a tacM promoter, a glmS gene from corynebacterium glutamicum S9114 and a yqab gene from escherichia coli K12 MG1655, and simultaneously has five gene defect types of nagA, nagB, ldhA, msccg and msccg2 in a genome and two gene single base mutation types of odhA and glnA, and the codon of the glnA for coding the 405th amino acid is mutated from TAC to TTC. By blocking excretion of glutamic acid of corynebacterium glutamicum and enhancing conversion of glutamic acid to glutamine, the supply capacity of a precursor of corynebacterium glutamicum is enhanced, and an optimal way for synthesizing N-acetylglucosamine is obtained, so that efficient production of N-acetylglucosamine in corynebacterium glutamicum is realized, and the yield of N-acetylglucosamine in corynebacterium glutamicum is increased. The method has important economic value and social significance.

Description

Technical Field

[0001] The invention relates to Corynebacterium glutamicum for producing N-acetylglucosamine and application thereof, belonging to the technical field of synthetic biology. Background Art

[0002] N-acetylglucosamine (GlcNAc) is a common monosaccharide in organisms and is widely distributed in bacteria, fungi, plants and animals. N-acetylglucosamine is a synthetic precursor of the disaccharide unit of glycosaminoglycans and plays a key role in the repair and maintenance of cartilage and joint tissue function. At present, N-acetylglucosamine is widely used. In drugs for the treatment of arthritis, N-acetylglucosamine is often used as one of the main ingredients to effectively relieve patients' pain and inflammation. In terms of cosmetics, it can be added to skin care products to enhance the skin's moisturizing and elasticity functions.

[0003] At present, Escherichia coli, Bacillus subtilis and Corynebacterium glutamicum are mainly used for fermentation and production of N-acetylglucosamine. At present, Escherichia coli and Bacillus subtilis have achieved industrial production of N-acetylglucosamine, but, compared with Escherichia coli and Bacillus subtilis, Corynebacterium glutamicum is recognized as a biosafety strain by the U.S. FDA, and the advantages of not producing endotoxins make it an excellent host for producing N-acetylglucosamine. However, in the research on the production of N-acetylglucosamine by Corynebacterium glutamicum, although the researchers have achieved the increase of N-acetylglucosamine production to a certain extent by blocking the catabolic pathway of N-acetylglucosamine and heterologously expressing the key enzymes of the N-acetylglucosamine synthesis pathway, compared with Escherichia coli and Bacillus subtilis, Corynebacterium glutamicum produces N-acetylglucosamine and there is still a large room for improvement, and there is still a large gap from industrial production. At the same time, Corynebacterium glutamicum mostly uses glucosamine (GlcN) when producing N-acetylglucosamine, but its cost is relatively high; de novo synthesis of N-acetylglucosamine uses glucose, and the cost is relatively low, but its yield is relatively low. Therefore, how to further improve the yield and conversion rate while using cheap culture medium for production has become the main problem in the current production of N-acetylglucosamine by Corynebacterium glutamicum fermentation. Summary of the invention

[0004] In order to solve the above problems, the present invention proposes a method for transforming a genetically engineered strain capable of efficiently synthesizing N-acetylglucosamine using Corynebacterium glutamicum as a host.

[0005] The first object of the present invention is to provide a recombinant Corynebacterium glutamicum, wherein the recombinant Corynebacterium glutamicum comprises the following modifications: overexpression of a gene encoding glucosamine-6-phosphate synthase ( glmS)、glucosamine 6-phosphate N-acetyltransferase encoding gene ( GNA1 ) and the gene encoding 6-phosphoacetylaminoglycan-specific phosphatase ( yqab ), knocking out the gene encoding acetylglucosamine deacetylase ( nagA )、Acetylglucosamine deaminase encoding gene ( nagB )、lactate dehydrogenase encoding gene ( ldhA ) and genes encoding mechanosensitive channel proteins ( msccg ), the α-ketoglutarate dehydrogenase encoding gene on the genome ( odhA ) was replaced with GTG, and the codon encoding tyrosine at position 405 in glutamine synthetase was replaced with a codon encoding phenylalanine.

[0006] Furthermore, the recombinant Corynebacterium glutamicum also includes the following transformation: knocking out the glutamate transport protein encoding gene ( msccg2 ); the glutamate transport protein encoding gene ( msccg2 ) is shown in SEQ ID NO.9.

[0007] Furthermore, the glucosamine-6-phosphate synthase encoding gene ( glmS ) has a nucleotide sequence as shown in SEQ ID NO.1; the glucosamine 6-phosphate N-acetyltransferase encoding gene ( GNA1 ) has a nucleotide sequence as shown in SEQ ID NO.2; the 6-phosphoacetylaminoglycan-specific phosphatase encoding gene ( yqab ) has a nucleotide sequence as shown in SEQ ID NO.3; The acetylglucosamine deacetylase encoding gene ( nagA ) has a nucleotide sequence as shown in SEQ ID NO.5; the acetylglucosamine deaminase encoding gene ( nagB ) has a nucleotide sequence as shown in SEQ ID NO.6; the lactate dehydrogenase encoding gene ( ldhA ) is shown in SEQ ID NO.7; the mechanosensitive channel protein encoding gene ( msccg ) has a nucleotide sequence as shown in SEQ ID NO.8; The α-ketoglutarate dehydrogenase encoding gene ( odhA ) has a nucleotide sequence as shown in SEQ ID NO.10; the glutamine synthetase encoding gene ( glnA )'s nucleotide sequence is shown in SEQ ID NO.11.

[0008] Furthermore, the glutamine synthetase encoding gene ( glnA) the codon encoding the 405th amino acid is replaced by TAC to TTC (i.e., TAC at positions 1213 to 1215 of SEQ ID NO.11 is replaced by TTC).

[0009] Furthermore, a strong promoter is used to overexpress the glucosamine-6-phosphate synthase encoding gene ( glmS )、glucosamine 6-phosphate N-acetyltransferase encoding gene ( GNA1 ) or the gene encoding 6-phosphoacetylaminoglycan-specific phosphatase ( yqab ).

[0010] Furthermore, the strong promoter includes but is not limited to tacM promoter; the nucleotide sequence of the tacM promoter is shown in SEQ ID NO.5.

[0011] Furthermore, the Corynebacterium glutamicum host bacteria include but are not limited to Corynebacterium glutamicum S9114.

[0012] The second object of the present invention is to provide the use of the recombinant Corynebacterium glutamicum in the preparation of N-acetylglucosamine.

[0013] The third object of the present invention is to provide a method for producing N-acetylglucosamine, comprising the following steps: using the Corynebacterium glutamicum for fermentation production.

[0014] Furthermore, production is carried out using glucose as a substrate.

[0015] Furthermore, the fermentation includes shake flask fermentation or fed-batch fermentation.

[0016] Furthermore, the fermentation comprises: preparing a seed solution, inoculating the seed solution into a fermentation medium for culturing; The culturing includes culturing at 28-35°C and 220-280 rpm (shaking flask); Or the culture comprises culturing at 28-35°C and a ventilation rate of 0.3-2 Nm 3 / h conditions, and the glucose concentration was controlled at 10-15 g / L and the pH was controlled at 6.8-7.2 (fermentation tank) during the fermentation process.

[0017] Furthermore, the fermentation process includes: adding feed medium after 18-22 hours of fermentation to control the glucose concentration to 10-15 g / L; the feed medium contains 800-900 g / L glucose.

[0018] Furthermore, the shake flask fermentation seed culture medium contains: 20-30 g / L glucose, 15-25 g / L corn steep liquor, 0.5-1.5 g / L potassium dihydrogen phosphate, 0.1-1 g / L ammonium sulfate, and 1-1.5 g / L urea.

[0019] Furthermore, the shake flask fermentation medium contains: 90-110 g / L of glucose, 10-20 g / L of corn steep liquor, 0.5-1.5 g / L of potassium dihydrogen phosphate, 10-30 g / L of ammonium sulfate, 0.1-1 g / L of magnesium sulfate, 10-30 g / L of calcium carbonate, and 0.1-0.5 g / L of iron sulfate.

[0020] Furthermore, the fermentation tank seed culture medium contains: 20-30 g / L glucose, 15-25 g / L corn steep liquor, 0.5-1.5 g / L potassium dihydrogen phosphate, 0.1-1 g / L ammonium sulfate, and 1-1.5 g / L urea.

[0021] Furthermore, the fermentation medium in the fermenter contains: 40-60 g / L glucose, 5-15 g / L corn steep liquor, 0.5-1.5 g / L potassium dihydrogen phosphate, 10-30 g / L ammonium sulfate, 0.1-1 g / L magnesium sulfate, and 0.1-0.5 g / L iron sulfate.

[0022] A fourth object of the present invention is to provide a method for promoting the synthesis of N-acetylglucosamine by Corynebacterium glutamicum, the method comprising the following steps: Overexpression of the gene encoding glucosamine-6-phosphate synthase in the host bacterium Corynebacterium glutamicum glmS )、glucosamine 6-phosphate N-acetyltransferase encoding gene ( GNA1 ) and the gene encoding 6-phosphoacetylaminoglycan-specific phosphatase ( yqab ), knocking out the gene encoding acetylglucosamine deacetylase ( nagA )、Acetylglucosamine deaminase encoding gene ( nagB )、lactate dehydrogenase encoding gene ( ldhA ) and genes encoding mechanosensitive channel proteins ( msccg ), the α-ketoglutarate dehydrogenase encoding gene on the genome ( odhA ) was replaced with GTG, and the codon encoding tyrosine at position 405 in glutamine synthetase was replaced with a codon encoding phenylalanine.

[0023] Furthermore, the method also includes the step of knocking out the gene encoding the glutamate transporter protein.

[0024] Beneficial effects of the present invention: The present invention obtains an optimal path to promote the increase of N-acetylglucosamine production in Corynebacterium glutamicum through a large number of screening and verification experiments, and increases the extracellular accumulation of N-acetylglucosamine. The average yield in a shake flask for 72 hours is increased to the highest reported level of 41.7 g / L, and the fermentation in a 50 L fermenter for 72 hours reaches 143.6 g / L, and the production intensity reaches 1.99 g / L·h. Compared with the current highest report (Engineering Corynebacteriumglutamicum for the efficient production of N-acetylglucosamine), the fermentation yield of 138 g / L for 128 hours and the production intensity of 1.07 g / L·h, the present invention has a higher production intensity and does not require the supplementation of precursors in the culture medium, and does not require the use of expensive culture medium, which lays the foundation for the industrial production of N-acetylglucosamine by Corynebacterium glutamicum. The recombinant Corynebacterium glutamicum construction method provided by the present invention is simple, easy to use, and has a good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is the N-acetylglucosamine yield of different genetically engineered strains; Figure 1 Middle (A) shows knockout of S9114 strain nagA , nagB , ldhA , zwf , pfkA , fba , odhA One or more genes were introduced into the recombinant plasmid pJYW-4- glmS - GNA1 - yqab The N-acetylglucosamine yield of the obtained engineered strain, Figure 1 Middle (B) is the introduction of recombinant plasmid pJYW-4- glmS - GNA1 - yqab S9114Δ nagAB Δ ldhA strain, S9114Δ nagAB Δ ldhA Δ msccg strain, S9114Δ nagAB Δ ldhA Δ msccg Δ msccg2 strain, S9114Δ nagAB Δ ldhA Δ msccg Δ msccg2 _ odhA-GTG strain or S9114Δ nagAB Δ ldhA Δmsccg Δ msccg2 _ odhA- GTG_ glnA N-acetylglucosamine production by the Y405F strain.

[0026] Figure 2 This is the result of producing N-acetylglucosamine in a fermenter. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0028] 1. The solution involved in the present invention is as follows: In order to improve the yield and conversion rate of N-acetylglucosamine produced by Corynebacterium glutamicum, Corynebacterium glutamicum S9114 was selected as the starting strain and CRISPR / cpf1 The system knocked out nagA , nagB , ldhA , in order to block the pathway for N-acetylglucosamine to be reused by the strain. We also tried to downregulate zwf , pfkA , fba The expression of the gene inhibited the glycolytic pathway and the pentose phosphate pathway, prompting energy to flow to the synthesis of N-acetylglucosamine, but no dominant strain was obtained.

[0029] We then added glutamine, a precursor of N-acetylglucosamine, to the culture medium to determine whether there was a bottleneck in this pathway in the strain. We found that exogenous supplementation of glutamine in the culture medium could increase the synthesis of N-acetylglucosamine. Since attempts to adjust the metabolic flow of glycolysis and the pentose phosphate pathway did not result in a dominant strain, we knocked out odhA Gene, balance the metabolic pathway of TCA cycle, to enhance glutamine synthesis while balancing cell growth and product production. However, we compared direct knockout and weakening by replacing the start codon odhA We investigated the expression of the gene and found that direct knockout decreased the yield and had a significant impact on cell growth, while replacing the start codon further increased the yield. odhA The start codon of was changed to GTG to downregulate expression, which successfully increased the yield. msccg , msccg2 To reduce the efflux of glutamate, which can glnA The synthesis of N-acetylglucosamine precursors is further enhanced by the conversion of N-acetylglucosamine into glutamine under the catalysis of msccg , msccg2After that, the production was successfully increased. glnA Single base mutation was performed to further promote metabolism to glutamine, the precursor of N-acetylglucosamine. At the same time, plasmid pJYW-4 was used to express tacM Saccharomyces cerevisiae S288C promoter GNA1 Gene, Corynebacterium glutamicum S9114 glmS Gene, from Escherichia coli K12 MG1655 yqab Gene, realizing the efficient synthesis of N-acetylglucosamine in Corynebacterium glutamicum S9114.

[0030] 2. The genes and sequences involved in the present invention are as follows: nagA : Gene encoding acetylglucosamine deacetylase nagB : Gene encoding acetylglucosamine deaminase ldhA : Lactate dehydrogenase encoding gene msccg (a glutamate efflux protein): a gene encoding a mechanosensitive channel protein msccg2 (a glutamate efflux protein): a gene encoding a glutamate transport protein odhA : α-ketoglutarate dehydrogenase encoding gene glnA : Glutamine synthetase encoding gene glmS : Glucosamine-6-phosphate synthase encoding gene GNA1 : Glucosamine 6-phosphate N-acetyltransferase encoding gene yqab :Gene encoding 6-phosphoacetylaminoglycan-specific phosphatase zwf :6-phosphate glucose dehydrogenase encoding gene pfkA :6-phosphofructokinase encoding gene fba :1,6-bisphosphate fructose aldolase encoding gene Sequence information: glmS (SEQ ID NO.1): GNA1 (SEQ ID NO.2): ATGAGCCTGCCGGATGGCTTTTATATTCGCCGCATGGAAGAAGGCGATCTGGAACAGGTGACCGAAACCCTGAAAGTGCTGACCACCGTGGGCACCATTACCCCGGAGAGCTTTAGCAAACTGATTAAATATTGGAACGAAGCGACCGTGTGGAACGATAACGAAGATAAAAAAATTATGCAGTATAACCCGATGGTGATTGTGGATAAACGCACCGAAACCGTGGCGGCGACCGGCAACATTATTATTGAACGCAAAATTATTCATGAACTGGGCCTGTGCGGCCATATTGAAGATATTGCGGTGAACAGCAAATATCAGGGCCAGGGCCTGGGCAAACTGCTGATTGATCAGCTGGTGACCATTGGCTTTGATTATGGCTGCTATAAAATTATTCTGGATTGCGATGAAAAAAACGTGAAGTTTTATGAAAAATGCGGCTTTAGCAACGCGGGCGTGGAAATGCAGATTCGCAAATAG yqab (SEQ ID NO.3): ATGTACGAGCGTTATGCAGGTTTAATTTTTGATATGGATGGCACAATCCTGGATACGGAGCCTACGCACCGTAAAGCGTGGCGCGAAGTATTAGGGCACTACGGTCTTCAGTACGATATTCAGGCGATGATTGCGCTTAATGGATCGCCCACCTGGCGTATTGCTCAGGCAATTATTGAGCTGAATCAGGCCGATCTCGACCCGCATGCGTTAGCGCGTGAAAAAACAGAAGCAGTAAGAAGTATGCTGCTGGATAGCGTCGAACCGCTTCCTCTTGTTGATGTGGTGAAAAGTTGGCATGGTCGTCGCCCAATGGCTGTAGGAACGGGGAGTGAAAGCGCCATCGCTGAGGCATTGCTGGCGCACCTGGGATTACGCCATTATTTTGACGCCGTCGTCGCTGCCGATCACGTCAAACACCATAAACCCGCGCCAGACACATTTTTGTTGTGCGCGCAGCGTATGGGCGTGCAACCGACGCAGTGTGTGGTCTTTGAAGATGCCGATTTCGGTATTCAGGCGGCCCGTGCAGCAGGCATGGACGCCGTGGATGTTCGCTTGCTGTGA tacM(SEQ ID NO.4): TTGACAATTAATCATCGTGTGGTACCATGT nagA (SEQ ID NO.5): nagB (SEQ ID NO.6): ATGGACATCATCATCTGCAAAGACGAGCAAGAAGTCGGCAAAGCAGCGGCAGCCCTGATCGCACCCTTCGCAACTAAGGGCGGAACCTTGGGGCTTGCAACAGGATCGTCACCTTTGAGCACCTACCAAGAGCTCATTCGCATGTATGAAGCTGGGGAAGTGTCATTCAAGAACTGCAAGGCATTCTTGTTGGATGAATACGTGGGATTAACGCGCCACGATGAAAACAGCTACTTCAAAACCATTCGCAAAGAGTTCACTGACCACATCGACATCGTTGATGAAGAGGTCTACAGCCCAGATGGTGCAAACCCTGATCCATACGAAGCAGCTGCAGAGTATGAGGCAAAGATCGCTGCAGAATCCGTTGATGTTCAAATCCTTGGCATCGGCGGAAACGGCCACATCGCTTTCAATGAGCCATCATCTTCTCTGTCAGGACTGACAAAGGTCCAGGCGCTGCACCCTAAAACTGTGGAGGACAACGCTCGATTCTTCAACACCATCGAAGAGGTCCCAACCCACGCCCTCACCCAGGGTTTGGGCACTTTGTCCCGCGCGCAAAACATCGTGTTGGTGGCAACTGGTGAAGGAAAAGCCGACGCCATCCGCGGAACTGTGGAAGGCCCAGTGACTGCTTCTTGCCCAGGTTCCATCCTGCAGATGCACAACAATGCCACCGTCATCGTTGATGAAGCAGCAGCATCCAAGCTGGAAAACGCTGATCACTACCGTCTCATGGAGCAATTAAAGCTGCGCTAG ldhA (SEQ ID NO.7): ATGAAAGAAACCGTCGGCAATAAGATTGTCCTCATTGGCGCAGGAGATGTTGGAGTTGCATACGCATACGCACTGATCAACCAGGGCATGGCAGATCACCTTGCGATCATCGACATCGATGAAAAGAAACTCGAAGGCAACGTCATGGACTTAAACCATGGTGTTGTGTGGGCCGATTCCCGCACCCGCGTCACTAAGGGAACCTACGCTGACTGCGAAGACGCAGCCATGGTTGTCATTTGTGCCGGCGCAGCCCAAAAGCCAGGCGAAACTCGCCTCCAGCTGGTGGACAAAAACGTCAAGATTATGAAGTCCATCGTTGGCGATGTCATGGCCAGCGGATTCGACGGCATCTTCCTCGTAGCCTCCAACCCAGTGGATATCCTCACCTACGCAGTGTGGAAATTCTCCGGCCTGGAATGGAACCGCGTGATCGGCTCCGGAACTGTCCTGGACTCCGCTAGATTCCGCTACATGCTCGGCGAACTCTATGAAGTGGCACCAAGCTCCGTCCACGCCTACATTATCGGCGAACACGGCGACACTGAACTTCCAGTCCTGTCCTCCGCGACCATCGCAGGCGTATCGCTTAGCCGCATGCTAGACAAAGACCCGGAGCTTGAGGGCCGTCTAGAGAAAATTTTCGAAGACACCCGCGACGCCGCCTATCACATCATCGACGCCAAGGGCTCCACTTCCTACGGCATCGGCATGGGTCTTGCTCGCATCACCCGCGCAATCCTACAAAACCAAGACGTTGCAGTCCCAGTCTCTGCACTGCTCCACGGTGAATACGGTGAGGAAGACATCTACATCGGCACCCCAGCAGTAGTAAACCGCCGAGGCATCCGCCGCGTTGTCGAACTAGAAATCACCGACCACGAGATGGAACGCTTCAAGCATTCCGCAAATACCCTGCGCGAAATTCAGAAGCAGTTCTTCTAA msccg (SEQ ID NO.8): msccg2 (SEQ ID NO.9): odhA (SEQ ID NO.10): glnA (SEQ ID NO.11): 3. The materials and methods of the present invention are as follows: 1. Culture medium E. coli culture medium LB (g / L): yeast powder 5.0, peptone 10.0, sodium chloride 10.0 Seed activation liquid medium BHIS (g / L): brain heart infusion 37.0, sorbitol 91.0.

[0031] Seed activation solid medium BHIS (g / L): brain heart infusion 37.0, sorbitol 91.0, nutrient agar 20.0.

[0032] Competent medium (g / L): peptone 10.0, yeast extract 5.0, sodium chloride 10.0, glycine 30.0, isoniazid 4.0, and 10 mL of Tween 80.

[0033] BHIS recovery medium after electroporation transformation (g / L): 5.0% peptone, 2.5% yeast extract, 5.0% sodium chloride, 18.5% brain heart infusion, and 91.0% sorbitol.

[0034] Solid BHIS medium for transformant coating (g / L): 5.0% peptone, 2.5% yeast extract, 5.0% sodium chloride, 18.5% brain heart infusion, 91.0% sorbitol, and 20.0% nutrient agar.

[0035] Shake flask seed culture medium (g / L): glucose 25.0, corn steep liquor 20.0, potassium dihydrogen phosphate 1.0, ammonium sulfate 0.5, urea 1.25. pH 7.0.

[0036] Shake flask fermentation medium (g / L): glucose 100.0, corn steep liquor 15.0, KH2PO4 1.0, (NH4)2SO4 20.0, MgSO4 0.5, CaCO3 20.0, Fe2(SO4)3 0.18. pH 7.0.

[0037] Initial medium for fed-batch fermentation (g / L): glucose 50.0, corn steep liquor 10.0, KH2PO4 1.0, (NH4)2SO4 20.0, MgSO4 0.5, Fe2(SO4)3 0.18. pH 7.0.

[0038] Sterilization conditions: 115 °C, 20 min. All culture media used for transformant detection or recombinant bacterial culture were added with 25 mg / L kanamycin sulfate.

[0039] (II) Product determination method Determination method of N-acetylglucosamine: High performance liquid chromatography (HPLC) detection method: Agilent 1260, RID detector, HPX-87H column (Bio-Rad Hercules, CA), mobile phase: 5 mM H2SO4, flow rate 0.6 mL / min, column temperature 35 °C, injection volume 10 μL.

[0040] 3. PCR method The PCR reaction system was: 25 μL PrimeSTAR Max (purchased from Takara), 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 1 μL template DNA, and 22 μL double distilled water. The PCR amplification conditions were: 98 °C pre-denaturation for 5 min; followed by 30 cycles of 98 °C for 10 s, 55 °C for 15 s, and 72 °C for 3 min, and finally 72 °C for 5 min.

[0041] 4. Preparation of E. coli competent cells E. coli competent cells were prepared using a Competent Cell Preparation Kit (purchased from Takara). The preparation method is described in the kit instructions.

[0042] 5. Plasmid chemical transformation into E. coli competent cells The competent E. coli cells stored in the ultra-low temperature refrigerator were placed on ice to melt; 6 µL of PCR product was added and gently mixed, and ice bathed for 45 min. The centrifuge tube containing the competent cells was placed in a 42 ℃ water bath for heat shock for 90 s, and the centrifuge tube was transferred to an ice bath to cool the cells for 2 min; 800 µL of LB culture medium was added and cultured at 37 ℃ for 1 h; a small amount of supernatant was removed by centrifugation, and the bacteria were resuspended, and the culture solution was spread on an LB plate containing the corresponding antibiotics, and inverted at 37 ℃ for 10-12 h, and the colonies were observed, and a single colony was picked to verify the positive clone using colony PCR, and a single positive colony was picked and cultured in LB liquid culture medium overnight, and the plasmid was extracted and sequenced for verification.

[0043] (VI) Preparation of electrocompetent cells of Corynebacterium glutamicum (1) Corynebacterium glutamicum was inoculated into BHIS medium (selection was required on a freshly cultured slant, otherwise the growth of the bacteria would be affected), placed on a circulating shaker (200 rpm), and cultured at 30 °C for 16 h until the OD600 reached 3.0.

[0044] (2) Transfer the bacterial solution in (1) to the competent medium at a 10% inoculation volume until the OD600 reaches 0.3, place it on a circulating shaker (200 rpm), and culture it at 30°C until the OD600 reaches 0.9 (culture for about 3-5 hours, and it is in the logarithmic growth phase. Generally, if the bacterial concentration remains low at about 0.6, you can continue with the subsequent operations). The general concentration multiple is 100 times (50 mL of competent medium is concentrated to 0.5 mL to prepare 5 tubes of competent cells).

[0045] (3) Place the bacterial solution in an ice water bath for 15 min, centrifuge at 4000 rpm, 4°C for 10 min, and discard the supernatant.

[0046] (4) Fully resuspend the cells in 30 mL of pre-cooled 10% glycerol, centrifuge at 4000 rpm, 4°C for 10 min, discard the supernatant, and repeat the washing and resuspending process four times.

[0047] (5) Resuspend the cells in 500 μL of pre-cooled 10% glycerol (concentrated 100 times) and dispense into 1.5 mL sterile centrifuge tubes, with 90-100 μL per tube.

[0048] (6) Store the aliquoted competent cells at -80°C until use.

[0049] 7. Electroporation transformation of Corynebacterium glutamicum (1) Thaw the competent cells of Corynebacterium glutamicum stored at -80°C in an ice bath.

[0050] (2) Add 1-5.0 μL of plasmid, mix well, and incubate on ice for 5-10 min.

[0051] (3) Add to a pre-cooled 0.1 cm electric shock cup and shock twice at 1.8 KV for 5 ms.

[0052] (4) Quickly add 1.0 mL of culture medium (BHIS) preheated at 46 °C, mix well, and transfer to a new 1.5 mL sterile centrifuge tube. Incubate in a 46 °C water bath for 6 min.

[0053] (5) Place the bacteria on a circulating shaker (220 rpm) and incubate at 30°C for 2 h.

[0054] (6) Centrifuge at 4000 rpm for 2 min at room temperature, discard part of the supernatant, resuspend the remaining bacterial liquid and spread it on a solid plate coated with the transformant with the corresponding resistance, and culture it in a constant temperature incubator at 30 °C for 2-3 days.

[0055] Example 1 Construction of strains (one) nagAB Knockout because nagA ,nagB The genes are located continuously in the genome, so they are knocked out together. The specific steps are as follows: ①Using plasmid pJYS3_ΔcrtYf as a template, design upstream primers (line-nagAB-F) and downstream primers (line-nagAB-R) to obtain the pJYS3_ΔcrtYf_line linear plasmid fragment by PCR amplification.Using the genome of Corynebacterium glutamicum S9114 as a template, design upstream primers (nagAB-FF) and downstream primers (nagAB-FR), and obtain the upstream homology arm by PCR amplification; design upstream primers (nagAB-RF) and downstream primers (nagAB-RR), and obtain the downstream homology arm by PCR amplification. The expression vector and gene fragment were connected using ClonExpress II One Step Cloning Kit (non-ligase-dependent single-fragment rapid cloning kit) of Novozyme Biotechnology Co., Ltd. The linearized vector obtained by PCR and the target gene fragment with homologous ends of the vector were recovered by gel and mixed at a molar ratio of 3:1. At the same time, 4 μL of 5×CE II Buffer (buffer for recombination reaction) and 2 μL of Exnase II (recombinase) were added, and then ddH2O was added to make the total volume of the connection system reach 20 μL. The reaction was carried out at 37 °C for 30 min and then reduced to 4 °C for insulation. Then 10 μL of the connection system was taken to transform Escherichia coli competent cells. The correct transformants of colony PCR were selected and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3_ΔcrtYf_nagAB.

[0056] ② Design the upstream primer (nagAB-crF) and the downstream primer (nagAB-crR) with crRNA, amplify the plasmid pJYS3_ΔcrtYf_nagAB by PCR to obtain the linear plasmid fragment pJYS3_ΔcrtYf_nagAB_line, and use the ClonExpress II One Step Cloning Kit (non-ligase-dependent single fragment rapid cloning kit) of Novozyme Biotechnology Co., Ltd. to connect the linear expression vector and transform Escherichia coli. Select the correct transformant by colony PCR and send it to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3_ΔcrtYf_nagABcrRNA.

[0057] ③ Extraction step ② pJYS3_ΔcrtYf_nagABcrRNA plasmid of positive transformants was electroporated into Corynebacterium glutamicum S9114 competent cells and screened for successful knockout nagABThe positive transformants of the gene were cultured at 37 °C overnight to eliminate the plasmid pJYS3_ΔcrtYf_nagABcrRNA, thereby obtaining S9114Δ nagAB strains.

[0058] (two) ldhA Knockout ①Using plasmid pJYS3_ΔcrtYf as a template, design upstream primers (line-ldhA-F) and downstream primers (ling-ldhA-R) to obtain the linear plasmid fragment pJYS3_ΔcrtYf_line through PCR amplification.Using the genome of Corynebacterium glutamicum S9114 as a template, design upstream primers (ldhA-FF) and downstream primers (ldhA-FR), and obtain the upstream homology arm through PCR amplification; design upstream primers (ldhA-RF) and downstream primers (ldhA-RR), and obtain the downstream homology arm through PCR amplification. The expression vector and gene fragment were connected using ClonExpress II One Step Cloning Kit (non-ligase-dependent single-fragment rapid cloning kit) from Novozyme Biotechnology Co., Ltd. The linearized vector obtained by PCR and the target gene fragment with homologous ends of the vector were recovered and mixed in a molar ratio of 3:1. At the same time, 4 μL of 5×CE II Buffer and 2 μL of ExnaseII were added, and then ddH2O was added to make the total volume of the connection system reach 20 μL. The reaction was carried out at 37 °C for 30 min and then reduced to 4 °C for insulation. Then 10 μL of the connection system was taken to transform Escherichia coli competent cells. The correct transformants of colony PCR were selected and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3_ΔcrtYf_ldhA.

[0059] ② Design the upstream primer (ldhA-crF) and downstream primer (ldhA-crR) with crRNA, amplify the plasmid pJYS3_ΔcrtYf_ldhA by PCR to obtain the linear plasmid fragment pJYS3_ΔcrtYf_ldhA_line, and use the ClonExpress II One Step Cloning Kit (non-ligase-dependent single fragment rapid cloning kit) of Novozyme Biotechnology Co., Ltd. to connect the linear expression vector and transform Escherichia coli. Select the correct transformant by colony PCR and send it to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3_ΔcrtYf_ldhAcrRNA.

[0060] ③ Extraction step ② pJYS3_ΔcrtYf_ldhAcrRNA plasmid of positive transformant was electrotransformed into Corynebacterium glutamicum S9114Δ nagABScreening for successful knockout in competent cells ldhA The positive transformants of the gene were cultured at 37 °C overnight to eliminate the plasmid pJYS3_ΔcrtYf_ldhAcrRNA, thereby obtaining S9114Δ nagAB Δ ldhA strains.

[0061] (three) msccg Knockout ① Using pJYS3_ΔcrtYf as a template, design upstream primers (line-Msccg-F) and downstream primers (line-Msccg-R) to obtain the pJYS3_ΔcrtYf_line linear plasmid fragment by PCR amplification. Using the genome of Corynebacterium glutamicum S9114 as a template, design upstream primers (msccg-FF) and downstream primers (msccg-FR), obtain the upstream homology arm by PCR amplification, design upstream primers (msccg-RF) and downstream primers (msccg-RR), obtain the downstream homology arm by PCR amplification. The expression vector and gene fragment were connected using ClonExpress II One Step Cloning Kit (non-ligase-dependent single-fragment rapid cloning kit) from Novozyme Biotechnology Co., Ltd. The linearized vector obtained by PCR and the target gene fragment with homologous ends of the vector were recovered and mixed in a molar ratio of 3:1. At the same time, 4 μL of 5×CE II Buffer and 2 μL of Exnase II were added, and then ddH2O was added to make the total volume of the connection system reach 20 μL. The reaction was carried out at 37 °C for 30 min and then reduced to 4 °C for insulation. Then 10 μL of the connection system was taken to transform Escherichia coli competent cells. The correct transformants of colony PCR were selected and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3_ΔcrtYf_msccg.

[0062] ② Design the upstream primer (msccg-crF) and downstream primer (msccg-crR) with crRNA, amplify the plasmid pJYS3_ΔcrtYf_msccg by PCR to obtain the linear plasmid fragment pJYS3_ΔcrtYf_msccg_line, and connect and transform E. coli using the ClonExpress II One Step Cloning Kit rapid cloning kit linear expression vector of Novogene Biotech Co., Ltd. Select the correct transformant by colony PCR, and then send it to Suzhou Jinweizhi Biotech Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3_ΔcrtYf_msccgcrRNA.

[0063] ③ Extraction step ② pJYS3_ΔcrtYf_msccgcrRNA plasmid of positive transformant was electrotransformed into Corynebacterium glutamicum S9114Δ nagAB Δ ldhA Screening for successful knockout in competent cells mcssg The positive transformants of the gene were cultured at 37 °C overnight to eliminate the plasmid pJYS3_ΔcrtYf_msccgcrRNA, thereby obtaining S9114Δ nagAB Δ ldhA Δ msccg strains.

[0064] (Four) msccg2 Knockout ① Using pJYS3_ΔcrtYf as a template, design upstream primers (line-msccg2-F) and downstream primers (line-msccg2-R) to obtain the pJYS3_ΔcrtYf_line linear plasmid fragment by PCR amplification. Using the genome of Corynebacterium glutamicum S9114 as a template, design upstream primers (msccg2-FF) and downstream primers (msccg2-FR), obtain the upstream homology arm by PCR amplification, design upstream primers (msccg2-RF) and downstream primers (msccg2-RR), obtain the downstream homology arm by PCR amplification. The expression vector and gene fragment were connected using ClonExpress II One Step Cloning Kit (non-ligase-dependent single-fragment rapid cloning kit) of Novozyme Biotechnology Co., Ltd. The linearized vector obtained by PCR and the target gene fragment with homologous ends of the vector were recovered and mixed at a molar ratio of 3:1. At the same time, 4 μL of 5×CE II Buffer and 2 μL of Exnase II were added, and then ddH2O was added to make the total volume of the connection system reach 20 μL. The reaction was carried out at 37 °C for 30 min and then reduced to 4 °C for insulation. Then 10 μL of the connection system was taken to transform Escherichia coli competent cells. The correct transformants of colony PCR were selected and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3_ΔcrtYf_msccg2.

[0065] ② Design the upstream primer (msccg2-crF) with crRNA, and the downstream primer (msccg2-crR) to amplify the plasmid pJYS3_ΔcrtYf_msccg2 by PCR to obtain the linear plasmid fragment pJYS3_ΔcrtYf_msccg2_line, and use the ClonExpress II One Step Cloning Kit of Novogene Biotech Co., Ltd. to connect the linear expression vector and transform Escherichia coli. For detailed methods, see ①. Select the correct transformants of colony PCR, and then send them to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3_ΔcrtYf_msccg2crRNA.

[0066] ③ Extraction step ② pJYS3_ΔcrtYf_msccg2crRNA plasmid of positive transformant was electrotransformed into Corynebacterium glutamicum S9114Δ nagAB Δ ldhA Δ msccg Screening for successful knockout in competent cells msccg2 The positive transformants of the gene were cultured at 37 °C overnight to eliminate the plasmid pJYS3_ΔcrtYf_msccg2crRNA, thereby obtaining S9114Δ nagAB Δ ldhA Δ msccg Δ msccg2 strains.

[0067] (five) odhA Single base mutation ①Using the pk18-mob-sacB plasmid as a template, the upstream primer (pk18-F) and the downstream primer (pk18-R) were designed to obtain the pk18_line linear plasmid fragment by PCR amplification. Using the genome of Corynebacterium glutamicum S9114 as a template, the upstream primer (odhA-F) and the downstream primer (GTG-R) were designed to obtain the homology arm fragment after the key site mutation; the upstream primer (GTG-F) and the downstream primer (odhA-R) were designed to obtain the downstream homology arm by PCR amplification. The expression vector and the gene fragment were connected using the ClonExpress II One Step Cloning Kit (non-ligase-dependent single fragment rapid cloning kit) of Novozyme Biotechnology Co., Ltd. Then 10 μL of the connection system was taken to transform Escherichia coli competent cells. The correct transformant of the colony PCR was selected and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pk18_odhA-GTG.

[0068] ② Extraction step ① pk18_odhA-GTG plasmid of positive transformant was electrotransformed into Corynebacterium glutamicum S9114Δ nagAB ΔldhA Δ msccg Δ msccg2 In competent cells, screening odhA The positive transformants with successful mutation of the gene locus were cultured at 37 °C overnight to eliminate the plasmid pk18_odhA-GTG, thereby obtaining S9114Δ nagAB Δ ldhA Δ msccg Δ msccg2 _ odhA-GTG strains.

[0069] (six) glnA Single base mutation ① Using the pk18-mob-sacB plasmid as a template, the upstream primer (pk18-F) and the downstream primer (pk18-R) were designed to obtain the pk18_line linear plasmid fragment through PCR amplification. Using the genome of Corynebacterium glutamicum S9114 as a template, the upstream primer (glnA-F) and the downstream primer (TTC-R) were designed to obtain the upstream homology arm through PCR amplification; the upstream primer (TTC-F) and the downstream primer (glnA-R) were designed to obtain the downstream homology arm through PCR amplification. The expression vector and gene fragment were connected using ClonExpress II One Step Cloning Kit (non-ligase-dependent single-fragment rapid cloning kit) from Novozyme Biotechnology Co., Ltd. The linearized vector obtained by PCR and the target gene fragment with homologous ends of the vector were recovered by gel and mixed at a molar ratio of 3:1. At the same time, 4 μL of 5×CE II Buffer and 2 μL of Exnase II were added, and then ddH2O was added to make the total volume of the connection system reach 20 μL. The reaction was carried out at 37°C for 30 min and then reduced to 4°C for insulation. Then 10 μL of the connection system was transformed E. coli JM109 competent cells (for details on the competent cell preparation method, please refer to the instructions of the Takara E. coli competent cell kit). Select the correct transformants by colony PCR and send them to Suzhou Genewise Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pk18_glnA-TTC.

[0070] ② Extraction step ① pk18_glnA-TTC plasmid of positive transformant was electrotransformed into Corynebacterium glutamicum S9114Δ nagAB Δ ldhA Δ msccg Δ msccg2 _ odhA-GTG In competent cells, screening glnA The positive transformants that successfully mutated to TTC were cultured at 37 °C overnight to eliminate the plasmid pk18_glnA-TTC, thereby obtaining S9114Δ nagAB Δ ldhA Δmsccg Δ msccg2 _ odhA- GTG_ glnA strain Y405F.

[0071] (VII) Plasmid pJYW-4- glmS - GNA1 - yqab Construction and electroporation of the chassis strain ① Using the pJYW-4 plasmid (Construction of a novel expression system for use in Corynebacterium glutamicum) as a template, the upstream primer (tacM-F) and the downstream primer (tacM-R) were designed to obtain a linear plasmid fragment with the promoter replaced with tacM through PCR amplification. The expression vector and gene fragment were connected using the ClonExpress II One Step Cloning Kit rapid cloning kit of Novozymes Biotech Co., Ltd., and Escherichia coli was transformed. Sequencing was used to verify whether the promoter was successfully replaced. Then, the upstream primer (pJYW4-F) and the downstream primer (pJYW4-R) were designed to obtain the pJYW-4-line linear plasmid fragment through PCR amplification. Using the genome of Corynebacterium glutamicum S9114 as a template, the upstream primer (glmS-F) and the downstream primer (glmS-R) were designed to obtain the gene through PCR amplification. glmS Using the Saccharomyces cerevisiae S288C genome as a template, we designed upstream primers (GNA1-F) and downstream primers (GNA1-R) and obtained the gene by PCR amplification. GNA1 Using the E. coli K12 MG1655 genome as a template, upstream primers (yqab-F) and downstream primers (yqab-R) were designed, and the gene was obtained by PCR amplification. yqab The expression vector and gene fragment were connected using ClonExpress II One Step Cloning Kit (non-ligase-dependent single-fragment rapid cloning kit) from Novozymes Biotech Co., Ltd. The linearized vector obtained by PCR and the target gene fragment with homologous ends of the vector were recovered by gel and mixed in a molar ratio of 3:1. At the same time, 4 μL of 5×CE II Buffer and 2 μL of Exnase II were added, and then ddH2O was added to make the total volume of the connection system reach 20 μL. The reaction was carried out at 37 °C for 30 min and then reduced to 4 °C for insulation. Then 10 μL of the connection system was transformed E. coliJM109 competent cells (for details on the preparation of competent cells, please refer to the instructions of the Takara E. coli competent kit). Select the correct transformants by colony PCR and send them to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYW-4- glmS - GNA1 - yqab .

[0072] ②The recombinant plasmid pJYW-4- glmS - GNA1 - yqab Electrotransformation into chassis cells of Corynebacterium glutamicum S9114Δ nagAB Δ ldhA Δ msccg Δ msccg2 _ odhA- GTG_ glnA Y405F, and the final recombinant strain was obtained.

[0073] The primers involved are listed in Table 1.

[0074] Table 1 Primer sequences

[0075]

[0076] Example 2 Fermentation production of recombinant strains (1) Shake flask fermentation Seed culture of Corynebacterium glutamicum: Pick a single colony from a loop of BHIS solid medium and inoculate it into the seed culture medium, and culture it at 30°C in a constant temperature reciprocating shaker at 220 rpm for 16 to 18 h until the cells reach the early logarithmic stage. Fermentation culture of Corynebacterium glutamicum: Inoculate the seed culture solution into the fermentation medium at an initial OD600 of 1.6, and culture it at 30°C in a constant temperature reciprocating shaker at 220 rpm for 72 h.

[0077] The shake flask fermentation results are shown in Figure 1 After the fermentation, the yield of N-acetylglucosamine in the recombinant strain constructed in Example 1 reached 41.7 g / L. msccg2 The recombinant strain also performed well in fermentation production, with a yield of about 40 g / L. msccg , knockout msccg2 ,replace odhA Start codon, glnA Single base mutation and other single modifications do not significantly increase the yield of the target product. Only when the modifications are performed simultaneously can the yield be significantly improved, which may be due to the synergy of different modification methods.

[0078] (2) Fermentation in a fermentation tank The composition of the seed medium used in the fed-batch fermentation was the same as that used in the shake flask fermentation. The seed culture was cultured in a 1000 mL shake flask containing 100 mL of seed medium at 30 °C and 220 rpm for 16-18 h. The seed fermentation liquid was inoculated into a 50 L fermenter (Shanghai Bailun Biotechnology Co., Ltd.) to ensure that the initial OD600 of the fermentation medium was 1.6 and cultured for 72 h. The initial fermentation medium volume was 14.5 L. The pH value was maintained at 7.0 by adding 29% ammonia water, and the temperature was controlled at 30 °C. The air volume and initial rotation speed were 0.8 Nm 3 / h, 25 Hz. After 20 hours of fermentation, 850 g / L glucose was added to keep the glucose concentration in the range of 10-15 g / L, and the sugar addition rate was adjusted according to the change of glucose concentration in the fermentation medium.

[0079] In the fermentation tank, the recombinant strain produced 143.6 g / L of N-acetylglucosamine after 72 hours of fermentation, with a production intensity of 1.99 g / L·h( Figure 2 ).

[0080] Comparative Example

[0081] We investigated the effect of the glutamicum S9114 nagA , nagB , ldhA , zwf , pfkA , fba , odhA One or more genes are knocked out, and the recombinant plasmid pJYW-4- glmS - GNA1 - yqab The target product was produced by introducing different gene knockout genetically engineered bacteria under the same shake flask fermentation conditions as in Example 1. Figure 1 It can be seen that only by knocking out nagA , nagB and ldhA The strains performed best in production, although related studies also mentioned zwf , pfkA , fba , odhA etc. was beneficial to the accumulation of N-acetylglucosamine in Corynebacterium glutamicum, but we found that this was not the case, which may be due to the complexity of the gene network.

[0082] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A Corynebacterium glutamicum for producing N-acetylglucosamine, characterized in that: The Corynebacterium glutamicum comprises the following transformations: overexpressing a gene encoding glucosamine-6-phosphate synthase, a gene encoding glucosamine 6-phosphate N-acetyltransferase and a gene encoding 6-phosphate acetylaminoglucose-specific phosphatase, knocking out a gene encoding acetylglucosamine deacetylase, a gene encoding acetylglucosamine deaminase, a gene encoding lactate dehydrogenase and a gene encoding a mechanical sensitive channel protein, replacing the start codon ATG of an alpha-ketoglutarate dehydrogenase encoding gene on the genome with GTG, and replacing a codon encoding the 405th tyrosine of glutamine synthetase on the genome with a codon encoding phenylalanine.

2. The Corynebacterium glutamicum according to claim 1, characterized in that The Corynebacterium glutamicum also includes the following transformations: knocking out the gene encoding the glutamate transport protein; The nucleotide sequence of the glutamate transporter encoding gene is shown in SEQ ID NO.

9.

3. The Corynebacterium glutamicum according to claim 1, characterized in that The nucleotide sequence of the gene encoding glucosamine-6-phosphate synthase is shown in SEQ ID NO.1; the nucleotide sequence of the gene encoding glucosamine 6-phosphate N-acetyltransferase is shown in SEQ ID NO.2; the nucleotide sequence of the gene encoding 6-phosphate acetylaminoglycan-specific phosphatase is shown in SEQ ID NO.3; The nucleotide sequence of the gene encoding acetylglucosamine deacetylase is shown in SEQ ID NO.5; the nucleotide sequence of the gene encoding acetylglucosamine deaminase is shown in SEQ ID NO.6; the nucleotide sequence of the gene encoding lactate dehydrogenase is shown in SEQ ID NO.7; the nucleotide sequence of the gene encoding mechanosensitive channel protein is shown in SEQ ID NO.8; The nucleotide sequence of the gene encoding α-ketoglutarate dehydrogenase is shown in SEQ ID NO.10; the nucleotide sequence of the gene encoding glutamine synthetase is shown in SEQ ID NO.

11.

4. The Corynebacterium glutamicum according to claim 3, characterized in that The codon TAC encoding the 405th amino acid in the glutamine synthetase encoding gene on the genome was replaced by TTC.

5. The Corynebacterium glutamicum according to claim 1, characterized in that Using a strong promoter to overexpress the glucosamine-6-phosphate synthase encoding gene, the glucosamine 6-phosphate N-acetyltransferase encoding gene or the 6-phosphate acetylose-specific phosphatase encoding gene; The strong promoter includes tacM promoter; The nucleotide sequence of the tacM promoter is shown in SEQ ID NO.

5.

6. Use of the Corynebacterium glutamicum according to any one of claims 1 to 5 in the preparation of N-acetylglucosamine.

7. A method for producing N-acetylglucosamine, characterized in that: The method comprises the following steps: using the Corynebacterium glutamicum described in any one of claims 1 to 5 for fermentation production.

8. The method according to claim 7, characterized in that The fermentation production process contains at least one of the following characteristics: (1) Fermentation production using glucose as substrate; (2) The fermentation includes shake flask fermentation or fed-batch fermentation; (3) The seed culture medium contains: glucose 20-30 g / L, corn steep liquor 15-25 g / L, potassium dihydrogen phosphate 0.5-1.5 g / L, ammonium sulfate 0.1-1 g / L, urea 1-1.5 g / L; (4) The fermentation medium contains: glucose 90-110 g / L, corn steep liquor 10-20 g / L, potassium dihydrogen phosphate 0.5-1.5 g / L, ammonium sulfate 10-30 g / L, magnesium sulfate 0.1-1 g / L, calcium carbonate 10-30 g / L, and iron sulfate 0.1-0.5 g / L; (5) The fermentation medium contains: glucose 40-60 g / L, corn syrup 5-15 g / L, potassium dihydrogen phosphate 0.5-1.5 g / L, ammonium sulfate 10-30 g / L, magnesium sulfate 0.1-1 g / L, and iron sulfate 0.1-0.5 g / L.

9. The method according to claim 7 or 8, characterized in that: The fermentation comprises: preparing seed liquid, inoculating the seed liquid into a fermentation medium for culturing; The culturing comprises culturing at 28-35° C. and 220-280 rpm; Or the culture comprises culturing at 28-35°C and a ventilation rate of 0.3-2 Nm 3 / h conditions, and the glucose concentration was controlled at 10-15 g / L and the pH was controlled at 6.8-7.2 during the fermentation process.

10. A method for promoting the synthesis of N-acetylglucosamine by Corynebacterium glutamicum, characterized in that: The method comprises the following steps: In the Corynebacterium glutamicum host bacteria, genes encoding glucosamine-6-phosphate synthase, glucosamine-6-phosphate N-acetyltransferase and 6-phosphate acetylaminoglucose-specific phosphatase were overexpressed, genes encoding acetylglucosamine deacetylase, acetylglucosamine deaminase, lactate dehydrogenase and mechanosensitive channel protein were knocked out, the start codon ATG of the α-ketoglutarate dehydrogenase gene on the genome was replaced with GTG, and the codon encoding tyrosine at position 405 of glutamine synthetase on the genome was replaced with a codon encoding phenylalanine; Optionally, a gene encoding a glutamate transporter is knocked out or not.

Images